MG1655
W3110
Search for
Japanese | English
Deletion Report : 2-1
General information
Deletion 2-1  
Location (BP) 3,617,031 - 3,716,336   Go Linear View
Length (BP) 99,306
Related strains
     Strains ME5078    ME5079    ME5115    ME5116    ME5117    ME5118    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer 3616638-C-2-1-Lar  
Sequence AATAAAGAGTAAAAGCCCGAGCGATAAGGACCCAATAATAGACTCAATCT  
3' Primer 3715943-U-2-1-Rar  
Sequence AGATTGAGTCTATTATTGGGTCCTTATCGCTCGGGCTTTTACTCTTTATT  

 Linear View (Whole Mode)
View Location
   3615.0  –  3765.0 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             CGTGCAGCAT TTTGCCGATG ACGTTATCGC 
-00070 CCAGCGCGGC GTGCGGCACG GGCATTTGCA GTGCTTGCCG AAGGAAGATT GAGTCTATTA TTGGGTCCTT 
000001 TGGTGAACGA TCAACAAAGG GCCACTAGCA CACCTGATTC CTCTCTAAAT ACCCTATCCG AACCTTCTCT 
000071 TTTGTAACGT TCTAAATATA TTCCTAAAAA TCTTCAATTC ATTGTGACCA CAAGTTTTTC TTCGCTTTTT 
000141 CGTATGAAGA TACTGTCATT AAAATAATAG AAAAGGATTT TACGATGAGC GGAAAACCGG CGGCGCGTCA 
000211 GGGTGACATG ACGCAGTATG GCGGTAGCAT TGTTCAGGGT TCAGCCGGGG TACGTATTGG TGCCCCCACC 
000281 GGCGTGGCCT GTTCGGTGTG CCCCGGCGGA GTGACGTCCG GCCATCCGGT CAATCCCCTG CTCGGTGCAA 
000351 AGGTCCTTCC CGGTGAAACC GACATCGCCC TGCCCGGCCC GCTGCCGTTC ATCCTCTCCC GCACCTACAG 
000421 CAGTTACCGG ACAAAAACGC CCGCGCCGGT GGGGAGCCTC GGCCCCGGCT GGAAAATGCC TGCGGATATC 
000491 CGCTTACAGC TGCGCGATAA CACACTGATA CTCAGTGATA ACGGCGGCAG AAGCCTGTAT TTTGAGCACC 
000561 TGTTTCCCGG TGAGGACGGT TACAGCCGCA GCGAGTCACT GTGGCTGGTG CGCGGCGGCG TGGCGAAACT 
000631 GGATGAAGGT CACCGGCTGG CCGCACTCTG GCAGGCGCTG CCGGAAGAAC TCCGCTTAAG TCCGCATCGT 
000701 TATCTGGCGA CAAACAGTCC GCAGGGGCCG TGGTGGCTGC TCGGTTGGTG TGAGCGGGTG CCGGAAGCGG 
000771 ATGAGGTGCT GCCTGCGCCG CTGCCGCCGT ACCGGGTACT GACCGGGCTG GTGGACCGCT TCGGGCGCAC 
000841 ACAGACGTTC CACCGCGAAG CCGCCGGTGA ATTCAGCGGC GAAATCACCG GCGTGACGGA TGGTGCCTGG 
000911 CGTCACTTCC GGCTGGTACT GACCACGCAG GCGCAGCGGG CAGAAGAAGC CCGGCAGCAG GCCATTTCCG 
000981 GCGGGACGGA ACCGTCCGCT TTTCCTGATA CCCTGCCGGG TTACACCGAA TATGGCCGGG ACAACGGCAT 
001051 CCGTCTGTCT GCCGTGTGGC TGACGCACGA CCCGGAATAC CCGGAGAATT TACCTGCCGC GCCGCTGGTG 
001121 CGCTATGGCT GGACGCCACG CGGCGAACTG GCGGTGGTGT ATGACCGTAG TGGCAAACAG GTGCGCAGCT 
001191 TTACTTACGA TGATAAATAC CGGGGCCGGA TGGTGGCGCA CCGTCACACG GGCCGGCCGG AAATCCGTTA 
001261 CCGTTACGAC AGCGACGGGC GGGTGACAGA ACAGCTAAAC CCGGCAGGCT TAAGCTACAC GTATCAGTAT 
001331 GAGAAAGACC GCATCACCAT CACCGACAGC CTGGACCGCC GTGAAGTGCT GCACACGCAG GGCGAAGCCG 
001401 GGCTGAAGCG GGTGGTGAAA AAGGAACACG CGGACGGCAG CGTCACGCAG AGTCAGTTTG ACGCCGTGGG 
001471 CAGGCTCAGG GCACAGACGG ATGCCGCAGG CAGGACAACA GAGTACAGCC CGGATGTGGT GACGGGCCTC 
001541 ATCACGCGCA TAACCACGCC GGATGGCAGG GCATCGGCGT TTTACTATAA CCACCACAAC CAGTTAACGT 
001611 CAGCCACCGG GCCTGACGGG CTGGAATTGC GCCGGGAATA TGATGAATTG GGCCGTCTGA TTCAGGAAAC 
001681 TGCCCCTGAC GGCGATATCA CCCGCTACCG TTATGATAAT CCACACAGTG ACTTACCCTG CGCAACGGAA 
001751 GATGCCACCG GCAGCCGGAA AACCATGACG TGGAGCCGTT ACGGTCAGTT GCTGAGCTTC ACCGACTGTT 
001821 CCGGTTATGT AACCCGTTAT GACCATGACC GCTTCGGGCA GATGACGGCG GTGCACCGCG AGGAAGGGCT 
001891 GAGTCAGTAC CGCGCATACG ACAGCCGTGG ACAGTTAATT GCCGTGAAAG ACACGCAGGG CCATGAAACG 
001961 CGGTATGAAT ACAACATCGC CGGTGACCTG ACCGCCGTCA TTGCCCCGGA CGGCAGCAGA AACGGGACAC 
002031 AGTACGATGC GTGGGGAAAG GCCGTCCGTA CCACGCAGGG CGGGCTGACG CGCAGTATGG AATACGATGC 
002101 TGCCGGACGG GTCATCCGCC TGACCAGTGA AAACGGCAGC CACACCACCT TCCGTTACGA TGTACTTGAC 
002171 CGGCTGATAC AGGAAACCGG CTTTGACGGC CGCACACAGC GTTATCACCA CGACCTGACC GGCAAACTTA 
002241 TCCGCAGCGA GGATGAGGGT CTGGTCACCC ACTGGCACTA TGACGAAGCA GACCGCCTCA CGCACCGCAC 
002311 CGTGAAGGGT GAAACCGCAG AGCGGTGGCA GTATGACGAA CGTGGCTGGC TGACAGACAT CAGCCATATC 
002381 AGCGAAGGGC ACCGGGTGGC GGTGCATTAC AGGTATGATG AGAAAGGCCG GCTGACCGGT GAGCGTCAGA 
002451 CGGTGCATCA CCCGCAGACG GAAGCACTGC TCTGGCAGCA TGAGACCAGA CATGCGTACA ACGCGCAGGG 
002521 GCTGGCGAAC CGCTGTATAC CGGACAGCCT GCCCGCCGTG GAATGGCTGA CCTACGGCAG CGGTTACCTG 
002591 GCAGGCATGA AACTCGGCGA CACACCGCTG GTGGAGTACA CCCGCGACCG CCTGCACCGG GAAACGCTGC 
002661 GCAGCTTCGG CCGTTATGAA CTCACCACCG CTTATACCCC TGCCGGGCAG TTACAGAGCC AGCACCTGAA 
002731 CAGCCTGCTG TCTGACCGCG ATTACACCTG GAACGACAAC GGCGAACTCA TCCGCATCAG CAGCCCGCGC 
002801 CAGACCCGGA GTTACAGCTA CAGCACCACC GGCAGGCTGA CCGGCGTTCA CACCACCGCA GCGAATCTGG 
002871 ATATCCGCAT CCCGTATGCC ACAGACCCGG CAGGTAACCG CCTGCCCGAC CCGGAGCTGC ACCCGGACAG 
002941 CACCCTCAGC ATGTGGCCGG ATAACCGTAT CGCCCGTGAC GCGCACTATC TTTACCGGTA TGACCGTCAC 
003011 GGCAGGCTGA CAGAGAAAAC CGACCTCATC CCGGAAGGGG TTATCCGCAC GGATGATGAG CGGACTCACC 
003081 GGTACCATTA CGACAGTCAG CACCGGCTGG TGCACTACAC GCGGACACAA TATGAAGAGC CGCTGGTCGA 
003151 AAGTCGCTAT CTTTACGACC CGCTGGGCCG CAGGGTGGCA AAACGGGTGT GGCGGCGTGA ACGGGACCTG 
003221 ACGGGCTGGA TGTCGCTGTC ACGGAAACCG CAAGTGACCT GGTACGGCTG GGACGGCGAC CGGCTGACCA 
003291 CGATACAGAA CGACAGGAGC CGCATCCAGA CGATTTATCA GCCGGGGAGC TTCACGCCAC TCATCAGGGT 
003361 CGAAACTGCC ACCGGTGAGC TGGCGAAAAC GCAGCGCCGC AGCCTGGCGG ATGCCCTTCA GCAGTCCGGC 
003431 GGCGAAGACG GTGGCAGTGT GGTGTTCCCG CCGGTGCTGG TGCAGATGCT CGACCGGCTG GAAAGTGAAA 
003501 TCCTGGCTGA CCGGGTGAGT GAGGAAAGCC GCCGCTGGCT GGCATCGTGC GGCCTGACCG TGGAGCAGAT 
003571 GCAAAACCAG ATGGACCCGG TGTACACGCC GGCGCGAAAA ATCCACCTGT ACCACTGCGA CCATCGCGGC 
003641 CTGCCGCTGG CGCTCATCAG CACGGAAGGG GCAACAGCGT GGTGCGCAGA ATATGATGAA TGGGGCAACC 
003711 TGCTGAATGA AGAGAACCCG CATCAGCTGC AGCAGCTTAT CCGGCTGCCG GGGCAGCAGT ATGATGAGGA 
003781 GTCCGGCCTG TATTACAACC GCCACCGCTA TTATGACCCG CTGCAGGGGC GATATATCAC TCAGGATCCG 
003851 ATTGGACTGA AGGGGGGATG GAACCTGTAT GGATATCAAT TGAATCCGAT ATCAGACATC GACCCCCTGG 
003921 GTTTATCTAT GTGGGAGGAT GCAAAATCGG GGGCATGTAC TAATGGTCTT TGCGGCACAC TATCCGCTAT 
003991 GATAGGTCCA GATAAATTTG ATTCTATAGA TAGCACCGCA TATGACGCCT TAAATAAAAT AAATAGCCAA 
004061 TCTATTTGCG AAGATAAAGA GTTCGCTGGT TTAATATGTA AGGATAATAG TGGCAGATAT TTCTCAACAG 
004131 CACCTAACCG AGGAGAAAGA AAAGGATCAT ATCCATTCAA TAGCCCTTGC CCTAATGGTA CTGAGAAAGT 
004201 ATCAGCTTAT CATACTCATG GTGCAGATAG TCATGGAGAA TATTGGGACG AAATATTTTC AGGTAAAGAT 
004271 GAGAAAATAG TTAAAAGTAA AGATAACAAT ATCAAGTCAT TTTATTTAGG TACGCCCAGT GGTAATTTTA 
004341 AAGCAATAGA TAACCACGGG AAGGAAATAA CAAACAGAAA AGGATTACCT AATGTCTGCA GAGTTCATGG 
004411 TAATATGTAA AAAAATATTG TTTAGGAACT GTGTCATTGT ATCTTTGTTT GTTTTTACAT ACAACACATG 
004481 GGCGCAGTGT AATAATAATA TTAAAATAAT GCGCAAGTAT GAAAGTGAAG GTAAATATAC CGTTAGAAAT 
004551 TTGGTTAAAA ATAAAGCTAT AGCATTGGAA TTAGCTGAGA TATATGTTAA GAATCGTTAT GGACAGGATG 
004621 CCGCAGAAGA AGAAAAACCA TACGAAATCA CTGAGTTAAC AACAAGTTGG GTTGTTGAAG GTACCATTCA 
004691 CTCAGACCAA ATTGCTGGTG GGGTTTTTAT TATAGAAATA GGCAAAAATG ATGGGAGAAT TCTGAATTTT 
004761 GGCCACGGAA AATAAGTATG TAAGGATAAT CAAACATCGT GTGCGCTGAT GGCAGAGTAG GTGGAGGACT 
004831 CCAGACAGTC AAACGATAGA AAAAGATAGC CTTTATGGAG GTTCCTGCAA TGTCAAATAC ATACCAGAAA 
004901 AGAAAGGCAA GTAAAGAGTA TGGTTTATAT AATAAATGTA AGAAACTAAA TGATGATGAA TTATTTCGCT 
004971 TACTTGATGA TCGCAATTCC TTGAAAAGGA TTTCATCTGC CAGAGTATTA CAGTTAAGAG GGGGGCAAGA 
005041 CGCTGTTAGA TTGGCAATTG AATTCTGCAC TGACAAAAAT TATATCCGTA GAGATATCGG AGCATTTATA 
005111 CTCGGGCAAA TATAAATTTG CAAAAAATGC GAAGATAATG TTTTTAATAT TTTGAACAAT ATGGCATTGA 
005181 ATGATAAGAG TGCTTGCGTT CGAGCTACGG CAATCGAGTC AACGGCCAGG GAAAGATCAT CAAAAGTTCA 
005251 CTTTTTGCAC TAAATAATTC GCATTTTATG TTTAAAAATT GAGATATTCC TTATTACCTG AAGCTGTTTT 
005321 TTATTGCTTA TACATGATCA AATACTCCTT ACCTAATTAA GGAGAACAAA ATGGAACTTA AAAAATTGAT 
005391 GGAACATATT TCTATTATCC CCGATTACAG ACAAACCTGG AAAGTGGAAC ATAAATTATC GGATATTCTA 
005461 CTGTTGACTA TTTGTGCCGT TATTTCTGGT GCAGAAGGTT GGGAAGATAT AGAGGATTTT GGGGAAACAC 
005531 ATCTCGATTT TTTGAAGCAA TATGGTGATT TTGAAAATGG TATTCCTGTT CACGATACCA TTGCCAGAGT 
005601 TGTATCCTGT ATCAGTCCTG CAAAATTTCA CGAGTGCTTT ATTAACTGGA TGCGTGACTG CCATTCTTCA 
005671 GATGATAAAG ACGTCATTGC AATTGATGGA AAAACGCTCC GGCACTCTTA TGACAAGAGT CGCCGCAGGG 
005741 GAGCGATTCA TGTCATTAGT GCGTTCTCAA CAATGCACAG TCTGGTCATC GGACAGATCA AGACGGATGA 
005811 GAAATCTAAT GAGATTACAG CTATCCCAGA ACTTCTTAAC ATGCTGGATA TTAAAGGAAA AATCATCACA 
005881 ACTGATGCGA TGGGTTGCCA GAAAGATATT GCAGAGAAGA TACAAAAACA GGGAGGTGAT TATTTATTCG 
005951 CGGTAAAAGG AACCCAGGGG CGGCTAAATA AAGCCTTTGA GGAAAAATTT CCGCTGAAAG AATTAAATAA 
006021 TCCAGAGCAT GACAGTTACG CAATCAGTGA AAAGAGTCAC GGCAGAGAAG AAATCCGTCT TCATATTGTT 
006091 TGCGATGTCC CTGATGAACT TATTGATTTC ACGTTTGAAT GGAAAGGGCT GAAGAAATTA TGCGTGGCAG 
006161 TCTCCTTTCG GTCCATAATA GCAGAACAAA AGAAAGAGCC AGAAATGACG GTCAGATATT ATATCAGTTC 
006231 TGCTGATTTA ACCGCTGAGA AATTCGCCAC AGCGATCCGA AATCACTGGC ACGTGGAGAA TAAGCTGCAC 
006301 TGGCGTCTGG ACGTGGTAAT GAATGAAGAC GACTGCAAAA TAAGAAGAGG AAATGCAGCA GAATTATTTT 
006371 CAGGGATACG GCACATTGCT ATTAATATTT TGACGAATGA TAAGGTATTC AAGGCAGGGT TAAGACGTAA 
006441 GATGCGAAAA GCAGCCATGG ACAGAAACTA TCTGGCGTCA GTCCTTGCGG GGAGCGGGCT TTCGTAATCT 
006511 TGCCCTGAAT ACAGGACTGA GTATCAAAAA GCCGGTTAAC TGAAACTGTC CAGGTTTTGG GGGTCAGTTC 
006581 ATAAACGCCT TATCCGGCCT AAAAACAACT AAAATTCAAT AAATTGCACC GATGCGTAGT CCCTATAAGC 
006651 TTACGCATCG GGCAATTGTA TTTACGCCAT TGTCCCAATC GTCTTCCTGA ATCGCAGCAG CGCAATGGTG 
006721 AAAAATGCGC CGCCAATTGC CATCAGCGTC AGAAACTGCG GCCAGACGAT TTCGAATCCG GCACCCCGGT 
006791 AGAGGATGGC CTGCGCGAGG CTAACAAAGT GTGTCGTCGG CATGGTCAGC ATAATGTCCT GCACCATCTG 
006861 CGGCATACTT TCGCGCGGCG TGGAACCACC GGAAAGCATT TGCAGCGGCA GCAGCACCAG AATCACCAGC 
006931 AGCCCCAGTT GCGGCATTGA ACGCGCTATC GTCCCCATAA AAATGCCGAT TGACGTGGTG GCAAACAGAC 
007001 TGAGCGCCAC GCCCAGCATA AACAGCGGGA TCGAGCCTTC AATCGGTACG CCCAGTACAC CTTTCACCAT 
007071 CAGCACCAGC GATAATCCCG ATACCACCAG CACCACCAGC CCCATCGACC AGATCTTCGC CATCATGATC 
007141 TCAAACGGCG TTATCGGCAT CACCAGTAAG TGTTCCACCG TGCCGTGTTC ACGCTCGCGG ATCAGCGCCG 
007211 ATCCGGTCAA TACAATCGCC AGCATGGTAA TGTTGTTGAT GATCGCCATC ACCCCGCCAA ACCACGCGGG 
007281 ATCGAGGTTC GGGTTAAAGC GCATCCGGGT TTCCAGCGAT ACCAACGGTT CGCTGTTATC ACGGTAGCGC 
007351 GCGACAAAGC TGTTCACTTC ACCGTTGATA ATATTCTGGA TATACCCATT GCCGGTAAAT GCCTGGCTCA 
007421 TGCGCGTGGC ATCGACGTTC ACCTGAATAT CCGGCTGGCG TCCGGCGAGG ACATCACGCT GAAAATTAGG 
007491 CGGAATATTT ATCGCGAAGG TATAGCGTCC GGCGTCCAGT CCGGCATCCA TCTCATCGGC GGTGATCATC 
007561 TCCGGTGGCA AAAACCACGG ACGATAGAAG CTGTTAACGA TCCGGTTCGA TAACTGCGAT TGATCCATAT 
007631 CGGCAATGGC GATCGGCGCG AGGTTCAACG ATCCTGGCGT AACGGTCGCT GACGAATACA CCGACACCGT 
007701 AAACGAGAAG ACAATCAGCG TCAGCATCGC TTTATCACCG AGCAGACTGC GCAACTCTTT GATACCCAGA 
007771 TTAAAAATAT TGCGTAAATG GCGCATCATC CCTCCTGTTT TTTCAGCAGC AGGATACTTA AGCCCATCAC 
007841 CAGCGGGATG GCTATCAGTA ACGGGATAAA AAGTTGCCAC AAATCAGTCA GATCCAGCGC TTTCGAGAAC 
007911 GTCCCGCGGG CGATAGTCAG AAAATGACTG GTCGGGTAAA CCTCGCCGAT CCAACGTCCA GGCCCTTCCA 
007981 GCGAAGCTAC CGGATCGATC ATCCCGGAAA ACTGTGTCGC CGGGATCAAC GTGATAATCG CCGTTCCGAA 
008051 AATGGCGGCA ATCTGGCTTT TCATAAAGGT GGAGATCAGC AGCCCCATTC CGGTGGCAAT GATGATATAC 
008121 AGCAGCGCCG CCAGGGTGAG CGTCAGGAAA CTGCCTTTAT GCGGTACGCC AAACACAAAC ACCGACAGGC 
008191 CGCAGAGCAG GAAAAAGTTC AGCATCCCCA GCGCGATGTA TGGCAACTGT TTACCAAGCA AAAATTCACT 
008261 ACGCGTGGTG GGGGTCACGT AAAGGTTGAT AATCGACCCA AGCTCTTTTT CCCGCACCAC GCTAAGGGCG 
008331 CTTAGCATTG ACGGGATCAT CATCAGCAGA AGCGGGATCA CCGCCGGAAC AATCGCTGGC AGGCTTTTTA 
008401 CGTCCGGGTT ATAGCGATAG CGCGTCTCAA TATTCATCAG CCCGCTTTGG CTGGCGGGTG TCGATTGTCG 
008471 GCTCGCCACA TCCTGTAACC AGCTCTGGTG CATGGCCTGC ACGTAACCTT TTACCGTTTC AGCACGGCTC 
008541 GGCATCGCTC CGTCGATCCA GACGCCGAGT TCCACAGGCG TACCACGCGC GATATCGCGC CCGAAATTGG 
008611 GCGGGATCTC AATCGCCACC GTGATATCGC CCGCACGCAT CCGACGATCA AGCTCGTCAT AACTGGTGAG 
008681 CGGCGGCTGT TCGATAAAGT AACGGGAACC GGAGAGGTTG AGTGTCCACG CCTGGCTACT GACGGTCTGG 
008751 TCGCGGTCGA GCACCGCAAA GCGCAGGTTT TCCACATCCA TACTGATGCC GTAACCCATT ATCAGCATCA 
008821 GGATCACCGT TCCCATCAGC GCCAGCGTCG AACGTACTGG ATCGCGTCGC AGTTCCAGCG CTTCGCGGCG 
008891 GCTGTAGCTA AACAGACGGC GCAGGCTAAA TCCCTGACGC GGCGCGTGGG TGGTGTCGTG TACCACGGGC 
008961 GGCGCTTCGG CTTCGTTGCT CTGCCCTGCC GCTTCCTGCA AATAGGCGAT AAATGCCTCT TCCAGACTGG 
009031 CGGCTCCGCG TTTCTCAACC AGTTCCTGCG GTGTACCGCT GGCAAGCACT TTTCCGGCGT GCATCAGTGA 
009101 GATGCGGTCG CAACGTTCCG CTTCGTTCAT AAAGTGGGTG GAGATGAAGA TAGTCACTTT GTCCTGGCGC 
009171 GAGAGATCGA CCATCAACTG CCAGAACATA TCCCTCGCCA CCGGATCGAC ACCAGAAGTA GGCTCATCGA 
009241 GGATTAACAT CTCCGGGCGA TGAATCACCG CCACCGCCAG CGAAAGCCGC TGGCGAATGC CGAGCGGCAA 
009311 TGACTCCGGC AGAATATCTT CAACGTCGTT GAGCTTAAAA CGCTCGCTCA TTTCAGCCAC TCTTGCGGGA 
009381 ATTTCCGCTT CCGGGATGTG AAACAAACGG GCATGTAACT CAAGGTTTTG CCGCACGGTG AGTTCGTTAT 
009451 AGAGCGAAAA CGCCTGCGAC ATATAGCCCA CCCGACGGCG GGTATCGATA TCTTTTGGAT CAACCGGTTG 
009521 CCCGAACAGC CACGCCTCAC CTTCGCTGGC GGGCAGCAGT CCGGTGAGCA TTTTCATGGT GGTGGATTTA 
009591 CCGCAGCCGT TCGAACCAAG AAAACCAAAA ATCTCCCCGC GTGGAATGCG GAAATTAACG TGATCAACGG 
009661 CAACGAAGGA ACCAAAACGC ATGGTCAGAT CGCGCGCTTC GATGGCAATC TCTGCGTTTT CAGGTTGATA 
009731 CGGTGGGATC ACTACCGCCT GATGCGCCTG GCGTTGCGCT TGCGGTAACA GATTTATAAA TGCTTCTTCC 
009801 AGCGTAGCGC TTTGCGTTTG CTGCCGTAGC TCTTCGGCGC TGCCAGTTGC CAGCACTTCT CCGGCATTCA 
009871 TCGCTACCAG CCAGTCGAAG CGTTCGGCCT CTTCCATATA GGCGGTGGCG ACCAGCACGC TCATATTGCT 
009941 CTGCCGCTGG CGAATACTGT CGATCAGATC CCAGAACTGG GAGCGGGAGA GCGGGTCAAC CCCCGTTGTT 
010011 GGCTCATCAA GGATCAACAG TTCCGGGTCG TGGATTAACG CGCAGCACAG CCCAAGTTTT TGCTTCATCC 
010081 CGCCGGAGAG TTTCCCTGCC GGACGATCGC GAAACGGTGC TAACCCGGTG CTGGTCAGCA GCTCATTGAT 
010151 TCGCACTTCC CGCTCCGCTT TGTCGTGACC GAACAGGCGA GCGAAAAAAT CGACGTTTTC ATACACCGAC 
010221 AAGGTGTGGT AGAGGTTTTT GCCCAGCCCC TGCGGCATCC AGGCGATGCG CGGGCAGACG TCGCGGCGAT 
010291 GCTTCGGGTC GCGCATATCG CCGCCCAGCA CCATCACATT GCCCTGTTCA ATGACGCGGG CACCGGAAAT 
010361 CAACGACAAC AAGCTCGACT TCCCGACGCC GTCCGGGCCA ATCAGCCCGA CCATACAGCG GGCCGGAATA 
