MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download ddlB_nt.seq
    Gene name ddlB
    Length 921bp
    Fasta Format

>ddlB
atgactgataaaatcgcggtcctgttgggtgggacctccgctgagcgggaagtttctctg
aattctggcgcagcggtgttagccggactgcgtgaaggcggtattgacgcgtatcctgtc
gacccgaaagaagtcgacgtgacgcaactgaagtcgatgggctttcagaaagtgtttatc
gcgctacacggtcgcggcggtgaagatggtacgctgcaggggatgctcgagctgatgggc
ttgccttataccggaagcggagtgatggcatctgcgctttcaatggataaactacgcagc
aaacttctatggcaaggtgccggtttaccggtcgcgccgtgggtagcgttaacccgcgca
gagtttgaaaaaggcctgagcgataagcagttagcagaaatttctgctctgggtttgccg
gttatcgttaagccgagccgcgaaggttccagtgtgggaatgtcaaaagtagtagcagaa
aatgctctacaagatgcattaagattggcatttcagcacgatgaagaagtattgattgaa
aaatggctaagtgggccggagttcacggttgcgatactcggtgaagaaattttaccgtca
atacgtattcaaccgtccggaaccttctatgattatgaggcgaagtatctctctgatgag
acacagtatttctgccccgcaggtctggaagcgtcacaagaggccaatttgcaggcatta
gtgctgaaagcatggacgacgttaggttgcaaaggatggggacgtattgacgttatgctg
gacagcgatggacagttttatctgctggaagccaatacctcaccgggtatgaccagccac
agcctggtgccgatggcggcacgtcaggcaggtatgagcttctcgcagttggtagtacga
attctggaactggcggactaa
						
    Fasta Format

View sequence in neighbor 100bp

>ddlB
aacgacctgattctcgttcagggggctggtaatattggaaaaattgcccgttctttagct
gaaatcaaactgaagccgcaaactccggaggaagaacaacatgactgataaaatcgcggt
cctgttgggtgggacctccgctgagcgggaagtttctctgaattctggcgcagcggtgtt
agccggactgcgtgaaggcggtattgacgcgtatcctgtcgacccgaaagaagtcgacgt
gacgcaactgaagtcgatgggctttcagaaagtgtttatcgcgctacacggtcgcggcgg
tgaagatggtacgctgcaggggatgctcgagctgatgggcttgccttataccggaagcgg
agtgatggcatctgcgctttcaatggataaactacgcagcaaacttctatggcaaggtgc
cggtttaccggtcgcgccgtgggtagcgttaacccgcgcagagtttgaaaaaggcctgag
cgataagcagttagcagaaatttctgctctgggtttgccggttatcgttaagccgagccg
cgaaggttccagtgtgggaatgtcaaaagtagtagcagaaaatgctctacaagatgcatt
aagattggcatttcagcacgatgaagaagtattgattgaaaaatggctaagtgggccgga
gttcacggttgcgatactcggtgaagaaattttaccgtcaatacgtattcaaccgtccgg
aaccttctatgattatgaggcgaagtatctctctgatgagacacagtatttctgccccgc
aggtctggaagcgtcacaagaggccaatttgcaggcattagtgctgaaagcatggacgac
gttaggttgcaaaggatggggacgtattgacgttatgctggacagcgatggacagtttta
tctgctggaagccaatacctcaccgggtatgaccagccacagcctggtgccgatggcggc
acgtcaggcaggtatgagcttctcgcagttggtagtacgaattctggaactggcggacta
atatgtcgcaggctgctctgaacacgcgaaacagcgaagaagaggtttcttctcgccgca
ataatggaacgcgtctggcggggatccttttcctgctgacc