MG1655
W3110
Search for
Japanese | English
Deletion Report : 13
General information
Deletion 13  
Location (BP) 2,346,572 - 2,387,982   Go Linear View
Length (BP) 41,411
Related strains
     Strains ME5087    ME5088    ME5089    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer 2346569_C_13_1_RcL  
Sequence ATAGTAGATAGACGCAGAGCGTTAATTGTGTGCCAGTGATGCGCAGGGTA  
3' Primer 2387980_U_13_B_LcR  
Sequence TACCCTGCGCATCACTGGCACACAATTAACGCTCTGCGTCTATCTACTAT  

 Linear View (Whole Mode)
View Location
   2345.0  –  2395.0 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             CTTATCTGGT CGGGCAGATT GACTCGGAAG 
-00070 TGGACACCGA CGATTTGAGT AACTTCCAGC TCTGATGGCC CGCGTTACCC TGCGCATCAC TGGCACACAA 
000001 CTGCTGTGCC AGGATGAACA CCCTTCCCTT CTGGCGGCGC TGGAATCCCA CAATGTGGCG GTTGAGTACC 
000071 AGTGTCGCGA AGGTTACTGC GGCTCCTGTC GCACACGCCT GGTTGCAGGT CAAGTTGACT GGATTGCCGA 
000141 ACCGTTAGCC TTTATTCAGC CGGGGGAAAT TTTGCCCTGT TGTTGCCGGG CAAAAGGCGA TATTGAAATC 
000211 GAGATGTGAA TTGGTTGTAG TGCCAGATAC AACGCTTATG CGTCTTATCT GGCCTACAAC GATTACATGG 
000281 CGTAGTAATA CGCTTTCACC TGCTCCCAGT CCGCTTTGGG GATTGGCTCC AGATATTTTT CCAGCTGGCG 
000351 GAAGTCATGA TTAATCGCTT TATCGCGACG CAAGCGGCGA CGACTTTTCT CCAGGTCAAG AAAACCAGCT 
000421 TCTGCATTAC CTTCTGTTTT CACATAGATA TGGCGAACAT AACAACAGCC ATGCTGACGA TTAATGCTAT 
000491 GCATTTTCTT AAACGCCAGC GCCACTGCTT TCAACATGGC TTGCCGTACT TCGTCAGAAT AAGGCGATAC 
000561 TGCATGCTGG GCATACCAGT CAGCAATGCT GATGAACCCC GCCATATCTT CAGTCACCAG CAACGCTCGC 
000631 CATTCACCCT CAATTTTCAC CGCTTCACCA AAAACGATCT TCGGCACGAT GACACCGGCC CGTTCCAGTT 
000701 CTTTAATTAC CGCAACCTCA CGGACAATCG TTGGTCGGCC GAACGGATAA CGTACGGAAT GAAACAGATG 
000771 ATGCGTCATG CGCTTTACAT ACAGCTTTTT GCCGTTGCGC TCGACGCATT GCACCCCGCT CATACCATTA 
000841 CGGCGATAGT TAGGCTCTTC AACCCAGTCG CCCTCTGTTG CCCACCAGTG ATTAAATTCG TCGTACTTTG 
000911 CTGAAACTGC CATACCCTAT CGCCTGTCAT TTTTATTAAC GACAATGACT ATAGGTGGTT ACCTGAGGAA 
000981 AATCTTAATG AAACGTGTCG TATTAATGAA TTTCTTTTGC CACTACTAGC TTGACACCGC TTTTACCCTT 
001051 CATTTGCAGC GCATAGATTC CACCAGCCAC TACCACTAAT AGTGCGCCCA GCAGATAAAA TGTGAATTTA 
001121 ATCAGGCGGA TACAGCGATG AATTTTATTC GACAGGGATT AGGCATCGCC TTACAACCAG AGTTAACGCT 
001191 GAAAAGCATT GCAGGTGAAT TGTGTTCCGT TCCTCTCGAA CCAACTTTCT ATCGACAGAT TTCGTTGCTG 
001261 GCTAAAGAAA AGCCGGTAGA AGGCAGTCCA CTGTTTTTAC TACAAATGTG CATGGAACAA TTAGTGGCGA 
001331 TTGGAAAAAT TTGATATGAG ACAGGATGGC GCATGAACGC CATCCTGCAG TAACATTACT CTTTATTAAG 
001401 AAATTTTACT GCCTTATCAG GGAAATCAGT AAACAGCCCA TTTACACCCG CTTTGTTATA CAGAGCATCA 
001471 TATAACTGAT TCACATCAGG AGTGTATTCA GGCAGTTTAT CTGACCGCAC GGTATAAGGA TGCACTACCA 
001541 GTTTATTCTG CTGAGCATCT TGCACCATGC CAGTGAGTTT GATATTACCC GGCTGCGATG TCTCCTCAAT 
001611 CAACATATGG TAATCCGGAC CAATACCATC TGCATATTCC GCCACCTGTT TCATGGCACC CGGCTTAAAC 
001681 ATCCAGTCGT AGTTGTAATT AACCCAGCTT CCATCCGGCT GTTTCTGCTG CGTTTCATTC CAGTCGGTAT 
001751 AGGCAATCAG CTGTACCAGA TTGAGCTCCA TGCCCATTTT GGGTTCCAGC TCATTCTTAA TACGCTTCAG 
001821 CTCATCAGCA TCAAAACATT GCAAATAAAC TTTATCGTCT TTACCGGTGT AACCATATTT CTTCAGCACT 
001891 TCCAGCGTTT TTGCCGCAAT ATCCTTCCCT TCCTGATGAT GGAACCACGG CGCTTTGATT TCTGGATAAA 
001961 TACCGATATT TTTCCCGGTA GAGTGATTTA ACCCCTGAAC AAATTCAATC TCTTCTTCAA AGGTGTGCAC 
002031 CCGGAAGTCG GACTTACCCA TTGGGAAACG CCCCGGATAA GTCTGCACTT TTTTACCGTT TTCAATATCG 
002101 AAACCTTCGG TAAATTTCAA CGACTTAATT TCATCCAGCG TGAAATCTAT CGCGTAGTAA CGACCGTCTT 
002171 TGCGCGCCCG ATCCGGGAAA CGATCGGCAA CATCAGTAAC ACGATCGAGG TAATGGTCAT GCAGAACAAC 
002241 CAGATTGTCG TCTTTGGTCA TCACCAAATC CTGTTCCAGA TAATCCGCTC CCTGCGCATA CGCCATCGCT 
002311 TTTGCTGGCA GCGTATGCTC CGGCAAATAT CCACTGGCAC CGCGATGGGC GATGACTATT TTTTCGTTGC 
002381 TGTCCGCCGC CATTGCACTG CTTCCCATGA CTATAGTGCT CATCATGATC GCCATGCTAA GGTTTTTCAG 
002451 CGTCAATTTC ATGCCATTAG CCTCCGTTGC GTTCTTGCAG TAATTGTTCA TGGCGACGTT TTTCGCCAAT 
002521 CATCACAACA ATCAACAAGA TAACCGCCAG AATGCTGCCG CCAATCATTA CCATAAAGCC GCCATCCCAG 
002591 CCGAAGAAGT CCACGGTGTA GCCAACAATC GCGCTCGCCG CCACCGAACC GCCCAGGTAA CCAAACAGCC 
002661 CGGTAAAGCC CGCTGCCGTA CCTGCCGCTT TTTTCGGTGC CAGTTCCAGC GCATGCAGAC CGATCAGCAT 
002731 CACAGGACCG TAGATCAGGA AGCCGATAAC AATCATACAA ATCATATCGA CGGTTGGGTT ACCTGCCGGG 
002801 TTCATCCAGT AAACGATAGT CGCGATGGTC ACCAGTGTCA TAAAGAAAAC GCCGGTTGCC CCACGGTTGC 
002871 CACGGAAGAC TTTATCCGAC ATCCAGCCGC ACAGCAGAGT GCCCGGAATA CCTGCATATT CATAAAGGAA 
002941 GTAGGCCCAG GAGGATTTAT CTAGCGCGAA ATGCTTAACC TCTTTCAGAT AAGTCGGTGA CCAGTCGAGG 
003011 ATGCCGTAAC GCAGCAGATA AACGAACACG TTGGCGATGG CGATATACCA CAGCAGTTTG TTCGGCAGTA 
003081 CGTACTGCAT GAAGATTTGC TTCGCCGTCA GCTCCTGTTC CGCTTTTTCG TTATAGTCGT CCGGATAATC 
003151 ATTTTTGTAC TCTTCGATCG GCGGCAAGCC ACAGGATTGC GGGGTATCGC GCATCATCGC AAAGGCGAAT 
003221 AATGCCACCA GAATGGCGCA GAAAGCAGGC ATATAGAGCG CCGCATGCCA GTCATTGAAC CAGGCCATCC 
003291 CCAGCAGGAA CAGCAGCGGC GGAATACCAC CACCGACGTT GTGCGCACAG TTCCACACTG ACACAATGCC 
003361 GCCACGTTCT TTCTGCGACC ACCAGTGCAC CATAGTACGA CCACACGGCG GCCACCCCAT CCCCTGGAAC 
003431 CAACCGCAGA GGAACAACAG TACAAACATC ACCGCAATGC TCGACGTCGC CCATGGCACA AAGCCCATAA 
003501 ACAACATCAC TGCCGCCGCC AGAATCAAAC CTGCGGGCAG GAAAACGCGC GGATTCGAGC GATCCGATAC 
003571 CGAACCCATG ATGAATTTCG AAAATCCATA AGCAATCGAG ATCCCCGAAA GGGCAAAACC TAAATCACCG 
003641 CGTGAGAATC CCTGCTCAAC CAGATAAGGC ATAGCAAGCG CAAAGTTCTT ACGAACCAAA TAGTAAGCCG 
003711 CATAGCCAAA GAATATCCCC AGGAAAATTT GCCAGCGCAA TCGACGATAA GTCGGATCGA TCTCCGCGGC 
003781 AGGTAAGCGC GCTTTGTGTG GCGCTGGTTT AAAAATACTC AACATTGATA GCCTCCGTGG CCCGTGGTCT 
003851 TATTTATGAT TAACAGCCTG ATTCAGTGAG AGAACCTGCC GTTTCTTGAG TTGCCGCGAT GTTAAGAAAA 
003921 CATTCATAAA TTAAATGTGA ATTGCCGCAC ACATTATTAA ATAAGATTTA CAAAATGTTC AAAATGACGC 
003991 ATGAAATCAC GTTTCACTTT CGAATTATGA GCGAATATGC GCGAAATCAA ACAATTCATG TTTTTACTAT 
004061 GGCTAAATGG TAAAAAACGA ACTTCAGAGG GATAACAATG AAAACTCGCG ACTCGCAATC AAGTGACGTG 
004131 ATTATCATTG GCGGCGGCGC AACGGGAGCC GGGATTGCCC GCGACTGTGC CCTGCGCGGG CTGCGCGTGA 
004201 TTTTGGTTGA GCGCCACGAC ATCGCAACCG GTGCCACCGG GCGTAACCAC GGCCTGCTGC ACAGCGGTGC 
004271 GCGCTATGCG GTAACCGATG CGGAATCGGC CCGCGAATGC ATTAGTGAAA ACCAGATCCT GAAACGCATT 
004341 GCACGTCACT GCGTTGAACC AACCAACGGC CTGTTTATCA CCCTGCCGGA AGATGACCTC TCCTTCCAGG 
004411 CCACTTTTAT TCGCGCCTGC GAAGAAGCAG GGATCAGCGC AGAAGCTATA GACCCGCAGC AAGCGCGCAT 
004481 TATCGAACCT GCCGTTAACC CGGCACTGAT TGGCGCGGTG AAAGTTCCGG ATGGCACCGT TGATCCATTT 
004551 CGTCTGACCG CAGCAAACAT GCTGGATGCC AAAGAACACG GTGCCGTTAT CCTTACCGCT CATGAAGTCA 
004621 CGGGGCTGAT TCGTGAAGGC GCGACGGTGT GCGGTGTTCG TGTACGTAAC CATCTCACCG GCGAAACTCA 