010431 TCGAGAGTGA TATTGTTCAG CGCAACGGTT TTTCCATAAT GCTGGCTCAC GCCCGCCAGT TGCGCGACAG 
010501 GCGGGACGGG AACCAGTTCC AGATGCGTCA TTGCGGCAAC CTCACCACGA GGTCGTCAGG CCACGGAAGT 
010571 TCTTCATTCA CCCGCACCCA CGCTACGCCC GGCAAACCGG TTTTGACATA TTCCAGATGC TGCTGGAGTA 
010641 ATTCCGGTGG GATACGCGCT TTGACGCGGA ACATCAGTTT CAGCCGTTCA TCGCTGGTTT CGACGGTTTT 
010711 TGGCGTGAAC TGGGCGACAC TGGCGACAAA ACTGATGGTT GCAGGAATAC GCAGATCTGG CGCGGCATCG 
010781 AGGATCAGCC GGGCTTCACC GCCCAGTTTC AGCGTGCCCG CCTGTTCGGT TGGCAGGAAG AAAGTCATAT 
010851 AGACGTCGCT GAGATCGACC ATATTCAGCA CCCGACCGCC TGCCGCCAGC ACTTCGCCTG GCTCGGCAAC 
010921 CCGATACTGC ACGCGTCCGT CACGCGGGGC TTTCAGTTCG CTGTCATCGA TATCTGCGGC AATGCGCCGT 
010991 TCAGTGGCTT GTGCCGCTTC GACGCGGGTT TGCGCCTGAA TGATATTGGT GCGTGCCGCT TCTATAGCCG 
011061 CTTTAGAAGC CGATACCTGA GCTTTCGCCG ATTCCAGCGC AGCTCGGGCG CTCTCAGCGG CGGCGCGATC 
011131 GTCATCCAGC TGTTGCGCAG AAATAGCCCC TCGTTGGGCC AGTGAACGGG AACGCGTATG ACGTTTTGCT 
011201 ACGGAGTCCA GTTCTGCCTG GCGTTGATTA ACCAGCGACT GTGCGGCACG AGTTTCGCTT TGTCGTTGCT 
011271 CCAGCAAAGC CTGCGCGGCA GCAACGGCGC TTTGTGCCTC TTTGATTTGC GCGATGGCTT CCAGTCGCTG 
011341 TTCCTGCAAC ACGCGAGTAT CCATCTTCGC CAGCACTTCA CCTTCGCGAA CAAACTTGCC TTCTTTCACC 
011411 AGAATGGTGT CGATACGCCC GGCAATTTTG CTGGCAATAT CCACTTCCGT CGCTTCAATG CGCCCATTAC 
011481 TGACAGCAAA GCCTTCCGGC ACACCTGCCG GGCGCAACAG CCACCACGCC ACGATAGCCG CCACCGCCAG 
011551 TAACCCGACA ACCCACCACG CCAGATGGCG CTTACTCTTA TCCATAATCG ACCCGCCATA ATCCCTGTAA 
011621 GCAAACGACG CGTGTTACAA CTGCCGCCGA ACGACGTTCA GCGGATTCTT CCATCCGGGA TAAGAAGGAA 
011691 ACGGCAAATA CGACCAGCGC GCAGAGCATT GAGCGCCAAC GGGGAAGGCT TAGTGAAAAC GGGTAGTAAT 
011761 GTTGTCATCA TCAGCATTCC TGGCCGTAAA TGAAACACGC ATACTCATAA GTGTGATCTA TAAAACTGGC 
011831 TGACAAAACG GTATCCATCC TGTTGGATAG CGTTTCACGC CTGTTCAGTT GCAGGAACAG AGCATTCCTT 
011901 TTTACGTTTT ATCAACAGTC TCAACCAGAT AGTAACATTA ATATTCATGT TGTCTATGGT TCAGAGCTGT 
011971 AACATTGTGC GCCTTCTAAT CAAAGGCATA AGTCCATTTC TGTTTTTTTC ATGCTGGTAA GACTTCCAGG 
012041 GAGTGGTTAT CTCAGGCCCT GCACCAGGGT TAATTTGGCA ATTATGCATG CTGAACATTC TTCCAGCATG 
012111 TTTACTGTCA CGGGCGTTAA GACCTAAAAC TGTCCCCGTT TCGCCTATGC GTTCTCTTCC ACCATTTCCG 
012181 TTATGTGCAA CAACTTGATT TATACCTAAC ATTTGTGAAC ATGCTAATAG TGCTTCAAGT TTAGGTCTGT 
012251 AATCTGTCGA AACAGAAAAA TAACGATTAA AGGATCGACA AGAGATAGCC CGGCTAGTTT TAAACTTTTT 
012321 GCCATTAATT ATAGCATGAT GCTTTTTATT GATAATTGCC GCTAATTCGA CCGGATCGAG AGCATTGGTC 
012391 ATTTCATCAA TAGAGACTGT TATCGGTCCT ATAATGTAAC GTTTTCGCTG ATCATCAAAA GTTATCCCAT 
012461 GATGATTTGC CATTATTTTG TATTTGGGGT CATAGAAACA TACAGGATAA TCTTTTATCC CAGAGTAGGT 
012531 ATCCTCATCG AGTGGTTTCA TACGCGTGAA GTTCTGCATA TAGTTACCAT TGCAATTCGT TTCATGATTT 
012601 CCAGCTAATA CATGAACATT TTCATTGATA CTCATTATGC GTTTTAACAA ATCGATGATA AATTGATCAC 
012671 CACAGATATT GCTAAATCGA TCGCCGGTTT GGTCGCCCAG AAACGTACAT GGCGTCACAG CGTCTTTATT 
012741 AATAACTAAA TAAGGCTGAA GACTTTCTAA AATAATGTCT CTTCTGTTCA GGATACTGAT TATTGTATTA 
012811 ACATTAGTGT TAAGTTGCTC ATTAAAGTTC TCCCTTAGCA ATACGTTGAG AACTTCATCT TCTATATTAA 
012881 GCAACTGGCT AAGGAAATTT TCTCCTTCAG CCATGATTCC CAAATGTCCC GTTGCGAAAA GCGCGAACAA 
012951 AACTGCACCG ACTGAGCCAT CGGTATCACC AAAATAGGTT GGTCTGGTAC TTGTGGGATC AACGGGTAAA 
013021 CAATTGGAGA AATAGATTCT GTCAGCGAAC TGGGGTTTTA TCATTGTTTC GAATTTAATA TCAGATACAT 
013091 TATATTGCGA TATTTTCCAG TTCCAGATGG GTTTGTACGA CTCAGTAACT GCAACATCAT TAGCATTATC 
013161 ATTTACTGTC ATATTATTAA GTAAATAAAC AATACTGCAC CAATTAATAT CGGTATTATC AAGAGAGCAA 
013231 CCGTAATTTT TGCTATTAAT TGTCACAATA AACTGATAAT TATTATTCCT ACGTAGAATA TGAGCACGCA 
013301 TGCCCGATAG CATACTATAT TTTTCTGAAT GATCCGTTTG TATGGTAAAT GAAATTTTGT CATCTTGAAT 
013371 AGATTGTTGG AACCGTTCTA TTTGCCAATC ATCTATTTTT TCCACAACCT CACCGAGCAT TGTCCTGGCA 
013441 ATACTTGATA TATCATCACC TATACCATTT GCAATATACC CAAACAGTTC TTTAGTGAAG TTGGTAACAT 
013511 GCTCTTGCAC CATATCATTT GTTGCGATTG TCGTTGTACT GTCGTTAGTG CCTGCCACAG TTCCAATTTT 
013581 CATATTTTAC CTCATATTAT TTACCGCGAG GAATACATAG TTAACATTTT ATCTTATGAC ATACACCTCA 
013651 TGTTCGATGG GAAAATAATT ATATTTTGCA CAAATCATTC AGCCTCAAAG CATAATATGA AATTTCTTAT 
013721 CTCATAGCAG AGAAAGTCCC TAAAGATTGT AGAGGCGTCA TCAGAACATG CCTCTACAAT CGATTAAGAA 
013791 AACCTATGAA ATACTGGCAG GATTAAAAAG ACATACCACC GTATTCATGG AGTTTTAATG TAGTTGAAAA 
013861 CAACTAAGCC CTGAGGAATA AATTATTTTA TTATTTTTAT CACGTGCTTC CTTCAGGGAA TTTAGCCCCA 
013931 TAATACCATT ATCAAATTGT TGATTATGAT CTACCCCGGG CCCATGATGC CCATATTTTT GTCTAATGTA 
014001 TTTGCTGGGG TCTTCACCTT TGAGTGTCTC CCCACATATG AAGATACGTT CACGTGCTGG TCTGAAATCA 
014071 GTAGTGTTAT CAAAATAATT AGCATATACA GGTGTGGGTT TCAAAGTATT GCTTCGGATT AGATGGAATA 
014141 GAGGATCATC CATGTGTTCT TTATGTTTTT TATTAAAAAT ATTGGCTAAT TCCTCAGGAT CAGTAGGATT 
014211 TTTCATCTGA TTAAATGGAA CCTGCAAAGC ACCGAGACAA TAACATTTTT TTCTTCATCT CTTATTATTC 
014281 CGTGATGACT GGTTAAAACT TGCCTTTCTG AGTCATAATT ACAAACATCG AGCGTTTTAA TTAAGTTATA 
014351 CGTATCACCG GCAGAGAGTT TATGATTTGC TAGTCGTGCA GTATAGTTAC CATTAAAATT GATTTCATGA 
014421 TTTCCAGCCA GAACGACGAC ATTTTTATTA ATACGGCTAT CTTTATTACC CTCCATATTT CGCATAGAAT 
014491 TTAGCAAAGT AAGGATATAT TTATCACCAA AAATAGTACT AAATCTATCG CCTGTATGAT CCCCAAGGAA 
014561 GATACAAGGG GTTATCGCAT CGTCCTTTAA AAAAACATGT TGATGCAACT CATTCAAGAT CATGTCTCTC 
014631 GTATTTAATA AATCGTAGAG CACTTTATTA TTTTTATGTT TGTATGCAGA TGAAGCCATC TCTTCGTGTT 
014701 TTAATAATTC ACATAATAAA CTCCAACCCT TTTCCCTGAT GCCTATATGC CCTGAAACGA GCAATGCATA 
014771 AAGTACAGCG CCTACTCTTC CATCTGTATC GCCAAAATAA GCCGTGTTGG CATTTTGTGG GTTAATCACA 
014841 CCACACTGTT TATAGAAGTC TATTTTTGAA AACACAGATT TAACATAGCT ATCAAACTTT TCCTTAGTAA 
014911 ACGTCTCTTT AGAGACATCC CAACGCCAGT CAGGTTTGAA ATTACCACTA AGAAGAGTAA AGAAATTTCT 
014981 CGCTATGATA GAAAGCCCAT CAACTTTATA AATTATATCT GATTTATCTC CAGAGGAATT AATAAAATAA 
015051 TAACCGCCCT TACACTCAAC AGTAACGGTA ATGGGAGACG ATAATTTTAA CACATGGTTA TTGTCTGGTA 
015121 TAATTGTAAA GATAAACGTA TCAGTAGTAT TGTCGGCGAA TCTATTATAT TCTTGAATAT CTATAGAAGG 
015191 TTCACTATTA TAAAACCATA CTTTCTCCAT CTGGTGACTA CGATCATTTA CCTTCCAGTG ACCATGTTGC 
015261 AGGAAATAGA TGATATGCAG GCCAAAATCG TTATCTATTT GCGAATCATT ATCCAGTTTA TCAAATTCAA 
015331 CTATCTTTGC ACGATGTGTT TTATCAACCT TGCCATGGTG TTGATGACTG TTAACTTTAT CTGAATGCTT 
015401 ATCTTGATGG CTTGAAGAGA TGTTTCTAAT CTGATTGTCA ATTGCTTTCA TAAATAACCT GTGATATTTT 
015471 TGAATTGTTT GTAACAAAAT AAATGATACT TGTCTGAAAA ACAGATTTAC GACGATATAA AATAATAATA 
015541 CTTATATGTT CGCTGATTTT AAGCACCGAG ACTATCCGGT CTTTTACCAA ATAATGAAGA ATAATCCCTC 
015611 CCTGGAAGAT AATTGTAAAA AACAACAGCA TAAGAATTAA TCTTAGGATA AATTTTTATT TATCATGGCC 
015681 TTTTGAACGC TGAAAAGTAG CGCTCTGCAA AGTAAACCCC GCTATAGTTA TGCTATGCAT TTGTCTTTAA 
015751 TGATATCTCG TCATTATATT AACAGGATGA AATTATCATT AATGCATATT TCAATATTAG CAGGGATACC 
015821 TGAGGAGTTT AAAGTGAACA TATATATCGG GTGGCTTTTC AAATTAATCC CTTTGATTAT GGGCTTAATT 
015891 TGTATCGCGT TAGGTGGCTT TGTGCTGGAA AGTTCAGGGC AAAGCGAGTA TTTCGTCGCG GGTCATGTGC 
015961 TGATTTCTCT GGCGGCCATA TGCCTGGCAT TATTCACTAC CGCATTTATT ATCATTTCGC AGCTCACGCG 
016031 CGGCGTTAAT ACGTTTTACA ATACATTGTT CCCCATTATT GGCTATGCGG GGTCAATTAT CACCATGATA 
016101 TGGGGTTGGG CACTGTTAGC AGGCAATGAT GTGATGGCAG ACGAGTTTGT CGCCGGCCAT GTTATTTTCG 
016171 GCGTTGGTAT GATTGCCGCC TGTGTATCGA CGGTGGCAGC GTCATCCGGT CACTTTCTGC TCATTCCCAA 
016241 AAATGCAGCG GGGAGCAAGA GCGACGGAAC ACCGGTACAG GCTTATTCTT CATTAATCGG TAACTGCCTC 
016311 ATTGCCGTTC CCGTTTTACT CACCCTGCTC GGTTTCATTT GGTCTATTAC GCTGTTACGT AGTGCTGACA 
016381 TAACTCCGCA TTATGTCGCG GGTCACGTAT TGCTTGGGTT AACCGCAATC TGTGCCTGTC TAATTGGCCT 
016451 TGTTGCCACA ATTGTCCATC AAACACGTAA TACGTTTTCA ACTAAAGAAC ACTGGCTGTG GTGTTATTGG 
016521 GTTATTTTTC TCGGCTCAAT CACGGTACTG CAGGGGATAT ACGTCTTAGT CAGTTCCGAT GCAAGCGCCC 
016591 GACTGGCTCC CGGCATTATT CTTATTTGCC TCGGAATGAT CTGTTACAGC ATATTCTCAA AAGTCTGGCT 
016661 ACTGGCACTG GTATGGAGAC GTACCTGTTC GTTAGCCAAC AGAATACCGA TGATTCCCGT CTTCACCTGC 
016731 CTGTTTTGCC TTTTCCTGGC ATCGTTTCTT GCGGAAATGG CGCAGACCGA CATGGGATAT TTTATTCCTT 
016801 CGCGAGTTCT GGTCGGTTTG GGAGCGGTAT GCTTTACGTT GTTCTCAATC GTTTCAATAT TAGAAGCGGG 
016871 TTCTGCTAAA AAATAATTGC AACGTACCGG ATAAAACCAG CGTTGACCAT TTGCGTAACG CTGGTTTTTC 
016941 TTAGGCATCA TGAAATAACG CAGCATTAAT GCATAGTGGT TAAGTATAAA AAACAGCAAA GTTACTGTTT 
017011 TTTTCAACCT GTTCATATTT CATAAAGATC TGGCCACTGA GTGAGTTTTC AATCACCTTT CCATCCACCT 
017081 TATATTAAGC ATGGAGGGTT TCAGTTCACG GGCTCATTAG AAAATAATCA CAAGATAACC ACTATCAAAA 
017151 TTAGCTCATT TTTAATGCGA CTCTAATAAT TTTCATCTTT AGGAAATAGG TCAGGACGAC TTTGCTGCAA 
017221 TCAAATCCTG CGCACAAGCC CACGCACTCG ACCACGCCCA CTGGAAGTTA TAGCCCCCCA GCCAGCCGGT 
017291 GACGTCCATC ACTTCGCCGA TGAAGTACAG CCCAGGCACT TTGCGCGCTT CCATCGTCCG TGAAGAGAGT 
017361 TCGTTGGTGT CCACGCCGCC GAGCGTCACT TCGGCAGTGC GATAGCCTTC AGTGCCGTTG GGTTGTACGC 
017431 GCCAGTCGGT CAATGTGCTA ATCAGTGCCT GTTGGTCACG CACGTTGAGC TGTTTTAGCG AAACATCCGG 
017501 GATTTGCCCG AGTTGCTGTA AGCGTTCAAC CAACCGCTTC GGTAGATGAA CCGCCAGTGT GTTTTTCAGG 
017571 CTTTGATTCG GATGTGCGTT ACGCTGCTCA TTCAGGAAGG TTTCGAGGTC CACATCCGGT AGCAGATTGA 
017641 TGCTGACAAA TTCCCCCGGT TGCCAGTAGC TTGAAATCTG CAACACCGCC GGTCCAGACA AGCCGCGGTG 
017711 GGTGAAGAGT AAGTTCTCAC GGAAAACGGT GCCGTTTTCA GCGGTAATCA CGGAAGGCAC CGCCACGCCC 
017781 GCCAGCACCT GTAACTCTTC GAGCAACGGT TTATGCAGAG TGAATGGCAC CAGACCCGCG CGGGTCGGCA 
017851 GCACGTTGAG GCCAAATTGT TCGGCAATCT TATAACCAAA CGGCGACGCG CCCAGCCCCG GCATTGACAG 
017921 CCCACCAGTC GCGATGACCA GCTTTTCGCA ACCGACAGTC ATGCCGTTCA GATCAAGCGT GAAGCCTGTT 
017991 TCATCCTTCG CCACACTCAG CACTTCGCTA CGCAATCTGA AGGTCACATT GCCCTTCTCG CACTCATCCA 
018061 CCAGCATGTC GACAATCTGC TGCGCGGAGT CATCGCAGAA GAGTTGCCCT AACGTTTTCT CGTGCCAGGC 
018131 GATGCCGTGT TTATTGACCA GATCAATGAA ATCCCACTGG GTAAAACGTG CGAGTGCAGA CTTACAAAAA 
018201 TGCGGATTCT GGCTCAGATA AGCGCCTGGT TCGACATAAA GGTTGGTAAA GTTGCAGCGC CCACCGCCAG 
018271 ACATAAGGAT TTTGCGCCCT GGTTTTTTAC CATTATCGAT CAGCAGAACC CGGCGTCCTG CCTGACCTGC 
018341 CAGCGCAGAA CAGAACATAC CCGCCGCACC AGCGCCTATA ATAATGGCAT CAAACCTTTC CACGTTGCGC 
018411 TCCTCTTAGA AAAAACGGGC GTGAATTGTA AAGATTCCTC AGTGGTCGCA CCAGCATCAA TATTACTAAA 
018481 AGGAAGTATT TGCCTGAATT ATATAAGATA ATTATTTTTT GAGTGAAATC CATACAGGGG GCAAATCAAA 
018551 AAAAGTCTAT ATTTCACTTT GCCCGCGCCG CGAAAGTCAC TGATAATGCG CCGCGTTCAT GTCCTCAAAA 
018621 TGGCGTAACG TCCTATGCTA CATTTGTTTG CTGGCCTGGA TTTGCATACC GGGCTGTTAT TATTGCTTGC 
018691 ACTGGCTTTT GTGCTGTTCT ACGAAGCCAT CAATGGTTTC CATGACACAG CCAACGCCGT GGCAACCGTT 
018761 ATCTATACCC GCGCGATGCG TTCTCAGCTC GCCGTGGTTA TGGCGGCGGT ATTCAACTTT TTGGGTGTTT 
018831 TGCTGGGTGG TCTGAGTGTT GCCTATGCCA TTGTGCATAT GCTGCCGACG GATCTGCTGC TTAATATGGG 
018901 ATCGTCTCAT GGCCTTGCCA TGGTGTTCTC TATGTTGCTG GCGGCGATTA TCTGGAACCT GGGTACCTGG 
018971 TACTTTGGTT TACCTGCATC CAGCTCTCAT ACGCTGATTG GCGCGATCAT CGGGATTGGT TTAACCAATG 
019041 CGTTGATGAC CGGGACGTCA GTGGTGGATG CACTCAATAT CCCGAAAGTA TTAAGTATTT TCGGTTCTCT 
019111 GATCGTTTCC CCTATTGTCG GCCTGGTGTT TGCTGGCGGT CTGATTTTCT TGCTGCGTCG CTACTGGAGC 
019181 GGCACCAAGA AACGCGCCCG TATCCACCTG ACCCCAGCGG AGCGTGAAAA GAAAGACGGC AAGAAAAAGC 
019251 CGCCGTTCTG GACGCGTATT GCGCTGATCC TTTCCGCTAT CGGCGTGGCG TTTTCGCACG GCGCGAACGA 
019321 TGGTCAGAAA GGCATTGGTC TGGTTATGTT GGTATTGATT GGCGTCGCGC CAGCAGGCTT CGTGGTGAAC 
019391 ATGAATGCCA CTGGCTACGA AATCACCCGT ACCCGTGATG CCATCAACAA CGTCGAAGCT TACTTTGAGC 
019461 AGCATCCTGC GCTGCTCAAA CAGGCTACCG GTGCTGATCA GTTAGTACCG GCTCCGGAAG CTGGCGCAAC 
019531 GCAACCTGCG GAGTTCCACT GCCATCCGTC GAATACCATT AACGCGCTCA ACCGCCTGAA AGGTATGTTG 
019601 ACCACCGATG TGGAAAGCTA CGACAAGCTG TCGCTTGATC AACGTAGCCA GATGCGCCGC ATTATGCTGT 
019671 GCGTTTCTGA CACTATCGAC AAAGTGGTGA AGATGCCTGG CGTGAGTGCT GACGATCAGC GCCTGTTGAA 
019741 GAAACTGAAG TCCGACATGC TTAGCACCAT CGAGTATGCA CCGGTGTGGA TCATCATGGC GGTCGCGCTG 
019811 GCGTTAGGTA TCGGTACGAT GATTGGCTGG CGCCGTGTGG CAACGACTAT CGGTGAGAAA ATCGGTAAGA 
019881 AAGGCATGAC CTACGCTCAG GGGATGTCTG CCCAGATGAC GGCGGCAGTG TCTATCGGCC TGGCGAGTTA 
019951 TACCGGGATG CCGGTTTCCA CTACTCACGT ACTCTCCTCT TCTGTCGCGG GGACGATGGT GGTAGATGGT 
020021 GGCGGCTTAC AGCGTAAAAC CGTGACCAGC ATTCTGATGG CCTGGGTGTT TACCCTTCCG GCTGCGGTAC 
020091 TGCTTTCCGG CGGGCTGTAC TGGCTCTCCT TGCAGTTCCT GTAATCGTAC GCACCAAAAC GAGCGGGTCA 
020161 GCTGGCCCGC TTCAGATTGT GACATAGTGC GCTTTGTTCA TGCCGGATGC GGCGTGAACG CCTTATCCGG 
020231 CCTACAAAAA CATGCAAATT CAATAGATTG CAGAGATTAT GTAGGCCTGA TAAGCGTAGC GCATCAGGCA 
020301 ATTTTGCGTT TGTAATCAGT CTCGAGCGGG TCAGTTTACT GGCCCGCTTT TTTTATGCGT TATTATTGCT 
020371 GAAGTGCTTA ATGCCAAATC ATCAATGCAA TCAGGCTGAC CACCACCAGA CCACACAATG CGCTGGTCAG 
020441 AATAAACTGC CGACGCACCC GCTCACAGCG GCGAATAAAT TCATCATCGT GATGATCGCG ATAACGTTGG 
020511 GCATAGATAT ACCAAACGAG ACGCACCTGT TTGTTGGGTT GGCCATGTGA GGTAAAAAAG CCCCCTCCAT 
020581 CAACATATTG ATAGAGCAAT GGATCGCAGT TACGCAGTAC CACTAACAAC GCGCGTAGTG ATGAGAAATA 
020651 GCGCGCCATG TTAACAATGC AAACGACACA TAAAGCCCAA AATAATGCGA CGGTGCTTAT CATACCTCCT 
020721 CCCCGGCGAC CTGCCCGCGG AGTTCCACCC CGGGGCTACC GCTCCCGATA CGCTGCCAAT CAGTTAACAC 
020791 CAGGTCCTGG AGAAACCGCT TTTGTGGTGA CCAACATACG AGCGGCTCTA TAGATAGTGT AGGAGATCAG 
020861 GTTGTTTTTT TTCCAGAAGG TTAACCACTA TCAATATATT CATGTCGAAA ATTTGTTTAT CTAACGAGTA 
020931 AGCAAGGCGG ATTGACGGAT CATCCGGGTC GCTATAAGGT AAGGATGGTC TTAACACTGA ATCTTTACGG 
021001 CTGGGTTAGC CCCGCGCACG TAGTTCGCAG GACGCGGGTG ACGTAACGGC ACAAGAAACG CTAGCTGGCC 
021071 AGTCATCGAC AACTTTATGG AAGGAGTAAC ACTATGGCTT ATAAACACAT TCTCATCGCG GTCGACCTCT 
021141 CCCCGGAAAG CAAAGTTCTG GTAGAGAAAG CAGTCTCTAT GGCTCGCCCC TACAATGCGA AAGTTTCTCT 
021211 GATCCACGTA GATGTAAACT ACTCTGACCT ATACACCGGG CTTATTGATG TGAATCTGGG TGATATGCAG 
021281 AAACGCATCT CTGAAGAGAC ACATCATGCA CTGACCGAGC TTTCCACTAA TGCAGGCTAC CCAATCACTG 
021351 AAACCCTGAG CGGCAGCGGC GACCTGGGCC AGGTTCTGGT CGATGCAATC AAGAAATACG ATATGGATTT 
