MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download carB_nt.seq
    Gene name carB
    Length 3222bp
    Fasta Format

>carB
atgccaaaacgtacagatataaaaagtatcctgattctgggtgcgggcccgattgttatc
ggtcaggcgtgtgagtttgactactctggcgcgcaagcgtgtaaagccctgcgtgaagag
ggttaccgcgtcattctggtgaactccaacccggcgaccatcatgaccgacccggaaatg
gctgatgcaacctacatcgagccgattcactgggaagttgtacgcaagattattgaaaaa
gagcgcccggacgcggtgctgccaacgatgggcggtcagacggcgctgaactgcgcgctg
gagctggaacgtcagggcgtgttggaagagttcggtgtcaccatgattggtgccactgcc
gatgcgattgataaagcagaagaccgccgtcgtttcgacgtagcgatgaagaaaattggt
ctggaaaccgcgcgttccggtatcgcacacacgatggaagaagcgctggcggttgccgct
gacgtgggcttcccgtgcattattcgcccatcctttaccatgggcggtagcggcggcggt
atcgcttataaccgtgaagagtttgaagaaatttgcgcccgcggtctggatctctctccg
accaaagagttgctgattgatgagtcgctgatcggctggaaagagtacgagatggaagtg
gtgcgtgataaaaacgacaactgcatcatcgtctgctctatcgaaaacttcgatgcgatg
ggcatccacaccggtgactccatcactgtcgcgccagcccaaacgctgaccgacaaagaa
tatcaaatcatgcgtaacgcctcgatggcggtgctgcgtgaaatcggcgttgaaaccggt
ggttccaacgttcagtttgcggtgaacccgaaaaacggtcgtctgattgttatcgaaatg
aacccacgcgtgtcccgttcttcggcgctggcgtcgaaagcgaccggtttcccgattgct
aaagtggcggcgaaactggcggtgggttacaccctcgacgaactgatgaacgacatcact
ggcggacgtactccggcctccttcgagccgtccatcgactatgtggttactaaaattcct
cgcttcaacttcgaaaaattcgccggtgctaacgaccgtctgaccactcagatgaaatcg
gttggcgaagtgatggcgattggtcgcacgcagcaggaatccctgcaaaaagcgctgcgc
ggcctggaagtcggtgcgactggattcgacccgaaagtgagcctggatgacccggaagcg
ttaaccaaaatccgtcgcgaactgaaagacgcaggcgcagatcgtatctggtacatcgcc
gatgcgttccgtgcgggcctgtctgtggacggcgtcttcaacctgaccaacattgaccgc
tggttcctggtacagattgaagagctggtgcgtctggaagagaaagtggcggaagtgggc
atcactggcctgaacgctgacttcctgcgccagctgaaacgcaaaggctttgccgatgcg
cgcttggcaaaactggcgggcgtacgcgaagcggaaatccgtaagctgcgtgaccagtat
gacctgcacccggtttataagcgcgtggatacctgtgcggcagagttcgccaccgacacc
gcttacatgtactccacttatgaagaagagtgcgaagcgaatccgtctaccgaccgtgaa
aaaatcatggtgcttggcggcggcccgaaccgtatcggtcagggtatcgaattcgactac
tgttgcgtacacgcctcgctggcgctgcgcgaagacggttacgaaaccattatggttaac
tgtaacccggaaaccgtctccaccgactacgacacttccgaccgcctctacttcgagccg
gtaactctggaagatgtgctggaaatcgtgcgtatcgagaagccgaaaggcgttatcgtc
cagtacggcggtcagaccccgctgaaactggcgcgcgcgctggaagctgctggcgtaccg
gttatcggcaccagcccggatgctatcgaccgtgcagaagaccgtgaacgcttccagcat
gcggttgagcgtctgaaactgaaacaaccggcgaacgccaccgttaccgctattgaaatg
gcggtagagaaggcgaaagagattggctacccgctggtggtacgtccgtcttacgttctc