004691 GGCCCTTCAT GCACCTGTCG TGGTTAATGC CGCTGGGATC TGGGGGCAAC ACATTGCCGA ATATGCCGAT 
004761 CTGCGCATTC GCATGTTCCC GGCGAAAGGA TCGCTGCTGA TCATGGATCA CCGCATTAAC CAGCATGTGA 
004831 TCAACCGCTG CCGTAAACCT TCCGACGCCG ATATTCTGGT GCCTGGCGAT ACCATTTCGC TGATTGGTAC 
004901 CACCTCTTTA CGTATTGATT ACAACGAGAT TGACGATAAT CGAGTGACGG CAGAAGAGGT TGATATTCTG 
004971 CTGCGTGAAG GGGAAAAACT GGCCCCCGTG ATGGCGAAAA CGCGCATTTT GCGGGCCTAT TCTGGCGTGC 
005041 GCCCGCTGGT TGCCAGCGAT GACGACCCGA GCGGACGTAA CGTCAGCCGT GGCATCGTGC TGCTCGACCA 
005111 TGCTGAACGC GATGGTCTGG ACGGATTTAT CACCATCACC GGTGGCAAAC TGATGACCTA TCGGCTGATG 
005181 GCTGAATGGG CTACCGACGC GGTATGCCGC AAACTGGGCA ACACGCGCCC CTGTACGACT GCCGATCTGG 
005251 CACTGCCTGG TTCACAAGAA CCCGCTGAAG TTACCTTGCG TAAAGTCATC TCCCTGCCTG CCCCGCTGCG 
005321 CGGTTCTGCG GTTTATCGTC ATGGCGATCG CACGCCTGCC TGGCTGAGCG AAGGCCGTCT GCACCGTAGC 
005391 CTGGTATGTG AGTGCGAAGC GGTAACTGCG GGTGAAGTGC AGTACGCGGT AGAAAATTTA AACGTTAATA 
005461 GCCTGCTGGA TTTACGCCGT CGTACCCGTG TGGGGATGGG CACCTGCCAG GGCGAACTCT GCGCCTGCCG 
005531 CGCTGCCGGA CTGCTGCAAC GTTTTAACGT CACGACGTCC GCGCAATCTA TCGAGCAACT TTCCACCTTC 
005601 CTTAACGAAC GCTGGAAAGG CGTGCAACCC ATCGCCTGGG GAGATGCACT GCGCGAAAGC GAATTTACCC 
005671 GCTGGGTTTA TCAGGGATTG TGTGGTCTGG AGAAGGAGCA GAAAGATGCG CTTTGATACT GTCATTATGG 
005741 GCGGCGGCCT CGCCGGATTA CTCTGTGGCC TGCAACTGCA AAAACACGGC CTGCGCTGTG CCATTGTCAC 
005811 TCGTGGTCAA AGCGCACTGC ATTTCTCATC CGGATCGCTG GATTTGCTGA GCCATCTGCC AGATGGTCAA 
005881 CCGGTGACAG ACATTCACAG TGGACTGGAA TCTTTGCGTC AGCAGGCACC AGCCCATCCT TACTCCCTTC 
005951 TCGAGCCACA ACGCGTGCTC GATCTCGCTT GCCAGGCGCA GGCATTAATC GCTGAAAGCG GTGCGCAATT 
006021 GCAGGGCAGC GTAGAACTTG CTCACCAGCG GGTTACGCCG CTCGGCACTC TGCGCTCTAC CTGGCTAAGT 
006091 TCGCCAGAAG TCCCCGTCTG GCCGCTGCCC GCGAAGAAAA TATGTGTAGT GGGAATTAGC GGCCTGATGG 
006161 ATTTTCAGGC GCACCTTGCG GCAGCTTCGT TGCGTGAACT CGGCCTTGCC GTTGAAACCG CAGAAATAGA 
006231 GCTGCCGGAA CTGGATGTGC TGCGCAATAA CGCCACCGAA TTTCGCGCGG TGAATATCGC CCGTTTCCTT 
006301 GATAATGAAG AAAACTGGCC GCTGTTACTT GATGCGCTTA TTCCTGTCGC CAATACCTGC GAAATGATCC 
006371 TGATGCCCGC CTGCTTCGGT CTGGCCGATG ACAAACTGTG GCGTTGGTTG AATGAAAAAC TACCTTGTTC 
006441 ACTGATGCTT TTGCCAACGC TGCCGCCTTC CGTGCTGGGC ATTCGTCTGC AAAACCAGTT ACAGCGCCAG 
006511 TTTGTGCGCC AGGGTGGCGT GTGGATGCCG GGCGATGAAG TGAAAAAAGT GACCTGTAAA AATGGCGTAG 
006581 TGAACGAAAT CTGGACCCGC AATCACGCCG ATATTCCGCT ACGTCCACGT TTCGCGGTTC TCGCCAGCGG 
006651 CAGTTTCTTT AGTGGCGGAC TGGTAGCGGA ACGTAACGGC ATTCGAGAGC CGATTCTCGG CCTTGATGTG 
006721 CTACAAACCG CCACGCGGGG TGAATGGTAT AAGGGAGATT TTTTTGCGCC GCAACCGTGG CAGCAGTTCG 
006791 GTGTAACCAC TGATGAGACG CTACGCCCGT CACAGGCAGG GCAAACCATT GAAAACCTGT TTGCCATCGG 
006861 TTCGGTGCTG GGCGGATTTG ATCCCATCGC CCAGGGATGC GGCGGCGGTG TTTGTGCCGT CAGTGCTTTA 
006931 CATGCCGCTC AACAGATTGC CCAACGCGCA GGAGGCCAAC AATGAATGAC ACCAGCTTCG AAAACTGCAT 
007001 TAAGTGCACC GTCTGCACCA CCGCCTGCCC GGTGAGCCGG GTGAATCCCG GTTATCCAGG GCCAAAACAA 
007071 GCCGGGCCGG ATGGCGAGCG TCTGCGTTTG AAAGATGGCG CACTGTATGA CGAGGCGCTG AAATATTGCA 
007141 TCAACTGCAA ACGTTGTGAA GTCGCCTGCC CGTCCGATGT GAAGATTGGC GATATTATCC AGCGCGCGCG 
007211 GGCGAAATAT GACACCACGC GCCCGTCGCT GCGTAATTTT GTGTTGAGTC ATACCGACCT GATGGGTAGC 
007281 GTTTCCACGC CGTTCGCACC AATCGTCAAC ACCGCTACCT CGCTGAAACC GGTGCGGCAG CTGCTTGATG 
007351 CGGCGTTAAA AATCGATCAT CGCCGCACGC TACCGAAATA CTCCTTCGGC ACGTTCCGTC GCTGGTATCG 
007421 CAGCGTGGCG GCTCAGCAAG CACAATATAA AGACCAGGTC GCTTTCTTTC ACGGCTGCTT CGTTAACTAC 
007491 AACCATCCGC AGTTAGGTAA AGATTTAATT AAAGTGCTCA ACGCAATGGG TACCGGTGTA CAACTGCTCA 
007561 GCAAAGAAAA ATGCTGCGGC GTACCGCTAA TCGCCAACGG CTTTACCGAT AAAGCACGCA AACAGGCAAT 
007631 TACGAATGTA GAGTCGATCC GCGAAGCTGT GGGAGTAAAA GGCATTCCGG TGATTGCCAC CTCCTCAACC 
007701 TGTACATTTG CCCTGCGCGA CGAATACCCG GAAGTGCTGA ATGTCGACAA CAAAGGCTTG CGCGATCATA 
007771 TCGAACTGGC AACCCGCTGG CTGTGGCGCA AGCTGGACGA AGGCAAAACG TTACCGCTGA AACCGCTGCC 
007841 GCTGAAAGTG GTTTATCACA CTCCGTGCCA TATGGAAAAA ATGGGCTGGA CGCTCTACAC CCTGGAGCTG 
007911 TTGCGTAACA TCCCGGGGCT TGAGTTAACG GTGCTGGATT CCCAGTGCTG CGGTATTGCG GGTACTTACG 
007981 GTTTCAAAAA AGAGAACTAC CCCACCTCAC AAGCCATCGG CGCACCACTG TTCCGCCAGA TAGAAGAAAG 
008051 CGGCGCAGAT CTGGTGGTCA CCGACTGCGA AACCTGTAAA TGGCAGATTG AGATGTCCAC AAGTCTTCGC 
008121 TGCGAACATC CGATTACGCT ACTGGCCCAG GCGCTGGCTT AAACTCCTTT CTGATGCCCG GTAAGCATGT 
008191 GGTTACCGGG CATTTTTGCG TACACGATTC CGTGCCCAAT GTATGCGTTG CAACGCAGTG AAAATTCCTC 
008261 TGAAAACGTC TCGCAAAGGC TGAAACTGGC AGATGTCAAA GGCCTGGGAT AACCGTAATG TCGCGTCATC 
008331 ATAAATATCA GGTGACGGAC AACCATGACC GAATCAACAA CCTCCTCCCC GCATGATGCG GTATTTAAAA 
008401 CCTTTATGTT CACACCCGAA ACCGCACGGG ATTTTCTCGA AATACATTTA CCAGAACCAC TGCGCAAGCT 
008471 TTGCAACCTG CAAACCTTAC GCCTGGAACC CACTAGTTTT ATTGAAAAAA GTTTACGCGC TTACTACTCG 
008541 GATGTTTTGT GGTCCGTGGA AACCAGCGAC GGTGACGGCT ATATCTACTG CGTGATTGAA CATCAAAGCT 
008611 CTGCAGAAAA GAATATGGCT TTTCGGCTAA TGCGCTATGC CACTGCCGCC ATGCAGCGTC ACCAGGACAA 
008681 AGGCTATGAC AGAGTCCCGC TGGTGGTGCC GTTGCTGTTT TATCATGGCG AAACCTCGCC TTACCCGTAC 
008751 TCACTCAACT GGCTGGATGA GTTTGACGAT CCGCAACTTG CCCGGCAGTT GTACACCGAA GCTTTTCTGT 
008821 TGGTGGATAT CACCATCGTA CCTGACGATG AGATCATGCA ACATCGGCGT ATAGCTCTGC TGGAACTGAT 
008891 TCAAAAGCAT ATTCGCGACC GCGATTTAAT CGGCATGGTC GACAGGATCA CCACGCTTTT GGTTAGAGGC 
008961 TTCACTAATG ACAGCCAGCT ACAAACACTG TTTAATTATC TGCTGCAATG CGGCGATACC TCCCGTTTCA 
009031 CCCGTTTTAT TGAGGAGATT GCCGAACGTT CACCACTACA AAAGGAGAGA TTAATGACTA TTGCTGAACG 
009101 GCTACGGCAG GAAGGGCATC AAATTGGCTG GCAGGAAGGT ATGCATGAAC AAGCCATTAA AATTGCTTTG 
009171 CGCATGCTGG AGCAGGGCTT TGAACGTGAG ATTGTGCTGG CGACAACCCA ACTCACTGAT GCTGATATTC 
009241 CGAACTGTCA TTAAAAGGAG AGATTAATGA CTATTGCTGA ACGGCTGCGG CAGGAAGGAC ATCAAATTGG 
009311 CTGGCAGGAA GGTAAATTAG AAGGTTTGCA TGAACAAGCC ATTAAAATTG CTTTGCGCAT GCTGGAACAG 
009381 GGCTTTGATC GTGACCAGGT GCTCGCGGCC ACCCAGCTAA GCGAAGCCGA TCTGGCAGCG AATAACCACT 
009451 AATTAACACA GGCCCACAGC CGATCCCCAT GGGCCTTTGA TATCAATAAC TACCTTTTAT GCGTGGCCCA 
009521 TTTTTGCCTG ATTTAAACAT CGCCAGTCGT TGATCCAGGG CATCGCTGTA GAGCATCGTG TCAACGCCAA 
009591 CAGCGACAAA GTTCGCTCCC CACGCCAGGC ATTGCTGCGC CATATCAGGA GCCACAGCCA GAAAACCAGC 
009661 CGCTTTACCC GCAGCACGGA TCCGCCGAAT ACTGGTTTCA ATAATTCGCT GCACTTCCGG GTGCCCGGCG 
009731 TTATCCGGGT AGCCCAACGA CGCAGAAAGA TCCGCAGGTC CAATAAACAC GCCATCAATC CCTTCGACGT 
009801 CGAGGATTTC GTCCAGGTTA TCCAGTGCCG TTTTACTTTC CACCTGCACC AACAGACAAA GCGAATCGTT 
009871 AACTTGCGCC ATGTAATTCT CAATGCGTCC CCAGCGCGCA GCCCGTGCCA CACTGGCCCC GACACCACGC 