021421 GGTGGTTTGT GGTCACCACC AGGACTTCTG GAGCAAACTG ATGTCTTCCG CACGTCAGCT GATCAACACC 
021491 GTTCACGTTG ATATGCTGAT TGTTCCGCTG CGCGACGAAG AAGAATAATC TTCCCTCTAC GACGTGTTCC 
021561 TGAACGCCCG CATATGCGGG CGTTTTGCTT TTTGGCGCGC CTTGTTACCT GATCAGCGTA AACACCTTAT 
021631 CTGGCCTACG GTCTGCGTAC GCAATCAAAA TCCCCAGCCA ATACAACATT TAACACCATC ATATTTTCCA 
021701 TCATTAGTGT GATCATCTGG TTATTTTCTG TTGTAATAGT GTATTAATCT ATTCACCGCA TCAATATTAA 
021771 GAATCTCTGA CAGATGTAAA CTTTTTCGCG CGTTATCCCT TACGCGTTCA TACTTTTCAG GATGGTATTG 
021841 GAAGGTTAAT AAATATGAAT ACAACAACAC CCATGGGGAT GCTGCAGCAA CCTCGCCCAT TTTTCATGAT 
021911 CTTTTTTGTC GAGTTATGGG AGCGATTCGG CTACTACGGC GTGCAGGGCG TACTGGCGGT TTTCTTCGTT 
021981 AAACAGCTTG GATTCTCGCA AGAGCAGGCT TTTGTCACTT TTGGTGCTTT TGCTGCGCTG GTCTATGGCC 
022051 TCATTTCCAT TGGCGGCTAT GTCGGCGACC ACCTGCTGGG GACCAAACGC ACCATTGTTC TTGGAGCACT 
022121 TGTGCTGGCG ATTGGCTACT TCATGACCGG CATGTCGCTA CTTAAGCCTG ACCTGATTTT CATCGCCCTG 
022191 GGGACTATCG CTGTCGGTAA CGGCCTGTTT AAAGCTAACC CAGCCAGCTT GCTTTCGAAG TGCTATCCGC 
022261 CGAAAGATCC GCGGCTTGAT GGCGCATTCA CCCTGTTCTA TATGTCGATC AACATCGGCT CGTTGATAGC 
022331 GTTATCGCTG GCCCCTGTGA TCGCTGATAG ATTCGGTTAT TCAGTCACCT ACAACCTGTG CGGGGCGGGG 
022401 TTAATTATCG CATTACTGGT TTACATCGCC TGTCGTGGAA TGGTGAAAGA CATTGGTTCT GAACCCGACT 
022471 TCCGGCCAAT GAGCTTCAGC AAACTGTTGT ACGTGTTACT TGGCAGCGTG GTGATGATCT TCGTATGCGC 
022541 ATGGCTGATG CACAACGTAG AAGTCGCCAA TCTGGTGCTG ATTGTTCTCT CCATCGTCGT CACCATCATC 
022611 TTCTTTCGTC AGGCATTCAA GCTGGATAAA ACCGGGCGCA ATAAAATGTT TGTCGCCTTT GTCCTGATGC 
022681 TCGAAGCGGT GGTGTTTTAC ATTCTCTACG CCCAGATGCC AACATCGCTG AACTTCTTTG CCATCAACAA 
022751 CGTGCATCAT GAAATTCTCG GTTTTTCCAT CAACCCGGTC AGCTTCCAGG CGCTTAACCC GTTCTGGGTG 
022821 GTACTCGCCA GCCCAATACT GGCAGGCATT TACACGCATC TGGGTAACAA AGGCAAAGAC CTCTCGATGC 
022891 CGATGAAATT TACTCTCGGC ATGTTTATGT GCTCACTGGG CTTTTTGACG GCGGCAGCTG CGGGAATGTG 
022961 GTTTGCGGAT GCACAAGGGC TGACATCGCC ATGGTTTATC GTGCTGGTGT ACTTATTCCA GAGCTTAGGT 
023031 GAACTGTTTA TTAGCGCCCT TGGCCTGGCG ATGATTGCTG CCCTGGTGCC GCAGCATTTG ATGGGCTTTA 
023101 TTCTCGGGAT GTGGTTCCTG ACGCAGGCTG CCGCGTTCTT GCTGGGCGGC TATGTGGCAA CATTTACCGC 
023171 GGTGCCGGAC AACATTACCG ATCCGCTTGA GACGTTGCCC GTCTATACCA ACGTGTTTGG TAAGATTGGT 
023241 CTGGTCACGC TGGGCGTTGC AGTAGTGATG CTGTTGATGG TGCCGTGGCT GAAACGCATG ATTGCGACGC 
023311 CGGAAAGCCA TTAATTATTC TTGCAGAAAG CAGGGTAGCG TTATCGCTAC CCTGTTTTAG TTTTACACTG 
023381 GCGTACCTGC ATAGATATCA AAGCGATGCC CTTTAGTGAC TACCGCGTTT GGCGTGGCGA CATTCGCCAG 
023451 CGGTGGCGCG TAGTCCGGGC GCTTTACCAC CACGCGTTTG GTCGCCAGCA AGCGTGCAGG CTCCAGTAAT 
023521 CCATCGGCAT CAAGATCCGG TCCCACCAGC GACTGAAAGA CACGCATCTC TTTTTTCACT AGCGCGCTTT 
023591 TCTGCTTATG CGGGAACATC GGGTCGAGAT AAACCACCTG CGGGCGCGGG GTAATATCAG TCAGCGCCGT 
023661 CAGGCTGGAG GCGTGAATTA ACTGCAACCG CTCCTGCAAC CAGCCGCCGA TTTCCGCATC CGCATAACCA 
023731 CGCGCCAGGC CGTCGTCGAG TAGCGCGGCA ACCACTGGAT TACGCTCCAG CATCCGCACG CGGCAGCCGA 
023801 CTGAAGCCAG TACAAAGGCA TCGCGCCCAA GTCCTGCAGT GGCATCCACC ACATCCGGCA AATAATCGCC 
023871 TTTAATGCCC ACCGCTTTCG CCACCGCCTC ACCGCGACCA CCGCCGAATT TGCGTCGGTG CGCCATCGCT 
023941 CCGCCAACAA AATCAACAAA GATGCCGCCA AGTTTTGGCT CATCACGCTT GCGCAATTCC AGATGTTCCG 
024011 GCGTTAACAC CAGCGCCATC AGGTTGTCTT CATCGTGCTC CAGCCCCCAG CGGGCCGCCA GAACAGATAA 
024081 GGCACCGTCT CCGGTGCCTG TTTCATCAAT TAAGCAGATT TTCACTGAAT GATCAGCCCT TAATGCCGTA 
024151 ATGCTCCAGC ATCGCATCCA GCTGCGGTTC ACGACCACGG AAGCGTTTGA ACAGATCCAT CGGCTCTTCT 
024221 GAACCGCCAC GGCTCAGAAT GTTGTCGAGG AACGACTGCC CGGTTTCACG GTTGAAAATG CCCTCTTCCT 
024291 CAAAGCGCGA GAAAGCATCT GCCGCCAGTA CGTCAGCCCA CAGGTAGCTG TAGTAACCTG CGGCATAACC 
024361 ACCGGCGAAA ATATGGCTGA AAGCGTGCGG GAAACGGCCC CAGGACGGAG ATGGCACCAC GGCAACCAGT 
024431 TTCTTGATTT CTGCCAGAGT TTCGAGGATT TTTGCCCCCT GATCCGGGCG GAACTCGGCA TGAAGGCGGA 
024501 AATCAAACAG GCCGAACTCC AGCTGACGCA GAATAAACAG CGCCGCCTGG TAGTTCTTCG CCGCCAGCAT 
024571 TTTATCCAGC AACTCTTTCG GCAGCGGTTC GCCGGTTTCA TAGTGACCAG AGATAAACGC CAGCGCCTCC 
024641 GGCTCCCAGC ACCAGTTTTC CATAAACTGA CTCGGCAGTT CGACCGCATC CCACGGCACA CCGCTGATAC 
024711 CGGAAACACC AGCGGTTTCG ATGCGGGTCA GCATATGGTG CAGGCCGTGA CCGAACTCGT GGAAGAGGGT 
024781 GATCACTTCG TCGTGAGTGA ACAGCGCCGG TTTACCATTT ACCGGGCGGT TGAAGTTACA AGTCAAATAC 
024851 GCGACCGGTT TTTGCAAAGA ACCATCAGCT TTACGCATCT GGCCTACGCA GTCATCCATC CACGCCCCGC 
024921 CGCGCTTGTT TTCACGGGCA TACAGATCGA GGTAGAAGCT ACCGCGCAGT TCGTTATTTT CGTCATACAG 
024991 TTCGAAGAAA CGTACATCCG GATGCCAGAC ATCAACATCT TTACGCTCTT TAGCGGTGAT GCCGTAAATA 
025061 CGCTTAACCA CTTCAAACAG GCCGTTAACC GCTTTGTTTT CCGGGAAGTA CGGACGCAGC TGTTCGTCAC 
025131 TGATGCTGTA GAGGTGCTGT TTTTGTTTTT CGCTGTAGTA AGCGATATCC CACGGCTGCA ACTCATCGAC 
025201 GCCAAATTCG GCTTTGGCAA AGGCACGCAA TTGCGCCAGC TCTTTTTCGC CTTGTGGACG CGCGCGTTTT 
025271 GCCAGATCGG TTAAGAAATC CAGCACCTGC TGCGGGTTTT CTGCCATTTT AGTGGCAAGG GATTTAAAGG 
025341 CGTAGTTTTC AAAGCCCAGC AGTTGCGCCA GTTCGTGACG CAGCGCGAGG ATCTCTTCCA TCACCTTGCT 
025411 GTTATCCCAT TTACCGGCGT TTGGGCCTTG ATCGGAGGCG CGGGTGCTGT AAGCGCGATA CATCTCTTCA 
025481 CGCAGAGCCT GGTTGTCGCA GTAGGTCATT ACCGGCAAGT AGCTTGGGAT ATCCAGCGTC AGCAAATAAC 
025551 CTTCCAGCTC TTTCGCTTCG GCCTGGGCTT TTGCCGCAGC CAGCGCGCTT TCTGGCATCC CCGCCAGCTC 
025621 CGCTTCGTCG GTAACGAGTT TGGTCCAGCC CATTGTCGCA TCGAGGACGT TGTTGCTGTA CTGGTTGCCC 
025691 AGTTCAGAAA GACGGGTCGC AATTTCGCCG TAACGCTGCT GTTTCTCTTT CGGCAGACCT ATGCCAGAGA 
025761 GTTCAAAGTC GCGCAGTGCG TTATCAACCG CTTTCTTCTG CGCCGTGTTC AGCGTGGCGT AATGATCGCC 
025831 ATCGCGCAGG TCGCGATACG CTTTATACAG CCCTTCATGT TGCCCTACCC AGGTGCTGTA TTCCGACAGC 
025901 AGCGGCAGGG TTTGTTCGTA GGCTTCACGC AGTTCCGGGC TATTTTTCAC CGAGTTCAGG TGGCTGACCG 
025971 GGGAGAAGAT ACGCCCCAAC ACATCGTCCA CTTCCGCCAG CGGCTGGCAG AGATTTTCCC AGGTGTACGG 
026041 TGCCCCTTGC GCTACTACGC GCTCCACGTT TTCGCGGCAG TCGTTCAATG CCTTAGTCAC GGCTGGAACG 
026111 ACATGTTCCG GGAGAATTTT AGAAAACGGA GGCAATTCAA AGGGAGTCAG TAACGGATTC GTCATTCGCG 
026181 CAGTCCTGGT TAAAGAGGTT AAGGAAGCGC TCAACAGGCG CTTTACATAA TGTGTGTAGC ATGGGGTTAA 
026251 GTGTAGTGAA TTTCAATGAG AAACGTTACG CTTTCGCGGC GGCGGCCTCT TTTCGGTATA CTGTCCTGAT 
026321 ACGCTTTTGT GCGCCCCGAA TACGGGCCGA TTTTTACTTA CCGGAACACC TTTACCCATG CTCAGTTATC 
026391 GCCACAGCTT TCACGCTGGC AACCACGCCG ACGTCCTTAA ACATACCGTT CAGAGCCTGA TCATCGAGTC 
026461 GCTGAAAGAG AAAGATAAAC CGTTTCTCTA TCTCGACACC CACGCAGGGG CCGGGCGTTA TCAGTTAGGC 
026531 AGCGAACATG CCGAGCGTAC CGGCGAATAT CTCGAAGGCA TCGCCCGTAT CTGGCAGCAG GACGATTTGC 
026601 CCGCAGAACT GGAGGCGTAC ATCAATGTGG TAAAACACTT CAACCGTAGC GGTCAGTTGC GTTACTACCC 
026671 CGGTTCGCCG TTGATTGCTC GCCTGCTACT GCGTGAACAG GACAGCCTGC AACTGACCGA ACTGCACCCG 
026741 AGCGATTACC CGTTGTTGCG TTCTGAATTT CAGAAAGATA GCCGTGCGCG TGTCGAAAAA GCCGACGGTT 
026811 TCCAGCAGCT TAAGGCCAAA CTGCCGCCGG TTTCCCGCCG TGGTTTAATC CTTATCGACC CGCCGTATGA 
026881 AATGAAAACT GACTATCAAG CGGTGGTCAG CGGGATAGCA GAAGGTTACA AACGTTTCGC CACTGGTATT 
026951 TACGCACTGT GGTATCCGGT GGTGCTGCGT CAGCAAATTA AGCGCATGAT CCACGATCTG GAAGCGACCG 
027021 GTATTCGCAA AATTCTGCAA ATTGAACTGG CGGTACTGCC AGACAGCGAT CGCCGTGGCA TGACCGCTTC 
027091 CGGCATGATT GTGATTAACC CGCCGTGGAA ACTGGAACAA CAGATGAATA ACGTGCTGCC GTGGCTGCAC 
027161 AGCAAACTGG TTCCGGCAGG CACCGGGCAC GCCACCGTAA GCTGGATCGT GCCGGAGTAA TTGCAGCCAT 
027231 TGCTGGCACC TATTACGTCT CGCGCTACAA TCGCGGTAAT CAACGATAAG GACACTTTGT CATGACTAAA 
027301 CACTATGATT ACATCGCCAT CGGCGGCGGC AGCGGCGGTA TCGCCTCCAT CAACCGCGCG GCTATGTACG 
027371 GCCAGAAATG TGCGCTGATT GAAGCCAAAG AGCTGGGCGG CACCTGCGTA AATGTTGGCT GTGTGCCGAA 
027441 AAAAGTGATG TGGCACGCGG CGCAAATCCG TGAAGCGATC CATATGTACG GCCCGGATTA TGGTTTTGAT 
027511 ACCACTATCA ATAAATTCAA CTGGGAAACG TTGATCGCCA GCCGTACCGC CTATATCGAC CGTATTCATA 
027581 CTTCCTATGA AAACGTGCTC GGTAAAAATA ACGTTGATGT AATCAAAGGC TTTGCCCGCT TCGTTGATGC 
027651 CAAAACGCTG GAGGTAAACG GCGAAACCAT CACGGCCGAT CATATTCTGA TCGCCACAGG CGGTCGTCCG 
027721 AGCCACCCGG ATATTCCGGG CGTGGAATAC GGTATTGATT CTGATGGCTT CTTCGCCCTT CCTGCTTTGC 
027791 CAGAGCGCGT GGCGGTTGTT GGCGCGGGTT ACATCGCCGT TGAGCTGGCG GGCGTGATTA ACGGCCTCGG 
027861 CGCGAAAACG CATCTGTTTG TGCGTAAACA TGCGCCGCTG CGCAGCTTCG ACCCGATGAT TTCCGAAACG 
027931 CTGGTCGAAG TGATGAACGC CGAAGGCCCG CAGCTGCACA CCAACGCCAT CCCGAAAGCG GTAGTGAAAA 
028001 ATACCGATGG TAGCCTGACG CTGGAGCTGG AAGATGGTCG CAGTGAAACG GTGGATTGCC TGATTTGGGC 
028071 GATTGGTCGC GAGCCTGCCA ATGACAACAT CAACCTGGAA GCCGCTGGCG TTAAAACTAA CGAAAAAGGC 
028141 TATATCGTCG TCGATAAATA TCAAAACACC AATATTGAAG GTATTTACGC GGTGGGCGAT AACACGGGTG 
028211 CAGTGGAGCT GACACCGGTG GCAGTTGCAG CGGGTCGCCG TCTCTCTGAA CGCCTGTTTA ATAACAAGCC 
028281 GGATGAGCAT CTGGATTACA GCAACATTCC GACCGTGGTC TTCAGCCATC CGCCGATTGG TACTGTTGGT 
028351 TTAACGGAAC CGCAGGCGCG CGAGCAGTAT GGCGACGATC AGGTGAAAGT GTATAAATCC TCTTTCACCG 
028421 CGATGTATAC CGCCGTCACC ACTCACCGCC AGCCGTGCCG CATGAAGCTG GTGTGCGTTG GATCGGAAGA 
028491 GAAGATTGTC GGTATTCACG GCATTGGCTT TGGTATGGAC GAAATGTTGC AGGGCTTCGC GGTGGCGCTG 
028561 AAGATGGGGG CAACCAAAAA AGACTTCGAC AATACCGTCG CCATTCACCC AACGGCGGCA GAAGAGTTCG 
028631 TGACAATGCG TTAAATGTTA AAGGGCTAAG AGTAGTGTGC TCTTAGCCCT TAATTACGTT TCCGCTATCA 
028701 GTTCAGAAGC TGAAGCAGAA AGCGGATCAG TTCCAGCAGC GCAATTAACG CCCCTAGAAC GATGATTGCT 
028771 TTATCAATCA CCCGTTTTCT CCATGCGATG GAGTGAGAAT GCATCCGCTT ACTCATCCAC TGCCTGTCAC 
028841 GGCGCATGTC TCATTGTTAG ATAAGAACTC TCTCACTCCG GCCAGAGCAT CAGTTAACGG CACCACCCGT 
028911 ACTTCTGACC AGGACTTTGA AAGCGTTTAT GCGCATTGCC AGAGTGAAAA TGCCTCAGAG CTAACTGGAT 
028981 AATCATACAG TACATGCAGG TTATAAAACC AGCACGTCCT TGCAATAGTT TCAGTATGGT ATTAGCATTG 
029051 ATGCGTTAGA TGATGGCTAT CTCACTCCAG TCAGAGCCAC CAACTCAGGG CTGGAAAGTA AAAAACCGAC 
029121 GCAAAGTCGG TTTTTTTACA TCCGGATTCG GACAAGGCTT AATATGACGA TGACCCAGTG AAAGTATATA 
029191 AATCGTCACT GCGATATATA CCGAAGTGCT CCCTCCGCCA GCTGAAGAAA TCGCTAATTC TTGCAATGTT 
029261 AGCCACTGGC TAATAGTATT GAGCTGTTAG ATAAGAACTC TCTCACTCCA GCCAGAGCCA CCAACTCAGG 
029331 GCTGGAAAGT AAAAAACCGA CGCAAAGTCG GTTTTTTTAC GTCCTGATTC AGACCTCCTT TCAAATGAAT 
029401 AGCCAACTCA AAATTCACAC CTATTACCTT CCTCTGCACT TACACATTCG TTAAGTCATA TATGTTTTTG 
029471 ACTTATCCGC TTCGAAGAGA GACACTACCT GCAACAATCA GGAGCGCAAT ATGTCATTTC TGTTACCCAT 
029541 CCAATTGTTC AAAATTCTTG CTGATGAAAC CCGTCTGGGC ATCGTTTTAC TGCTCAGCGA ACTGGGAGAG 
029611 TTATGCGTCT GCGATCTCTG CACTGCTCTC GACCAGTCGC AGCCCAAGAT CTCCCGCCAC CTGGCATTGC 
029681 TGCGTGAAAG CGGGCTATTG CTGGACCGCA AGCAAGGTAA GTGGGTTCAT TACCGCTTAT CACCGCATAT 
029751 TCCAGCATGG GCGGCGAAAA TTATTGATGA GGCCTGGCGA TGTGAACAGG AAAAGGTTCA GGCGATTGTC 
029821 CGCAACCTGG CTCGACAAAA CTGTTCCGGG GACAGTAAGA ACATTTGCAG TTAAAAATTT AGCTAAACAC 
029891 ATATGAATTT TCAGATGTGT TTTATCCGGG AGGCATTATG TTACTGGCAG GCGCTATCTT TGTCCTGACC 
029961 ATCGTATTGG TTATCTGGCA GCCGAAAGGT TTAGGCATCG GCTGGAGTGC AACGCTCGGC GCAGTACTGG 
030031 CGTTAGTTAC GGGCGTGGTC CATCCGGGTG ATATTCCGGT GGTGTGGAAT ATCGTCTGGA ACGCGACGGC 
030101 TGCGTTTATC GCCGTCATTA TCATCAGCCT GCTGCTGGAT GAGTCCGGCT TTTTTGAATG GGCGGCGCTG 
030171 CACGTCTCAC GCTGGGGTAA TGGTCGTGGT CGCTTGCTGT TTACCTGGAT TGTCCTGCTC GGTGCTGCCG 
030241 TTGCCGCCCT GTTTGCCAAT GATGGCGCGG CGCTTATTTT GACACCGATT GTCATCGCCA TGCTGCTGGC 
030311 TTTAGGGTTC AGTAAAGGCA CTACGCTGGC GTTCGTGATG GCGGCCGGAT TCATTGCCGA TACCGCCAGC 
030381 CTGCCGCTTA TTGTCTCCAA CCTGGTGAAT ATCGTTTCCG CTGATTTCTT TGGCCTCGGC TTTCGCGAAT 
030451 ACGCCTCGGT GATGGTGCCG GTGGATATCG CCGCGATTGT TGCCACGCTG GTGATGTTAC ATCTCTATTT 
030521 TCGCAAAGAT ATTCCGCAGA ACTACGATAT GGCGCTGCTG AAATCTCCCG CAGAAGCGAT CAAAGATCCT 
030591 GCTACGTTCA AAACTGGCTG GGTTGTTTTA CTGCTTCTGC TGGTGGGATT TTTCGTCCTG GAACCGCTCG 
030661 GCATTCCGGT GAGCGCCATT GCAGCTGTGG GCGCGCTGAT ATTATTTGTC GTCGCTAAAC GCGGTCATGC 
030731 GATTAATACG GGTAAAGTCC TGCGCGGTGC CCCCTGGCAG ATTGTCATCT TCTCGCTCGG CATGTATCTG 
030801 GTGGTTTATG GCCTGCGCAA TGCCGGATTA ACGGAATATC TTTCTGGCGT ACTCAACGTG CTGGCGGATA 
030871 ACGGCCTGTG GGCCGCGACG CTCGGCACCG GATTCCTCAC CGCCTTCCTC TCTTCTATTA TGAACAATAT 
030941 GCCGACGGTA CTGGTTGGCG CGTTGTCCAT TGATGGCAGC ACGGCATCTG GCGTTATCAA AGAAGCGATG 
031011 GTTTATGCCA ATGTGATTGG CTGCGATTTG GGACCGAAAA TTACCCCAAT TGGTAGCCTG GCTACGCTAC 
031081 TCTGGCTGCA CGTACTTTCG CAGAAGAATA TGACTATCAG CTGGGGATAT TACTTCCGTA CAGGGATTAT 
031151 CATGACCCTG CCTGTGCTGT TTGTGACGCT GGCTGCGCTG GCGCTACGTC TCTCTTTCAC TTTGTAATGA 
031221 GATACTGATA TGAGCAACAT TACCATTTAT CACAACCCGG CCTGCGGCAC GTCGCGTAAT ACGCTGGAGA 
031291 TGATCCGCAA CAGCGGCACA GAACCGACTA TTATCCATTA TCTGGAAACT CCGCCAACGC GCGATGAACT 
031361 GGTCAAACTC ATTGCCGATA TGGGGATTTC CGTACGCGCG CTGCTGCGTA AAAACGTCGA ACCGTATGAG 
031431 GAGCTGGGCC TTGCGGAAGA TAAATTTACT GACGATCGGT TAATCGACTT TATGCTTCAG CACCCGATTC 
031501 TGATTAATCG CCCGATTGTG GTGACGCCGC TGGGAACTCG CCTGTGCCGC CCTTCAGAAG TGGTGCTGGA 
031571 AATTCTGCCA GATGCGCAAA AAGGCGCATT CTCCAAGGAA GATGGCGAGA AAGTGGTTGA TGAAGCGGGT 
031641 AAGCGCCTGA AATAAAGCGG CGATATCCCC CCCACAGGTT GTTAGAAAAG TGCGCTTTAT TTATGTCGGA 
031711 TGCGACGCTG GCGCGTCTTA TCCGACCTAC AAAGTTATGA AAATTCGATG AATAGTATGT TATTTGTAGG 
031781 CCTGACAGGC GTAGCGCATC AGGCGATTTT GCTATTTACA CAGTACTCCC TGCGTGAGAT TCCAATTATC 
031851 GCGTCCAGCA TGGTGTATCA GTGAGCTGCT TAGTTATCAG CGATACAGCG CAGTAGTTTA AAGACGTACT 
031921 GGATTATGAT TTATCAGTGG TTTACACAAC AAATTATTAA ATAATTATAA GATACCTTAA CCCATTTTAT 
031991 TATTACACAT CTAAAACATC ACAAAAAAAA TCACTTCACA CACTATCAGA GAACATAATA ACTTTTTAAA 
032061 ATGAGCGCAT TTTGATAGTT GTTAACGATT TCCTTTACGA TACTATCACT ACCCTTTTTT TACACACAAA 
032131 TATTACCGGG TGGAGATAAA AGGGAAATCA AAGGTAATTA TATCAGGAAG ATATAACGCA TTACATTTAT 
032201 TGTGTGTAGA AGAAAATCCA TTCCTGTTCT AATTATCCAA TTTAAACATC TTAGCATAAA ACAAATGATG 
032271 AATAAGGAAT TTTATGTCAA TTGACTTTAC CCCAGGTATA ATAAATACAT ATCACGGCGA TATTTATAAC 
032341 TGCACAACAA ATACCGATAA TGCTAAAACG CCAGACACAC CGAAGTGGCC TTGCGATAAT TGGGAAGAAC 
032411 AACAACCCAT TAATTCCACA TTCTCTGGAG AAGGATATAT CTCTGATCAA TATGATTTAG CGCAACACCA 
