MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download lacA_nt.seq
    Gene name lacA
    Length 612bp
    Fasta Format

>lacA
ttgaacatgccaatgaccgaaagaataagagcaggcaagctatttaccgatatgtgcgaa
ggcttaccggaaaaaagacttcgtgggaaaacgttaatgtatgagtttaatcactcgcat
ccatcagaagttgaaaaaagagaaagcctgattaaagaaatgtttgccacggtaggggaa
aacgcctgggtagaaccgcctgtctatttctcttacggttccaacatccatataggccgc
aatttttatgcaaatttcaatttaaccattgtcgatgactacacggtaacaatcggtgat
aacgtactgattgcacccaacgttactctttccgttacgggacaccctgtacaccatgaa
ttgagaaaaaacggcgagatgtactcttttccgataacgattggcaataacgtctggatc
ggaagtcatgtggttattaatccaggcgtcaccatcggggataattctgttattggcgcg
ggtagtatcgtcacaaaagacattccaccaaacgtcgtggcggctggcgttccttgtcgg
gttattcgcgaaataaacgaccgggataagcactattatttcaaagattataaagttgaa
tcgtcagtttaa
						
    Fasta Format

View sequence in neighbor 100bp

>lacA
ccctgctgcgtcgtcaggtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcga
gcgccttatccgaccaacatatcataacggagtgatcgcattgaacatgccaatgaccga
aagaataagagcaggcaagctatttaccgatatgtgcgaaggcttaccggaaaaaagact
tcgtgggaaaacgttaatgtatgagtttaatcactcgcatccatcagaagttgaaaaaag
agaaagcctgattaaagaaatgtttgccacggtaggggaaaacgcctgggtagaaccgcc
tgtctatttctcttacggttccaacatccatataggccgcaatttttatgcaaatttcaa
tttaaccattgtcgatgactacacggtaacaatcggtgataacgtactgattgcacccaa
cgttactctttccgttacgggacaccctgtacaccatgaattgagaaaaaacggcgagat
gtactcttttccgataacgattggcaataacgtctggatcggaagtcatgtggttattaa
tccaggcgtcaccatcggggataattctgttattggcgcgggtagtatcgtcacaaaaga
cattccaccaaacgtcgtggcggctggcgttccttgtcgggttattcgcgaaataaacga
ccgggataagcactattatttcaaagattataaagttgaatcgtcagtttaaattataaa
aattgcctgatacgctgcgcttatcaggcctacaagttcagcgatctacattagccgcat
ccggcatgaacaaagcgcaggaacaagcgtcg