009941 TCACCGTAGG GAGGATAGCG CGTGGCAGAC ACCACCTGAC GTGCCTGTTC GGCAGTATCG ACCATCGGGA 
010011 TCAGTAGAGT TTGCGCGCCA ATATCCAGGA CTTGTTTAAT CAGCGGTTTA CTGCCTTCCA CCGGACGGAT 
010081 CACGGGTTGG CTGGCATAGG GCGCTACCGC CTGTAGCTGA TGATAAAGAT CCTGAATGGT GTTTGGCGCG 
010151 TGCTCCCCGT CAATCAGCAA CCAGTCATAA CCAGAAGTGG CGGCAATTTC TGCCATATAG GCAGTCGTTG 
010221 AGCTTAACCA CAGACCAATT TGCACTTCGC CCTTGCGTAA ACGTTCTTTA AAGGGATTGC TTAATAATGC 
010291 GTTCATCGTG TTCCTTAACC TATTTAATGA TGTGCCACGT CGGTCTGCGC AACAGTGCGA TTTACACGCA 
010361 GAGTGAAAAT AATCAGCGAA CCGATGACCG CCACCGCTGC CAGCGTCAGT AATCCCGCCG CATCGCTGGC 
010431 AAATAACGTT TCTGCTTTCA CGCGCAGGAT CGGGGCAATA AACCCGCCCA CTGCACCAAA CAGGTTTACA 
010501 AAACCAATTC CCGCAGCCAG CGCCGTACCG GAAAGCAGTT GTGTCGGCAT CGTCCAGAAC ACTGGCTGCA 
010571 CGGCAATAAA CCCGATAGCT GCAACACACA GCGCTACGAT CGCCATTACT GGAGAAAGCA GCCCGGACAG 
010641 ACCAATACCA ATGCCCGCCG CCAGTAATGT CAGCGCTGCG ACATTACGCC GTTCGCCGGT TTTATCGGAA 
010711 TAGCGCGGAA TAAGCCAGGT CCCAAACAAG GCCGCAACCC ACGGAATGGC GGTGACCACC GACGCTGTAA 
010781 AGCCCACTTT TGTTCCCAGC AATGCCGCAA CCTGGGTCGG CAGGAAGAAA ATTAATCCGT AAACCGCCAC 
010851 CTGAATGGTC AGGTAGATAA TCGCTAGTTG CCAGACTCGG CCATTACGCA GCGCATCGCT CAGCCGAGAA 
010921 GTCACTTTCT GTTGTTCTTC ACTTGCCAGT TGATTGATAA GCAACGTTTT TTCTTGTTTA CTCAGAAAAC 
010991 GTGCCTGCTC CGGTGTGTCA TCAAGCCAAA AGAATGTGAA TACCCCAGCA CCGACTGCCA ACAATCCTTC 
011061 AATCACAAAC ATCCAGAACC AGCCGGGATG CCCCATAAAT CCATGCATCT CCAACAGCGC GCCGGAAAGC 
011131 GGTGATCCCA GTGTTAACGC CAGCGGTGCG CCCATATAGA ACAGCCCCAT AATGCTGGCG CGATTACGCT 
011201 GCGGAAACCA TTGCGAGGTG AGATAAATCA TACCAGGGAA AAATCCGGCC TCCGCAGCAC GAAGCAGAGT 
011271 GCGAACTATC AGAAATTTCG CTTCAGTATC GGCCCATGCC ATGGCTGCCG AAAGAAATCC CCACAGCAGT 
011341 GTTGTCGTAC CAATCCAGGT TCTGGCCCCC AGTTTGCGCA TCAAAAGATT CGCCGGAACA CCCAGAAACG 
011411 CATATACCAC AAAGAAAATG CCTGCTCCCA GCGCATAAGC TTCATTACTC AACCCGGTAT CAATCTGGTA 
011481 GGTCTGTTTG GCAAAACCGA TATTCGAACG GTCGAGAAAC GCCAGCACAT ACAGCGCCAA CATAAACGGA 
011551 ATTAAACGCA CACGGTTTTT CTTCACCACG GCGTCAAGCA AAGCGGTGCT CATAAAAAGC TCCTTAGAAT 
011621 ATGTGGGCGT TACCGTTGTC ACAGCAACGC CCGGAGTGAT TAGTGGCTGT AGGGGCGTTT CAAATTGCAG 
011691 TCACGATTGA GTTCGACGCC AAAACCGGGT TTATCAAGCA CTGATTTATG AATACGACCA TTCACCGGAA 
011761 CCGGCTCATT GAGCAGAATC GGGTCAAACT GCGGACGCAT CGTTGAACAA TCCGGGCTGG TCATCAGGAA 
011831 TTCGCTGAAT GGCGTATTGG TGAAGGTGAT CACCGCATGG TGAGAGTAAA CAGACGAACC GTGCGGCACC 
011901 ACCAGTTGCC CCCTGGATTT GGCGATTGCG GCAATTTCCA CCAGCGTGGT TAAACCACCG CACCAGCCAA 
011971 CATCCGGCTG CATAATGTCG ATACCGGTTT CTGAAAGCGT ACGAAAAGAT TGCAGTGTGC CGTGGTGCTC 
012041 ACCGCTGGTG ACCATCATTC CGACTGGCGC GTTGCGTTTC AGTTCGCGAT AACTTTCATA CTGCTGTGGC 
012111 GGCAGGCACT CTTCGATCCA TTTCAGGTTA TAGGGCGCGC AAGCGTGGGC CAGTTTGGTC GCATAGTTCA 
012181 CGTCCTGACT CATCCAGCAG TCGAGCATTA ACCAGAAATC CTCACCGCAT TTTTCACGCA TATCCGCGAC 
012251 CATAGCGGCA TCTTTGCGGA TCCCCGCATC GCCATCATGT GGCCCCCAGT GCGTCGGCAT TTTGCCACCG 
012321 ATAAAGCCCA TCTCTTTTGC CAGATCCGGA CGCGCACCTG TGGCGTAGAA CTGAATCTCA TCACGAACAG 
012391 CGCCGCCTAA AAGTTTATAA ACCGGAAGCC CGACCACTTT GCCGAACAGA TCCCACAGAG CCAGATCGAC 
012461 ACAAGAAATC GTATTCATCA CCAGGCCACC AGAGCCGGAG TAATACAGGG TGGCACTGAG CATTTGATCG 
012531 TGGATCAGTT TGATATCACT GACACATTTA CCCTCAATGA AACGGTTAAG ATGTTTTTCG ACAATAAAAC 
012601 AGCCCATTTC ACCGGCTGTC GAAACGGCGA ATCCGGTCTG GCCGTTTTCT GCTTCGACTT CAACAACCAA 
012671 CGTGCCAAGA ACGTTAATGC CAAATGACTG GCGTGACTGC TCGTAATCGC GGTATTTACT CATCGGGGTG 
012741 GCAATATGAT CGTCTATCCA GTGATTCGCC CCCTGGTCGT GATAATCACC GCCGCCAGCG CCTTTTTCTG 
012811 CTGTCGCACC GCCAGTAAAC CAGGCGCGAA CCTGTTTAAT TTTTGGTAGG GTCATGATGT TCTCCATTGT 
012881 TATGAGGCTT GTAAGTCAAA GGGACTTTTC CATCCCAACA GACGTGAAAT ATCCCTGGCG CAGGCAATGG 
012951 CCTTGCCCGC CAGATAATCA CGGTATTCTT CATTGATTTG TAAGCGGGTA CCGACCACCG AGATCGCAGC 
013021 GGTAAGCTCG TTATTGGCGT TAAACACCGG CGCAGCGACA CAACGGACAT CGGCGTAATC TTCGCCGTTG 
013091 TCATAGCTCC AGCCCTGACG GCGAATACGC GCCAGTTCTT CGTGAAGTTG CTGTGGATGA GTAATCGTTG 
013161 TGGGTGTCGC CTGCTCCCAG ACCAGCCCTT CGATAATACT TTGCTGTACC GCTGCAGGTT GCCAGGCAAG 
013231 CAGGCATTTA CCTATTCCGG AGCGATAAAG CGAAAGGCTT TTTCCTTCAT GGGAACGCAC GCTGATAGTG 
013301 GCTGATGACT CCACTTTCAA AATGTAATAA GCGCTGCCGT TATCAATAAT CCCCAGGTGA CATAACAGCC 
013371 CGGTGGTATC CATCAGTTGC GTCAAACGCG GTCGAGCCAG TTCCCGGAGA TCCATCTTGC TTAACGCATG 
013441 ACCGGAAAGC TCCACCAGCC TGGTCCACAA ACAAAAATTT TCCTGGTGAT CAAGGCTAAG AAAACGCTGA 
013511 CGCCTGAGTT CATTAAGCAG CAAATAGGCC GTGCTTTTAG GGATTCCCAA TGTGTCAATG ATCGTCGCAG 
013581 CACTACAGGG GCCAATGCGG GCAATCAAAT TGAGAATATC AATAGCCCGT GTCAGGGCGG GAACTTTGCT 
013651 TGATTCCAAC ATACTGGACT CCAGTCTTAG ATACTGGAAT CAGTCTCGTT GCTCAGGGGG AGTAAAATTG 
013721 TGAAGCGCAT CAAATCCCGC TCCTCGTCCA GCAGACTGGA GAAATTACGC ACAAATTTGT GAATCAGCGC 
013791 ACGGATTTTT TCTTATTGAG TACAACAGGT TGGACAAATT TTGCCGGAGG GGGAATGTGC CGGTGCAGTA 
013861 AACCGGCACA GAGTGGCGGA ATCAGACAGA TAAGGTCATG GACTCAACAA CCTCAATCCA GCCATGCTCA 
013931 CTGGCGATAT CCTGGCCGTT TAACCAACGG CGCAGCATAT TCAGTGCCAT CATTGCGCAC ACTTCCTGAC 
014001 GGATAGCCAG GCTGTAGCGC GTAGTGCTGA AACGCACACG CAGAGCGAAA GTGCCGTCTG GCGTGGCTAG 
014071 CGCAAAGTTG AGATGCTCGT TCTCGAAACC CGAAACAGCC AGTGCCAGCC CGGCAAAATG GTTGGCCCGC 
014141 CGTTCTGTAA TCCAGTGCGC AGTTTGCGCC AGGGTTTCCT CCTGTGAAGG AACCACTTCA CACGCCAGCA 
014211 ATGGAGCACC TGCGCGAGAA AGTTGCAAAG CCAATAAACC ACCGGTGAAT TGCTCGCTCA ACGTCAGGCT 
014281 GAACTGGCGG TTTTGCAATT CGCGACTGAT CTGCGCGGGC AGTCCTTCAG TGCCTTCGAA AATCACGCTC 
014351 TGTCCGGCAA CACGTTTAAC ATCCAGCCAC AGTTTTTCCA TCGCCTGTTG CTCGCTTGCC GGTCCGGTGA 
014421 GTTTCAGTTC GATGATAGGC ATTGAGGAGC GATAGCCCAT TGTTACGCCC GGCGGCAGTT GTAGAGTGTC 
014491 CAGGCTTTGT GCCAGATCGC TTTCCGAACG ACCAAAAGTA GTCAAACGCA GACAAACCGG CGGCTGCGGT 
014561 AAAGAAAAAC GCTCGCGCAG GCGCGGCAGG ATTTCGTGCT CGACCATCAC CTTAAATTCT GACGGTACGC 
014631 CGGGAGTAAA GAACATCAGG CAACGATTAA GCTGCACGGC AAAACCACAG GCGGTGCCTA CCGGGTTATT 
014701 GATAAATTCA GCACTGGCAG GCAGCTCCGC TTGTTTACGG TTGCTCGGTG CCATTACTCG TCCACGTTCG 
014771 TGGAAATAGC GTTCCATCTC TTTGAGCCAG GCTTCATGCA GCACCAGGCC TTCACCTTTT GCTGTCGCAG 
014841 CGGCGAGTGC GCTTAAATCA TCGCTGGTCG GTCCCAGCCC GCCGTTAACG ATCAGCACAT CGGCGTGCTG 
014911 ACTACGTTCG CGAAGAATGG TGACTAAGTC ATCAAGGTTA TCCCCCACCG TATTGCGGCG AGATAATGGC 
014981 AACCCCTGAT GAAAGAAAAA ATCGGCCAGC CAGGCAGCGT TAGTGTCAAC GATTTGCCCG TGTAACACTT 
015051 CATCCCCGGT GGATAACATT TCCACTTTTA ACATGGTTAT CTCCTGCTTT TGTTATCGAA TCACTATAAC 
015121 GCAAAGGGAG ATAAGGCGTA GTAAGAAACT GAATGGCGCG ACAGAATGCC GCGCCGGAAG GGATCAGAAA 