032481 ACTTCAACAA ATTAATGCGT GCCACACGAA CACTACATAT ACAAATGCAG ACTACTCAAA AGTTGTGGCT 
032551 CAACTTGTAA GTCTTATTAC TAACATTGAA ACGATAAGTT CGACACAACT TACGCAACAG ACACAATCAA 
032621 TACTTAATCA GATTAATAAC ATTAGATATG AAAAAAACAA AAGTGCTGAA TGTCGAATCA TTGTTATCGC 
032691 TAATCCTAAA CCCGACAAGG CAATCATAAC TAAAATTAGC GTAGAAGAGG GAATACCCAT AACATTCAGT 
032761 GTCCAAACCA TGTTTTCAGA TACTAATTTT ATTGCTGAAC AACGAGCTGA CTTACCAACT AATATAAAAG 
032831 ATATTCAAAG CCTGTATCAA AAAATGACGA AGTTATATAT TGAGCACAGT GAAAATAAAA ACAGGATGAA 
032901 AGTCTTTGCC GGAACCAACT TTATTGATTT CAATATGACA GGACAGAACC TGTCCGGGTT CGTTCTAACC 
032971 TTGTCAAGGT TTTATTTCGA AGATCTACTT AATATAAATT TCACTGACGC AAATTTAGGG AAGGTGCGAA 
033041 TAAGCGGGGA AATTCTTCTC GGCTGACTCA GTCATTTCAT TTCTTCATGT TTGAGCCGAT TTTTTCTCCC 
033111 GTAAATGCCT TGAATCAGCC TATTTAGACC GTTTCTTCGC CATTTAAGGC GTTATCCCCA GTTTTTAGTG 
033181 AGATCTCTCC CACTGACGTA TCATTTGGTC CGCCCGAAAC AGGTTGGCCA GCGTGAATAA CATCGCCAGT 
033251 TGGTTATCGT TTTTCAGCAA CCCCTTGTAT CTGGCTTTCA CGAAGCCGAA CTGTCGCTTG ATGATGCGAA 
033321 ATGGGTGCTC CACCCTGGCC CGGATGCTGG CTTTCATGTA TTCGATGTTG ATGGCCGTTT TGTTCTTGCG 
033391 TGGATGCTGT TTCAAGGTTC TTACCTTGCC GGGGCGCTCG GCGATCAGCC AGTCCACATC CACCTCGGCC 
033461 AGCTCCTCGC GCTGTGGCGC CCCTTGGTAG CCGGCATCGG CTGAGACAAA TTGCTCCTCT CCATGCAGCA 
033531 GATTACCCAG CTGATTGAGG TCATGCTCGT TGGCCGCGGT GGTGACCAGG CTGTGGGTCA GGCCACTCTT 
033601 GGCATCGACA CCAATGTGGG CCTTCATGCC AAAGTGCCAC TGATTGCCTT TCTTGGTCTG ATGCATCTCC 
033671 GGATCGCGTT GCTGCTCTTT GTTCTTGGTC GAGCTGGGTG CCTCAATGAT GGTGGCATCG ACCAAGGTGC 
033741 CTTGAGTCAT CATGACGCCT GCTTCGGCCA GCCAGCGATT GATGGTCTTG AACAATTGGC GGGCCAGTTG 
033811 ATGCTGCTCC AGCAGGTGGC GGAAATTCAT GATGGTGGTG CGGTCCGGCA AGGCGCTATC CAGGGATAAC 
033881 CGGGCAAACA GACGCATGGA GGCGATTTCG TACAGAGCAT CTTCCATCGC GCCATCGCTC AGGTTGTACC 
033951 AATGCTGCAT GCAGTGAATG CGTAGCATGG TTTCCAGCGG ATAAGGTCGC CGGCCATTAC CAGCCTTGGG 
034021 GTAAAACGGC TCGATGACTT CCACCATGTT TTGCCATGGC AGAATCTGCT CCATGCGGGA CAAGAAAATC 
034091 TCTTTTCTGG TCTGACGGCG CTTACTGCTG AATTCACTGT CGGCGAAGGT AAGTTGATGA CTCATGATGA 
034161 ACCCTGTTCT ATGGCTCCAG ATGACAAACA TGATCTCATA TCAGGGACTT GTTCGCACCT TCCTTAGGTG 
034231 ACACTATTTT TTTACATAAA GAACACCCTA CCCCCAAATT ATATAAAGAT GGACAATATC TTGACAAACA 
034301 AATCGAAGGT TTATTTTCAA CATTATTAAC CATTAATGAC AACCTTTTAC GAGCAAAAGC GGAAATTGCT 
034371 TCGACAATAA TTAAATTTTT AGAGGCCAGG ATAACCAATC TTTCATACAA TGACATATTA AAATATCAGC 
034441 AAGAATTCCA AAGACAATGT TATAAGCAAG TTAAAGCCTT TACGACACTC TCCCGATACA ATAAAATTCA 
034511 AACATGGGCA GAAATGTCTG AATATCAATT CGAAGTATTT CAATACGAGA CGCTTAACCC AAAAAAAATG 
034581 TCACACACGC CTTATTTAAA GAGGCCACTG CCTAATGAAA AAGATATAAA TTATGGGGTG GAAATAGAAA 
034651 TACCATCTGG TAAAAGAATT CGCTTATCAA ATCATTACCA GAATATAATA CCATAATATT GATTATTAGC 
034721 ACTTTATAAT CATTGAATAA AAATAGATTT TATGTACTTT TAAAACAATG CACTATATTA TGGGGTGATG 
034791 GATATTCATG TCACGCCCCA AAATTAACTG AGTTCACCTA AACAGAAAGG ATATAAACAT CAGACAGGTT 
034861 TACGTTACTA TCAGGCATAT CACCTCAGAA TCAGATGAAA ACTATAAAGA AATATCTATT ATGGTTTTAA 
034931 TATTTGTTGA TAAGGATAGT AACATGAACA TGACAAAAGG TGCACTCATC CTCAGCCTTT CATTTTTGCT 
035001 TGCCGCATGT AGTTCAATTC CGCAAAATAT CAAAGGCAAT AACCAACCTG ATATTCAAAA AAGTTTTGTT 
035071 GCTGTTCATA ACCAGCCGGG GTTATATGTT GGTCAACAAG CGCGCTTTGG TGGGAAGGTT ATCAACGTTA 
035141 TCAATGGCAA AACGGATACG TTGTTAGAAA TCTCTGTATT ACCGTTGGAT AGCTATGCGA AGCCTGATAT 
035211 TGAAGCCAAC TATCAGGGCC GACTGCTCGC CAGACAAAGC GGCTTCCTTG ATCCAGTGAA CTATCGTAAT 
035281 CACTTTGTTA CCATCCTCGG CACCATTCAG GGTGAACAAC CTGGCTTTAT CAATAAAGTC CCGTATAACT 
035351 TCCTGGAAGT GAATATGCAG GGCATCCAGG TGTGGCATTT GAGAGAAGTG GTTAATACCA CCTATAACCT 
035421 GTGGGATTAC GGCTATGGTG CATTCTGGCC GGAACCGGGC TGGGGTGCGC CTTACTACAC CAATGCGGTG 
035491 AGTCAGGTAA CACCTGAGCT GGTCAAATAA CACCACCGAA AGATGCAGAT GCTTTCTCAG CATCTGCATC 
035561 ATGCATTACA TCAAATTAAT ACACAGTAAG CTAACTATTA TTATTATAAG CCCTGTCCTG TTAATTACCT 
035631 TTGGCAAACT GATTATAAAG TTAATGTCCG CACCAGGAGT CGGTTATGTT TCTTATAATT ACCAGGGATA 
035701 CGATGTTCTT CACCGCGATG AAAAACATTC TGAGTAAAGG TAATGTCGTT CATATACAGA ACGAAGAAGA 
035771 GATCGACGTA ATGTTGCATC AGAATGCCTT CGTCATTATT GATACATTAA TGAATAATGT ATTTCATTCT 
035841 AATTTTCTCA CTCAAATTGA ACGATTAAAA CCTGTCCATG TCATTATTTT CTCCCCCTTT AATATTAAAC 
035911 GCTGCCTGGG GAAAGTGCCG GTGACCTTTG TTCCGCGGAC TATCACTATC ATTGATTTTG TCGCACTCAT 
035981 CAATGGCAGT TACTGCTCTG TGCCTGAAGC GGCTGTGTCA CTTTCGCGCA AGCAACATCA GGTTCTGAGC 
036051 TGCATTGCGA ATCAAATGAC AACGGAAGAT ATTCTGGAGA AACTGAAAAT ATCGCTAAAA ACGTTCTACT 
036121 GCCATAAACA CAATATCATG ATGATCCTCA ATCTTAAGCG GATCAATGAG CTGGTACGCC ATCAGCATAT 
036191 TGATTATCTG GTGTGAATTT CAGGCTTACG GTGAGTCTGG CTACGCTGCC ACACAGATTA GCTAATTGAA 
036261 ACGCCTTTCA CCCCTGCCAT ACCTTTTAAT AATCGCAACA GGTCTTCTAT CGACGTTGTG GCATGAAGCT 
036331 GGATATCAAT GGCGACCACT TCATGATCTT CATTTTCCTG CAACGAAACT AAATCAGTTT TTATTTTTTG 
036401 CTGCTTAAAC CAGTCGAGCA TTGATACCGT ATTACCGTTC ACTAATGTCA GCTGTAAATG GTAATTTTTG 
036471 TTCATCAGGC GGAAGGTTAA TTGATGGAAG ACTTCCAGCA CCAACAAGGT CATCACTGAA CCATAAATAC 
036541 CCAGTTCGTA CATACCGCTG CCAATAACCA TACCTATGGC GGCGGTCACC CAGATATCCG CTGCCGTCGT 
036611 CAGACCTACA ATATTTTGGT TACGAACGAG AATGTTACCT GCACCGATAA ACCCGACGCC CGTCACCACC 
036681 TGAGCAGCAA TACGGCTGGG GTCGAGTCCG ACGTGATCTA AAGACAGCAC GTCAGCAAAA CCATATTTCG 
036751 AAACAATCAT AAACAGGGCG CTTCCCATGC CAATTAATAC ATGTGTGCGT AACCCTGCTC CTTTGCCGCG 
036821 CATTTGCCTT TCCATGCCAA TAGCGCCACA GGCAATTGCC GCGAGTATAA GACGTATAAT AAATTCTGCT 
036891 GTCATATAAA AATGCAAAAA GGAGCAGCAA GATGGCTCAA CTTGCTACTC CTTTTTACTT GCACCTCATT 
036961 AATTCGGCAA GTCATTAGAT GCTTGATTTT TGAAGGTATA CAAATTTTTC TGCGGGTTTT TCTTACAGTA 
037031 TTCGATCACT TTAGGAATTT GAGTGAGATC GGTTTCATTT AAAGTAACGG TATCGCCACC TTTATATACT 
037101 GTTTCTTCAT GCAGCATCCA CCATGCAACC GGGGTCATTG CTTTTGGATT CAGATCAATA AATTCCTGGC 
037171 AGGTCATATC TTTAGCGGAT TCATTGGCTG CCAACGCAGA TTGTGCGTTC ACCAGTGACA AAGCCGCTAC 
037241 AGCGCCCATA AAAATAAACG CTTTACGGAG AGATGAAATA TTCATTTTGT AACCCATTCA ATATAGAGAT 
037311 TATATATGAA CAGGAGGAAT AGCTGCTTTT AAAGAAGATA TTCCGGCCTG TTCAATATGC AAGGAAGTAC 
037381 GATGTAACGC ATTCCCGGAA TTACATATCT TTCTTAATTT TGTCCCATTC GCCTTTAACT TTATCTTTAA 
037451 AGTTGGCTTG TTTATCCTGA GTACAAGCCT GAACGATAGC TGGGGTTACG GTTGCAATAC CCTGAACATC 
037521 TAAAACCGCA TCTTCTGGTT TATCTTTGTT GTTCAGCGCT TCAGCAAAAC CAACTGCAGT TGGCTGGAAG 
037591 GATTCGTCCA CAGCCAGGAA ATCTTCACAG GTCCAGGAGT TGACCGGTTT TTTGTTATCA GCTGCTTTTT 
037661 GCGCATCCGC TGCATTGCTC ACAACTGGCA GAAGAAGCAG ACCACCAAGA ATAACGCCTA ATACTTTTTT 
037731 CATCGTAATA TCCTCAACTA TAAAGTGAAA GAGCCGTCAC GAATCAATTT CGACACTGAG GTTATAACCT 
037801 GGTTTTCTGT ATATGTCATG TTGATGGAAA ATATCAAAAT CAGATATTTT TATTTCAATA CAATGAGTTA 
037871 CAGATGCATC AGATACTGCA ATTAGGAAAT TTTTATTAAA TCGACTGCAT TCTTAGACGC GTTTTTGGCA 
037941 TAGATTGATA GCAGGGGATT TTCTTCTTAA TTTTATAGGG TGGTTCTATG TTATATATAG ATAAGGCAAC 
038011 AATTTTGAAG TTTGATCTGG AGATGCTTAA AAAACATCGC AGAGCAATCC AGTTTATTGC CGTGCTGCTG 
038081 TTTATCGTCG GGTTGCTGTG TATCAGTTTC CCGTTCGTCT CTGGCGATAT TTTAAGCACA GTAGTGGGTG 
038151 CATTATTAAT CTGCTCGGGT ATTGCGCTTA TTGTCGGGTT ATTCAGCAAC CGCAGTCATA ATTTCTGGCC 
038221 GGTATTATCC GGTTTCCTCG TCGCAGTCGC CTATTTATTG ATCGGCTATT TCTTCATCCG CGCACCGGAG 
038291 CTGGGCATTT TTGCCATTGC GGCATTTATT GCCGGTTTGT TCTGTGTTGC AGGGGTTATT CGCCTGATGA 
038361 GTTGGTATCG TCAGCGTTCA ATGAAAGGCA GCTGGCTACA GCTCGTTATT GGTGTGCTGG ATATCGTCAT 
038431 TGCCTGGATA TTCCTTGGTG CAACGCCGAT GGTGTCTGTA ACGCTGGTTT CCACACTGGT GGGAATTGAA 
038501 CTGATATTTA GCGCCGCCAG CCTGTTCAGC TTCGCCAGTT TGTTCGTTAA GCAGCAATAA TTACCCCGGT 
038571 TGTCACCCGG ATCATAGTCA CTTGATGTGA CTATGATCCG ATTAATACTC TCTCCGCTAC GCAGTGTTGT 
038641 AGATCAATTG CGCACTATCA TTGAAATAAT TACCTGCTAG TGATTATTTC AACCTACTGA ATTTCATCTA 
038711 ATTTTTTTCA CTCTATGGCA AATTAGCCAT TTCAAACATT ATCATGGCTG ATATTTTCCG TAGTCAGGTT 
038781 TAATGTTTTA AAAGTGCTGT GGGAAAGTGA ACAAAGAGTT CCGTAAGCGT TGATGCTATG GGCGGTTAAA 
038851 TAAGTAATCC GGGTTCATTT TTTTGCAACT GGCGTTGATT ACATTGCATA AATATCCGTG TCTCCAGACG 
038921 CTATATAAAA ACCTGAAGAC ATGAATGCGT TATTTACTCA GGTAATTTCA ATGCGTTAAA AGAAAGCTGG 
038991 CAATCCAATT GCCAGCTTAA GTCGAAACAA GGAGACTCGA TATTTAAATC GGATTACATT TTAACTTTAG 
039061 TAATATTCTT CAGAGATCAC AAACTGGTTA TTGATAACTT ATTCTTGGGC AGTAATCCGC AAACGTTAAC 
039131 TTTTTGTTTG CTATTTACAA GCTGATAACA ACCAGGAATC TTACTTAGGA TCAATATATG GAGTGCGTGA 
039201 TGGATAAATC TGAAGTATTG ATTAGTGTTA ATAGACGTAT TAGTTCACGA AGGGTAAAGT TCTTATAGGC 
039271 GTTTACTATA TTGAACAACG ATTCGGACAA GGATGTAAAT AATGAAAAGG ATGACATATT CGAAACGATA 
039341 ACGGCTAAGG AGCAAGTTAT GATTTTTCTC ATGACGAAAG ATTCTTTTCT TTTACAGGGC TTTTGGCAGT 
039411 TGAAAGATAA TCACGAAATG ATAAAAATCA ATTCCCTGTC AGAGATCAAA AAAGTAGGCA ATAAACCCTT 
039481 CAAGGTTATC ATTGATACCT ATCACAATCA TATCCTTGAT GAAGAAGCGA TTAAATTTCT GGAGAAATTA 
039551 GATGCCGAGA GAATTATTGT TTTGGCACCT TATCACATCA GTAAACTAAA AGCTAAAGCG CCTATTTATT 
039621 TTGTTAGCCG CAAAGAAAGT ATCAAAAATC TTCTTGAGAT TACTTATGGT AAACACTTGC CCCATAAGAA 
039691 TTCACAATTA TGTTTTTCAC ATAATCAGTT CAAAATTATG CAACTGATTC TGAAAAATAA AAATGAAAGC 
039761 AATATCACGT CGACGCTCAA TATTTCGCAA CAAACATTAA AGATTCAGAA ATTCAACATT ATGTACAAGC 
039831 TGAAACTAAG ACGTATGAGC GACATCGTCA CCCTGGGTAT CACATCTTAT TTTTAGTCAG GACATAAGCA 
039901 ACTGAAATTG ATGGCTGGCA TGACGAGGGA TGCAGATGCT GATTTCATTA CCCCCGGTGA TTACTAAAGG 
039971 AGAGGCTAAA ACGACTTTAT TCCCCTGGTA TGTGTATCCA CCAGTAGAAC CCTTCGTTGC CCGAATGCTG 
040041 GCAGGAACTG TTGGCAGAAC GGCAACATTT TTTTTGTCGT TGACCTCACC ATGTCGATCA CTGTGCCTGT 
040111 ATCCCACCTT ACTGGCTGAC AACCCCACTA TGCCGCTGGT CTGTAAATCC CTCATATCTC TCCTCGCGCG 
040181 CAATTTAAAG AACCGTTATT TCTCAAGAAT TTTCAGGGAC TAAAATGAAC AGAAGAAGAA AGCTGTTAAT 
040251 ACCGTTGTTA TTCTGCGGCG CGATGCTCAC CGCCTGCGAT GACAAATCGG CGGAAAACGC CGCCGCCATG 
040321 ACGCCTGAGG TCGGTGTCGT CACACTCTCC CCCGGTTCGG TCAATGTGTT GAGCGAATTG CCCGGTAGAA 
040391 CCGTTCCTTA TGAAGTTGCC GAGATACGTC CCCAGGTGGG CGGTATTATC ATTAAACGCA ACTTTATCGA 
040461 AGGCGATAAA GTGAACCAGG GCGATTCGCT GTATCAGATT GATCCTGCAC CTTTACAGGC CGAGCTAAAC 
040531 TCCGCCAAAG GCTCGCTGGC GAAAGCGCTC TCTACCGCCA GCAATGCCCG CATCACCTTT AACCGCCAGG 
040601 CATCGTTGCT GAAGACCAAC TACGTTAGCC GTCAGGATTA CGACACCGCG CGCACCCAGT TGAATGAAGC 
040671 AGAAGCCAAT GTCACCGTCG CCAAAGCGGC TGTTGAACAG GCGACGATCA ATCTGCAATA CGCGAATGTC 
040741 ACCTCGCCGA TTACGGGCGT CAGCGGGAAA TCGTCGGTGA CCGTCGGCGC ACTCGTTACC GCTAATCAGG 
040811 CAGATTCGCT GGTTACCGTA CAACGTCTGG ACCCGATTTA TGTCGATCTC ACGCAGTCGG TGCAAGATTT 
040881 CTTACGCATG AAAGAAGAGG TCGCCAGTGG GCAAATCAAA CAGGTTCAGG GCAGTACGCC AGTACAGCTC 
040951 AATCTGGAAA ATGGTAAACG CTACAGCCAG ACCGGCACGC TGAAATTCTC CGACCCGACA GTGGATGAAA 
041021 CCACGGGCTC CGTGACGTTA CGGGCGATTT TCCCCAACCC AAATGGTGAC TTGCTGCCTG GCATGTACGT 
041091 CACGGCATTA GTGGATGAAG GTAGCCGCCA GAATGTATTA CTGGTGCCGC AGGAAGGCGT CACCCACAAC 
041161 GCCCAGGGTA AAGCAACGGC GCTCATTCTG GATAAAGACG ATGTCGTGCA GCTACGCGAA ATTGAAGCCA 
041231 GCAAAGCCAT CGGCGACCAG TGGGTCGTCA CCTCTGGCTT GCAGGCTGGC GATCGGGTGA TCGTTTCCGG 
041301 TTTGCAACGC ATTCGTCCGG GTATCAAAGC ACGAGCAATT TCCTCCAGCC AGGAAAACGC CAGCACCGAA 
041371 TCGAAACAAT AACGTTGCAG GCTTAAGGGG ACTTTCATGG CTAACTATTT TATTGATCGC CCGGTTTTTG 
041441 CCTGGGTACT TGCCATTATT ATGATGCTTG CAGGTGGTCT GGCGATCATG AACTTACCGG TTGCGCAGTA 
041511 TCCGCAGATT GCGCCACCGA CCATTACCGT CAGCGCTACC TATCCAGGTG CCGATGCGCA AACGGTAGAA 
041581 GACTCGGTCA CTCAGGTGAT TGAGCAAAAT ATGAATGGGC TTGATGGCCT GATGTACATG TCTTCAACCA 
041651 GTGATGCGGC GGGCAATGCC TCTATCACTC TGACCTTCGA GACTGGGACA TCTCCTGATA TCGCACAGGT 
041721 TCAAGTGCAA AATAAACTGC AACTCGCTAT GCCTTCATTA CCTGAAGCAG TGCAGCAGCA GGGGATTAGC 
041791 GTCGATAAGT CGAGCAGTAA TATCCTGATG GTAGCGGCGT TTATTTCTGA TAACGGCAGC CTCAACCAGT 
041861 ACGATATCGC GGACTATGTA GCGTCTAATA TCAAAGACCC GCTAAGCCGT ACCGCGGGCG TTGGTAGCGT 
041931 ACAACTCTTT GGTTCCGAGT ATGCCATGCG TATCTGGCTG GACCCGCAAA AACTCAATAA ATATAACCTG 
042001 GTACCTTCCG ATGTTATTTC CCAGATTAAG GTGCAAAACA ACCAGATTTC CGGTGGTCAA CTGGGTGGCA 
042071 TGCCACAGGC GGCAGACCAG CAGCTAAACG CCTCGATCAT TGTGCAGACG CGTCTGCAAA CGCCGGAAGA 
042141 ATTTGGCAAA ATCCTGTTGA AAGTTCAGCA AGATGGTTCG CAAGTGCTGC TGCGTGATGT CGCTCGCGTC 
042211 GAACTTGGGG CGGAAGATTA TTCCACCGTG GCACGCTATA ACGGCAAACC TGCTGCCGGG ATCGCCATCA 
042281 AACTGGCTGC CGGAGCAAAC GCCCTGGATA CCTCGCGGGC AGTCAAAGAG GAACTGAACC GCTTATCAGC 
042351 CTATTTCCCG GCAAGTCTGA AGACGGTTTA TCCTTACGAC ACCACGCCGT TTATCGAAAT TTCTATTCAG 
042421 GAAGTTTTCA AAACACTGGT TGAGGCTATC ATCCTAGTCT TCCTGGTCAT GTATCTGTTT TTGCAGAATT 
042491 TCCGTGCCAC AATCATCCCG ACGATTGCCG TACCGGTGGT TATTCTCGGG ACGTTTGCGA TCTTGTCGGC 
042561 GGTCGGTTTC ACCATCAACA CGTTGACTAT GTTCGGGATG GTGCTGGCGA TAGGGTTACT GGTGGATGAC 
042631 GCCATCGTGG TGGTGGAGAA CGTCGAGCGT GTCATTGCGG AAGATAAGCT ACCGCCGAAG GAAGCGACGC 
042701 ATAAATCGAT GGGGCAGATC CAACGTGCGC TGGTCGGTAT TGCCGTTGTT CTTTCCGCAG TGTTTATGCC 
042771 GATGGCCTTT ATGAGCGGTG CAACCGGGGA GATCTACCGC CAGTTCTCCA TCACGCTGAT CTCCTCCATG 
042841 CTGCTTTCAG TATTTGTGGC AATGAGCCTG ACCCCTGCCC TGTGCGCCAC CATTCTGAAA GCCGCGCCGG 
042911 AAGGCGGTCA CAAACCTAAC GCCCTGTTCG CACGCTTCAA CACGCTGTTT GAAAAATCAA CTCAACACTA 
042981 TACCGATAGC ACCCGCTCGC TGTTGCGTTG TACCGGTCGC TACATGGTGG TCTACCTGCT GATTTGCGCC 
043051 GGGATGGCGG TGCTGTTCCT GCGCACGCCG ACCTCTTTCT TACCAGAAGA GGATCAGGGG GTATTTATGA 
043121 CCACCGCGCA GTTACCTTCC GGTGCCACCA TGGTTAACAC CACGAAAGTG CTGCAACAGG TGACGGATTA 
043191 TTATCTGACT AAAGAGAAAG ATAATGTCCA GTCGGTGTTT ACCGTTGGCG GCTTTGGCTT CAGCGGTCAG 
043261 GGGCAAAACA ACGGCCTGGC GTTTATCAGT CTCAAGCCGT GGTCTGAACG TGTCGGTGAG GAAAACTCGG 
043331 TTACCGCGAT CATTCAGCGG GCAATGATTG CGTTAAGCAG TATCAATAAA GCCGTCGTCT TCCCGTTCAA 
043401 CTTACCCGCG GTGGCTGAAC TGGGTACCGC GTCAGGTTTT GATATGGAAC TGCTGGACAA CGGTAACCTG 