ggcggtcgggcgatggaaatcgtctatgacgaagctgacctgcgtcgctacttccagacg
gcggtcagcgtgtctaacgatgcgccagtgttgctggaccacttcctcgatgacgcggta
gaagttgacgtggatgccatctgcgacggcgaaatggtgctgattggcggcatcatggag
catattgagcaggcgggcgtgcactccggtgactccgcatgttctctgccagcctacacc
ttaagtcaggaaattcaggatgtgatgcgccagcaggtgcagaaactggccttcgaattg
caggtgcgcggcctgatgaacgtgcagtttgcggtgaaaaacaacgaagtctacctgatt
gaagttaacccgcgtgcggcgcgtaccgttccgttcgtctccaaagccaccggcgtaccg
ctggcaaaagtggcggcgcgcgtgatggctggcaaatcgctggctgagcagggcgtaacc
aaagaagttatcccgccgtactactcggtgaaagaagtggtgctgccgttcaataaattc
ccgggcgttgacccgctgttagggccagaaatgcgctctaccggggaagtcatgggcgtg
ggccgcaccttcgctgaagcgtttgccaaagcgcagctgggcagcaactccaccatgaag
aaacacggtcgtgcgctgctttccgtgcgcgaaggcgataaagaacgcgtggtggacctg
gcggcaaaactgctgaaacagggcttcgagctggatgcgacccacggcacggcgattgtg
ctgggcgaagcaggtatcaacccgcgtctggtaaacaaggtgcatgaaggccgtccgcac
attcaggaccgtatcaagaatggcgaatatacctacatcatcaacaccacctcaggccgt
cgtgcgattgaagactcccgcgtgattcgtcgcagtgcgctgcaatataaagtgcattac
gacaccaccctgaacggcggctttgccaccgcgatggcgctgaatgccgatgcgactgaa
aaagtaatttcggtgcaggaaatgcacgcacagatcaaataa
						
    Fasta Format

View sequence in neighbor 100bp

>carB
ccagccctggtccacacgacgccgcgccgttgttcgaccactttatcgagttaattgagc
agtaccgtaaaaccgctaagtaatcaggagtaaaagagccatgccaaaacgtacagatat
aaaaagtatcctgattctgggtgcgggcccgattgttatcggtcaggcgtgtgagtttga
ctactctggcgcgcaagcgtgtaaagccctgcgtgaagagggttaccgcgtcattctggt
gaactccaacccggcgaccatcatgaccgacccggaaatggctgatgcaacctacatcga
gccgattcactgggaagttgtacgcaagattattgaaaaagagcgcccggacgcggtgct
gccaacgatgggcggtcagacggcgctgaactgcgcgctggagctggaacgtcagggcgt
gttggaagagttcggtgtcaccatgattggtgccactgccgatgcgattgataaagcaga
agaccgccgtcgtttcgacgtagcgatgaagaaaattggtctggaaaccgcgcgttccgg
tatcgcacacacgatggaagaagcgctggcggttgccgctgacgtgggcttcccgtgcat
tattcgcccatcctttaccatgggcggtagcggcggcggtatcgcttataaccgtgaaga
gtttgaagaaatttgcgcccgcggtctggatctctctccgaccaaagagttgctgattga
tgagtcgctgatcggctggaaagagtacgagatggaagtggtgcgtgataaaaacgacaa
ctgcatcatcgtctgctctatcgaaaacttcgatgcgatgggcatccacaccggtgactc
catcactgtcgcgccagcccaaacgctgaccgacaaagaatatcaaatcatgcgtaacgc
ctcgatggcggtgctgcgtgaaatcggcgttgaaaccggtggttccaacgttcagtttgc
ggtgaacccgaaaaacggtcgtctgattgttatcgaaatgaacccacgcgtgtcccgttc
ttcggcgctggcgtcgaaagcgaccggtttcccgattgctaaagtggcggcgaaactggc
ggtgggttacaccctcgacgaactgatgaacgacatcactggcggacgtactccggcctc
