MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download argF_nt.seq
    Gene name argF
    Length 1005bp
    Fasta Format

>argF
atgtccgatttatacaaaaaacactttctgaaactgctcgactttacccctgcacagttc
acttctctgctgacccttgccgcacagctcaaagccgataaaaaaaatggcaaggaagta
cagaagcttaccggtaaaaacatcgcgctcatcttcgaaaaagactcgactcgtacccgt
tgctctttcgaagttgccgcatttgaccagggcgcgcgcgttacctatttagggccgagc
ggcagccagattgggcataaagagtcaattaaggacaccgcgcgggttctcgggcggatg
tatgacggcattcagtatcgcggtcacggccaggaagtggtcgaaacgctggcgcagtat
gcgggcgtgccggtgtggaacgggctgaccaacgagttccacccgacccagctgctggcg
gacctgatgaccatgcaggagcacctgccgggcaaggcgtttaacgagatgacgctggtc
tacgcgggcgatgcgcgcaacaacatgggcaactcgatgctggaagcggcggcgctgacc
gggctggatctgcgcctgttggccccgaaagcctgctggccggaagagagcctggtggcg
gagtgcagcgcgctggcggagaagcacggcgggaaaattactctgacggaagacgtggcg
gcaggcgttaagggcgcggactttatctataccgacgtgtgggtgtcgatgggcgaggcc
aaagagaagtgggcagagcggattgcgctgctgcgcgggtatcaggtgaacgcgcagatg
atggcgctgaccgacaacccgaacgtgaagttcctgcactgtctgccggcgttccatgac
gaccagactacgctcggcaagcagatggcgaaggagttcgatctgcacggcgggatggag
gtgacggacgaggtgtttgagtcggcggcgagcatcgtgttcgaccaggcggaaaaccgg
atgcatacgattaaggcggtgatgatggcaacgcttggggagtga
						
    Fasta Format

View sequence in neighbor 100bp

>argF
cctttgtaagaaagaattgtgaaatggggttgcaaatgaataattacacatataaagtga
attttaattcaataagtggcgttcgccatgcgaggataaaatgtccgatttatacaaaaa
acactttctgaaactgctcgactttacccctgcacagttcacttctctgctgacccttgc
cgcacagctcaaagccgataaaaaaaatggcaaggaagtacagaagcttaccggtaaaaa
catcgcgctcatcttcgaaaaagactcgactcgtacccgttgctctttcgaagttgccgc
atttgaccagggcgcgcgcgttacctatttagggccgagcggcagccagattgggcataa
agagtcaattaaggacaccgcgcgggttctcgggcggatgtatgacggcattcagtatcg
cggtcacggccaggaagtggtcgaaacgctggcgcagtatgcgggcgtgccggtgtggaa
cgggctgaccaacgagttccacccgacccagctgctggcggacctgatgaccatgcagga
gcacctgccgggcaaggcgtttaacgagatgacgctggtctacgcgggcgatgcgcgcaa
caacatgggcaactcgatgctggaagcggcggcgctgaccgggctggatctgcgcctgtt
ggccccgaaagcctgctggccggaagagagcctggtggcggagtgcagcgcgctggcgga
gaagcacggcgggaaaattactctgacggaagacgtggcggcaggcgttaagggcgcgga
ctttatctataccgacgtgtgggtgtcgatgggcgaggccaaagagaagtgggcagagcg
gattgcgctgctgcgcgggtatcaggtgaacgcgcagatgatggcgctgaccgacaaccc
gaacgtgaagttcctgcactgtctgccggcgttccatgacgaccagactacgctcggcaa
gcagatggcgaaggagttcgatctgcacggcgggatggaggtgacggacgaggtgtttga
gtcggcggcgagcatcgtgttcgaccaggcggaaaaccggatgcatacgattaaggcggt
gatgatggcaacgcttggggagtgattgggtccgctgcgcgttggtgccctcaccccggc
cctctcccacagggagagggagaacaccggctccatttcattgatttttcatcccgaaaa
aggta