043471 GGGCACGAAA AACTAACCCA GGCGCGAAAC GAGCTGTTAT CACTGGCAGC GCAATCACCG AATCAGGTCA 
043541 CCGGGGTACG CCCGAACGGC CTGGAAGATA CGCCGATGTT CAAAGTGAAC GTCAACGCTG CGAAAGCTGA 
043611 AGCGATGGGC GTGGCGCTGT CTGATATCAA CCAGACAATT TCCACCGCCT TCGGCAGCAG CTACGTGAAC 
043681 GACTTCCTCA ACCAGGGGCG GGTGAAAAAA GTGTATGTCC AGGCAGGCAC GCCGTTCCGT ATGTTGCCGG 
043751 ATAACATCAA CCAATGGTAT GTACGCAACG CCTCTGGCAC GATGGCACCG CTTTCTGCCT ACTCGTCTAC 
043821 CGAATGGACC TATGGTTCAC CGCGACTGGA ACGCTACAAC GGCATCCCGT CAATGGAGAT TTTAGGTGAA 
043891 GCGGCGGCCG GGAAAAGTAC CGGTGACGCC ATGAAATTTA TGGCAGACCT GGTCGCTAAA CTTCCGGCAG 
043961 GCGTCGGCTA CTCATGGACC GGACTATCGT ATCAGGAAGC GTTATCCTCA AATCAGGCTC CTGCGCTGTA 
044031 TGCGATTTCA CTGGTCGTGG TGTTCCTCGC CCTCGCCGCA CTCTATGAGA GCTGGTCAAT TCCGTTCTCG 
044101 GTGATGTTGG TTGTTCCGTT AGGCGTCGTT GGCGCATTAC TGGCCACCGA TCTGCGCGGC TTAAGTAATG 
044171 ACGTCTACTT CCAGGTTGGT TTGCTGACCA CCATCGGGCT TTCCGCCAAA AACGCCATCC TGATTGTCGA 
044241 ATTTGCCGTT GAGATGATGC AGAAAGAAGG GAAAACGCCG ATAGAGGCAA TCATCGAAGC GGCGCGGATG 
044311 CGTTTACGCC CAATCCTGAT GACCTCTCTG GCCTTTATTC TCGGCGTGCT GCCGCTGGTT ATCAGTCATG 
044381 GTGCCGGTTC TGGCGCGCAA AACGCGGTAG GTACCGGCGT GATGGGCGGG ATGTTTGCCG CAACAGTGCT 
044451 GGCAATTTAC TTCGTTCCGG TCTTTTTCGT TGTAGTGGAA CATCTCTTTG CCCGCTTTAA AAAAGCGTAA 
044521 CGTGTAAATG AGAGTAAGGT TGAACATGAA GGTTCAGCCT TACTCTTTCC TGCTAACCAT TCACCACTCA 
044591 ACAACCAGCT AACCGTCAGG AATACCAGGC TTAGTACACA GCACTGAAAG TAGAAACCAC TCCAGCCATT 
044661 CGTCATCAAT TTGAACAACA CAATACTGAC CCACATTCCC GTAATCGTAT GAATTGTCAG CTTAATAATC 
044731 CCAAACATGC CGAGTCTTTT CCTCCTGAAA ATACCGATAC CGCCTGGCAA ACTGCGAAAG AGAACTAGCC 
044801 GGTAGCCCGG CAGAAATCAT CAGGGAAGAG TTTCACATGA AGCAGGTGTG AGATCCTGAC CAATATTCAA 
044871 ATGCGAAATA TGTCAGGAAA AGGTACCTGG CGAATGTTGC GCAAACTGAT GTGGCGTTAC ACCATAATAT 
044941 TGTCGAAATG TGTTTATAAA GTACGATGTA CTGCTATAGC CACATTTTTC CGCAATAGTA TGCAGAGGAA 
045011 TTTGACGTAA CTCGAGTAAT CGTCTGGCCA TCGACATCCT GGAGGCGAGT AATATTTTAC TGAAACAGGT 
045081 ATTTTCATCC TGCAACTTTT TTTTGATTAG ACTCTCGCTG GTATACATTC TTTCCGCGAT ATCGCGCAGA 
045151 TACCAACGTT TGGCGATATC AAAGCTAATA AGGCGTTCAA CTTTTCCTGA AACAGTGCTG ATGCTATTGA 
045221 AAAGTAAGGG GATCAGTTCT TTCTTATGAG AAAACATCGA TAAACAGGAA AGGTAGAGCA TATTGCTCAG 
045291 TATCGGTGAA TTTACCCCGG ATTCATTGAA GCTATCAAAA ATCGCCGTCA CCAGCGGCAT GGGGGGTGAC 
045361 TGGTTAATTA ACAAACGGTC TTTGCTGTGT AACCCTAAAT TGCGTGGTAG CTGACGAATA TTTTGTAAGT 
045431 AATGGCAAAC TGTCAGCTCA TCGATATCCA GTCGTCGCGT ATCCGGTGAA CAAAACGCAA AATCGTCTGC 
045501 CAAATTTTTC TCCAGCAGCA GAATACTCTC GTTATGCAGC GATATTTTTT GCTGTTCATG ATAAATATCG 
045571 AATGAACGAC GAATGAGGAT CACCGAGCAG ACATGAGTCA TGATTATCCC TTATATTTCA TACTGCGATT 
045641 ATTTCAATTT CAGTATACTA ATGAAATGAT GCCAGACTGT TTCTTAGCGC AAAAACTGCC AGATTTGGTA 
045711 GGACCAAAAT TTATCCACAA AGTAGTTTTG CATAACAGTT AATTGATAAT AAGTAAATGC AGCACGAATA 
045781 TATTTTCGCA CAGCGTATAG CTTATGTTTA TAAAAAAATG GCTGATCTTA TTTCCAGTAA AAGTTATATT 
045851 TAACTTACTG AGAGCACAAA GTTTCCCGTG CCAACAGGGA GTGTTATAAC GGTTTATTAG TCTGGAGACG 
045921 GCAGACTATC CTCTTCCCGG TCCCCTATGC CGGGTTTTTT TTATGTCTGA GTAAAACTCT ATAATCTTAT 
045991 TCCTTCCGCA GAACGGTCAG TGCCGTAAAA ATTCCCTTGC GCAACAATAC TTGCCGCCGA GTCACGGTTC 
046061 GACAATCTCT GCGCCGATCG CTCCTGATAC TCTGTGGGCG TCATCCCATA ATAATTTCGA AAGACGTAAA 
046131 TGAAATACGA CACGCTGTGA TATCCACAGG ATACTGCAAC TCGCTTAATT GAAAAACCAT GTATAACAAT 
046201 AAGTTGCAAA GCACGTTGCA TTCTACACTC AGTAAGCAAC TGTGAATATG ATGTCTCTTC TTCGCGCAAT 
046271 TTTTTCTTTA ACAGACTTGG ACTCATCAAC AGCTCGCTGG CGATTCGGGC TAGTGTCCAC TCATGGGCGA 
046341 TATTATTATT GATAACCGTA CAAACTCGTG TTCGCATGTT CGGTTGTAAA ACGTTCAGAA GCAGCGGTAT 
046411 AAAGTGCTCA TCCTCAAGAA AAACAGATAA CAACGCAAAG ATTAATGCTC TTTTACGTAG CATTTCTGCA 
046481 TAGCGAAGAT TCTTATTCTG CGATAGTTGC GCAACTTCCT GAAAAACAGG AATATCTCTA CTACAGTGAT 
046551 GAACGAGTAA TGAAGAAACT TTTTTATGTG CATGAAGATT TAATGCCTCC TCCTTGAGCA TCGGGAGAAA 
046621 TAATGAAAGC GTGTCCCTTG ACACGAATAC AAAATTTTCA ACACACTTAT CTACTCGAAT TTGGCTTGCA 
046691 TCCGCAAAAA CCAGGTCACC GCCATTAAAA TAGCGATATT CACCATTAAC CATGGTGAGA ATATATTTAT 
046761 GTCTTGCATA CGCAATTAGA CAATTCCCAT GTAGTGATTG CATAGTTGAC TTAATATTAC ATAAACATAT 
046831 TACTGTTTAT TAATGTAGCA CGCCGCCCTC TTAAGTCAAA TTGATTGATA AATAAATTTA AACGAAGCGG 
046901 GAGAACAGGA TGATAATGTG TGATGTTCTA CGGGCAGGAT GACTGGATTT ATAATACAAA AACGTGTTTA 
046971 AGAACACAGG GAAATTAATA GTAAGCAAAT AATCCCTTTT CGTGACATTA AAGGTAATCG CTACATTTAA 
047041 TAAACATTCA TATAACATAT ATCTTATCAA CACGATGAAT AGACAGCCAA TATATTATTG CGATTAATAA 
047111 GCAACCGAAT GCCCAGCTGT TTTTTTAAAG GCTGGGCATT CGGTTTTTAC AACGTTATGT TATCAGGTGT 
047181 GTTTAAAGCT GTTCTGCTGG GCAATACCCT GCAGTTTCGG GTGATCGCTG AGATATTTCA GGGAGGCTTT 
047251 GTAGTCTTCC AGCAACAGTT CAGCAAAGTC CATTTCGAAG CCGCGACGAC ACATAATGCG CATCACCACG 
047321 ATGTCGGTGG CTTCACCGCC GAGAGTGAAG GCCGGAACCT GCCAGCCGCG CAGACGCAGA CGTTCAGAGA 
047391 GGTCGTACAG GGTGTATCCC GGATCTTCAC CATCTTTCAG TTTGAAGCAA ACCGCCGGGA TGCCTTCGTC 
047461 CGGGCGACCC GTACAGATGA ACTCATACGG CCCCAGTTTG GCGATTTCAT CCGCCAGATA AGCGGCAACC 
047531 TGGTAAGAGG CGTTCTGTAC TTTGGTATAG CCTTCACGAC CGAGGCGCAG GAATTCATAG TACTGTGCAA 
047601 TTACCTGACC CGCCGGGCGG GAGAAGTTGA TGGCAAAAGT ACCAATTTGA CCACCCAGGT AGTCAACGTT 
047671 GAACACCAGT TCCTGCGGCA GCGCTTCTTC GTCACGCCAG ATAACCCAGC CGCAGCCCAG CGGAGCCAGA 
047741 CCGAATTTAT GGCCTGAAGC ACTGATCGAT TTCACACGCG GCAGGCGGAA GTCCCAGACG ATATCCGGGG 
047811 CGACGAACGG TGCCAGGAAG CCACCGCTGG CAGCGTCGAT GTGCATGTCG ATGTCGATAC CGGTGTCGGC 
047881 CTGGAATTTA TCCAGCGCAT CGTGCAGCGG TTGTGGGAAC TCATAGTTAC CGGTGTAGGT CACGCCGAAA 
047951 GTCGGCACCA CGCCGATGGT GTTTTCGTCA CAGGCTTCAA TCATGCGTTT CGGGTCCATA AACAACTGAC 
048021 CGGGGCGCAT AGGGATCTCA CGCAGCTCCA CATCCCAGTA GCGGGCGAAT TTATGCCAGC AGATTTGTAC 
048091 CGGACCGCAC ACCAGGTTTG GTTTATCCGT TGGTTTGCCT GCAGCTTCCA TACGCTTGCG CCAACGCCAT 
048161 TTCATCGCCA TCCCGCCGAG CATACAGGCC TCGGAAGAAC CAATGGTGTT GGTGCCAACG GCCTGACCAT 
048231 TTTTCGGCGC AGGCGCATGC CACAGATCGG CAACCATATT TACGCAACGC AGGTCGATGG CTGCGGATTG 
048301 CGGATATTCT TCTTTGTCGA TCCAGTTTTT ATTGATCGAC AAATCCATCA ATTTATGGAC GTTTTCGTCG 
048371 TCCCAGGTCT GGCAGAAAGT GGCCAGGTTC TGACGAGCGT TGCCATCAAG ATATAATTCA TCATTGATAA 
048441 TCTGAAATGC GACATCATCG CGCATTTCGT GCAGCGGAAA TCGTTTTGAC TCCGCGATAG TAGAAATGGC 
048511 CTTTGCGCCA AAACGTGAAT CGAGTAGTTC TGAGCGGAAA TCCGTTAACA GCTTCTGGTC CATTTCGAAC 
048581 TCCTTAAATT TATTTGAAGG CAATAAAAAA GTAGGATTTA TCCGCAATGG AAGCAAGGCA TTACAGGCTT 
048651 AATTTAAATA ACAAAATCCT AAGCAGAAAA ACGACTTTTT ATAATATAAA CATTTAACAT GATAATATTA 
048721 AAAACAGACT TTATTATCGT AATAAAAATC GCCCAAACAT TGCTGTTCGG GCGATCAAAT TAATTATTGT 
048791 TTATCCTGCA TATACGGCGT GTACACCCCG TTCAGACTGT GCAGGAAAGC TACGATATCA TCCACATCCT 
048861 CCTGCGGCAG CTCTTTGCCT ACCTGATAGC GCAGCATCAG TTTCACCGCC CCGTCCAGCG TCGGCACGTC 
048931 ACCGCGATGG AAGTACGGTG CCGTTAAAGC AACGTTACGT AAACCGGGTA CTTTCTGACG CAATTTATCA 
049001 CGCTCTTCTT TAGTCACATT CATACGACCA ATATCCGCCG CCGTAATTTC CCCAAAGTTA AAGTCTTTTT 
049071 TCAGCCCCAA CGGTTCAAAG GAACGTCCGC CGAGAATAAT ACCACCATGA CAAGTTGCAC ATTTATTATC 
049141 TTTAAATAAT TGATAGCCTT TTTTCTGTTG CGCCGTCAGC GCATTTTCAT CTCCGCGCAA CCATTTATCA 
049211 AATGGGGAAT CCGGCGTAAT TAATGTTTTC TCAAATTCAG CAATGGCATC AGTAATATTT TCGCCACTGA 
049281 AACCTTGCGG ATAGACTTCG AGGAACTGCG TTTTAAGCTG CGGATCTTTT TCCAGCTTAG CAATAATTTC 
049351 GTCCCAGGAT TTCGACGCCA TTTCAATCGG GTTCAACGGC GGTCCACCAG CCTGATCCTG CAATGTTGCC 
049421 GCACGACCAT CCCAGAACTG CTCAACGTTA AATACTGAGT TAAATACCGT CGGCGCGTTA ATCGGCCCAA 
049491 CTGCGCCACC AACACCAATC GATGTTTTTC TGCCATCGAC GCCCCCCGCA TTCAACGCAT GGCAATGAGC 
049561 GCATGAAATG GTGCTATCAG CCGATAAACG GGGATCGTGA TACAGCGCAA AACCCAACGC CACTTTTTGC 
049631 GCATCGGTAG GCAGTTTTTG CGGGATGGGC TGCACCGGTT CATTGCGATG TTCCGGAGCA GTATCATTGC 
049701 TGGCGTAATA TTCCGCGCGC TGTTTTGCAA TCCAGGCCAG TATTTCCGCC CGCTCTTCAT CACTCACCTT 
049771 ACCCGCCCAG TGTAGCGCGG TATAACGCGT TGGTGGCATA GTTTCATACT GCATCACCCA TTCAATCTTA 
049841 TTCAAATCGC TTTGCGAAAC GGGTTTATCA GCCAGCAGTG CCGCACGCAC GGCCTCAAGG TTAAAAGATT 
049911 TATATCCAAG CTTAATGTCG TAATCCATCA ACTGTTTCGC GCCAGGAATA TAATAATAGG CGGGTAATTC 
049981 TGCCGAAGGC GTGTGGCAAT AGTCGCATCC TTTTTCGCGG AGAAAGCCTA AAACCTTATT ATTTTCACTG 
050051 ACAGCAGATG CCTGAACATC GGCCTGTTTA CTGCGTTTAT TATCGTGGTA CCACACATAA CCAGATAACC 
050121 CTAAATAGCA AATCGCGACG CCAGCCAGGC CGATCGCGGT AATACGTGAG ACCATTTTCA TTATTCTTCC 
050191 CTCACGGTGG TGAGTTATTG TGACCCAGAA AATTTTCCAG AATGCTGCAA ACGTCTCTGC GAGACAAAGC 
050261 CATCATAAAA AACAGGGAGA TACGCTTTTT GATAGGAATC AATCAATTAC ATGAATATAA ACTATCAATA 
050331 AGATAGCCTG TGCCTATTAC CCAGATCAGG AATGGCATAT CATGATTGCG GCGAGAGCAG GATTGAATGT 
050401 TCTGAAAATG AAAAACAACA CCAAATCGGT ATTTTTATAA ATTCCATTGA TATTAGTGCG TTATATTTTT 
050471 TGACAGGTTA ATAAACGTGA TCCACCGCAC GCTTTGTCGC CCACCAGGCG GAGCGAATGA CTACCCTTAA 
050541 AGAAAAGCCG ATAATTAGCG ACGAATTTCG GAGGTTGGAT CCTTATGCTC AATCAGAAAA TTCAAAACCC 
050611 TAATCCAGAC GAACTGATGA TCGAAGTCGA TCTCTGCTAT GAGCTGGACC CGTATGAATT AAAACTGGAT 
050681 GAGATGATCG AGGCAGAACC GGAACCCGAG ATGATTGAAG GGCTGCCTGC CTCTGATGCG CTGACGCCTG 
050751 CCGATCGCTA TCTCGAACTG TTCGAGCATG TTCAGTCGGC GAAAATTTTC CCCGACAGTA AAACCTTTCC 
050821 CGACTGCGCA CCTAAAATGG ACCCGCTGGA TATCTTAATC CGCTACCGTA AAGTGCGCCG TCATCGTGAT 
050891 TTTGACTTGC GCAAGTTTGT TGAAAACCAC TTCTGGCTGC CGGAGGTCTA CTCCAGCGAG TATGTATCGG 
050961 ACCCGCAAAA TTCCCTGAAA GAGCATATCG ACCAGCTGTG GCCGGTGCTA ACCCGCGAAC CACAGGATCA 
051031 CATTCCGTGG TCTTCTCTGC TGGCGCTGCC GCAGTCATAT ATTGTCCCGG GCGGCCGTTT TAGCGAAACC 
051101 TACTATTGGG ATTCCTATTT CACCATGCTG GGGCTGGCGG AAAGTGGTCG GGAAGATTTG CTGAAATGCA 
051171 TGGCCGATAA CTTCGCCTGG ATGATCGAAA ACTACGGTCA CATCCCCAAC GGCAACCGCA CCTATTATTT 
051241 GAGCCGCTCG CAACCACCGG TTTTTGCGCT GATGGTGGAG TTGTTTGAAG AAGATGGTGT ACGCGGTGCG 
051311 CGCCGCTATC TCGACCACCT TAAAATGGAA TATGCCTTCT GGATGGACGG TGCAGAATCG TTAATCCCTA 
051381 ATCAGGCCTA TCGCCATGTT GTGCGGATGC CGGACGGATC GCTGCTCAAC CGTTACTGGG ACGATCGCGA 
051451 CACGCCGCGT GACGAATCCT GGCTTGAGGA CGTTGAAACC GCGAAACATT CTGGTCGCCC GCCCAACGAG 
051521 GTGTACCGCG ATTTACGCGC GGGGGCGGCC TCCGGTTGGG ATTACTCTTC CCGTTGGCTG CGTGATACTG 
051591 GTCGTCTGGC GAGCATTCGT ACCACCCAGT TCATCCCCAT CGATCTGAAT GCCTTCCTGT TTAAACTGGA 
051661 GAGCGCCATC GCCAACATCT CGGCGCTGAA AGGCGAGAAA GAGACAGAAG CACTGTTCCG CCAGAAAGCC 
051731 AGTGCCCGTC GCGATGCGGT AAACCGTTAC CTCTGGGATG ATGAAAACGG CATCTACCGC GATTACGACT 
051801 GGCGACGCGA ACAACTGGCG CTGTTTTCCG CTGCCGCCAT TGTGCCACTC TATGTCGGTA TGGCGAACCA 
051871 TGAACAGGCC GATCGTCTGG CAAACGCCGT GCGCAGTCGG TTACTGACAC CTGGCGGGAT TCTGGCAAGC 
051941 GAGTACGAAA CCGGTGAACA GTGGGATAAA CCCAACGGCT GGGCACCGTT ACAATGGATG GCGATTCAGG 
052011 GATTTAAAAT GTACGGCGAT GACCTTCTGG GTGATGAAAT CGCGCGAAGC TGGCTGAAGA CGGTGAATCA 
052081 GTTCTATCTG GAACAGCACA AACTGATCGA AAAATACCAT ATTGCCGATG GTGTTCCCCG CGAAGGCGGC 
052151 GGTGGCGAGT ATCCGTTGCA GGATGGGTTT GGCTGGACTA ACGGTGTGGT ACGCCGTTTA ATTGGTTTGT 
052221 ACGGCGAACC ATAATATTTT TACAGCCAGC CGCTAACTTC CTGCTGGCTG TAAAATTATC CTCTTCAGGA 
052291 GGAGATATTT AACATCATTG CCGCCTGGGT GCGATTTTTC ACTTCCAGAC GGCGATACAG GGATTCCAGA 
052361 TGCGCTTTTA CCGTTCCGGT ACTGATATTC AGCGCTCTGC CGATCTCCTT ATTTGATTCG CCCGCCGCTA 
052431 ACATGGTTAA AATCTCCCGC TGGCGGGCGC TTAACGATTT GAGATCTTTA ATGTCCTTTT CCGGCGTCGT 
052501 CCGCCAGTCT CCAGGCAGAA ACATCATCCC CATCGCCGCA CTATTTACCG CCAACGCAAA TGTCTCGACG 
052571 GTTGAATCAC GAGGCACAAT GGCCAGCACA TTAAAATGGA TAACTTCCTG TAACCACCGT TTATTGCAAT 
052641 CCGTCGCCGT AATTAACACC TTAACCTCAG GAAATTGCAC CACGGTTTTT TGCAGCAACC AGTAGCAAAA 
052711 CTCACCATCC TGATCGCCAT CGAGCATAAC TAAGGCTTCA GGGTAACTTT CCAGCTTTTG CCATAACTCG 
052781 TCTGCCTGAC TGGCCCCCTG AATACTCACT CCTGGAATAC GCTGCTGTAA ACTGATTTTC ATTCCATGAA 
052851 TAAATATTGA CTGCCTGTCA AACATGACTA TTTGCATAAC TGAATCTCCA CCTGAATACG TTAAAAAGAC 
052921 TTAAGTAGTG GAAGGGTATT ACCCGCGAGA AAAAATAAGA ATTCGCCATT TGGCGGTGGC CATTCTACAG 
052991 AGATGACGTG TAGAAAATAG TTACCGATAT AAATAGTTAC AGCTAAACGC CTGAAATTAC ATGTCGAGGG 
053061 CACTATTTAA AACAATTTTG AGGATTTCCT TATATTGGTG GTTAGTACGC ATGCAATTAA AAATGAAATT 
053131 CCGCGACCAC AAGCCAAAAT AACAAACGGC AAGGAGACAA AAATAAGCAC AAATAGCCAA CACGTCCTCT 
053201 GTTCACTTTA AAGGGAATCG CTGAAAAATA CGCTCTGTTT AAGGGGATTC ACCTTTCTCA GAAAGCTATT 
053271 CCGCCCTTTT CCTGCTGAGA AATCGCCACA TTCGGCATGA CAACATTGTG AAACCCGGCA TTAGATGTTA 
053341 GAAAAAACAA TAAACAATGC GATATGCGCG TTACTGTTTC GCTGTGAACA ACAATCGGTC AAAGAAATGG 
053411 ATAAAATTCA CGCAATGCAG TTGTTCATCA AAGTCGCGGA GCTGGAAAGT TTTTCCCGCG CAGCGGATTT 
053481 CTTTGCTTTG CCAAAGGGAA GTGTTTCGCG CCAGATACAG GCACTGGAAC ATCAACTTGG CACCCAGCTT 
053551 CTCCAGCGCA CCACGCGACG GGTCAAACTC ACGCCAGAAG GCATGACCTA TTATCAACGA GCAAAAGATG 
053621 TGTTGAGTAA TCTCAGCGAA CTGGACGGTC TGTTTCAACA GGATGCCACC AGTATCAGCG GTAAATTACG 
053691 CATCGACATC CCGCCAGGAA TCGCGAAAAG CCTGTTACTG CCGCGCCTGT CGGAATTTCT CTATCTGCAT 
053761 CCGGGAATTG AGCTGGAACT GAGTAGCCAT GACCGTCCGG TAGATATTCT TCATGATGGT TTTGATTGCG 
053831 TGATACGCAC TGGCGCGTTA CCGGAAGATG GCGTTATCGC CCGTCCCCTC GGCAAACTGA CCATGGTCAA 
053901 CTGTGCCAGT CCGCACTATC TGACGCGCTT TGGTTATCCG CAAAGCCCCG ATGATCTGAC TTCACACGCA 
053971 ATAGTGCGTT ATACACCGCA CCTGGGTGTA CATCCGTTAG GTTTTGAGGT TGCCAGCGTT AATGGCGTCC 
054041 AGTGGTTTAA GTCTGGCGGC ATGTTGACGG TAAACAGTAG CGAAAACTAT CTCACCGCCG GTCTTGCCGG 
054111 TCTGGGGATT ATTCAGATCC CGCGCATTGC CGTGCGCGAA GCCCTGCGTG CCGGGCGGCT TATTGAAGTA 
054181 TTACCTGGCT ACCGTGCCGA GCCGCTCTCC CTTTCGCTGG TTTATCCGCA GCGTCGGGAG CTTTCCCGGC 
054251 GTGTAAACCT GTTTATGCAG TGGCTGGCTG GCGTAATGAA AGAGTACCTG GACTGACCGA CTATACTTTT 
054321 TAAGAATGAC CACGACAGAA GGACAAAAGA GCGGATGACG CAGGAAAACG AGATCAAACG TCCCATCCAG 
054391 GATCTGGAGC ACGAGCCGAT TAAGCCGTTG GATAATAGCG AGAAAGGCAG CAAAGTTAGC CAGGCGCTGG 
054461 AAACCGTCAC CACCACTGCC GAAAAAGTCC AACGCCAACC GGTTATTGCG CACCTGATTC GCGCGACAGA 