cttcgagccgtccatcgactatgtggttactaaaattcctcgcttcaacttcgaaaaatt
cgccggtgctaacgaccgtctgaccactcagatgaaatcggttggcgaagtgatggcgat
tggtcgcacgcagcaggaatccctgcaaaaagcgctgcgcggcctggaagtcggtgcgac
tggattcgacccgaaagtgagcctggatgacccggaagcgttaaccaaaatccgtcgcga
actgaaagacgcaggcgcagatcgtatctggtacatcgccgatgcgttccgtgcgggcct
gtctgtggacggcgtcttcaacctgaccaacattgaccgctggttcctggtacagattga
agagctggtgcgtctggaagagaaagtggcggaagtgggcatcactggcctgaacgctga
cttcctgcgccagctgaaacgcaaaggctttgccgatgcgcgcttggcaaaactggcggg
cgtacgcgaagcggaaatccgtaagctgcgtgaccagtatgacctgcacccggtttataa
gcgcgtggatacctgtgcggcagagttcgccaccgacaccgcttacatgtactccactta
tgaagaagagtgcgaagcgaatccgtctaccgaccgtgaaaaaatcatggtgcttggcgg
cggcccgaaccgtatcggtcagggtatcgaattcgactactgttgcgtacacgcctcgct
ggcgctgcgcgaagacggttacgaaaccattatggttaactgtaacccggaaaccgtctc
caccgactacgacacttccgaccgcctctacttcgagccggtaactctggaagatgtgct
ggaaatcgtgcgtatcgagaagccgaaaggcgttatcgtccagtacggcggtcagacccc
gctgaaactggcgcgcgcgctggaagctgctggcgtaccggttatcggcaccagcccgga
tgctatcgaccgtgcagaagaccgtgaacgcttccagcatgcggttgagcgtctgaaact
gaaacaaccggcgaacgccaccgttaccgctattgaaatggcggtagagaaggcgaaaga
gattggctacccgctggtggtacgtccgtcttacgttctcggcggtcgggcgatggaaat
cgtctatgacgaagctgacctgcgtcgctacttccagacggcggtcagcgtgtctaacga
tgcgccagtgttgctggaccacttcctcgatgacgcggtagaagttgacgtggatgccat
ctgcgacggcgaaatggtgctgattggcggcatcatggagcatattgagcaggcgggcgt
gcactccggtgactccgcatgttctctgccagcctacaccttaagtcaggaaattcagga
tgtgatgcgccagcaggtgcagaaactggccttcgaattgcaggtgcgcggcctgatgaa
cgtgcagtttgcggtgaaaaacaacgaagtctacctgattgaagttaacccgcgtgcggc
gcgtaccgttccgttcgtctccaaagccaccggcgtaccgctggcaaaagtggcggcgcg
cgtgatggctggcaaatcgctggctgagcagggcgtaaccaaagaagttatcccgccgta
ctactcggtgaaagaagtggtgctgccgttcaataaattcccgggcgttgacccgctgtt
agggccagaaatgcgctctaccggggaagtcatgggcgtgggccgcaccttcgctgaagc
gtttgccaaagcgcagctgggcagcaactccaccatgaagaaacacggtcgtgcgctgct
ttccgtgcgcgaaggcgataaagaacgcgtggtggacctggcggcaaaactgctgaaaca
gggcttcgagctggatgcgacccacggcacggcgattgtgctgggcgaagcaggtatcaa
cccgcgtctggtaaacaaggtgcatgaaggccgtccgcacattcaggaccgtatcaagaa
tggcgaatatacctacatcatcaacaccacctcaggccgtcgtgcgattgaagactcccg
cgtgattcgtcgcagtgcgctgcaatataaagtgcattacgacaccaccctgaacggcgg
ctttgccaccgcgatggcgctgaatgccgatgcgactgaaaaagtaatttcggtgcagga
aatgcacgcacagatcaaataatagcgtgtcatggcagatatttttcatccgctaatttg
atcgaataactaatacggttctctgatgaggaccgtttttttttgcccattaagtaaatc
tt