MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download ftsQ_nt.seq
    Gene name ftsQ
    Length 831bp
    Fasta Format

>ftsQ
atgtcgcaggctgctctgaacacgcgaaacagcgaagaagaggtttcttctcgccgcaat
aatggaacgcgtctggcggggatccttttcctgctgaccgttttaacgacagtgttggtg
agcggctgggtcgtgttgggctggatggaagatgcgcaacgcctgccgctctcaaagctg
gtgttgaccggtgaacgccattacacacgtaatgacgatatccggcagtcgatcctggca
ttgggtgagccgggtacctttatgacccaggatgtcaacatcatccagacgcaaatagaa
caacgcctgccgtggattaagcaggtgagcgtcagaaagcagtggcctgatgaattgaag
attcatctggttgaatatgtgccgattgcgcggtggaatgatcaacatatggtagacgcg
gaaggaaataccttcagcgtgccgccagaacgcaccagcaagcaggtgcttccaatgctg
tatggcccggaaggcagcgccaatgaagtgttgcagggctatcgcgaaatggggcagatg
ctggcaaaggacagatttactctgaaggaagcggcgatgaccgcgcggcgttcctggcag
ttgacgctgaataacgatattaagctcaatcttggccggggcgatacgatgaaacgtttg
gctcgctttgtagaactttatccggttttacagcagcaggcgcaaaccgatggcaaacgg
attagctacgttgatttgcgttatgactctggagcggcagtaggctgggcgcccttgccg
ccagaggaatctactcagcaacaaaatcaggcacaggcagaacaacaatga
						
    Fasta Format

View sequence in neighbor 100bp

>ftsQ
ccgggtatgaccagccacagcctggtgccgatggcggcacgtcaggcaggtatgagcttc
tcgcagttggtagtacgaattctggaactggcggactaatatgtcgcaggctgctctgaa
cacgcgaaacagcgaagaagaggtttcttctcgccgcaataatggaacgcgtctggcggg
gatccttttcctgctgaccgttttaacgacagtgttggtgagcggctgggtcgtgttggg
ctggatggaagatgcgcaacgcctgccgctctcaaagctggtgttgaccggtgaacgcca
ttacacacgtaatgacgatatccggcagtcgatcctggcattgggtgagccgggtacctt
tatgacccaggatgtcaacatcatccagacgcaaatagaacaacgcctgccgtggattaa
gcaggtgagcgtcagaaagcagtggcctgatgaattgaagattcatctggttgaatatgt
gccgattgcgcggtggaatgatcaacatatggtagacgcggaaggaaataccttcagcgt
gccgccagaacgcaccagcaagcaggtgcttccaatgctgtatggcccggaaggcagcgc
caatgaagtgttgcagggctatcgcgaaatggggcagatgctggcaaaggacagatttac
tctgaaggaagcggcgatgaccgcgcggcgttcctggcagttgacgctgaataacgatat
taagctcaatcttggccggggcgatacgatgaaacgtttggctcgctttgtagaacttta
tccggttttacagcagcaggcgcaaaccgatggcaaacggattagctacgttgatttgcg
ttatgactctggagcggcagtaggctgggcgcccttgccgccagaggaatctactcagca
acaaaatcaggcacaggcagaacaacaatgatcaaggcgacggacagaaaactggtagta
ggactggagattggtaccgcgaaggttgccgctttagtaggggaagttctgcccgacggt
atggtcaatat