054531 ACGCTTTAAC GATCGGCTGG GTAACCAGTT TGGTGCGGCT ATCACCTATT TCTCATTTTT GTCGATGATA 
054601 CCAATTTTGA TGGTGTCGTT TGCCGCAGGG GGCTTTGTGC TGGCCTCCCA TCCGATGTTG CTACAGGATA 
054671 TCTTCGACAA AATTCTGCAA AACATCAGCG ATCCGACGCT AGCCGCCACG TTGAAAAACA CCATCAACAC 
054741 CGCCGTTCAG CAGCGTACGA CTGTAGGGCT TGTCGGCCTG GCGGTGGCAC TTTATTCCGG CATCAACTGG 
054811 ATGGGTAACC TGCGTGAAGC GATTCGTGCC CAGTCGCGCG ATGTCTGGGA ACGCTCGCCG CAAGATCAGG 
054881 AGAAGTTCTG GGTAAAATAT CTGCGAGATT TTATTTCGCT GATTGGTTTG TTGATTGCGC TGATTGTGAC 
054951 GCTTTCGATC ACCTCGGTTG CCGGTTCGGC GCAGCAAATG ATTATTAGCG CCCTGCACCT GAACAGCATT 
055021 GAGTGGCTGA AACCGACGTG GCGATTGATT GGCCTGGCGA TTTCCATCTT CGCCAACTAT CTGCTTTTCT 
055091 TCTGGATCTT CTGGCGGTTG CCGCGCCACC GTCCGCGCAA AAAAGCCCTG ATTCGCGGAA CATTTCTGGC 
055161 TGCTATTGGT TTTGAAGTGA TTAAAATCGT GATGACCTAC ACCCTGCCAT CGTTGATGAA ATCCCCCTCT 
055231 GGCGCAGCAT TTGGTTCCGT GCTGGGGCTG ATGGCATTTT TCTACTTCTT CGCCCGTTTG ACGCTGTTTT 
055301 GCGCGGCGTG GATTGCCACC GCCGAATATA AAGACGACCC GCGAATGCCG GGGAAAACGC AGCCTTAAAA 
055371 TAGGCCGGAT GCGGCGTAAA CGCCTTATCC GGCATACGAT TTTATTCGGC CTGGCTCCCC GTAGGCCGGA 
055441 TAAGATGCGC CAGCATCGCA TCCGGCTATA ATGCGCACAT AACCTCTTGA AACTCGTCCC CAGAGCCTCT 
055511 TCAGCCATCT ATTTGGGAGC AAACAATTTC ATTCCAACTC ATAACCCCAG CATATAAATC CAGTTGGTAA 
055581 CTTTTATTTA ACCTGAAACC AGTTTTATCC ACTATTTATA AAATTATGTG AAGCATTTCA TAGAAGAAAA 
055651 ATCACTGGCC TAAACATTAT CCCCTTTTTG CCTGATTTTT GACCATTTCC GCGATTTGTT ACACATTGAA 
055721 ATATCACTTT TGCTGTGCGT AATATGGCTA TTCGTTAGCC AAAAAATAAG AAAAGATTAT GCAAGCAACA 
055791 GCCACAACAC TCGACCACGA GCAAGAATAC ACGCCGATCA ACTCGCGTAA TAAAGTCCTT GTCGCCTCTC 
055861 TCATTGGCAC AGCCATTGAG TTCTTCGACT TTTACATTTA CGCCACTGCG GCCGTTATTG TGTTTCCGCA 
055931 TATCTTCTTC CCGCAGGGCG ATCCTACGGC AGCAACGCTA CAGTCGCTCG CCACCTTCGC CATCGCCTTC 
056001 GTCGCGCGCC CCATTGGCTC TGCCGTTTTT GGTCATTTTG GCGATCGCGT TGGGCGTAAA GCGACGCTGG 
056071 TCGCCTCGTT GCTAACGATG GGGATTTCGA CCGTGGTGAT TGGTCTGCTG CCGGGCTATG CCACGATTGG 
056141 TATTTTCGCC CCGCTGCTGC TGGCGCTGGC TCGATTTGGT CAGGGTCTGG GCTTAGGCGG TGAATGGGGC 
056211 GGCGCGGCGC TGCTGGCGAC TGAAAACGCC CCACCGCGCA AACGTGCACT GTATGGCTCC TTTCCGCAGC 
056281 TGGGCGCACC GATTGGCTTC TTCTTTGCCA ATGGCACTTT CTTGCTGCTT TCCTGGCTAC TGACCGACGA 
056351 GCAGTTTATG AGCTGGGGCT GGCGTGTGCC ATTTATCTTC TCGGCGGTGC TGGTCATTAT CGGCCTGTAT 
056421 GTTCGCGTGT CGCTGCATGA GTCGCCGGTG TTTGAGAAAG TCGCTAAAGC GAAAAAACAG GTGAAGATCC 
056491 CGCTGGGTAC GCTGCTGACC AAACATGTTC GCGTAACCGT ACTGGGTACG TTCATTATGC TGGCAACCTA 
056561 TACGCTGTTT TACATCATGA CGGTCTACTC TATGACCTTT AGTACCGCCG CCGCGCCAGT TGGGCTTGGC 
056631 CTGCCGCGTA ACGAAGTGTT GTGGATGTTG ATGATGGCAG TTATTGGTTT TGGCGTGATG GTGCCAGTCG 
056701 CTGGATTACT GGCTGATGCC TTTGGTCGCC GTAAAAGCAT GGTAATCATC ACCACGCTGA TCATCCTGTT 
056771 CGCGCTGTTC GCCTTTAACC CACTGCTCGG TTCTGGCAAC CCGATTCTGG TTTTTGCCTT CCTGCTGCTG 
056841 GGGTTAAGTC TGATGGGTCT GACCTTCGGG CCAATGGGTG CGCTGTTACC AGAGCTGTTT CCGACAGAAG 
056911 TGCGTTACAC CGGAGCATCG TTCTCTTACA ACGTAGCGTC GATTCTCGGG GCTTCCGTTG CGCCATATAT 
056981 CGCAGCCTGG TTGCAGACTA ACTACGGGCT AGGTGCGGTG GGGTTATATC TGGCGGCGAT GGCTGGCTTG 
057051 ACGTTAATCG CCCTGCTGCT GACCCATGAG ACGCGACATC AGTCGTTGTA ATAAGAGTGA AAAGCCTGAT 
057121 GCGCTACGCT TATCAGGCCT GAATTTCCAT ACAATATATT GAATTCGCAA GGATTTGTAG GCCGGATAAG 
057191 GCGTTCACGC CGCATCCGGC ATGAACAAAG CACACTTTGC CAACAATCTA AATCTGTTTA ATTGCCGGAT 
057261 GTCAGACATC CGGCAATTAT CATCACTTCT TCATCTGCGA CAAAATCGTC CGACACTGAT TAGCCTCCCC 
057331 TTCGGAAGGT GAGATCAGTG CCAGTAACGC CGCCGCCGGT GTTACCAGCG TTGCCAGTGC CGCAGCAACA 
057401 GCACCACGGG CAATCAGCGG TCCGGCTTTC ACCCCAGCCT GCGGATTTTT AAACGTCCCC CGCACATACA 
057471 GCGGCGAACG CAGTGTGATA ATCCGAATTC CTTTACTCTC CGGATCAATA GTCAAATCCA GCTGTTCCGA 
057541 AGCAAAACTT GCCGTGCCGG TAACATTAAT CAACGCGTTC TCAGTATCGA AAGCAAAAAT CTGCGGGCGC 
057611 GCCACGCCGT TGGCAATATT CAGATTCGCC GCCGCGCAGT TCACCCGCAC CTCATCATCA CCAAATATCG 
057681 CACCGACAAT GTAGTTGCCG ACATTCAGCC CAACAATCTC CATCAGGTTG CGGCTCACCA GCCCGTCATT 
057751 CATCAACAGT TTCAGGTTGC CGTTACTGTT GCCTAAAAGT GCCGCCACCG AGTTACCGCT ACCGCGTAGT 
057821 TCCGCGTCAC CGTTCATTTC CCCCAGCGTC TTCTGCATCA GTTCCACATC GGGCATCAGT TCTTTCAGTT 
057891 TCAGTCGACG AGCCTGAATA TCTGCCCGCC CCTGCATCGG CTTTTTATCG CCTTCCAGAT GAATATTCGC 
057961 CGCAATGCTG CCGCCCGCCA TGCCAAATTT CAGCGGTTGC AGGCGCAGGT CAGCATTTTT GAGGATGATA 
058031 TGAGTAGAAA GATCGCTAAT CGGCAGGCTA CTGCCATGCT CAATGCGCCG CCCTTTGAAG CGAACATCGG 
058101 CATCCATAAC GTCCCATTTA TCGGTTTCGA AGCGGTCATA AGGCAGCACT TTGCCCGCAG GCTGAACGCT 
058171 TTTTTCGCCC TTCTTCTGTT CAGACCGTTT CGACTTTTCT GCCCCTTTCC CGGAATCAAC GCCAATCAAC 
058241 GGTCCCAGGT CCGCCAGCCG CAATTGCCGC GACTCGACAT CACCTTCCAG TTTTGGTCGT GGCTTTCCGG 
058311 TGGTGTAGAC CAGAGAACCG TGGATATCGC TATCACCAAT TCGCCCATTA AAACCGCGAT AATCAAAGAC 
058381 CGACGATTTT TCAGTGTCGA TTTTCGCTAC CAGCCGACCA TCCGTTTCAA ACGGCGGGGT ATCGGGCAGC 
058451 AGAACGCCCG TCAGTTCATA GAGATCACCC AGTGAATCGC CAGAAAATTT AAGCCGTAAA TCGACACCGC 
058521 CCATCTTCAT TGGGTCATTC ACGACGCCAT CAAAAGCAAC ACGGGTGTTA CCAGAGCGGA AATCAGCCTG 
058591 TACCGGAAAC GGCGTCCCTT CGCCACGCAG CGCCAGCATA CCGCCTATTT TTCCCGTACC CGTGAGCGGT 
058661 TCACCGTTAT ATCGTCCCTG CGCCTTCAGG CCAAAAACGT AATCGCCCAC CTTTTCTTTA TCCGCTTTAC 
058731 CTTTCGATCC AGTAACTTCG CTGAACGGCA GCGGCTTGCC TAAGGGATCA ACAAAAATCT CCAGATCCGC 
058801 TTTGCTTACT TTGTCATCAA TGGCGATCCG CCCTTGATCG AAAAGAATAT TATCCAGCCG AAACGACCAT 
058871 GCCGACGGCT TTGCATTCGC GTCTTTGTTA TCATCGTTGG CAAGATTAAA CGTCCAGTTA TTGTTCTTTT 
058941 CAGAGAGGCG AATCAGGCGC GCGTCGGGCT TTTCGAGCTT GATCCACGGC AGCCAGACCG TTTTGGTCAG 
059011 CAGCGCCAGC GGGGCCAGCG TTGCCTCTAC GCGTGGCAAA TGCACCATCG TGACTTCGGG AATATCCGGT 
059081 GGATTGCCAA GAATGATGTC TTCCGCGTGT ACATGGGGCC ACGGCACCCA GCTGCGCCAG CCAGTTTCTT 
059151 GTTTTTGCCG CTCCCACACC ACGCCCAGAT CGCCACGGAT AGCGAACGGA CGATTCAACT CCGCAGAGAC 
059221 TTTCTGGTTG ATAGTCGGTT TGAGTCGATT CCAGTCAAAA GTTGCAATCA AAATGATCGC CACGACAATC 
059291 AACAACAAGA AAGCCCCTGA AATCGCAGCG GTTATTTTGC CTGCCTTGCT CATCGTTCGC TTCCTCATAT 
059361 TCTTCCTGTG CCAGTCCTAA AGATAGTCCA GCCAGGCGGA AAATGAGGCA GCTTATAGCG CCAGAACCGC 
059431 CGTATTCAGC GTTTCTATCG GTGCCGGGCG TGAAAGAAAC CAGCCTTGTG CGGCGAATGC GGGCGAGTTC 
059501 TGAACATCAC GCCACTCTTC CGGCGTTTCT ACGCCCTCGA CAATCACCCC GCGACAATAG CGATTCATTA 
059571 GATGTAAAAG CTGAGAAAAG AGTGTGCGTC CTTCCGGCGA CTGACGCAGC ATCACAAACA GTTCTCGCGC 
059641 GATTTTGATG TAGTCATAAC GCACTTCACT TAGCGCAGAG AAATTTGCCA TCCCGGTACC AAAATCATCC 
059711 AGCCACAGCG GGCCAAATTC ACACATCGAG GCAAAGGTTG AATCTTTCGG CAGACGGATA TGCTCCACCA 
059781 GTTCGAAACG CAGCCAGGGA AGACGCTCAA TCTGGCGCAG GATTTTTGGT TGCTGACGCA GGGCGATGAG 
059851 CGTAGGGCCA TCAATATTGA CCGATGCCAG CAGGCCGTGC TCTATAAAGA AGTCGGCTTT TTGCGCCAGC 
059921 AAATCAATCT GCTCTTTCAC AACCTCCATC CGATGGCTGA CGGTGATTTC AGTAAAATAG CGATCCGGCG 
059991 GCAGGCGTTG CGAAGGGTTC AAGGGATGCG TGACCACCGT TAATAGCTCC ACGGCCATTA ACCGCCCGCA 
060061 TGTTTGATAG ATCGGCTGCC AGGTGTAAGC ACGCTCACAC TGCAACCAAA AACGCCGTTC CTGCAAGCTC 
060131 TCGATGCTTG CTTCAGGGTT GCTTATTCGC TGGATAACCT GCCTTATCAT CAAAGATGTC CTGTGTTTAA 
060201 AAGTGATGCT GCCCGGACTC GACAAAGATT ATCGGCGCGT AAGGGCAGAA CTTTACCGCC TGGCCGGGGT 
060271 AAATTTCCTC ACTCCACAAC GGAATCTTTC AGGAATACGT TCTGGCTCAA AAAAATAATG GAACACTGTT 
060341 TTAATATGGT TGACCAGCAA ACCACCACAG CGCAAACTAA CGCTAATTTT TTACAGATCA GGTTCACGAC 
060411 TATGTCCAAA AAGATTGCCG TGATTGGCGA ATGCATGATT GAGCTTTCCG AGAAAGGCGC GGACGTTAAG 
060481 CGCGGTTTCG GCGGCGATAC CCTGAACACT TCCGTCTATA TCGCCCGTCA GGTCGATCCT GCGGCATTAA 
060551 CCGTTCATTA CGTAACGGCG CTGGGAACGG ACAGTTTTAG CCAGCAGATG CTGGACGCCT GGCACGGCGA 
060621 GAACGTTGAT ACTTCCCTGA CCCAACGGAT GGAAAACCGT CTGCCGGGCC TTTACTACAT TGAAACCGAC 
060691 AGCACCGGCG AGCGTACGTT CTACTACTGG CGGAACGAAG CCGCCGCCAA ATTCTGGCTG GAGAGTGAGC 
060761 AGTCTGCGGC GATTTGCGAA GAGCTGGCGA ATTTCGATTA TCTCTACCTG AGCGGGATTA GCCTGGCGAT 
060831 CTTAAGCCCG ACCAGCCGCG AAAAGCTGCT TTCCCTGCTG CGCGAATGCC GCGCCAACGG CGGAAAAGTG 
060901 ATTTTCGACA ATAACTATCG TCCGCGCCTG TGGGCCAGCA AAGAAGAGAC ACAGCAGGTG TACCAACAAA 
060971 TGCTGGAATG CACGGATATC GCCTTCCTGA CGCTGGACGA CGAAGACGCG CTGTGGGGTC AACAGCCGGT 
061041 GGAAGACGTC ATTGCGCGCA CCCATAACGC GGGCGTGAAA GAAGTGGTGG TGAAACGCGG GGCGGATTCT 
061111 TGCCTGGTGT CCATTGCTGG CGAAGGGTTA GTGGATGTTC CGGCGGTGAA ACTGCCGAAA GAAAAAGTGA 
061181 TCGATACCAC CGCAGCTGGC GACTCTTTCA GTGCCGGTTA TCTGGCGGTA CGTCTGACAG GCGGCAGCGC 
061251 GGAAGACGCG GCGAAACGTG GGCACCTGAC CGCAAGTACC GTTATTCAGT ATCGCGGCGC GATTATCCCG 
061321 CGTGAGGCGA TGCCAGCGTA AACGCAGCAT ATGCAAAAGG CTGGATAAAG TGTTACCCCT CTATCCAGCT 
061391 CATCCATAAA TACCTGATGG TTGTGCTAAC TCATCACCAT CAGGCATTAC TGTGCAGGTG GAATATCCGT 
061461 CACTTCAGGA TGTACGTCAT CCGTGGCGAC AGAGGTGGTC GCAGCGGCGG TAGATGGGGC CATGATTTGA 
061531 TCCCAGACCG CCTGCAACGC TTTCATGTTA AATTCCGGCT CGCCTTTCGG CTGCAGCAGT ATTAACGCCA 
061601 TATCATTCGA CAACTGTTGA CGCAGATCCT GATTTAACAT CTCTACCGTC AGGCTATTAA GGAAATCCTG 
061671 CCGCAGTTTC TGATATTGCT CCGGCGCGAT ATCGACAACC TGATTTTGCA ACGAACGCAT CCGCTGACCC 
061741 ATCAGAATAT CGGTATCAGC TCGTGCATAG GCGGCAAACA GTTTCTGCAG CTCCAGTTTC TTTTGCGCCA 
061811 CTAACGCATT GAACTCTTCT TCCGGCAGAC CTTTATCGCG AACCTTCGCC AGTTCACGCG CCACCAGATT 
061881 AAGGTTGCTG TTCAGCTTGT CGTTTGGTGA TTCGATGTTG ATGGCACACT GCGCACGCAG ATACAGCACA 
061951 CGGCAGTCAA ATCCAAGACC GATGTCTTTG CTGTTACTGG CACTTAACGC TTGCTGAACA TGCCAGAACA 
062021 GCGCCTCGCG GGCCAGGTCC GCACGCCAGT AGCGCAGCAG TGCGGCTGAT TCACGAATCG GCTGCCACGG 
062091 CGTATCCCAC ATGATAGATA ACCGGTCCTG ACGCACCGCG TCAGTCATAA TACTCACCGC TTCCGCACGC 
062161 AGCGGAGAAA GCGTCGGCAC CGGAGCTGGC GTTTCACGTT TGCCTTTCAG TTCGCCAAAC GTTTTGTTTA 
062231 TTTGGTCGAC AACCGAGCGC GCATCCACGT TTCCCACCAC CAGTAGCGTC ATTGCATCCG GGGTGTACCA 
062301 TTTCTGATAG AAATCTTTAA TTTTTTCCGC TTCAACGGGT TGTTTCAGCG GATCGGCAGG ATCGTGACCT 
062371 AACAAGGTTG ACCCTTTCAG ACGATAGCGC CACCAGCCCT CTTTAGTATC GGCAGGCCAG GTTGCCACCA 
062441 TGTCCTGACT TTGCAGCGCG TGGTTGATGG TTTCTGGTGT GATGGTCAAT TTGCCAGTGG CATTTGCCAG 
062511 ATAAGAGAGC GCTTCTTTCA GCAAATCGTT ACGGTTATTG GGCAAACTCA GATTAAACAG CGTGGTGTCA 
062581 TAAGAGACAA TTACCGGCGG CATCGGGCGT TTAGGGTCGA TCCCCTGCTG CCACAATGAA CGCGCCTGTG 
062651 CTGCGTCAAG GCCACCGCTT TGCGTTAGCG CAATACGAGG GATGGCGTGA CTGTAACCGC TCTGTTGTGT 
062721 ACTTTCGGCG AGCGAACCGG TATTAACCAG CAGGCGAATT TCAACACGAT CGCTGGGACG CTGGGGGGTG 
062791 GTCAGCACTT GCCACTGTAA ACCGTTGGAA AGCGTCCCCT GTTGCCATGC TGGATCAGGC TGGAGCGCAT 
062861 CTGCCTGCAC ATAGCCAGCA GTGGCCATCA TCAGCAAACC GCCCGCTAAA AGTCGAATTT TTGTGCCCTG 
062931 CATGTGAACC CCTGATCAAC TATCCTGGTA ATAAAAAAAC TGCCCGTTGT CGGTCAGTCT AAATGACGTT 
063001 AAAAACACTT CGTGTTAGAC CGCAAGAACA TGAAAATGTC ACGGAAGAAG TGAAATAAAC CTGAACTCAC 
063071 CCAGGTGGTA AGTTCAGGCA CAGGGGTCAA TTATGCGCAA ACACCCGCAC TCGGGGAAGG GAGTGCGGGC 
063141 ATAAGTGATG AGATTAAGAG GATAATTCGT GCGTTTTGCC ATCCGGCGCA CGATTATTCA GCACATCGTC 
063211 CAGTTTTTTG TGGTCCAGTT CTTTCACCCA CTTAGCAACG ACAATGGTCG CTACGCCGTT ACCGACCAGG 
063281 TTAGTCAGCG CACGAGCTTC TGACATAAAG CGGTCGATAC CGAGGATCAG CGCCAGACCC GCTACCGGCA 
063351 AATGGCCCAC CGCAGAGAGC GTCGCCGCCA GCACGATAAA GCCACTACCC GTTACCCCTG CCGCCCCTTT 
063421 AGAAGAAAGC AGCAACACGA TTAACAGCGT GATTTGGTGG ACGATATCCA TCTGACTGTT AGTGGCCTGG 
063491 GCGATAAACA CCGCCGCCAT TGTCAGGTAT ATCGATGTGC CATCAAGGTT AAACGAGTAG CCTGTCGGGA 
063561 TGACCAGCCC CACCACCGAT TTACGGCAGC CGAGTTTCTC CATCTTGTCG AGCATACGCG GCAGCGCCGA 
063631 CTCGGAAGAT GAAGTCCCCA GTACAATCAG CAGTTCTTCA CGGATGTAGC GGATAAATTT GAAGATACTG 
063701 AAACCAGTCG CTTTAGCGAT TGAACCCAAT ACCAGCACCA CAAACAGGAT ACAGGTAATG TAGAAACAGA 
063771 TAATCAGCTG CCCCAGTTGC ACCAGTGTGC CGACGCCGTA TTTACCGATG GTAAACGCCA TTGCCCCGAA 
063841 CGCACCAATA GGTGCCAGAC GCATGATCAT ATTGATGATG CCGAAGATGA CCTGCGAGAA ACTTTCGATG 
063911 ACGTTAAAAA TCAGTTGGCC TTTGCTGCCC AGACGGTGGA GCGCAAAACC AAACAGTACG GCAAACAGCA 
063981 GCACCTGCAG AATGTTACCG CTGGCAAATG CGCCAATGAC GCTCGCCGGG ATGACATCCA TAATGAAGGC 
064051 GACAATGCCC TGGTCTTTCG CCTGATCGGC GTAAACCGCT ACCGCTTTCG CATCAAGCGT TGCCGGATCG 
064121 ACGTTCATTC CGGCACCAGG CTGCACGACG TTAACGATGA TAAGACCAAT AATCAGCGCG ATGGTACTGA 
064191 CAATTTCAAA GTAAAGCAGT GCGACTGCGC CGGTACGACC GACCGCCTTC ATGCTTTCCA TGCCCGCAAT 
064261 GCCCGTTACG ACGGTACAAA AGATGACAGG AGCGATGATC ATCTTAATGA GCTTAACGAA GCCGTCGCCA 
064331 AGCGGTTTCA TTTGCTCGCC TATTTCAGGA TAGAAATGGC CAAGGAGAAT ACCAATGGCT ATCGCTGTCA 
064401 GGACCTGAAA GTAAAGGCTT TTAAACAGAG AGGTTTTCAT AGGGTGTCCT TTAGTAAAAC CACAGGTCTT 
064471 GTAAGGTTAT GGGGTACCTG CGGCCTTAAA ATAACACCCA GACAACATCA CAGAAATGTA CCTGGATCAT 
064541 AATTGAAACA AAAAGGTTAA AAAGTTTGAG CTGGCTCGCA CAAACCAGCA CTTTTTAAAG TTTTGTAATC 
064611 AGTTTGGGGT AGCTACTTTT CTTCCAGGTA ACTCTCTTCG AAGATTTCAA TAGGGAGTGG GCGAGCAAAA 
064681 AGGAAGCCCT GGGCAATACC AACGCCCGCT TTTGCCAGCC AGTCGCGTTG TGCTTCAGTC TCCACGCCTT 
064751 CGGCAATCAT TTGTAAGTTC AGGCTCTGCG CCAGCATGAT AATTGCAGCA ATCATGCTGC TATCTCCCGG 
064821 CAAGCCTTCA ACAAACATTT TGTCGATTTT CAGTACGTCG ATTGGCAACG ATTTCATATG CTGCAGCTGA 
064891 CGCAGCCCTG CGTAGCCCAT GCCGAAATCA TCCAGCGCCA CCCGAACTCC GGCATTGCGC AGCGGACGGA 
064961 GGATTGCCAC CGCAGCATGA GGGTCGTCAA TACGTCGGCT TTCTGTCACT TCCAGAATCA GTGTTCCCGG 
065031 CTGAATGCGA TAGCGGGTTA ACAGTTCCAG CATATCCGCC ACCATATTCG GGTGCATCAG TTGCAGCGCA 
065101 GAGAGGTTTA CCGACAAGGG CAGCATAATG CCGCGCTCTT GCCAGGCTGC AAGCAATCGA CAGGACTCTT 
065171 CCAGCACCCA GTGACCGACG GTAACCATCA GCCCACAGCA CTCAATGCGA TCGATTAAGC CATCCGGCAG 
065241 GTCCCAACTG CCATCCGGTT GCTGGATACG CAGTAACACT TCCGCACTGA CCAGTTTACC GCTGGTCATC 
065311 TCGACCTGTG GCTGTAACCA AATAGCAAAC TGATGATTTT CCAGTGCATT AAGGATATCG CTCTCTTCCG 
065381 TCAACCGCTT CTGGGCGGCT TCCATCTGCT GCGGATCAAA GAACTGAATC TGATTCTTGC CTTTATGGCG 
065451 AGCGGTAAAT GCCGCAGAAA TAGCGCGACT GTAAAGCTGT TCGGCGGTGA GATCGCCGTA GAACATCGCC 
065521 ACGCCAATGC TACAGTGCGG ACGGAGTTGA ATACGTTCAA TCGGCAGGCG CTCGCTCATG ATAGTGAGCA 