015191 CTGGCGTTAA CCCCAACATA CGGGCCGTCA GCCACGGCGT TGTCGCGGTT ACCGTCTTTA CCCGACAGAT 
015261 TCAGGTAGCG ATAACCCGCC TCAATACTGA CTGGACGCAT AATGGTGTAA CGCGCGCCAG CATTCGCTTC 
015331 TTCATAACTT TGAATACCGC TGGAGAGCGA ATCCGGAGAG TAGTAATACT CGCCAAACAA ACGGAAGCTG 
015401 TTGCCAATTT TCCACTGCAA ACCACCTCCT ACCGCTGCGG CATAACCTTC ATCGCCGTAA TTCGGGTTGG 
015471 TGTAAACGCC TTTTCCGCCA ACGGTCGCCA TTAACGGCCC GAGAGGCAGA TTCAACCCCA GCCCCACGCC 
015541 AGCGACATCA CCGTCGTCGT CGTTATGTGT CCAGTTACCG CTTAACGCCA GGCCCGTCGT TTCAGTCCCA 
015611 AAACCGACAC CAATATTGGT GTATTCTTTA CCCGCCTGAC CGCTGATGCT CATTGCATTG ACCGATGCAG 
015681 AAACCAACAG CATTCCGGCC AGACCTGCTA GCGCAATTTT TTTCATTATC CCCTTTCCCA CAAGCAATTA 
015751 ATCAAAATTC CCAAAGCTGC GGGATTGTAC TGCCTGGCAC AGAGGATTCA ATGAGCGAAA AAAAGGATCT 
015821 AGTCACTTAT TGTAACTAAA TACTTCTTAA ATAATTAAAT GCCGAAAAAA TAAACACACT TTATCGATAC 
015891 ACACAAAAAT AATAATAAGT ACAGTTATCA TCGCAAAAGA GATTACTGTC ACTTTCACAT ATTTGTGAGT 
015961 TACCGTATTC TCATGGTTTC TTTTTATTTA TAAGGAATAT CCCTGTGCGA CAACGGACTA TTGTATGCCC 
016031 TTTGATTCAA AATGATGGTG CTTATTTGCT GTGTAAAATG GCCGACGATC GCGGCGTTTT CCCCGGTCAA 
016101 TGGGCGATTT CGGGTGGCGG CGTGGAGCCT GGCGAACGAA TTGAAGAGGC ACTACGCCGC GAAATTCGCG 
016171 AAGAACTGGG AGAACAGCTG CTTTTGACAG AAATCACGCC GTGGACCTTC AGCGATGATA TTCGCACCAA 
016241 GACGTATGCA GATGGTCGCA AGGAAGAGAT TTATATGATT TACCTGATTT TTGACTGCGT TTCTGCCAAC 
016311 CGAGAAGTGA AAATAAACGA AGAGTTTCAG GACTACGCGT GGGTAAAACC TGAAGATCTG GTGCATTATG 
016381 ATTTGAATGT CGCCACCCGA AAAACGTTAC GTTTGAAAGG TCTTCTGTAA CAATGATGAC AGCCATTACT 
016451 GGCTGTCAGA TTGAAAATTT AGTGGTTAAC GAATTCCCCA TCCAGATAAA CTTTGCCTTT TTCCACATGC 
016521 ATGACTAAAC CATCCAGATA ATCAGGTTTA AATGTCGCGT CACGCTTATC TTTAGCAATA TATGTCAGGC 
016591 AATGATTATG GGTGAAAATA ACGATATTTT TATCAGGCGC TTTGCTTTGT AAGTCCTTAA TTGCACTATA 
016661 AATCTCATTA CCGCACTGAA GAAGTCGTTT ATCTACCGTC AATTTTTTAC CCGCTGAAAA CCAGGTAGCC 
016731 GACTGAATGG TCCGGACGGT ATTACTGGAA TAAAGATCGA AATCAGGGAT ATCAGCACTA AAAGCGTTGC 
016801 CCAGTTCACG GGCATCCTGG GTACCTTTAA CCGTAATACC TGTTTTATCT GACAAGCATT GATTGGTTGA 
016871 ACGGTCGCAA CGTTCAGCAT GACGAAACAA AACGACAACC GGGTGCTGCT GTGCCAGTCT GGCCAGTGTT 
016941 TTATTGTCGA TACGTGGCAA ACCATTGCTA CTCCAGGCGG CATGAGTACC CAGTCCGGCA ATTGCAGCGA 
017011 GCGCCAGTAA AATGATGATA TATTTTTTTG ACTTCAACGA AGAGCGGCAA AAAGCTAACA CGTAAACTCC 
017081 ACCTATAGAC AAGCGCAACC AGACAATTAC CGTGAAATTG AGCTACATTT CTGGCGATAA TTCGCAGTTG 
017151 GTGTAATATT AAAAATCCTA CGATGTCGGC AAAATGCCTC AAAATTTTGC CAAATGCAAA GCCTAAATAA 
017221 GAAAAAATAT AAAAATTTCA ATATTTACGT CTAATATTAG TTTCTTAAGG TTAAGTTAAT ATTCTATCCT 
017291 TAAAATTTCG CTCCAAATGG CAAAATATAC ACAACACTCT TTATAGCAAA TATAAGTGGA CAGGTATTCA 
017361 ATGGCGGAAG GAAAAGCAAT GTCAGAATTT TTGCCTTTTT CGCGACCAGC AATGGGCGTG GAGGAACTCG 
017431 CTGCAGTTAA AGAGGTTCTC GAATCCGGTT GGATCACAAC CGGTCCGAAG AATCAGGCGC TTGAGCAAGC 
017501 TTTTTGCCAG TTGACGGGAA ATCAGCATGC CATCGCGGTC AGTTCAGCCA CCGCCGGAAT GCATATCACG 
017571 CTAATGGCGT TGAAAATTGG CAAGGGCGAT GAAGTGATTA CGCCTTCCCT GACCTGGGTT TCAACCCTCA 
017641 ATATGATTTC CTTGTTGGGT GCAACGCCGG TAATGGTGGA TGTCGACCGC GATACGCTGA TGGTCACGCC 
017711 TGAAGCTATC GAGTCAGCCA TTACGCCACG CACTAAAGCC ATCATTCCGG TGCATTATGC CGGTGCGCCA 
017781 GCAGATATTG ACGCCATTCG CGCCATTGGC GAACGTTACG GCATCGCAGT TATCGAAGAT GCTGCCCATG 
017851 CCGTCGGTAC GTATTACAAA GGGCGACATA TTGGCGCAAA AGGTACCGCT ATTTTTTCAT TTCATGCCAT 
017921 TAAAAATATT ACCTGTGCTG AAGGTGGCCT GATTGTAACT GATAATGAAA ACCTTGCCCG CCAGCTACGG 
017991 ATGCTGAAAT TTCACGGTCT GGGTGTCGAT GCCTATGACA GACAAACCTG GGGCCGTGCA CCGCAGGCTG 
018061 AAGTCTTAAC ACCGGGCTAT AAGTACAATC TGACCGATAT TAACGCCGCG ATTGCCCTGA CACAGTTAGT 
018131 CAAATTAGAG CACCTCAACA CCCGTCGGCG CGAAATTGCC CAGCAATATC AGCAAGCACT GGCAGCTCTC 
018201 CCCTTTCAGC CATTAAGCCT TCCCGCCTGG CCGCACGTTC ACGCCTGGCA TCTGTTTATT ATTCGTGTCG 
018271 ATGAACAACG TTGTGGTATC AGTCGCGATG CGTTGATGGA AGCGTTAAAA GAAAGAGGCA TTGGTACCGG 
018341 GTTACATTTC CGCGCCGCTC ACACACAAAA ATATTATCGC GAGCGTTTTC CCACGCTGTC GTTACCGAAT 
018411 ACCGAATGGA ATAGCGAACG CATCTGTTCT TTGCCGCTGT TCCCGGATAT GACTACCGCC GATGCCGACC 
018481 ATGTCATCAC AGCCCTTCAG CAACTCGCAG GACAATAAGC CATGTTTGAA ATCCACCCTG TTAAGAAAGT 
018551 CTCGGTGGTT ATTCCCGTTT ATAACGAGCA GGAAAGCTTA CCGGAATTAA TCAGGCGCAC CACCACAGCC 
018621 TGTGAATCGT TGGGGAAAGA GTATGAGATC CTGCTGATTG ATGACGGCAG TAGCGATAAT TCCGCGCATA 
018691 TGCTGGTCGA AGCCTCACAA GCGGAGAACA GCCATATTGT GTCTATTTTG CTTAACCGCA ATTACGGGCA 
018761 ACATTCAGCG ATTATGGCGG GATTCAGTCA CGTTACTGGC GACTTAATTA TTACCCTTGA TGCCGATCTC 
018831 CAGAATCCGC CAGAAGAAAT CCCCCGCCTG GTGGCAAAAG CCGATGAAGG TTACGACGTG GTAGGGACTG 
018901 TACGCCAGAA CCGCCAGGAC AGCTGGTTTC GTAAAACCGC TTCGAAGATG ATTAACCGGC TTATTCAGCG 
018971 CACCACTGGC AAAGCGATGG GTGATTACGG TTGTATGCTG CGCGCCTATC GCCGTCATAT TGTCGATGCG 
019041 ATGTTGCACT GCCATGAACG CAGCACCTTT ATCCCGATTC TGGCGAATAT CTTCGCCCGC CGTGCCATTG 
019111 AAATTCCAGT ACATCATGCC GAGCGTGAGT TTGGTGAATC CAAATACAGT TTTATGCGCC TGATTAATTT 
019181 GATGTACGAC CTGGTGACCT GCCTTACCAC AACGCCGCTA CGTATGCTGA GTCTGCTCGG CAGCATTATT 
019251 GCGATTGGAG GTTTTAGCAT TGCGGTGCTG CTGGTGATTT TACGCCTGAC CTTCGGACCA CAATGGGCGG 
019321 CAGAAGGCGT CTTTATGCTA TTTGCCGTGC TGTTTACTTT TATTGGCGCT CAGTTTATCG GCATGGGATT 
019391 ACTCGGTGAA TATATCGGCA GGATCTACAC CGATGTCCGC GCCCGCCCCC GCTATTTTGT TCAGCAAGTT 
019461 ATCCGTCCAT CCAGCAAGGA AAATGAATAA TGAAAACCGT CGTTTTTGCC TACCACGATA TGGGATGCCT 
019531 CGGTATTGAA GCCCTGCTGG CTGCCGGTTA CGAAATTAGC GCCATTTTTA CCCATACTGA TAATCCCGGT 
019601 GAAAAAGCCT TTTATGGTTC GGTGGCTCGT CTGGCGGCGG AAAGAGGCAT TCCGGTTTAT GCGCCGGATA 
019671 ACGTTAATCA TCCGCTGTGG GTGGAACGCA TTGCCCAACT GTCGCCAGAT GTGATTTTCT CTTTTTATTA 
019741 TCGCCATCTT ATTTACGACG AAATTTTGCA GCTCGCTCCC GCAGGTGCAT TTAATCTGCA TGGTTCGCTG 
019811 TTACCAAAAT ATCGTGGTCG CGCGCCGCTG AACTGGGTGC TGGTCAACGG TGAAACGGAA ACTGGCGTTA 
019881 CATTGCACCG AATGGTGAAA CGTGCCGATG CCGGGGCCAT TGTGGCGCAA CTGCGCATTG CCATTGCGCC 
019951 AGACGATATC GCTATTACGC TGCATCATAA ATTGTGCCAT GCCGCGCGCC AGCTACTGGA ACAGACATTA 
020021 CCCGCCATTA AACACGGTAA TATTCTGGAA ATCGCCCAGC GCGAAAACGA AGCCACCTGT TTTGGTCGCA 
020091 GAACGCCGGA TGACAGTTTC CTTGAATGGC ATAAACCGGC ATCCGTACTG CACAACATGG TACGTGCCGT 
020161 TGCCGATCCG TGGCCGGGTG CCTTCAGCTA TGTTGGCAAT CAGAAATTCA CCGTCTGGTC GTCGCGTGTT 
020231 CATCCTCATG CCAGCAAAGC ACAGCCGGGG AGCGTGATTT CTGTTGCGCC ACTGCTGATT GCCTGTGGCG 
020301 ATGGCGCGCT GGAAATCGTC ACCGGACAGG CGGGCGACGG CATTACTATG CAGGGCTCGC AATTAGCGCA 
020371 GACGCTGGGC CTGGTGCAAG GTTCACGCTT GAATAGCCAG CCTGCCTGCA CCGCCCGACG CCGTACCCGG 
