MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download leuO_nt.seq
    Gene name leuO
    Length 945bp
    Fasta Format

>leuO
atgccagaggtacaaacagatcatccagagacggcggagttaagcaaaccacagctacgc
atggtcgatctcaacttattaaccgttttcgatgccgtgatgcaggagcaaaacattact
cgtgccgctcatgttctgggaatgtcgcaacctgcggtcagtaacgctgttgcacgcctg
aaggtgatgtttaatgacgagctttttgttcgttatggccgtggtattcaaccgactgct
cgcgcatttcaactttttggttcagttcgtcaggcattgcaactagtacaaaatgaattg
cctggttcaggttttgaacccgcgagcagtgaacgtgtatttcatctttgtgtttgcagc
ccgttagacagcattctgacctcgcagatttataatcacattgagcagattgcgccaaat
atacatgttatgttcaagtcttcattaaatcagaacactgaacatcagctgcgttatcag
gaaacggagtttgtgattagttatgaagacttccatcgtcctgaatttaccagcgtacca
ttatttaaagatgaaatggtgctggtagccagcaaaaatcatccaacaattaagggcccg
ttactgaaacatgatgtttataacgaacaacatgcggcggtttcgctcgatcgtttcgcg
tcatttagtcaaccttggtatgacacggtagataagcaagccagtatcgcgtatcagggc
atggcaatgatgagcgtacttagcgtggtgtcgcaaacgcatttggtcgctattgcgccg
cgttggctggctgaagagttcgctgaatccttagaattacaggtattaccgctgccgtta
aaacaaaacagcagaacctgttatctctcctggcatgaagctgccgggcgcgataaaggc
catcagtggatggaagagcaattagtctcaatttgcaaacgctaa
						
    Fasta Format

View sequence in neighbor 100bp

>leuO
ctttttcttattttatatgcatgataaatcatattcttcaggattatttctctgcattcc
aataagggaaagggagttaagtgtgacagtggagttaagtatgccagaggtacaaacaga
tcatccagagacggcggagttaagcaaaccacagctacgcatggtcgatctcaacttatt
aaccgttttcgatgccgtgatgcaggagcaaaacattactcgtgccgctcatgttctggg
aatgtcgcaacctgcggtcagtaacgctgttgcacgcctgaaggtgatgtttaatgacga
gctttttgttcgttatggccgtggtattcaaccgactgctcgcgcatttcaactttttgg
ttcagttcgtcaggcattgcaactagtacaaaatgaattgcctggttcaggttttgaacc
cgcgagcagtgaacgtgtatttcatctttgtgtttgcagcccgttagacagcattctgac
ctcgcagatttataatcacattgagcagattgcgccaaatatacatgttatgttcaagtc
ttcattaaatcagaacactgaacatcagctgcgttatcaggaaacggagtttgtgattag
ttatgaagacttccatcgtcctgaatttaccagcgtaccattatttaaagatgaaatggt
gctggtagccagcaaaaatcatccaacaattaagggcccgttactgaaacatgatgttta
taacgaacaacatgcggcggtttcgctcgatcgtttcgcgtcatttagtcaaccttggta
tgacacggtagataagcaagccagtatcgcgtatcagggcatggcaatgatgagcgtact
tagcgtggtgtcgcaaacgcatttggtcgctattgcgccgcgttggctggctgaagagtt
cgctgaatccttagaattacaggtattaccgctgccgttaaaacaaaacagcagaacctg
ttatctctcctggcatgaagctgccgggcgcgataaaggccatcagtggatggaagagca
attagtctcaatttgcaaacgctaactgattgcagaataggtcagacatgaatgtctggt
ttattctgcattttttattgaatgtagaattttattctgaatgtgtgggctctctatttt
aggat