065591 CTTGCTGACC TAAGGTGATT GCGTGCCACG GTTCCTGTAC ACCGTTGGCA ATGACAGCAA AGTCATAACC 
065661 GCTAATCTGC GCGAGGATCA TACGTGGCGA CAGTACCGAT TTGAGTTTTT CCACCAGCGT CAGCAGCAGA 
065731 ATTTCTCGTT GCGCCTCTTT CAGCACGCCC GCAGTATCAC GCAGGGTTTC ACAGGTGATG ATCATCAGCG 
065801 CGGTGGTTTG TTTACGCGCG ACAACCTGCT CCAGCATCTC CATCAGCAAG GCTTTGTTCG GCAAATCCGA 
065871 CACCGGGAAG CGCATCGCAT TTTCGTTCTG TTCTTCATAA TGGCGCTGCA GCAATTGCTG GTTGAGGTTG 
065941 TAACTGCGCA CCAACATACC GATTTCATCG TCCTGATGCA GACGCGGTAA TGCCAGTTGG TGACCAACAA 
066011 GCTCCTTGGC TGGGATGGCG TTAAGTTCGC GAGCAATATT GCGTAACGGA TGCAAAATCA GGCGGTTAAT 
066081 GCACCAGCTG ATGGCGACGG TCAGGATAAG CGACAAAAGT AAGTAAATGG TCACTAACGT TGAGAGGGTG 
066151 CTCATCACGA ACTTATACAT ACGGAAGGAA TCCGCCTGTA GTACCAGATA GGCAATTGGC TGCGGGTTTG 
066221 CCGGACGTTC GAGCGAGTAA ACGCCCAGCG AGATTTGAAC CGGTAGCTCA AACAGGCGAG TAACCATTAC 
066291 CGGCACCGGG CGCTCTGGAA TAAAACTTTT ACGCAGCGCC TGGAACTGGT TAGGCAGCAC TACATCGGCA 
066361 CGGCTGACCA CGCCTGCCGG TTTAATGCTG GCAAGAATAG CTTCCGCTTC GGGAATATCG CCTTTCAAAA 
066431 TAGCTGAAGA TAAGGGTTCG CGGACAGAGC GAGCAATGCT TTCCAGTTGC GTAGCCGTGT TATAGCGATT 
066501 CTGCTGGACC AGATGGAACA GCAAAACGGT GCAAAAAATA AAAACGAACA CCAGGACAAC GGCTGCCACC 
066571 ATTGCCATCT GCTTGATTGT TAACGAGCGA CTTACGCGCA AATTGTCTCC CCCCGGAAAT CCCAGATTGC 
066641 CGCCCGAGTA TACCCGATCG CAGCGGCATT AAGAGAGGCG CTATCTGAAA ACTTACCAGT CGGCGTAAGG 
066711 TATCAGCGGC TGCGGCGGTA AATCCATGTC ACCCTGCCAT CCGGCGGCGG AATAACGTAC GTAGAGCAGG 
066781 AAATGGCTGG GTGCGTAATC TTTCGCCTGC TGGATATCAA TTGCCGTGCC AACAAACCAG TTGGAAGTAA 
066851 CACGTCGTTC AAGTAATGCC CGCGCCGTGT AGCCGAAGCC CTGACTGCTG CCGCCATCGT TGGATTGCCG 
066921 CGCAGCTTCT TCCTGCCAGT CGGTCGGGAT CAGATTCATC AGCGGATAAC GCGGCATGGT TTTGGTGCGT 
066991 GAATGCGACC ACGAGCCAGA CGCACCCAGC TCCCACGACC AGTTTTCCGT GCGCTCCCGC CACATCACCG 
067061 GTATGGCAAA CGACAGGTAT TCCTGCGGAC TGTAGTAACC GCCCTGACCG AGTGAGTAGC CACTCAGATC 
067131 TTTGTCGTAA TGCCAGATCA TGTTGTTCAG GCCGATTGTG ACGCGGCGAT TGTTCTGGTT AATGACCTTA 
067201 TAGTAATAGC CCGTCATCCA GCGCACGCGC CAGTTATCTT CGACATTTTT ACCGGTTAAC TGGTCGCCAC 
067271 TAAGCGATGC CCAGACGCCG TTTGCTTCAC CTTTATCGTA GCTCAGACTT AGCCCCACAC CGTCGGCACG 
067341 TACGCCACCC CATTTTTTCC CGGTATTGCT CGGGGAGTCT TTTTGCCCAC CAAAGGCCAG CAAAGAACTG 
067411 GAGATGGGCC GACGGTGGGC GTTAACGGTG TAACCCAGCG GCCCGATATC ATCGCTGTAA CTGATGCCGC 
067481 CGACCACATC CACCACGTTG AAGCCCATCG GCGTGGTACC GATATCCCAG CTCCAGACGT CATTTCGCCA 
067551 GCCGACCGCC ACGCTGGCAC CGGAATCCGA CTGGCTGCGG TTGCCGCTAC AGTCCTGTAA TGTACAGGTG 
067621 CCCCAGTTGT CATCCCATTT GCCATCGGCA TTAGTGGAGA AACTGCCGAC GTTCATATTG ACGAAATCAC 
067691 TGCGAAAGAA CATCCGCCCG TCAGAATACG GCGCATCCAC CTGCAACATG GTAGTGTGCG CTTTCAGATC 
067761 GGAGTAACCA CCGGTGCCGC TCGAACCCCA GTAATCGTGC TCAAGGGTGA CGTTAAGATC CTGCTGGCGA 
067831 TAGAGGTCCG CCGCATCGCT GCGCACGCCA CGTTTCAGCC AGTCATCTTT CTCGTCGTTA CGGGTCAGTC 
067901 GGGTAAAGGT GTCGTTATCC TGCGGACGCG TCGTAGTCAC ACCGGATGCG ACCATGGCGT CTTTGTAGGT 
067971 TTCCAGCGCC TGCGTTGGAT CGCCCGCCTG CGCTTCAAAC TTCGCACCAT CACGCAGCAC CATCGCGCTT 
068041 TCCATCGACG GTGGCTGAGA TTTTGCCTGC GGGATCAACT TATTAAACGT CCGCTGCGCT GCTGCGGTAT 
068111 CGCCAAGCTG CGCCTGTGCC AGCGCCACGC GCCGCTGTGT GTTCAGCGAG GCGTTATCGG TAGCGGGCAG 
068181 TTTCGCCAGC TGGCTACGTG CCGCCGCTTT GTCACCGGCA GCAATATCCA CTTCCGTCAG ACCAAGAATG 
068251 GCGTCGGCGT TAGCTGGCTC CCGCGTCAGG ACATTCTGAT ATGCAGCGCG GGCGGCGGTG TAATCACGTC 
068321 GTTGTTGCGC CCAGTCAGCC AGCGTGAGGT CAATACGCGT GGAAGGTGGT TGCTGGCGCA GCATCGCTTC 
068391 CGCTTCTGCC TCTTTGCCGC TTTCTCGCAG GCGGTTAGCG GTTTCCAGCA CCTGATCGCT TTGCAGTCGA 
068461 TTAACCAGCT CCTGAATATT GCTGTTCCAC TGCGCACGCG GCAGGCTATT GATATGCGCC AGCGCCGCTC 
068531 TGTCCTGGTC ATGACCAGAG AGGTACAGCC CGTAAGCGTA AACCTGCTCC GGGTCGTTCG ACTTCTGCTG 
068601 CGCCAGATTG CGCATTAACG TATCGGCCTG GCTGCGTTGT CCGGCCTGCC AGAGATCCTG CGAAAGTCGG 
068671 TAAGTAATCC ATACGCTGCC GGGGTCCAGC GCCAGTCGTT GCCGCTGAAG TGCTGCCGCC TGCGCCCATT 
068741 TGCCCTGGTT TTCCAGTGCC TCTGCCTGCT GTGCCAGACG GTCGTTTTGC AGGCTGCGTT CGATATCATC 
068811 AATGCTACGC CGCTGACTGG CAGAGAGCGA GGCGATAAAC GCTTCAGCTT TTTCTGGCGA TTGCTGGCGG 
068881 TAAATATTTG CCAGCCCGCG CACGGCGTTA GTGTTGCCGC TGTCCATACG CAAGGTCTGC TGATAATAAC 
068951 GTTCGGCGGC GGGATAATCT TTTCGCGCCA TCGCCACATC GCCCAGCCCC AGCACTGCAT AACTGTCGGT 
069021 GTTATCGACA TTACGCGCCT GCTGGAACAG GCGTTCTGCC CGGTCAGGAT TATTGGCTTT CAGCGCAGCA 
069091 TCGCCCTGCT GGATCGCCAG CCAGTAGCGG TTTACTTTCA GCAGACTGTT CCATTTGTCG TTGTTGCTGC 
069161 TGTGCGGGTC CAGTGCGAGG GCTTTTTCCA GATTCGCCAC TGCATTGGCG CGATCGCCTT TCTGAGAATA 
069231 CGCCTGGCCC AGCGCCCCCA GAGCTTCACT GTCTTTCGGG TTCGCCCGCA CCGCCTGTTG TAGTTCGGGA 
069301 ATGGCTTTAC CCGCCATACC AGAGTCCACC GCCGCTAAAC CTTGCGCACG AGCGCGGAAA GCAGGATCGG 
069371 CCAGCTGTTT TTGCTGTTCT GCCAGTTGCG ATTGCGCAGC CGCCACGCTA TCGCCATCAC TAAAGATCGA 
069441 GAGATATTTT TTCAGCGCCG ACACACTGGC ATCACTGACG GGCATGTCTT TAATCTGCCC GTACCAGATT 
069511 TTAGAGGCCC CTTCGCGCCC GGCGTTCGAT TTTGCCATCT GTTCCAGGAC GGCAAAACCT TCGTCACGGC 
069581 GATCGCTACT AAACAGCAAT AGCGCCAGAT TGTTTTGCAG GCCCGTATTG CCCGGTGCAT CCGCATTGAT 
069651 GCGTTTTAAC TGATTAATCG CTTCGCCACG GCGAGCCGGA ATTTTCGCCA CCGTACTCCA GTACTCGACA 
069721 GCAATGTCAC CTTCCGGCGG CGCACCGTTG AACAGTTTGT TGTAACTCGC CACAGCTTCT TCTGCATGAC 
069791 CGGTCGTCGC CTGCAATCGT GCCTGTTGCA GTGCCTGACG ACCATCCGGC GTGGAAAGTA GCATCGTAGT 
069861 CCGCGACGAT TTATACGCAT TTGAACTCGG CGCTAACTGC GACAGCCGAT CGAGCTGTTT TTGCGCGCCA 
069931 TCAATATCGC CCTGACGTAA CAAAGAACGG AAACGGGCGG CAACGACGTC CGGGTTATTC GGATCAATAA 
070001 GTTCCAGCCG ATATAACGAC TGTTGCACCA GATCTTCACG ATGGGTCGCT TCGCCTAACC GAACTTGCTC 
070071 CAGCAACTGT TGCTGAGCGG TTGGTGCTGC CTCGACCATC GGCATGACGG CCAGACCGAG GGAAAGCGTG 
070141 AATATGTTTA GTGTGAATTT GCGCATTCCT GGCCCCAGTC AGGTAATAAC TCACCTTTTG TCGAGAAGCG 
070211 GAAACGGTGT TGATCCCAGC CTTGTCCAAA CAGGGTCAGC ACATAGTTGT AATAGGCATC GCTGCCGGGA 
070281 AAGTTATCGG CCACGCGCTG GCGCTGAACG GCCTGCGCAT CGCGGTTTTG TAAAAAGGGC AGCATGGCGG 
070351 CAGAAAAACC GACTGGTCCT TTACCCTGCG CTTTCCCCGT AGCCACATCC ACTTTTTCCG GCGGATAACC 
070421 GTTTTTCTCA GTGAATGTCG CCATCGGTTT AAACCGGTTG AGCATCCGCG CTTTTTGCGG ATCGCTGTCA 
070491 GGCATCATGC CTACCCACAT GTAAACGCGG ATAGCGTCGT AGCTGCTGAT CAATGTTTTT TCGGCTTTTA 
070561 GCTGCCAGCC TTTGTCTTTC TCATAGCGCA CCCAGTCTGG CGAAAAACCT TTCGGGGCGG TTTCCAGCAA 
070631 TAAACGTTGA TTGGTTTCGC GCAGCGTGGT CCACGGCGCG CCAAAGCGGG TGAAATACTG CGCCAGCGTC 
070701 GGCGGCAGGT AGCTGGGGTT AAAACGCCAG CTGTTATCCT CAGCAAAACC CACTTTGCCC GGTAACAACA 
070771 TGGAACCCAG CCCAGGCACC GTCACCACTT CCTCCCGCGC GATACGTTTT AGCAACGCGC TGCCGATGTC 
070841 GGTATAACGC TGCTCTTTCC ACAAACGCCC CGCCTCCAGC AACGACCAGG CCATCCAGAC ATCACCATCG 
070911 GAGGCCGAAT TGCTGTCCAG CACTTCCCAC TTACTGTTCT CTTTCTTGCC CCACAGCCAG GCGGGCAAAC 
070981 GTTCTTTTAA AGAACCCTGA GCGAGATTGT TCTGCGTCCA GTCGAGAATA TTATCGAAAG CTGCACGGTC 
071051 GTTAGCCGCC AGGGCAGAGA ACATGCCGTA ACTTTGCCCT TCGGAGGTGG TGATTTTGCG CGCGTCGCTG 
071121 GGGTCGATGA CGCGCCCTTC CTGACTGATG TAATCCTTTT TAAACTGCTC CCAGGCAGGC CAGGTACAGG 
071191 CTGCCTGAAC ACTAAAGGCA GCCAGCAGCA GCATCGTCAC GATTCCACTA CGCAACACAT TCATCTTCAA 
071261 TTACTCGTTA TCCGGGTTAA GACGACGACG ACTAATAATT CGCAGCAGAC GCCACAGTAC CCATGCCAGC 
071331 AATATCACAC TGATAGCCGC CAGCACCGCC AGCAGAATCG GATGGTTTGC CAGCGCATAC CACACGCGCT 
071401 CGAACCACGG CAGATGACCT ACGTAATAAA CGTCGCCAAC ACGTAGGCTG TTGATACCGG ACTCGCGGAT 
071471 CACCGCGACC GAACCGAACA TGGTGGCGCG TTTGCCGCTA TCGTTCACCG CATCGTTAAG CATTTCATAA 
071541 CCGCGTGGGC TATCTGCCAA CAGCGCAATC ACGCTGCGCT GGTCGTTATA CGGCGACTGG AAGCCAATCA 
071611 CCGCCGCCAT CGCACCGGAA GAGGTCAGCG TTGACCGGGT TTCTGCCGCG CGATCGCTCT CGTCCGGCAC 
071681 AATGCCGGGG AACGGGGTCT GGCGCATCGG TGTTTTCACC CAGCTTTCGG TCGCCTGCAC CAATAGGTCG 
071751 ATCTGCTTAT CGTCTTTCAG TTTGTCCGGG ATACCACCGA TGATCATGAT GTCGGCATCT TTGCCCTGAA 
071821 TGGTGCTGCC ATCATCGGTC ACCGTCAGAT TAATCGCCGG GAAGCCCGTC TGTGCGCCGA TAAAACCAAC 
071891 AGTATTCAGC AACGTTTCCA TCTGTGCTTC GTTAGGCGCT TTCGGCATCA CGGTGATGGT TTGCGACAGA 
071961 TCCGCCATCC GGCTGAATGG GAAGCCCGCG TTAGCAAAGG CGCGTAGATC CGGCATCGGG ATGAAGTGGT 
072031 AATACTTCGA GAAGTCGATG GTGGAGTCGT CACCAATCAC CACATGATTC TGCACCGGCT GGAAGGTAAT 
072101 ACAGTTATCC ACCGAACCGC CCGGCATCGG GTTCATATAC TCAAAGTCGA AGCGCAGCTG GTTGGTCGCG 
072171 CCCAGTTTCA GCGCCGGAAT AGAGACATCT GTTTTGCCAT CCAGCAAACC TTGTAATACC GGAATCCGCA 
072241 GCAGCAGGCG GTTCGCCTCC TGTTTGCTGC TCAGGTTGAA GGATTGCAGG AACTGGTTAT TCAGGCTGAT 
072311 ATCCATCCGC GAACTGTCTT TCACCGGCGG CATGGTGTAG CGGTAATTAA TATCCATATC AATGCCGGTA 
072381 CTGCGCATCA GGTAGAGATC CGGCGGCAGG TTTAGCGAAA CGTTAATCGC TGCTGGCTCA AGACCGCTGG 
072451 ATTGTAACTG TTCTTCATAG GTTTTCAGTT CGCCAAATGT GACCGGACGA TCGGTACGTA CCCAGTTCGG 
072521 CGCATCGTAC GGCTTACGCG GTAGCAGCGG TTTCACTTCA TTCACTACCA CGCTTTCACC ACGGAACAGA 
072591 ATGTTACCCT GAGCGATACC TTTCGCTGCC TGCAACAGGT CTTTGTCGTC ACGACCAAAC ACCACCAGCA 
072661 GTTTGACGTA AGGATTCTGC GGATGGTTAA TCATCTCAAT CACCGGGGCT TTTACCGCCG GATGATCGCG 
072731 CAGGAAGTCC GGCCGTTTGT CGTTGGTTGC AAAGACAATG GCATTGCGAT CCGGCAGTTG GTTATAGAGT 
072801 ACCGGGAAGT TCTGCCCACG CCAGCCAGAA CGCGAACCAA ACCACGAGGC GACAATGGCA GAGGCTTGTT 
072871 GCAGCCCAAC ATCCGGCGCA CCCGCAAAGA CCATCGGCAA GGTGTTGGTG CGGTTATCGC TCGGGTCAAA 
072941 GAATGGCACC GGGAAGTGTG ACAGGTCATT CTTCACATTC AGGGTCTGAT AGGTCAGATC CAGTCCACTG 
073011 CTCCGCCCAA CATCCAGCCA AAGCGTGGTG CTGGCCGGTT TTTCGCACAC GTCCTGATAA TGGCCGACAA 
073081 ACTCCAGCCG TACACGGTTG AAGTCGCTAA TAAACAGTGG GTTAATGGGC ATTTGCGCCA GCGTTTTTTT 
073151 ACCCAACTGT TCTTTGGTCA CTGGCAGCAC GCCCATCAGT TCATCATTGA GATAAACCTT TAACTGCGAC 
073221 TGGACAGGCA GTAACGATGG CGATGGGGTG TATTCGAGGT TGAGCATCGC CTTCGTCACC ACTTCATCGC 
073291 TGCGCATACC AAACTCAATG CTGCCGTTCG GGTTAATGCC ACGTAGCACC ATGCTGCCCG GCGGCGGTGC 
073361 AATTTGCGCA AAGGTCAGCT TCACATCACG CGAAGGACCG TTCTGCGCCA CGACTGGCGC ATCAGCGCCC 
073431 TGCACGCCCG GCATCACTTG CCCCACCTGC GGATTTTGTT CCGTCTGGGC GGCTACAGCT GGCTCAGCAT 
073501 TGATCAGTGG TTGCGTTGCT GGCGTCGCCT GCGTCATGAA AGAGGGGAAC GCACTCATCC CCATAGCCAC 
073571 TGCACAAATC CAGAATAGTT TTCTTTTCAT CGCGTTATCA TCATTGTTGA GCCAAAGCCT GATCCGATGG 
073641 TTGTGCCGTT TCGCTCCGCT CCGGGCGGCG CGGAATAAAC GATACAACCC AGGAAACCAG AGAAGTCAGC 
073711 ACACGGAATA TGCCCTTCAC CGAAGAAGGC GCAAACTCCG CCAGATGGCG GTAGCCACGG AAGCCGAGCT 
073781 TCAGAATATC CAGCAGACTT TCCAGCGGCT TATCTTCCGG GTAGCTGTCC TGCCAGAGCG CCCATGTATC 
073851 CGCACGGGCA AACGTACACT GCACAAAATC GATATGTTGC TGGGTGGTGA GCGGCATTAA TTTCAGCCCA 
073921 ACTTCATTAC CCATCACGCG CGCCACCTGG GTCGGGAAGA CGTATTCCTG CTGACCGCGT TTAAGCAACA 
073991 GATTCACTTT CTGCCCTTCC AGAATCTGCG CCTGACCGTT GATCTTGATC CCCAAACCAC CGTCGGAGAA 
074061 ATCCTGAACG GTACACGAGA AGAGGTGACC ATCTTCGCGG GCAATTGCCG CGGGCATCGT CATCTCCACG 
074131 CGGTGCGATC GGCGTACCTG TTTGCTTTCT ACCGATACCG CAACTGCGCC GCCAAGAACA ATCAGGTTGT 
074201 AGAACACCCA CACCATACTG ACGACCACGG TGAGCATCTC GGTTGGCGGG CCATAGAAGT AGCGCCAGAT 
074271 GCCTACCGCA ACGCCCACCA GGTTGAGCAG GACAAGGAAG ATGTAGGGCC GCGAGATCAC CCAGTCGACG 
074341 TACTCTTCTT CCACCAGTCC ACCTTTGGCG GTGACGTTAA ATTTGCCTTT GTGCGGGTTA ATCAGCGCCA 
074411 CCAGCGTCGG TGGTGCGATA TACCACGCCA GCACCGTTTC GTAGATTTCA CTCCAGAAAG AGTGGCGATA 
074481 TTTGCCCTGG ATCTTGGAGT TGGTCAGGCT GGCATGGATC ATATGCGGCA GCACGAATAG GGCGATCATC 
074551 AACGCTGGCG CATAGATGAT GTAGGCATGA AGCAGCAGGA ACGCCAGCGG CGCAGTCAGG AAGATCAGCC 
074621 GTGGAATGCC CGACAAGAAG TGGAACATGG CGTTGACGTA ACATAGCCGC TGAGCAAACT TCAGCCCTTT 
074691 ACCGGTGAGC GGGTTATCGA GACGGAAGAT TTGTACCATC CCGCGCGCCC AGCGAATACG CTGACCGATA 
074761 TGCGCCGACA GACTTTCGGT CGCCAGCCCC GCCGCCTGCG GAATACGCAT ATACGCGGAG GTATAGCCAC 
074831 GACGGTGCAA CCGCAGAGAA GTATGCGCAT CTTCAGTCAC GGTTTCGACA GCAATGCCGC CAATTTCATC 
074901 CAGCGGCTTA CGACGAATCA CCGCACAGGA ACCGCAGAAG AAAGTGGCGT CCCACATATC GTTGCCATCC 
074971 TGCACCAGAC CATAGAACAG CGTGCCTTCG TTCGGCGTTT TACGGAAACG CCCCAGGTTG CGTTCAAACG 
075041 GGTCCGGTGA GAAGAAGTGG TGCGGCGTCT GCATCATCGC CAGCTGTTTT TCTTTCAGGA ACCAGCCCAT 
075111 GGTCATTTGC AAGAACGATC GCGTTGGTAC GTGGTCGCAG TCGAAAATCG ACACGAACTC GCCTTTGGCA 
075181 TATTTCAGCG CATTGTTGAT GTTGCCTGCT TTCGCATGTT CATGAGTGGT GCGGGCGATA TATTTCACCC 
075251 CCACGTTTTG CGCAAACTGG CGAAACTCTT CCCTGCCGCC GTCATCAAGG ATCCAGATAT TCAGCTTATC 
075321 TTTCGGCCAG TCGATACCCA GCGAGGCGTA AATGGTATTT TTCACCACGT TGAGATCTTC GTTGTAAGTC 
075391 GGGACAAAGA TATCCACCGA CGGCCACAGC GACATATCTT TCGGCAATGG CACCGGCTGA CGATTCAGCG 
075461 GCCATACTAC CTGGAAGTAG CCGAGCACCA GCACAATCCA CGCGTACGTT TCAGCGAAGA GCAGAATAAG 
075531 CCCGCACACC AGGCTGACCG GATCGTCCCA GTTCAGCGTA GAGGTGTAAC GCCACCAGAT ATAACGGCAA 
075601 GAAACGGTCA GCGACAGCAC AATCAACATT AGCGCCGAGA AGCGCCCCGG CATCCGCCGT ACGATCAGCG 
075671 CTACCCCCCA CAGCAGCATC AGGAAGATAA ACTGCGCCAG CGGGTTAAAC GGCTGAGTAA CGCAGATTAA 
075741 CGCCAGAATC AGCGAGAAGG TGACGATGAT ACCGAGGATC AACCGCCGCG CCCCGGCACT CAAATGACCG 
075811 AGCTCTTTTT TCTCATCCAG ATGCTGTGTT TTATGGCTAA CGCGCTCAGG CAGCTCGTTC ATCCATTGAT 
075881 GGTAACGTCC ACGAATATTT TGCAGACCTG AAAATGCCCG CCTGCGCGGT TTCGGCGTTT CTTTGCGCGA 
075951 TGCACCGATC AATAACCAGC ATGTTTGAAT GAGATAACGG ACCGGGTCCA GCGGACGCGG ACGCGAGGCG 
076021 TTGATATGCG GATACAGGTT TTTATGTTCT GCGCGAATAC GCTGCCAGCG CGGGTGCTCC AGCGGAATAA 
076091 AAATCCAGGC CAGGATCATC CAGAAACAGC CGAGCGTCGC GCTGAAAGCC GACGCACCGT GACGACGATA 
076161 ATCGCGATAA CGCCCGATAA GCCGCGCGTT GACCGGCGGG ATAAGCAACC ACCGGGTCAG GATACTCATG 
076231 ATGCACTCCC GACTGGCGTT TTCAGCCCGG AGTAGTTCAA CAGGCACCAG TTCGCCAGCG TCAGTATCTC 
076301 TTCAGCCGCC AGCGCATCAC TGCGATATTC ACCTACTGGT TGCTTAGCCG CCAGGCATTC AGCCATCGCT 
076371 TCATCACGAT GAATGAGCAT CGGCAGTAAT CGGCGCTGGC TTTGCAACCA AAGCTGGTAA ATATCGTCCT 
076441 GAACCTGACT GCCAATACGG AAGTCATTAA TCAAAATATG TGCGCCATCC GGCAGCGCTT GCTGATGCAG 
076511 TCGGATATGG CAGTTGGCAT CCACATTGAC GATTGCCAGC GAGTGATCGC ACAAACTCAG CAGCTGGTGG 