020441 GTACTCATCC TCGGGGTGAA TGGCTTTATT GGCAACCATC TGACAGAACG CCTGCTGCGC GAAGATCATT 
020511 ATGAAGTTTA CGGTCTGGAT ATTGGCAGCG ATGCGATAAG CCGTTTTCTG AATCATCCGC ATTTTCACTT 
020581 TGTTGAAGGC GATATCAGTA TTCATTCCGA ATGGATTGAG TATCATGTCA AAAAATGTGA TGTCGTCTTG 
020651 CCGCTGGTGG CGATAGCCAC GCCGATTGAA TATACCCGCA ACCCGCTGCG CGTATTTGAA CTCGATTTTG 
020721 AAGAGAATCT GCGCATTATC CGCTACTGCG TGAAGTACCG TAAGCGAATC ATCTTCCCGT CAACTTCAGA 
020791 AGTTTATGGG ATGTGTAGCG ATAAATACTT CGATGAGGAC CATTCTAATT TAATCGTCGG CCCGGTGAAT 
020861 AAACCACGCT GGATTTATTC GGTATCAAAA CAATTACTTG ATCGGGTGAT CTGGGCCTAT GGCGAAAAAG 
020931 AGGGTTTACA GTTCACCCTC TTCCGCCCGT TTAACTGGAT GGGACCACGA CTGGATAACC TTAATGCAGC 
021001 GCGAATTGGC AGCTCCCGCG CTATTACGCA ACTCATTCTC AATCTGGTAG AAGGTTCACC GATTAAGCTG 
021071 ATTGATGGCG GAAAACAAAA ACGCTGCTTT ACTGATATTC GCGATGGTAT CGAGGCGTTA TACCGCATTA 
021141 TCGAAAATGC GGGAAATCGC TGCGACGGTG AAATTATCAA CATTGGCAAT CCTGAGAACG AAGCGAGCAT 
021211 TGAGGAACTG GGCGAGATGC TGCTGGCGAG CTTCGAAAAA CATCCGCTGC GCCATCATTT CCCACCGTTT 
021281 GCGGGCTTTC GCGTTGTCGA AAGTAGCAGC TACTACGGCA AAGGATATCA GGACGTAGAG CATCGTAAAC 
021351 CGAGCATCCG CAATGCCCAC CGCTGCCTGG ACTGGGAGCC GAAAATTGAT ATGCAGGAAA CCATCGACGA 
021421 AACGCTGGAT TTCTTCCTGC GCACCGTTGA TCTTACGGAT AAACCATCAT GACCAAAGTA GGCTTACGCA 
021491 TTGATGTCGA TACCTTTCGT GGCACCCGTG AAGGCGTGCC GCGTCTGCTG GAAATCTTGA GTAAGCATAA 
021561 TATTCAGGCC AGCATTTTTT TCAGCGTCGG CCCGGACAAT ATGGGCCGCC ATCTCTGGCG ACTGGTGAAG 
021631 CCACAGTTTT TGTGGAAGAT GCTGCGCTCA AACGCGGCAT CGCTTTATGG CTGGGATATT TTACTGGCAG 
021701 GTACGGCCTG GCCAGGTAAA GAGATTGGTC ATGCCAATGC CGATATCATT CGTGAAGCGG CTAAACATCA 
021771 CGAAGTCGGC CTGCACGCCT GGGATCACCA TGCCTGGCAA GCCCGTAGCG GTAACTGGGA TCGGCAAACA 
021841 ATGATCGACG ATATTGCACG CGGTCTTCGC ACTCTGGAAG AGATTATCGG TCAACCGGTA ACCTGTTCTG 
021911 CCGCTGCGGG CTGGCGTGCC GACCAGAAGG TGATCGAAGC AAAAGAAGCG TTCCATTTGC GCTACAACAG 
021981 CGATTGTCGT GGGGCCATGC CGTTCCGTCC ATTGCTCGAA TCAGGAAACC CTGGCACTGC GCAAATTCCG 
022051 GTGACCTTAC CCACCTGGGA TGAAGTGATT GGTCGGGATG TGAAAGCAGA AGATTTTAAC GGTTGGTTAC 
022121 TCAACCGCAT CCTGCGAGAT AAAGGCACGC CGGTTTATAC CATTCATGCA GAAGTTGAAG GCTGCGCTTA 
022191 TCAGCATAAT TTTGTGGATC TCCTCAAACG CGCAGCTCAG GAAGGCGTGA CATTTTGCCC TTTAAGCGAA 
022261 CTGTTATCAG AGACGTTGCC GCTCGGACAA GTTGTTCGCG GAAATATTGC CGGACGTGAA GGCTGGCTGG 
022331 GTTGCCAACA AATTGCGGGT AGTCGCTGAT GAAATCGGTA CGTTACCTTA TCGGCCTCTT CGCGTTTATT 
022401 GCCTGCTATT ACCTGTTACC GATCAGCACG CGTCTGCTCT GGCAACCCGA TGAAACGCGT TATGCGGAAA 
022471 TCAGTCGAGA AATGCTGGCA TCCGGCGACT GGATTGTGCC CCATCTGTTA GGGCTACGTT ATTTCGAAAA 
022541 ACCCATTGCC GGATACTGGA TTAACAGCAT TGGGCAATGG CTATTTGGCG CGAATAACTT TGGTGTGCGG 
022611 GCAGGCGTTA TCTTTGCGAC CCTGTTAACT GCCGCGCTGG TGACCTGGTT TACTCTGCGC TTATGGCGCG 
022681 ATAAACGTCT GGCTCTACTC GCCACAGTAA TTTATCTCTC ATTGTTTATT GTCTATGCCA TCGGCACTTA 
022751 TGCCGTGCTC GATCCGTTTA TTGCATTCTG GCTGGTGGCG GGAATGTGCA GCTTCTGGCT GGCAATGCAG 
022821 GCACAGACGT GGAAAGGCAA AAGCGCAGGA TTTTTACTGC TGGGAATCAC CTGCGGCATG GGGGTGATGA 
022891 CCAAAGGTTT TCTCGCCCTT GCCGTGCCGG TATTAAGCGT GCTGCCATGG GTAGCGACGC AAAAACGCTG 
022961 GAAAGATCTC TTTATTTACG GCTGGCTGGC GGTTATCAGT TGCGTACTGA CGGTTCTCCC TTGGGGACTG 
023031 GCGATAGCGC AGCGGGAGCC TAACTTCTGG CACTATTTTT TCTGGGTTGA GCATATTCAA CGCTTTGCAC 
023101 TGGATGATGC CCAACATAGA GCTCCGTTCT GGTACTACGT GCCGGTCATC ATTGCCGGTA GCCTGCCGTG 
023171 GCTGGGATTA CTCCCCGGTG CACTGTACAC AGGCTGGAAA AACCGCAAGC ATTCCGCAAC CGTCTATTTG 
023241 TTGAGCTGGA CGATAATGCC GCTGCTGTTT TTCTCCGTCG CTAAAGGTAA ATTGCCCACC TATATTCTTT 
023311 CCTGCTTTGC ATCTCTGGCA ATGCTGATGG CGCATTACGC TTTGCTGGCA GCAAAAAATA ATCCTCTGGC 
023381 GCTGCGGATT AATGGCTGGA TTAACATCGC TTTTGGCGTC ACTGGCATTA TTGCCACATT TGTGGTCTCC 
023451 CCGTGGGGAC CAATGAACAC GCCGGTGTGG CAAACCTTCG AGAGCTATAA AGTCTTTTGT GCCTGGTCGA 
023521 TTTTTTCGCT ATGGGCATTT TTCGGCTGGT ACACCTTAAC AAACGTCGAA AAGACCTGGC CTTTTGCCGC 
023591 GCTTTGCCCG CTGGGGCTGG CGTTGCTGGT AGGATTTTCA ATTCCTGACA GAGTTATGGA AGGAAAACAT 
023661 CCGCAATTTT TTGTCGAGAT GACACAAGAA TCACTTCAGC CAAGCCGCTA TATTCTTACT GATAGCGTCG 
023731 GTGTTGCCGC AGGTCTGGCA TGGAGCCTGC AACGCGATGA CATCATCATG TATCGCCAGA CAGGTGAGTT 
023801 GAAATACGGC CTTAATTATC CGGATGCGAA AGGGAGATTT GTCAGCGGTG ATGAGTTCGC AAACTGGCTT 
023871 AATCAACATC GTCAGGAGGG GATTATTACT CTCGTGCTTT CGGTTGACCG CGATGAAGAT ATCAACAGTC 
023941 TCGCCATTCC GCCCGCAGAT GCCATCGATC GTCAGGAGCG TCTGGTGCTG ATTCAGTATC GTCCCAAATG 
024011 ATCTGGCTAA CATTAGTCTT TGCCAGCTTG CTTAGCGTTG CCGGGCAGTT GTGTCAGAAA CAGGCAACCT 
024081 GCTTTGTGGC GATAAACAAA CGGCGCAAAC ATATCGTGCT GTGGCTGGGA CTGGCGCTGG CTTGTCTTGG 
024151 TCTTGCCATG GTGCTCTGGC TGCTGGTCTT GCAGAACGTA CCGGTAGGCA TTGCTTACCC GATGTTAAGT 
024221 CTGAATTTTG TCTGGGTGAC GCTGGCTGCA GTAAAACTGT GGCACGAACC GGTATCGCCG CGTCACTGGT 
024291 GTGGGGTGGC GTTCATTATT GGCGGCATTG TGATCCTCGG GAGTACGGTG TAATGGGCCT GATGTGGGGA 
024361 TTATTCAGCG TCATTATTGC CTCAGTTGCG CAATTAAGCC TGGGTTTTGC GGCGAGTCAT CTGCCGCCGA 
024431 TGACGCACTT ATGGGATTTT ATCGCGGCTC TGTTAGCTTT TGGCCTGGAT GCCCGGATAC TGTTACTCGG 
024501 GCTGCTGGGT TATCTGCTTT CCGTTTTTTG TTGGTATAAA ACGCTTCATA AACTTGCGCT AAGCAAAGCC 
024571 TATGCCTTGC TCAGTATGAG TTATGTGCTG GTATGGATTG CTTCAATGGT ACTTCCCGGC TGGGAAGGGA 
024641 CTTTTTCGCT GAAAGCACTA CTGGGAGTAG CCTGTATTAT GAGCGGGTTG ATGCTGATTT TCCTGCCCAC 
024711 GACAAAACAA CGTTACTGAG TTTTCCCTGC CACTTTACAC TGCCGTTCCC ACTCATCGGG GCTATAACTG 
024781 CTTGCCGAGA GGACTTTCAC CGTATGCAGC TTTTCACGAT TAATACAATA AAGCGCATTC TGCAAAGGCG 
024851 AGAGTAAATC CCCCACTTTC ACGGCGAAGT CACTCTTCAC TTCGGCGATC ATTTTTATCG CGCCGCCAGC 
024921 ATCGCAGAGC ATAAGTACAT GTCTGTTATC TTGTTTATTG CAGCACGATT TTTTGACCAG CCATTCCATT 
024991 GCATTATCCT GTTTGCTAAG AGTTTTCACA TCAATTTACA GATTAACAGA TAAACTCTTT ATCAACGGCA 
025061 ATGGAATGGC AGAAATGAGA AGTGAAACGG AGGGTTAATT ATTGCTGACG TTGCACCCAC TCTTTTAGCG 
025131 CCTGACGTGA AATTTTAATA CCGCCGTTTT TCAGCTCCGG CGGCAGAGTT AGCCAGCGCA CCGGTTGTTG 
025201 AAAACGGGCC AGCTTATCTT TCACCCATTC ACTAAGATCA ACGCTCTCGT GGTCATACTC CATCACCGCC 
025271 ACCGGTCGAT GACCAAACTC CTTGTCGGCA ACGGGGACGA TAAACACCTG CAAAACCGCA GGATGTGCAG 
025341 CAATTACGCG CTCGACTTCT TCCGGCTGAA TACCCTCTCC GCCACTGAAG AATAGATTGT CTAAACGTCC 
025411 GACAATGGTC AGCTTGCCAT TATGCATCTC ACCGCGATCG CGCGTAGCGT ACCAGCCTTC GTCATTAACC 
025481 AGTGAAACCA GTTGCCCGTT ACGCCAGTAA CCTTCTGCCA TACTGGCAGC CCGCAGCCAC ACTTCATTAT 
025551 TAACGATTTT CACTTCCCGA CCCGGCAGCG GCGAACCAAC GTCTGCCAGG CCGTCGGCTT CTTTCGCACA 
025621 CACCGTGGAG GCAAACTCGG TCAGACCATA GCCGCAAAAG CAACGAATCC CCTGCTCGCG CGCCTGTTCC 
025691 GTCAACTCGA CCGGGATAGC CGCGCCGCCA AGTAACACCG CTTTCAGGGA AACGGAACTA CGGTTAACCA 
