MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download carA_nt.seq
    Gene name carA
    Length 1149bp
    Fasta Format

>carA
ttgattaagtcagcgctattggttctggaagacggaacccagtttcacggtcgggccata
ggggcaacaggttcggcggttggggaagtcgttttcaatacttcaatgaccggttatcaa
gaaatcctcactgatccttcctattctcgtcaaatcgttactcttacttatccccatatt
ggcaatgtcggcaccaatgacgccgatgaagaatcttctcaggtacatgcacaaggtctg
gtgattcgcgacctgccgctgattgccagcaacttccgtaataccgaagacctctcttct
tacctgaaacgccataacatcgtggcgattgccgatatcgatacccgtaagctgacgcgt
ttactgcgcgagaaaggcgcacagaatggctgcattatcgcgggcgataacccggatgcg
gcgctggcgttagaaaaagcccgcgcgttcccaggtctgaatggcatggatctggcaaaa
gaagtgaccaccgcagaagcctatagctggacacaagggagctggacgttgaccggtggc
ctgccagaagcgaaaaaagaagacgagctgccgttccacgtcgtggcttatgattttggt
gccaagcgcaacatcctgcggatgctggtggatagaggctgtcgcctgaccatcgttccg
gcgcaaacttctgcggaagatgtgctgaaaatgaatccagacggcatcttcctctccaac
ggtcctggcgacccggccccgtgcgattacgccattaccgccatccagaaattcctcgaa
accgatattccggtattcggcatctgtctcggtcatcagctgctggcgctggcgagcggt
gcgaagactgtcaaaatgaaatttggtcaccacggcggcaaccatccggttaaagatgtg
gagaaaaacgtggtaatgatcaccgcccagaaccacggttttgcggtggacgaagcaaca
ttacctgcaaacctgcgtgtcacgcataaatccctgttcgacggtacgttacagggcatt
catcgcaccgataaaccggcattcagcttccaggggcaccctgaagccagccctggtcca
cacgacgccgcgccgttgttcgaccactttatcgagttaattgagcagtaccgtaaaacc
gctaagtaa
						
    Fasta Format

View sequence in neighbor 100bp

>carA
gtttgccagaaattcgtcggtaagcagatttgcattgatttacgtcatcattgtgaatta
atatgcaaataaagtgagtgaatattctctggagggtgttttgattaagtcagcgctatt
ggttctggaagacggaacccagtttcacggtcgggccataggggcaacaggttcggcggt
tggggaagtcgttttcaatacttcaatgaccggttatcaagaaatcctcactgatccttc
ctattctcgtcaaatcgttactcttacttatccccatattggcaatgtcggcaccaatga
cgccgatgaagaatcttctcaggtacatgcacaaggtctggtgattcgcgacctgccgct
gattgccagcaacttccgtaataccgaagacctctcttcttacctgaaacgccataacat
cgtggcgattgccgatatcgatacccgtaagctgacgcgtttactgcgcgagaaaggcgc
acagaatggctgcattatcgcgggcgataacccggatgcggcgctggcgttagaaaaagc
ccgcgcgttcccaggtctgaatggcatggatctggcaaaagaagtgaccaccgcagaagc
ctatagctggacacaagggagctggacgttgaccggtggcctgccagaagcgaaaaaaga
agacgagctgccgttccacgtcgtggcttatgattttggtgccaagcgcaacatcctgcg
gatgctggtggatagaggctgtcgcctgaccatcgttccggcgcaaacttctgcggaaga
tgtgctgaaaatgaatccagacggcatcttcctctccaacggtcctggcgacccggcccc
gtgcgattacgccattaccgccatccagaaattcctcgaaaccgatattccggtattcgg
catctgtctcggtcatcagctgctggcgctggcgagcggtgcgaagactgtcaaaatgaa
atttggtcaccacggcggcaaccatccggttaaagatgtggagaaaaacgtggtaatgat
caccgcccagaaccacggttttgcggtggacgaagcaacattacctgcaaacctgcgtgt
cacgcataaatccctgttcgacggtacgttacagggcattcatcgcaccgataaaccggc
attcagcttccaggggcaccctgaagccagccctggtccacacgacgccgcgccgttgtt
cgaccactttatcgagttaattgagcagtaccgtaaaaccgctaagtaatcaggagtaaa
agagccatgccaaaacgtacagatataaaaagtatcctgattctgggtgcgggcccgatt
gttatcggtcaggcgtgtgagtttgacta