MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download glnX_nt.seq
    Gene name glnX
    Length 75bp
    Fasta Format

>glnX
tggggtatcgccaagcggtaaggcaccggattctgattccggcattccgaggttcgaatc
ctcgtaccccagcca
						
    Fasta Format

View sequence in neighbor 100bp

>glnX
aagcggtaaggcaccggattctgattccggcattccgaggttcgaatcctcgtaccccag
ccaatttattcaagacgcttaccttgtaagtgcacccagttggggtatcgccaagcggta
aggcaccggattctgattccggcattccgaggttcgaatcctcgtaccccagccacatta
aaaaagctcgcttcggcgagctttttgcttttctgcgttcattcaatgtcgaatgcgatg
ttgacacgtcttatccttcaatgtcggatgcgacg