025761 GCAAACGCCA GAGTTGTGTT GGCACCAGTG AAGCGTGAGT ACAGCCTGCC AGCATTTGCT CCAATGGCTG 
025831 TTTATCACGT ACCGTCATCC GCGCACCAGC GTATAACCAG CGCCACATAA TTCCCTGACC GGAGACGTGA 
025901 AACAGCGGTA AAGAGAGCAA CCAATCATCG TGATCGCCAA ACGGAATCAG CGATAACACA CCTTGCGCAC 
025971 TGGCAAGATG GGCCTGATAA GTATGGACAG CGGCTTTCGG CAAACCGGTA GAACCCGAGG TCAACGTCAT 
026041 TGAGCACAGA CGCGTCGGCT GCCACGTAGC GGCATGTGCG CCTTCAACCA GCTGAATGTG CAGCGACGTT 
026111 AATGCCGGAA ACGTGTTTTC CCCATCCGGC ACCAGAGCAA ATTGCAGCGT CAGATTGGGC AGCAATTCTT 
026181 CAAGCAACGG TTGCGGCAGC TGAGGGTTCA CGGGCAACAC CCGCGCCCCG CATTGCAGTA ACGCCAGCCA 
026251 GGCGAGCAGC GTTTGCGGCG TATTCCACGC CCGCAACATC ACGCCGCTGC CCTCAACCAC CCCCTGCACC 
026321 GCAAATCCGG AGGCTAATTC ATCGACGCGA GCACAAAGCT CGCGCCAGTT GAGTTGCTCG TCATTAAGAC 
026391 GTAAGGCGAT GGTTTCTCCC CGCACTTGCC GCCAGTGACG CCACGGCCAG TCAGAGAAGA TCATAACAAC 
026461 CGCTCCAGTG CATCAACTTC CACGACAGGC AGCGTGCTAC CCGGCCAGCG ACGTACCTGC TGCGCCTGCA 
026531 TCAGATCCAG CGTGTCCAGC CCTGGAATGG TGTCCGGCGT TAACCAGGCG GCAATCCGCG CCAGTTGCGT 
026601 TAAGCCTAAG CTCGATTCAA TGGAAGAACT GATCACCGCC GTCAGCCCCA GCGCGTGCGC CGCCTGTACC 
026671 TGCTCGCGTA CTTTTTCCAG ACTGCCCGTG AGCGTGGGTT TGATAACTAC CGCGCGCACG CCCTCTTCAG 
026741 CCACAAAGGC AAAATCCGGC TCGCGCAGGC TTTCATCCCA GGCAATGGCA ATGCCGGTTT CACGGGCAAA 
026811 CGCTCGCGAA TCATCGCGGG TTTTGCACGG CTCTTCGAGA AACGCGATGC GGTCGCGATA ATCCGGGTTA 
026881 ACGTATTTGG CAAACTGCTG ACCTTTCAGC GGTGTCCAGG CGCGATTTGC GTCAAGACGC AAATGCAGAT 
026951 CCGGAATTGC CTCCAGCAAC AGATTCACCA CCATGCCGTC GCGCACCGCT TCGTACAATC CCACTTTGAC 
027021 CTTCGCCACT TTCTCGCCTG GCATATCTGC AAGTTTGAGG ATCAGATCGT CCGGATCGCC ATTACACAGC 
027091 GGTGCCGCAC GGTAGTTGGC TGCTTGCGGC AACGTATCTG TCAGTTCTGC CAATGCACAG CTTACGCCAA 
027161 AGGCCACGGA AGGCATCTGC GGTAGCTCGC AATCGCCTGC CAGCCAGTTA TTTACCCAGG CAAGCAGCAC 
027231 ACTTTGCGCC TCTTCCCAGG TTTCCTGACT GAAGCCCGGC AGTGGGGAGA TCTCCCCCCA CCCTTCGCGC 
027301 TCGCCTTCAC GCAGGCAAAC ATACAGCCCG TCGCGGGTTT TTAACCGCCT GTCGCGCAGA ACCACCCCCG 
027371 CGTCCATGGG GATCTGCCAG CGGTATACCT GCGCGCTACG CATTACGGAT TCCGTTTGAA TTTGCTGAAG 
027441 TCAGGCTGAC GTTTCTGGTT GAAGGCGTTG CGACCTTCCT GACCTTCTTC CGTCATGTAG AACAGCATGG 
027511 TGGCGTTGCC CGCCAGCTCC TGCAGCCCCG CCTGCCCGTC ACAGTCGGCG TTCAGTGCAG CTTTCAGGCA 
027581 GCGCAGCGCC ATCGGGCTGT TTTGCAGCAT TTCGCGGCAC CAACGGACGG TTTCTTTTTC CAGATCCGCC 
027651 AGCGGTACCA CGGTGTTCAC AAGGCCCATA TCCAGCGCCT GTTTTGCGTC GTACTGACGG CACAGGAACC 
027721 AGATTTCACG CGCTTTTTTC TGCCCGACGA TGCGAGCCAT GTAGGAAGCG CCCCAGCCGC CGTCGAAGGA 
027791 ACCGACTTTC GGGCCAGTCT GACCGAAGAT GGCATTATCT GCCGCGATAG TCAGGTCGCA CATCATGTGC 
027861 AGAACGTGAC CGCCGCCGAT GGAGTAGCCA GCCACCATCG CGACAACCGG TTTCGGACAG GTACGGATCT 
027931 GACGCTGGAA GTCCAGCACA TTCAGGTGAT GTACGCCGGA ATCATCTTTA TAGCCGCCGT AATCACCACG 
028001 CACTTTCTGG TCACCACCGG AGCAGAACGC TTTATCGCCT GCACCAGTCA GAATGATCAC GCCGATGTTG 
028071 TCGTCATAAC GCGCATCTGC CAGCGCCTGG ATCATCTCTT TTACCGTCAG AGGACGGAAG GCATTGCGCA 
028141 CCTGCGGACG ATTAATGGTG ATTTTTGCGA TACCGTCGGT GGATTTTTCA TAACGAATGT CCTCGAAACC 
028211 TTCGGAGCAG TCGTGCCATT CAACCGGTGC GTAAAGCATT GCTTCATCAG GATAAATCAT ATTGTGTCCT 
028281 TTAGTCAGAA ACGCAAGATC TGCGCCAGAC TTGCGATTAC GCCAGCGGGA TTTTCCCGAT GCGCGTTATG 
028351 TCCGGCGCGA GGAATGACAT GGCAGTCGGC AGCCAGTTCC GCCGCCAGGG CGCGGAATTT GCTGTCACGT 
028421 TCACCACATA AATAATAAAA CGCAAATGTG CGGGCGCTAA GGTTAGCACG TAAATCAGGC TGGACGGCGA 
028491 GAGAAGTCGC CTCCAGCATG GCGGCAAGCG TTGCGCCATT ATTGTTGCTG CGCAGCGCCA CCAGCTCCCG 
028561 GCGTTGATCG TCATTGAGTG AGGCAAAAAC AGGCTGTTGA TACCAGTCGG CAAATACCGC CGTTAACGGT 
028631 TCTGTGAGAA AACGCTGCAC CCATTGGCGA TCGGAACGCT GACGTTCCGC ACGTTGTTCA GCATTTTGCA 
028701 GCCCCGGATG CCCGCCTTCG ACAATAACCC CACAAAGCCC CGCCAGCCCC TGGCAAGCCG CCATCATCGC 
028771 CACCCGTCCA CCAAGCGAGT ACCCCACCAG CCAGAAGTCA AGGATGTTGT AACTAACCAA GGTTTTACGC 
028841 AGTAAGTCGG TGACATCATC AAATCCATCG ACGCTAATCG CCGCCGAACC ACCGTGACCT GGGAGATCAA 
028911 CATACAACCG TGAGTAGTCG GCAAACGCCT CGCCCACTTC TTGCCATTCG TGGCAATCGC CGGAAAAACC 
028981 GTGCAAAAAC ACCAGCCAGG GTAAACCTGG TTTTCCGTGT TTTGCCTGCG CGTGCAGGAT CATAAATGGC 
029051 TTACCTGCGC CAGAAGTTGC TGGAGCGTTT GCGCACCATC GGTGTCGTTA ACCACCATTT CAATCACCGT 
029121 GGTGGTTGGC GTGCGCCAGG CGTCGGCAAA TGCCGTTTCA AGTTCCTGCC AGTTTTGCGG ACGATGATAT 
029191 TTCAGCTCGA ACATCGCGGC GGCGTGCTCA AAATGGACGT TTTGCGGCAT CAGATAGAAA CGCTCACGCT 
029261 CGCTTTGCGG CGTTGGCAAC AGCGAGAAAA TTTGCCCGCC GTTGTTGTTC ACCACAATTA ATACCAGCGG 
029331 CGCAGAAACC TGACGCAATA ACGCCAGCGC GTTGAGATCG TAAAGTGCGG AGAGATCGCC CACAATCGCC 
029401 AGCGTCGGTT TGCCGCTTGC CCGCTGAACG CCGGCGGCGG TCGAAAGCAG CCCGTCGATA CCGCTGGCCC 
029471 CACGGTTGCT GTACACCGGG TAACCTGCCG GAAGTTGCGA AAGCGCATCA ATCAGACGTA CCACCAGGCT 
029541 GTTACCAACA AACAATTGCC CCTGTTCAGG CAGATAGTCG CAGATGCGAT GCGCCAGTTG CGCTTCGCCA 
029611 AACGCATCAC GGCGGGCAAT AACCGCCTGC ATTGCCTGTT CCGCCAGGCG CGGGATTTCA ACGCACCAGG 
029681 GCTGGCGTTT TTCTGCCGGA TGCAGCTCCA GCCAGTCGGC AATATTGGCA ATTAAGCGAC GTCCGCGATG 
029751 GTGTGCCGGA TCAAGTCGCC CTTCAATGTC ATCAACAATC CAGTACTCTT CTGGTTCACA GCTTGCCTGC 
029821 CATTGCAGGA GCCGTTTCCC CGTCAGGCTG CTTCCCAGTT GCACCACAAT TTGCGCCTGC TGCAGCTCGC 
029891 TGGTCGCTTT GGCATTGCCT AACCAAAGAT CGGCACACGG CAGCGGCTGC CCGGTTTGTG ACAGCACATC 
029961 GCCAATCAGC GGCCAGCCAA GAGTTTGCGC CCACAGGGCA ACTTTTTTGC CCTCTTCCGC ACTCATGCGC 
030031 CCGGCAACCA CCACGCCGCG CTTTTGTCGC CAGAAGAACC AGTCGCGCTG TTTTTCACTT TCCAGACGAG 
030101 GCGCTTCACG CAGCCACGGT TTGTCGTCCT GCCACCAGTC ACCCAGACGC TGTTGCCAGC TAAGCCCGGT 
030171 ATCGTCCATT TCGCCATACA GCGGTTCAGC AAACGGGCAG TTGATATGGA CTCCCCCCGC ATGAAGCGTA 
030241 CCGAGAGCGT GGTCGATGGT AGAAACCAGC CAACGTGCGG GGATATCCTG GGTCGGGCGC GGCAATGAAA 
030311 TACTGTGCGT GGGGTGAGAG GCGAACATTC CCGGCTGGCG AATTGCCTGA TTCGCGCCGC AGTCAATTAG 
030381 CTCCGGCGGG CGATCGGCGG TTAAGAGAAT CAGTTTTTCT CCGGTTAACC CGGCTTCAAT CAGTGCCGGA 
030451 TAGAGATTTG CCACCGCCGT GCCGGAGGTC ACAATCACCG CCACCGGCTG CTTGCTGACT TTCGCCAGCC 
030521 CCAGCGCCAG ATGCCCCAAC CCACGCTCAT CGAAATGGGT GTGGTGAATG AATGCGGAAT TCTCCGCCGC 
030591 CGCTAACGTT AACGGTGTAG AACGCGAGCC TGGGGCGATA CAGATGTGTC TGACGCCGTG ACGCGTTAAT 
030661 GCTTCCAGAA TGACCGCCGC CCAGCGTCGG TTAAATGCGC TTACTGACAT GAGTTTGTCC GGTATCAATA 
030731 TTGCGGCTAA GTATAAGGAG CTACAAAAAT AGATTATTGA TATGAATCGG TAATGATGCG ACTCATTACT 
030801 ATTCCATTTG TAATAAAGTA CGCAGCCCTG CCGCTTTGTT GTCGATTTCC TGCCACTCTT GCTCGGGGTC 
030871 GGAACCACGG ACAATGCCCG CGCCAGCATA TAATCGCACG ACATTGCCGC TAATTTTTGC TGAGCGCAGG 
030941 GAAACGCAGA ATTCGCTTTG TTGTAATGAG AGATAGCCCG CAGAACCGGC GTACCATTCT CGGGTGAACG 
