MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download proK_nt.seq
    Gene name proK
    Length 77bp
    Fasta Format

>proK
cggtgattggcgcagcctggtagcgcacttcgttcgggacgaaggggtcggaggttcgaa
tcctctatcaccgacca
						
    Fasta Format

View sequence in neighbor 100bp

>proK
gctaactaagcggcctgctgactttctcgccgatcaaaaggcattttgctattaagggat
tgacgagggcgtatctgcgcagtaagatgcgccccgcattcggtgattggcgcagcctgg
tagcgcacttcgttcgggacgaaggggtcggaggttcgaatcctctatcaccgaccaaat
tcgaaaagcctgctcaacgagcaggcttttttgcatctgcagctcatgaggatgagaacc
tccgggggcagggaggttcgactcgagcgaagcgaga