MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download leuW_nt.seq
    Gene name leuW
    Length 85bp
    Fasta Format

>leuW
gcgggagtggcgaaattggtagacgcaccagatttaggttctggcgccgcaaggtgtgcg
agttcaagtctcgcctcccgcacca
						
    Fasta Format

View sequence in neighbor 100bp

>leuW
gcgaaaaaaaagatggctacgtagctcagttggttagagcacatcactcataatgatggg
gtcacaggttcgaatcccgtcgtagccaccatctttttttgcgggagtggcgaaattggt
agacgcaccagatttaggttctggcgccgcaaggtgtgcgagttcaagtctcgcctcccg
caccattcaccagaaagcgttgtacggatggggtatcgccaagcggtaaggcaccggttt
ttgataccggcattccctggttcgaatccaggtaccccagccatc