031011 GTTCGTGACG GGCGATAAAC TGTCGCGCCA GATCGCGCGG TAAGCCAGCA ACTGCTGCCG TTGGCTGCAA 
031081 CTGATGTAAA CAGATCACAT CATCCGCTTT GTTGAGTGAA GTCCAGATAC AGCGGCGAAG ATGCTGCACT 
031151 TTACGCAGAC GCAGTACCTG CGGCGGTAAA ACATCCAGCG TCTGGGTATC GGCCTGTAAT CGTTGACAGA 
031221 TATCTTCCAC CACCAGCATG TTCTCGCGCT GGTTTTTATC ATCCGCCATC AGCCACTCTC CTAACTGCTG 
031291 CGCCTGCTTA TCATCAGGAT TATTTGCTAC TGTTCCCGCC AGCGCTTCAG TACGCAGCGC TTTGTCACGC 
031361 CGCCGCCATA ACCGTTCCGG TGAAGAGCCA AGAAAAGCAT TTTCGCCATC AAAGGCCATG TAAAAATGGT 
031431 AGCAATTCAG ATTCAGTCGA CGACTGGCAG CCATCATCGC CGCCGCGTTG ACCGGACTTG CGAAATGCAG 
031501 GTCAGTTGCC CGAGCGAGCA CCACTTTGTC GAGCTCACCT TCGGCGATGG TTTTCGTTGC CAGTTCGATT 
031571 AATTGCGTCC AGCCCGTTTT GTCCGGCCAG TGTTGTTCTC GCGTGGTGGT TAAATGTAAC CCAGGCAAGG 
031641 GCTTGATACT CACCAGTGTG GCGATAAATT CTTTTGCCTG AATCGCATCG TGCTGAAGGG AGCTTTCGCT 
031711 GAATAGCGTC AGCCGCAGCG TGGCTTTACC GCCACAGCGT CGCCATTCCA GGCGGGGTAA AAGTAAATTG 
031781 CCCTGCGACG GGTCAAAAGC ATTCAGCCCC CAAATGCGTA AGTCGGCGTG TTCCGGGTGC TGGCGAAGAA 
031851 AACGTTGTGC CTGGTCCAAC GACGTAAAAC GGGTAATCGC GCCCAGGACG ACAGCTTCTT CATCACCATT 
031921 ACGTTGTTGC CAGTAGAATT GCGGGTATGT TTGCTGACTG GCCAGCCAGC TCAAGGCATC AAAAGCGTCT 
031991 TTGAGAGGGA AAGGAATATC GATAACCCGA ATGCCGGGTG TCGCCGGAAT CTCTTGCGAC AAATGGCGCA 
032061 GTAGATTTTC CAGCGCCGTA GTAAGTGATT GCACGCGGAC CTCTCCCTGT TAAAAGCCTC ACATTATACG 
032131 GGGTACTACA AAAAAAATGC AGTACCCCGG TGTAGGGAGG TTTTAACGGC GTGCCAGCAA CAGTCCTAGT 
032201 ACCAGCCCAA CGGCCGCGCC CACACCAATT CCTTGCCAGG GTTTTTCGTG GACGTAGTCA TCAGCACGAT 
032271 AAACTGCCTG CTTCGCCCGA TAGTAATAAC TGTCTGAAGC CTGGCTAACC CGTTTTTTCA CATCATCCAG 
032341 CGCTTTTTCT GCACGCGCTT TCAGCTCAAC ATATTTCTGA TCGGCGGGAT CGCCAGAGGA GCGGAGCACC 
032411 TCTTCCAGTG TTTCACTAAG CAGCGTCAGG TCGTCATCGA TACGTGTATC ACCAAACTGA TTAGACATTC 
032481 TCGTTCTCCA TTTGCGTAAA ACCTGTCACT AACTATAGAC AAGGGTTGTT GATTACGCCT GAATTACCTC 
032551 GCGTGCCATC CCAATGTGTG GGATACCATC TTCTTCATAG ACCTCCGTCA CAGGGATAAA ACCGAAACTC 
032621 TGGTAGAAGT TTTGCAGATG CGCCTGCGCC CCGAGGTAAA CAGGCTTATC AGGCCAGTGA TGCGTACATG 
032691 TTTCGAGTGT TTTACTCATC AGCTGCTGCC CCACTTTTTC GCCACGCAAC GCTTCACTGA CAATCACCCG 
032761 ACCTATAACG ACCGGCTCAA GATCATCATC ACTTTTCAGA ATCCTCGCAT ACGCCACCAG TTCATCATTT 
032831 TTCCAACCGA GAATATGGCG ATTATCCCCC GTCAAATCAT CACCATCGAT ATCCTGATAA GGGCAATTCT 
032901 GCTCGACAAC AAACACCGCG CAACGCAGTT GTAATAAGGC ATAAAGCTGG GAAACCGATA ATTCAGAGTG 
032971 ATGCAGATCT TGCCATTCAA TCATAATGCT CTCCTTTTAG ATGTATGCCT TATACTAGCC GGAATATTTT 
033041 TTGAAACGTG ATGAACTCAT GGAATTAATT TTTTTAGGTA CTTCAGCCGG TGTGCCAACC CGCACGCGCA 
033111 ATGTCACGGC AATATTGCTT AACCTGCAAC ATCCGACCCA GAGCGGACTT TGGTTGTTTG ACTGCGGTGA 
033181 AGGCACCCAG CATCAGCTAC TGCATACCGC CTTTAACCCT GGAAAACTGG ACAAGATTTT TATCAGTCAC 
033251 CTTCATGGCG ATCATCTTTT TGGTTTACCC GGCTTGCTGT GCAGTCGTTC TATGTCAGGC ATTATCCAAC 
033321 CCTTAACGAT TTATGGTCCG CAAGGTATCC GTGAATTTGT GGAAACCGCG CTGCGGATTA GCGGCTCATG 
033391 GACCGATTAT CCGCTGGAAA TTGTCGAAAT TGGCGCTGGC GAAATTCTCG ATGATGGCCT GCGCAAAGTA 
033461 ACCGCTTATC CGCTGGAACA CCCACTGGAA TGTTATGGCT ATCGTATTGA AGAACATGAT AAACCGGGTG 
033531 CATTAAATGC CCAGGCATTA AAAGCTGCTG GCGTGCCGCC TGGCCCACTG TTTCAGGAAT TAAAAGCGGG 
033601 CAAAACAATC ACGCTGGAAG ATGGAAGGCA GATTAACGGC GCAGATTACT TAGCTGCTCC AGTGCCAGGT 
033671 AAAGCGCTCG CTATTTTCGG CGATACCGGC CCCTGCGATG CCGCACTTGA CCTGGCTAAA GGTGTCGATG 
033741 TCATGGTGCA CGAAGCGACG CTGGATATAA CCATGGAAGC CAAAGCCAAT AGTCGCGGCC ATAGCTCTAC 
033811 ACGCCAGGCT GCGACACTAG CCCGTGAGGC TGGAGTCGGC AAGCTAATCA TTACCCACGT CAGCTCGCGC 
033881 TATGATGACA AAGGTTGTCA GCACCTGTTA CGTGAATGCA GGTCAATTTT CCCGGCGACT GAACTGGCGA 
033951 ATGATTTCAC CGTGTTTAAC GTTTAACTCT GCTTATTATT AAAAACAGGG CGAAACTTGC CCTGTTATCG 
034021 CAACCCGCGC TACATATATC CACCCACACA GGCATATTGA GCGATTTTTG ATATTTATTC ATCTCCTTAC 
034091 GCACTATATT CAGAGCAATA AGTTGCCTCT TTTCATCTTG ATTCAGCACA ACCTTTGCAA CTAAAAGGAG 
034161 CCCATGATGG TTACAGTTGT CAGCAATTAT TGTCAATTAT CTCAAACGCA ACTCAGTCAG ACATTTGCAG 
034231 AAAAATTTAC TGTGACCGAG GAATTACTGC AGTCTTTAAA AAAAACAGCG TTATCCGGAG ATGAAGAAAG 
034301 CATTGAGTTA CTGCATAATA TTGCGTTAGG TTATGATAAA TTTGGGAAAG AAGCTGAAGA TATTCTTTAC 
034371 CATATTGTTA GAACCCCAAC AAATGAGACC CTATCGATTA TCCGACTTAT CAAAAATGCT TGTTTAAAAT 
034441 TATATAATCT GGCACATATC GCAACCAACT CCCCCCTCAA ATCACATGAT TCAGATGATC TCCTGTTCAA 
034511 AAAACTATTC TCCCCTTCGA AATTAATGAC AATTATCGGT GATGAAATTC CTCTTATATC TGAAAAACAG 
034581 TCGCTTTCAA AGGTGCTTTT AAATGATGAG AATAATGAAC TGAGTGATGG TACAAACTTC TGGGATAAAA 
034651 ATCGTCAATT AACCACAGAT GAAATAGCTT GCTATCTTCA GAAGATCGCC GCTAATGCAA AAAATACTCA 
034721 AGTCAATTAT CCTACTGGTC TCTACGTCCC CTACTCCACC AGAACTCACC TGGAAGACGC TCTCAATGAA 
034791 AATATTAAGA GCGATCCATC ATGGCCGAAT GAAGTCCAGT TATTCCCCAT AAATACTGGC GGACACTGGA 
034861 TATTAGTTTC GCTACAGAAA ATAGTAAATA AAAAAAATAA TAAACTACAA ATAAAATGCG TCATATTCAA 
034931 CTCATTGCGT GCACTAGGCT ATGATAAAGA AAATTCACTT AAGCGTGTCA TTAATAGTTT TAATTCTGAA 
035001 CTCATGGGAG AAATGTCGAA TAATAATATA AAAGTTCATT TAAATGAACC AGAGATAATA TTTTTACATG 
035071 CCGATCTTCA GCAATACTTA AGCCAAAGTT GCGGTGCATT TGTGTGCATG GCAGCCCAGG AAGTGATTGA 
035141 ACAAAGGGAA AGCAATTCTG ACAGCGCCCC CTATACGTTA TTAAAAAACC ATGCTGACAG ATTTAAAAAA 
035211 TATTCAGCAG AAGAGCAGTA CGAAATTGAT TTTCAACATC GACTGGCAAA CAGAAATTGT TATTTAGATA 
035281 AATATGGCGA TGCAAATATC AATCATTATT ATAGAAACTT AGAAATAAAA CACTCACAAC CCAAAAATAG 
035351 AGCATCCGGC AAAAGAGTGA GTTAACATCA TTGTTAATTA ATTCGACCAG TCAGCAAATA TGCTGACTGG 
035421 TCGAACATAG TTTGCTAAAC AGTCATCACT GACTGATGTC AGTCACACCA TCCGCCAGTT CAATCAGGCG 
035491 AATAAATTCC GCCCTGTAAC CCTGTGGATC TTCCCCTTTT GCCTGCTGAG CCCACTGTTT GATCTGCTGC 
035561 CAGGAGGTAT TGTTCAGGTA TTCAGAACCG CGTAACTTTT GCCCATATGC AGCTACTGCT GCGCGAAAAC 
035631 GCATATCTTC AGAGGGCGCG TTTATTGTTG GCCCCAGCGG GAATTCAACT AACTGACTTT CTTTTCCCTG 
035701 CGGGTATTTC CAGCGAATTT TTAACCAGGC CAGTTCTTTC GTTTTGTCCG ATTTCGCTAA TTTGTTATCC 
035771 GGGGCATAGC GTAACTTATC AATTGATGCT TTTTGCCCGT TCAGCGTTAA TTCGAATAAC AACGTTATAT 
035841 GTTTGCCTGC GCCTATATCC CCTGCATCAA CGTTGTCGTT ATTAAAATGT TCCACCCGAA GTTGGCGCTT 
035911 TTCATAACCA ATCTGACGGT ATTCCGTTAC CCACGCGGGG TTAAACTCAA TTTGCGCTTT GACATCTTTT 
035981 GCTACGGTAA TCAACATCTG CCGCATTTCA CTATTCAATA CTTTCTGCGC TTCAGAGAGG GTATCAATGT 
036051 AGCTGTAGTT GCCGTTACCA ACATCGGCAA TTCGCACCAT CATTGCCTCG TTGTAATTGC TATTCCCCAC 
036121 GCCAAACGTC GACAGAGTAA CACCAGACTC CCGCTGTTTT TTGACCATTG ATTCAATCGA TTTTGGATCG 
036191 TCAATGCCAA CGTTAAAGTC ACCGTCAGTG GCTAATAAAA TGCGATTGAT GCCGCCCTTA ATAAACCCCT 
036261 TCGTCGCCTG CTGATAAGCC AGTTCCAGCC CGGCACCGCC ATTGGTACTG CCTTCGGCAT CCAGCGAATC 
036331 AATTGCGGCA TTAATTTCCG CCTTATGACT CCCGGAGATA GAAGGCAATG CAATACGGGA GTCGCCAGCG 
036401 TAGGTCACGA TGGCAATGTT ATCCTGCTCA CGAAGTTCTT TGACCAATAA TTTCAACGAA GACTGGATAA 
036471 GTGGCAAACG TTCATCAGAA ATCATTGAAC CAGAAGTGTC GATAAGAAAG ACCAGATTAG AAGCTGGTAA 
036541 CTCTTCACTT TTGCGATCTT TCGCCAGGAT ATCAACTTTC AGCAATGTTC GCTGTTCATT CCATGGTGCA 
036611 GGTGCCAATT CGTAGCGCAT AGCGAAAGGT ATTGGCTTAG AGGCCGGAAT AGATTGTTTG TCTTTGATAT 
036681 CCCAATCAGA CGGGAAATAA TTGACTATCT CCTCCACCCG CACAGCGTCT GGCGGAGGTA ACAGCCCTTG 
036751 ATTGAGGAAA CGCCTTACAT TCGCATAACT GCCAGTGTCA ACGTCAAGAC TAAACGTCGC CAACGGATTT 
036821 TGCGCTACCT GCTTAACCGG ATTATCATCG AACTGCTGGT AGCGAGCGGT TCCTGGATTT GCGATATGTG 
036891 TAGCTTTTGC TTTAGCCGCT CTTGCAAATG TTGGCGCTTC CTGCAATCGC CCCTGTAAAG CCTGTTTGTC 
036961 TGAATATTGT TGCACTTCTT GCTGGGCCAA GGCTTTCGCG GCGGCGGCGC TTTGCTCAGC CTCTTTTATT 
037031 GCAGCTTGCT GCGCGGCAAG CACTTGCTGC TCTGTGGGAG TACTGGGTTG TTGTTGCTGA CTTTCCTTAT 
037101 TCTCAGGTTG CGGCCCACAT CCTGACAAAA TCAAACTACT CATAAGCAAC ATGATTATAT TTTTATTTCG 
037171 CATATAAAAT CCTTTTAAAT AAACTCAGGC ACCAGACATA AAATATACTC TTTGTATAAT CCTGCTAATC 
037241 TTAATAAAAT ACAATATCGA AACCCATAGC AAATAATGAT TCAACAACGC AACCCATTAA TAATTTGCAT 
037311 ATGAAAAAAA TAATCTTTGC TTTTATTATA TTATTTGTGT TTTTACTCCC TATGATTATT TTTTACCAAC 
037381 CCTGGGTCAA TGCATTACCG TCAACGCCCC GACACGCAAG TCCTGAGCAA TTAGAAAAAA CAGTTCGTTA 
037451 TCTTACACAA ACTGTGCATC CACGTAGTGC CGACAATATT GATAATCTGA ATAGGTCCGC AGAATATATA 
037521 AAAGAGGTCT TTGTCAGTAG CGGTGCCAGA GTTACCTCGC AGGACGTCCC CATTACGGGT GGCCCCTACA 
037591 AAAACATTGT TGCTGATTAT GGTCCTGCCG ATGGACCGCT GATTATTATT GGTGCGCATT ATGACTCTGC 
037661 CAGCAGTTAT GAAAACGATC AATTGACCTA TACGCCGGGC GCGGATGATA ACGCCAGCGG TGTGGCAGGA 
037731 TTACTCGAAC TGGCACGTTT GTTACATCAG CAAGTACCGA AAACAGGCGT GCAGCTGGTC GCCTATGCGT 
037801 CGGAAGAACC GCCCTTCTTT CGTAGCGATG AAATGGGGAG CGCGGTGCAT GCAGCTTCGC TTGAGCGTCC 
037871 AGTGAAATTA ATGATAGCAC TGGAGATGAT TGGCTATTAC GACTCTGCGC CTGGAAGCCA GAATTACCCT 
037941 TACCCGGCAA TGTCCTGGCT TTATCCCGAT CGGGGAGACT TTATTGCCGT GGTCGGCAGA ATACAGGATA 
038011 TCAACGCCGT TCGTCAGGTA AAAGCGGCAT TGTTGTCATC TCAGGATTTA TCTGTTTATT CTATGAATAC 
038081 CCCAGGGTTT ATTCCCGGTA TTGATTTCTC TGACCACCTG AATTATTGGC AACACGATAT TCCCGCCATA 
038151 ATGATTACTG ACACCGCTTT TTATCGTAAT AAACAATACC ACTTGCCCGG TGATACCGCA GACAGATTGA 
038221 ATTATCAGAA AATGGCTCAG GTAGTGGATG GTGTTATAAC TTTGTTATAC AACAGTAAAT AATAAAAATT 
038291 TCTCGAGGCG GGTCCAGAAA AAGCGACATG CACATTTTAT TTTCCCTCAT CTGTTTTAAG ATGCGAAACA 
038361 TGAAATTCAA CGGAGGAAAA ATAAATGGGA ATGATTGGCT ATTTTGCAGA AATTGACTCA GAAAAGATTA 
038431 ACCAACTGCT TGAGTCTACT GAAAAACCTT TGATGGATAA TATACATGAC ACGCTTTCAG GATTACGCCG 
038501 ACTGGATATT GATAAACGCT GGGATTTTTT ACACTTTGGG CTGACAGGCA CCTCTGCTTT TGATCCCGCG 
038571 AAGAATGATC CGCTGAGTCG TGCCGTGCTT GGTGAACACA GCCTCGAAGA TGGCATAGAT GGCTTCCTTG 
038641 GATTGACCTG GAATCAGGAG TTAGCCGCGA CAATCGACCG ACTGGAATCA CTGGATCGAA ATGAACTGCG 
038711 TAAACAGTTT TCCATTAAGC GACTCAATGA AATGGAGATT TATCCGGGAG TGACCTTTTC AGAAGAGTTA 
038781 GAGGGGCAAC TCTTTGCCTC GATCATGCTT GATATGGAAA AGCTGATTAG CGCGTATCGA CGTATGCTGC 
038851 GACAAGGGAA TCATGCGCTG ACGGTTATTG TTGGGTGATA TAGCTTGATG CCTGGGGGAG AAAGACCCAT 
038921 TAGTTAAGAT TTACGCCAGG ATCATCTTGA AAAAATCTTT AACCATGGTC CGGTTTTTAT CCCCTTGTAT 
038991 AAATATTACT AAATGCTTGC TTAGTCGCAT TGTTAAATGC AATACCGTAT ATTCGGTATG TAACAGCGAT 
039061 ATCCTCTGTG CTGGCAACGA TCTGTCATGC TTGATGAAAA CGGAATTGAA CCTGTCATTA CCAGGTAGAT 
039131 AAAAAGCCTG TTCAATTTTG GGATTATTTT TTATAACTCG TGTCTGTTAT GGCGACACGG GAAAACATCA 
039201 ATATTGTCCT TCACAAATTG CAGTAATATA GAATCAACCT CTCTTGCAAG TTGGTCACAA TGTATTATAA 
039271 GCATTTTGAA TATGTCATCC TCTGTAATCT CGTGAAAATT TTCGGCCTTG TCTTTTAGCT CATCATATCG 
039341 GATTCTTGCA GTAACCATTT TTTGGGCGAG TTCTAATAAC CCCAAAGCTT GCAATTGCTG GTGAGTATGA 
039411 TCACTTTCAA AAAATATCCC ACACTCCATT CCTTCCCAAC CAACATATTC ATGCCATTCA TAAACCAGCA 
039481 TAAATGTTTG TAAAACTGGC GGTAATAATT GGATATCTGC AAAACCAAAC CAAAACTTAC GCTTGAGATC 
039551 CCACTCATAT TCAATCGCCA ATGCTATATT GTTTAAGGCA TCTCCGGCAT CCTTATTTTT ACGCAAAATC 
039621 AATTCCGTCA GTGTATAGCG TTGTTCATCA ATACGCCGAA GAGCTTCTGC AATATCATAG TTTGTAGCCA 
039691 ACAAAACATT CTCTGCTTCC TGATGAGTGA CGTCTGCTTT TGCCGTCAAT ATATTGATTT GGTCAATATG 
039761 AAACAACTTG ATGGCTTCAT CAACATCACC GCCAGTCCTC TCTAACAAAC GTCTGGCAAC CTGGATACCG 
039831 ACAGGTACGT TCTTCCGAAG TTTACGAATT TCACTTAACC ATTCCATGTC AAACCCCTTT AAATATTTAT 
039901 GATATTAAAT ATAACAACGT CTGGATAACG ACCCGGCCTG ACTGAATATC TCACGTTTTC CTGCTTAACA 
039971 TTCATGTTAT GATGCTCTTG AAACTAATAA TACGTATGGA ATTGTCACTA TTTATCTGCT AATGAATTCA 
040041 AACAATGTCA TTCGTTTGAT GAATATATTA TTTCAGGGAA TAATTATGAC ACCTTTAGAA CGCATTACCC 
040111 AACTTGTTAA TATCAATGGT GATGTTAATA ATCCTGATAC TCCTCGTCCA TTGTTATCTC TTGAGGATTT 
040181 TTTTATTGAC AATAATATCC ATGGTTCAAT ATGTTGCAAT GTGATTCCAG AACAATCTCC GCAAGCTATC 
040251 TATCACCATT TTCTGAAAAT ACGTGAGCGT AACAATGTTA GTGATGTTTT GGTAGAAATT ACGATGTTCG 
040321 ATGACCCAGA CTGGCCCTTT AGTGAAAGTA TTTTAGTTAT CACCACTGCT TCACCAGAAG AAGTTCAGAG 
040391 CTGGTTTGTA GAAGAAATTG CCCCTGATGA GTGCTGGGAA GGATGGTCAG AAGATACGGA GCATGGATGG 
040461 GTTGAAGTCC CTGTGGGTAT GCATCCGGTT ACTTGTTGGT GGGATTAAAA CATTTATATA AACAGATAAG 
040531 CGGATGTTTA CATAAATTTT TATGTGAAGG AACATGATGA AACTTATTCC TCGCAGTAGT GATATTTCAC 
040601 CTGGCATTGA TGGAATTTGC CCGGGGCCTT TTCCTCCGAA CGGATTTACC GTACTTACAG ATGCAGCATA 
040671 TGGTAACGGA GACTGTTTCG GTTTGTACTG GCCTATTGGT CAGGAGCATA AACTACCTAT AGTGTGCGAA 
040741 ACGTACCATG ACGAATGGCG AATCGTACCT GCCTTTTCCA GCATTAAGAA GTTCGAAGAA TGGCTGGAAG 
040811 TGAATGATGA TGATCCCCAT GAAAATGGCA TCAGCATCGA AGATCAAGAC TTTGCAGCAA ATCTCTTCCG 
040881 TGTTGCTCGG AAATGTCTTT CAACGGGAAG GCTTGATGAC GCACTGCCAC TGTTACAGCG AGCAACAGAA 
040951 CAATTGCCTG AAGTCAGCGA ATATTGGTTA GCACTGGCAA TCCAGTATCG CCGATGTAAA AAAACAGAAG 
041021 CTGCAGCACA GGCTGCGCTT AATGCTTATC TTGGCAATTG GGCATTTGGT GTTCCTGACA ATAAAGTCAT 
041091 TCATTTGCTG TCACAGGCCG CAGATGTCCC GAATTTCCAG GATGATCCTG TGATTCAGTG CATTAAAGAA 
041161 CAAGGATTAG ATCTTAGCTT TGGAGGAACA AAGGAAAATA ATAATTACCC CTTGATGCAG ATGTGTGTTG 
041231 ATACTTATTT TGCGCAGAGA AAACCGCTTC AGGCATTAAC CCTGTTACAT AATTATGCCT GGATAATGTC 
041301 CAGTGAAACG ACTGCATTTC AGGAACGCTA TGATTTTAAT ATCGATGAAT GGCGGGCAAA ATTCAGGCAG 
041371 TTATGTTTAG AGTATTTTGG CGATAGTCGT ACACAGTTCA CTTAACGCTC TGCGTCTATC TACTATCCCT 
041441 TCTTTTTCAG AAAAACCGCC GAGCATGTCG GCGGCTTTCT GACTTACAAA GTAACAGATT ACATCAGCGG 
041511 C