076581 GTTATCTGCG AGGCATCACG CGGTAAGTCG ATTAAAATCC ACTGGTAACG CCCGCTGGCT TTTAGTTGCT 
076651 GTAAGCCGGA GCAAATATCG CTCAGCCGGG TTTGCCAGTG CTGTGGATTT TCTTGTTCTT CAATGGATAA 
076721 CTGACCAAAA GGCAGCAAAT CGAGCTGCGA GGTGTAGCGC AACCCAGCGT CACGCCAGTC CTGGCCATCC 
076791 AGCATCGCTC TGGCCCAGCC CTGACGGTGG GTAAAATCAA CATTAAATGA CAGGCGCAAC AAGTTGTCCG 
076861 GGCAGGCATC GACCACCAGG ACATTTTCTC CCAACATTTG TAATGACCAG GCTAATGCGG CGGTGATGGT 
076931 TGTTGTCCCC ACGCCTCCCC GCACCCCCTG CTATCCCAGT ACGGCCATTC ACCAATCCCC TACTTTTGTT 
077001 GCGCAAACTC TGCCAGCAAC GGCCAGCGTT TTAATGCCGC GGCCAACTGT TCGCGTTGGG AAATATCGGC 
077071 ATAATCAATA TCAGGCAGTG AAAATGCCTG CTTTAACGCC ACAATATCAT TCTGGAAGAT ATAGCCTATC 
077141 GCGGGATCAG GCAGAGTATC TGGTTCATTG TTATTCATTT TGCTTGATCC CTATGAAATA ACCGTACCGT 
077211 TCATGAGACA ATTCTAACCG TGAGCATTTC GCCGGTTTAT TGTTTACGGC GAGACGGGAA TTTGCTCACT 
077281 TTTTGACTTT CCGTTACGCA ACAGAAAAAG TTAAAAACGA AAAGACTAAA ATCACACGTC TTGTGACCTT 
077351 CTAAATTGAT TCACATGCTA AATCTGATAA GTTTTAATTT CAATGGTAGG TTTATTTCTT AGCTTTCGCT 
077421 AGTAAACTGA TAATCAGACA AAATGGTGAC ATGAGGGACA TTGTGGACCC TGTATTCTCT ATCGGTATCT 
077491 CATCATTATG GGATGAGCTG CGACATATGC CAGCAGGCGG CGTCTGGTGG TTTAACGTCG ATCGCCATGA 
077561 AGATGCTATC AGTCTGGCGA ATCAAACAAT TGCATCCCAG GCTGAAACCG CACACGTCGC GGTCATTAGC 
077631 ATGGACAGCG ATCCGGCGAA AATCTTTCAA TTAGATGATT CTCAAGGGCC GGAAAAAATA AAATTATTTT 
077701 CAATGCTAAA TCATGAAAAA GGTCTATACT ATTTGACCCG TGATTTGCAG TGTTCTATTG ATCCCCATAA 
077771 TTACCTTTTT ATTCTTGTTT GCGCAAATAA CGCATGGCAA AACATTCCTG CCGAGCGGCT TCGCTCATGG 
077841 TTGGATAAAA TGAATAAATG GAGCAGGTTA AACCATTGTT CGCTTTTGGT AATTAATCCC GGAAATAATA 
077911 ACGATAAACA ATTTTCATTG TTGCTTGAGG AATACCGTTC ACTTTTTGGT CTTGCCAGTT TGCGTTTTCA 
077981 GGGTGACCAA CATTTGCTGG ATATTGCCTT CTGGTGCAAC GAAAAAGGGG TCAGCGCCCG TCAGCAGCTT 
078051 AGCGTTCAGC AACAAAATGG TATCTGGACA TTAGTTCAAA GCGAAGAGGC GGAGATCCAA CCACGCAGCG 
078121 ACGAAAAACG CATTCTGAGT AATGTTGCTG TACTGGAAGG TGCGCCGCCG CTATCGGAAC ACTGGCAACT 
078191 GTTCAACAAT AACGAAGTCC TGTTCAATGA AGCCCGTACC GCTCAGGCGG CGACGGTGGT CTTTTCTTTA 
078261 CAGCAAAATG CGCAAATCGA GCCACTGGCC CGCAGCATTC ATACCCTGCG TCGCCAGCGC GGTAGTGCGA 
078331 TGAAAATCCT CGTGCGGGAA AATACCGCTA GCCTGCGCGC CACCGATGAA CGTTTGTTAT TGGCCTGCGG 
078401 TGCAAATATG GTTATTCCGT GGAATGCGCC ACTCTCCCGT TGTCTGACGA TGATCGAAAG CGTGCAAGGG 
078471 CAGAAGTTTA GTCGCTATGT GCCGGAAGAT ATCACTACCT TGCTGTCAAT GACCCAGCCG CTCAAACTGC 
078541 GTGGTTTCCA GAAGTGGGAT GTGTTCTGTA ATGCCGTCAA CAACATGATG AATAACCCTC TATTACCTGC 
078611 CCACGGTAAA GGCGTTCTGG TTGCCCTACG TCCGGTACCG GGTATCCGCG TTGAACAAGC CCTGACGCTG 
078681 TGTCGCCCTA ACCGTACCGG CGATATCATG ACCATTGGCG GTAATCGGCT GGTGCTGTTT CTCTCATTCT 
078751 GTCGGATTAA CGATCTGGAT ACCGCGTTGA ATCATATTTT CCCATTGCCT ACTGGCGACA TTTTCTCAAA 
078821 CCGTATGGTC TGGTTTGAAG ATGATCAAAT CAGTGCCGAG CTGGTGCAGA TGCGCTTGCT TGCCCCAGAA 
078891 CAATGGGGCA TGCCGCTGCC TTTAACGCAA AGTTCTAAAC CGGTCATCAA TGCCGAGCAC GATGGTCGCC 
078961 ACTGGCGACG AATACCAGAA CCCATGCGAC TGTTAGATGA TGCTGTGGAG CGCTCATCAT GATGACCATC 
079031 AGCGATATCA TTGAAATTAT TGTCGTTTGC GCACTGATAT TTTTCCCGCT GGGCTATCTG GCGCGGCACT 
079101 CTTTGCGACG CATTCGCGAC ACCTTACGTT TGTTCTTTGC TAAACCTCGT TATGTTAAAC CGGCCGGGAC 
079171 GTTACGCCGC ACGGAAAAAG CCAGGGCAAC CAAAAAATGA CTCAATTTAC GCAAAATACC GCCATGCCTT 
079241 CTTCCCTCTG GCAATACTGG CGCGGCCTTT CCGGCTGGAA CTTCTATTTT CTGGTTAAGT TCGGCCTGTT 
079311 GTGGGCGGGA TATCTTAACT TCCATCCGCT CCTCAATTTG GTGTTTGCCG CGTTTCTGCT GATGCCCCTT 
079381 CCGCGCTACA GCCTGCATCG CTTGCGCCAC TGGATTGCCC TGCCGATCGG CTTTGCTTTG TTCTGGCATG 
079451 ACACCTGGTT GCCTGGCCCG GAAAGCATAA TGAGCCAGGG TTCGCAGGTG GCGGGGTTCA GTACCGATTA 
079521 TTTAATCGAC CTTGTCACAC GCTTTATTAA CTGGCAGATG ATTGGGGCCA TTTTTGTTTT ATTAGTGGCC 
079591 TGGTTATTCC TGTCACAATG GATTCGCATT ACCGTTTTTG TGGTTGCCAT ACTGCTATGG CTGAACGTAC 
079661 TTACCCTGGC GGGACCAAGT TTCTCCTTGT GGCCAGCCGG ACAACCGACG ACCACTGTAA CAACGACGGG 
079731 TGGTAACGCA GCGGCAACCG TTGCGGCGAC GGGTGGCGCA CCGGTAGTGG GTGATATGCC CGCACAAACT 
079801 GCACCGCCAA CAACGGCGAA CCTTAACGCC TGGCTGAATA ATTTCTATAA CGCGGAGGCG AAACGTAAAT 
079871 CGACCTTCCC GTCTTCGCTG CCCGCTGATG CTCAGCCATT TGAACTACTG GTGATTAACA TCTGTTCGCT 
079941 TTCCTGGTCG GATATAGAAG CCGCCGGGTT GATGTCGCAT CCACTGTGGT CGCATTTCGA TATTGAGTTC 
080011 AAGAACTTTA ACTCCGCCAC CTCCTACAGT GGCCCGGCGG CGATCCGTTT ACTGCGCGCC AGCTGCGGGC 
080081 AGACTTCGCA CACTAATCTG TATCAACCGG CAAATAACGA CTGCTATCTG TTTGATAACC TTTCGAAACT 
080151 GGGCTTTACC CAGCACCTGA TGATGGGACA TAACGGCCAG TTCGGCGGTT TTTTGAAAGA AGTTCGCGAA 
080221 AATGGCGGCA TGCAGAGCGA ATTGATGGAT CAAACAAATC TGCCGGTTAT TTTGCTGGGC TTTGATGGTT 
080291 CGCCGGTTTA TGACGATACC GCTGTGCTTA ACCGCTGGCT GGACGTTACC GAAAAAGATA AAAACAGCCG 
080361 TAGTGCCACG TTCTACAACA CGCTTCCACT GCATGACGGC AACCATTATC CGGGGGTCAG CAAAACAGCG 
080431 GATTACAAAG CGCGGGCGCA GAAATTCTTT GATGAACTGG ACGCCTTCTT TACTGAACTT GAGAAATCGG 
080501 GTCGTAAAGT GATGGTGGTC GTGGTGCCGG AACACGGCGG CGCGCTGAAG GGCGACAGAA TGCAGGTATC 
080571 TGGCCTACGT GATATCCCTA GCCCGTCTAT CACCGACGTC CCCGTTGGGG TGAAATTCTT CGGCATGAAG 
080641 GCACCGCATC AGGGGGCACC GATTGTCATC GAACAACCGA GCAGCTTCCT GGCTATCTCC GATCTGGTGG 
080711 TTCGCGTTCT CGATGGCAAG ATTTTCACCG AAGACAATGT TGACTGGAAA AAACTCACCA GTGGGTTGCC 
080781 ACAAACAGCA CCGGTCTCCG AGAACTCAAA TGCAGTAGTT ATTCAATACC AGGATAAACC GTACGTTCGC 
080851 CTGAACGGCG GCGACTGGGT GCCTTACCCG CAGTAAGAAC GAAAAAGGCC GCAGAGTTTC CCCCCTGCGG 
080921 CCTGGTCCGG GCGCAAATTG CCATTACGGC AGCCTGACGC CCGCATGACA CGTTACTTCC GCTTGTTCAG 
080991 CCAGTTCACG ATCATACTGG CAAGAATGCC AGCAATGACC GGAGCCGCTA AATCATGCCA GAAGGCCATG 
081061 CCCAGCTCTG CGAACGTCAT ATAGCCGCCT GTGTTGTAAT GACAACGTTT CGCGGCTATT CTTGAGTGGT 
081131 CTAGAGTCAA GATTAGCCCC CGTGGTGTTG TCAGGTGCAT ACCTGCAACG TGCGGGGGTT TTCTCTCTCC 
081201 AGCAACCAAT GCCACCAGGG ATAAAGCCCC CGCAACATTG CGCCTCACCG GAACCTTTCC GGCTTGCCGC 
081271 TGATTCTACG ATTGCTTTTT ACTGTCAGCA CCCGGCAATC TTCCTCATTG CGCGATGCCT TCCAGCTTAA 
081341 TTTCTTTATT TGCAATAGTT GCAGTTCATA TCCGGGCTGA CTCCAGACTG GTAGTGAAAT GCGCAATTTT 
081411 GTAGAATTGC GCCTCCTCGC GACCTCCCCA GTGAATCTGT TGCCTCATTT TTTACATACT GCGTATTCGA 
081481 CTTCTCCACC TGTTGCGCAA GAGAAACTGG GTTTATTCAT TTTTGCGAGG CCGACTTCTT TCTGGACAGG 
081551 ACTTTATGCA GCACAACACA CTATCGAAAC ACAATCAGAA ATTGCCGTTT ACACGCTACG ACTTCGGCTG 
081621 GGTTTTATTA TGCATAGGCA TGGCGATTGG TGCCGGAACC GTGCTGATGC CAGTACAAAT TGGCTTGAAG 
081691 GGAATTTGGG TATTTATTAC CGCAGCGATC ATTGCTTATC CTGCCACCTG GGTAGTGCAG GACATTTATT 
081761 TAAAAACCCT TTCTGAAAGC GATTCCTGTA ATGACTACAC CGATATTATC AGTCATTACC TGGGGAAGAA 
081831 CTGGGGAATT TTCCTCGGGG TTATCTACTT TTTGATGATT ATCCACGGGA TTTTTATCTA CTCTCTCTCC 
081901 GTGGTTTTCG ACAGCGCCTC GTACCTGAAA ACCTTCGGTT TAACCGATGC CGATCTTTCA CAATCTCTAC 
081971 TTTATAAAGT CGCTATTTTC GCCGTACTGG TGGCGATTGC GTCTGGTGGT GAACGATTAC TGTTTAAGAT 
082041 TTCCGGGCCA ATGGTGGTGG TCAAAGTAGG GATTATTGTC GTGTTCGGTT TTGCGATGAT CCCGCACTGG 
082111 AATTTCGCCA ATATAACCGC CTTCCCGCAA GCCTCCGTCT TTTTCCGCGA TGTCTTGCTT ACCATTCCAT 
082181 TTTGCTTCTT TTCTGCAGTA TTTATTCAGG TACTTAACCC AATGAATATT GCCTATCGTA AACGGGAAGC 
082251 GGATAAAGTA CTGGCAACCC GGCTCGCGCT GCGTACCCAC CGAATTAGTT ATATCACGCT CATCGCGGTG 
082321 ATCCTGTTTT TTGCCTTTTC GTTTACCTTC TCAATTAGCC ACGAAGAAGC CGTTTCTGCC TTTGAACAAA 
082391 ATATCTCAGC ACTGGCGCTG GCCGCGCAGG TGATCCCTGG GCATATCATT CATATCACCT CTACGGTGCT 
082461 TAATATCTTT GCCGTACTGA CCGCATTCTT TGGCATTTAT CTCGGTTTCC ACGAGGCCAT TAAAGGCATT 
082531 ATTCTCAATC TGTTAAGCCG AATTATTGAT ACCAAGAAAA TTAACTCACG CGTGCTGACT CTGGCGATCT 
082601 GCGCTTTTAT CGTCATTACG TTGACGATTT GGGTTTCGTT TCGTGTATCG GTGCTGGTGT TCTTTCAGTT 
082671 GGGAAGCCCG TTATATGGTA TTGTGTCGTG CCTCATTCCG TTTTTCCTGA TCTATAAAGT CGCACAACTG 
082741 GAAAAACTTC GCGGATTTAA AGCCTGGCTG ATTCTGCTGT ACGGCATTTT GCTATGCTTG TCGCCACTGT 
082811 TGAAGCTGAT TGAGTAAACC GGAGCGCATG GCCCCGGTTT TGTGAGTTAA CGCTGCGGAT TTTCATCCTG 
082881 ATCAACAGCA AAACAAGCTA CCAGTTGACC GCCGTAGTCT TTTAGCTGCG GCTGCAACTG GGTGCAGGGG 
082951 CCGAAGCGCC GACGACAGCG GGCGTTGAAG GCGCAACCCG GCGGTGGATT CAGTGGGCTT GGTAGTTCAC 
083021 CGCTGAGCTT GATGCGCTCG CGGCGATCGT CCGGGTTCAG GCGCGGCGTC GCGGAAAGTA GCGCCTGAGT 
083091 GTACGGATGG CGCGGGTTAT TGAAGATTTG GTCTTTCGTT CCCTTCTCCA CGCAGCGGCC CAGGTACATC 
083161 ACCATCACTT CATCAGCAAT GTGCTCCACC ACCGACAGGT CGTGGGAGAT AAAGACATAA GACAGCCCCA 
083231 ACTCCTGCTG CAAATCCATC ATCAGATTCA GCACCTGCGC GCGCACTGAA ACATCCAGCG CGGAAACCGG 
083301 TTCATCGGCA ATCACCACAT CCGGGTCGAG CATCAGACCA CGGGCGATGG CGATACGCTG ACGCTGACCG 
083371 CCGGAGAACA TATGCGGATA GCGGTCATAG TGCTCGGTTT TCAGGCCGAC TTTCGCCATC ATCGACAGGG 
083441 CTTTTTCCCG ACGCTGTTCT TTGCTTAAGC TGGTGTTGAT CAGCAGCGGC TCTTCAAGAA TTTGCCCGAC 
083511 TTTTTTACGC GGATTCAGCG AACCGTAAGG GTTCTGGAAG ACGATCTGGA TTTTCTGCCG ACGCAGCTTC 
083581 TGCGCCTGCG GATCGTGCTT AAGCAGATCC TGCCCCTGGT AATACAGCTC GCCACCGGTG GGCATTTCAA 
083651 TCATCGTCAG CAACCGACCG AGGGTCGATT TACCGCAGCC AGATTCGCCC ACTACTGCCA GCGTTTTGCC 
083721 ACGTTCAAGG TTAAACGAAA CGCCATCCAG CGCTTTAACC AGACGTTCCG GCGCGAACAT GCCTTTCTTC 
083791 ACCGGATAAT GTTTTTTCAG GTCGATAGCC TGCAACAGCG GTTGTTGCAG GGTGGCCTCT TGCGTACTCA 
083861 TAGTGTCGGC CTCCCGGCAT CATCAAGTGG GTAATGGCAT TTGGACTGAC GCCCGTCAGC GAGCATATTC 
083931 AGCGCCGGTT CTTCAGCGCG ACATCTGTCA GTGGCATAGG GGCAGCGCGG GTTAAGCAGG CAGCCGTTCG 
084001 GGCGGTCGTA CTTGCCGGGA ACGACACCTG GCAACGACGC CAGACGTTCT TTGTCCTGAG CAAATTCTGG 
084071 CAGCGCACGC AGCAATGCCT GAGTATACGG GTGACGCGGC GCATGGAAGA TGGCGTGCGC ATCACCGGTT 
084141 TCCACCACCT GGCCTGCATA CATCACGATG ATTTTATGTG CCGCTTCCGC CACCAGCGCC AGGTCATGGG 
084211 TAATTAACAC CAGCGCCATG TTCTCTTTCT GCTGTAGCTC CAGCAGTAGT TCGATGATTT GCGCCTGAAT 
084281 GGTCACGTCC AGCGCGGTGG TCGGTTCATC GGCAATCAGC AGTTTTGGCC GACAGGCAAT CGCCATGGCG 
084351 ATCATCACGC GCTGGCTCAT GCCGCCGGAA AGCTGATGCG GGTAAACATC CAGACGCGAT GCCGGATCGG 
084421 GAATACCGAC CTGATTCAGC AGGTCAATCG CTCGCTGACG GCGGGTACTT TTGTTGCCGC CCTGATGCAC 
084491 CTTAATCGCT TCCATAATCT GGAAACCCAC GGTGTAGCAC GGGTTAAGGC TGGTCATCGG GTCCTGGAAG 
084561 ATCATCGCCA CTTCGGCACC CACCAGGTTG CGGCGCTCTT TTTCTGAGAT ACGCTGCAAA TCCTGGCCGT 
084631 TAAACTCCAG TTTTTCTGCC ATTACGCGGC CCGGATAATC AATCAGCCCC ATAATCGCCA GTGAACTGAC 
084701 CGACTTACCG GAGCCGGACT CACCCACAAT CCCGACCACT TCGCCCTGTT TTACGCTGTA GCTGATGCGG 
084771 TCTACGGCGC GGAACGGCGC GCTTTCGTCG CCGAAATGCA CCGATAATTT ATCTACATTT AATAACGCCA 
084841 TCTCGAACCT CTTACTGCTT CAGTTTGGGA TCGAGCGCGT CACGCAGACC GTCACCCATC AGGTTAAATG 
084911 CCAGCACCGT CAGCAGGATC GCCAGACCCG GGAAGGTCAC GACCCACCAG GCGCTTTGCG CGAACTGCAA 
084981 CACGTCGGAG AGCATGGTGC CCCACTCAGG CGTTGGCGGC TGTGCCCCCA TGCCGAGGAA ACCAAGAGCA 
085051 GCCATATCGA GAATGGCGTT AGAGAAACCG AGCGACGCCT GAACAATCAG CGGCGCAAGG CAGTTCGGGA 
085121 AGATGTTAAT AAACATCTGA CGCATCGCCC CGGCACCCGC CACGCGAGAC GCGGTGACGT AATCGCGGTT 
085191 AACTTCCACC AGCACGGCGG CGCGGGTTAA GCGCACATAG TGCGGCAAGG CAACGAAGGT CAGTGCCAGC 
085261 GCGGCGTTAC CAATCGACGG GCCGAAAATT GCCACCAGCA CCAGCGCCAG CAGCAGACTT GGCAGCGCCA 
085331 GCATGATATC GACCACGCGC ATAATGATGT TATCGACCAG GCCGCCAAAG TAACCGGCGA TCAGGCCGAG 
085401 AATAACGCCC ATAATCAGCG ATAACACAAC TACCAGACAG CCAACCAGCA GCGACAGGCG CGCACCGTAC 
085471 ATCAGGCGCG ACAGCACATC ACGGCCTACG TCATCGGTGC CCAGCAAGTG CGCCATGCTG CCGCCTTCCT 
085541 GCCAGGCTGG CGGGGCGAGC AGTGCATCGC GGAACTGTTC CGCCGGGTTA TAGGGTGCAA TCCAGTTGGC 
085611 AAAGATCGCG ATGAACAGCA CGATGACGAC GTAAACCAGC CCGACGACCG CGCCTTTGTT GCGTTTAAAA 
085681 TAGTGCCAGA ACTCCTGTAA CGGGGTCATC GGCACCGGTG CGCTAATCAC TTTATTTTCA GTAACCTGTG 
085751 ACATGATGTC CCCTTACTTC TTATGACGAA TACGCGGGTT CACCACGCCG TACAGCAGAT CGACCAGCAA 
085821 GTTGACGAGG ATAATCATCG TCGCCACCAG CAATACGCCG CCCTGCACTA CCGGATAGTC GCGGCGTTGC 
085891 AGTGCGTCAA TCAACCAGCG TCCCAGACCG GGCCACGAGA AGATGGTTTC GGTCAGAATC GCCCCCGCCA 
085961 GCAATGTTCC CACCTGCAGG CCGATAACGG TCACCACCGG CAGCATCGCG TTACGCAGCG CATGGACGAT 
086031 AATCACCCGC ATGCGGGTTA GCCCTTTGGC GCGCGCGGTG CGGATGTAAT CCTCGCCCAG CACTTCCAGC 
086101 ATCGAGGAGC GTGTCATACG CACAATGACC GCCAGCGGAA TAGTACCCAG CACAATGGCA GGCAAGATCA 
086171 TATGGGCGAC GGCATCGATA AAGTTGCCGT CTTCACCCCA GATGGCGGTG TCGATTAGCA TAAAACCGGT 
086241 TAACGGATTG GAGTCATCGA GGAACACCAT ATCGCTCACG CGACCGGAGA CGGGCGTCAG GTTCCAGTGC 
086311 ACCGAAACCA GCATGATCAG CATCATGCCC CACCAGAAGA TAGGCATTGA ATAACCTGTC AGCGCCAGGC 
086381 CAACCGCTGT GTGATCGAAA ATGGAACCGC GTTTAACCGC AGCCAGCACG CCGACCGGAA TACCGACTGC 
086451 CGTAGCAAAA ATCATCGCGC AGACGCCAAG TTCCAGCGTG GCCTGGAAGC GCGGCACGAA CTCTTCCCAA 
086521 ACCGGGATGC GGCTTTTCAT TGAAATGCCT AGATCGCCAT GCATAACGCC CCAAATGTAA TGGAGATACT 
086591 GCTGCCACAT CGGTTTATCT AAGCCGAGTT CAGCCAGCAG CTGCGCGTGA CGCTCTGGGG AGATCCCACG 
086661 TTCGCCCGCC ATGATCATCA CCGGATCGCC CGGGATCATG TGGACAAAGG CAAATGTGAG AAGGGTAATA 
086731 CCGATAAACG TGGGGATGAC GAGTCCCAAA CGTCGGAGAA TAAACTGCAA CATAACCCGG ATTCTCTATA 
086801 GTGACCCGCA GCCTGGAACT GCGTGTCTGT ATTGCTCACA AATCAATTCC CGCCCTTATC GGACAGGGAA 
086871 TGAAGTATTG CTGCCGGATG GCGCTGCACG CAGAGGCACA GCGCCACCGG GTATACAGAT TGTTGACAAA 
086941 GTGCGCTTTG TTTATGCCGG ATGCGGCGTT AACGCCTTAT CCGGCCTACA AAATCGTGCA AATTCAATAC 
087011 ATTGCAGAAT TTTCGTAGGC CTGATAAGCG GAGCGCATCA GGCATTTTTG CCTTTGCCAT CAGTCTTGTA 
087081 TGGCTTTTAA TTATTCGATA GAGACGTTTT CGAAGTGATG TTTGCCTAAT GGATCAACCA CATAGCCTTT 
087151 AACTTCTTTA CGTACCGGTT CAAACACGGT GGAGTGAGCG ATGATCAGTG CCGGAGCCTG ATCGTGCATC 
087221 ACCACCTGCG CTTGTTTGTA CAGTTCAACG CGTTTATTGT GGTCGTCGGT AGCACGCGCC GGTTGAATCA 
087291 GATCTTCAAA CGGTTTGTAG CACCATTTTG AGTAGTTGGA GCCTTGTTCA GAGGCGGCGC AGCTGAACAG 
087361 GGTGGCGAAG AAGTTATCCG GATCCCCGTT ATCGCCAGTC CAGCCCATCA TTACCGTCTG GTGCTCGCCA 
087431 TCTTTCGCAC GCTTGAGGTA CTCACCCCAT TCGTAGGTGA CAATTTTGGC CTGCACGCCG ACTTTCGCCC 
087501 AGTCTGCCTG AATCATCTCC GCCATGCGGC GAGCGTTCGG GTTATACGGA CGTTGTACCG GCATCGCCCA 
087571 CAGGTCGATG GAGAAACCTT TTTCCAGACC CGCTTCTTTC AGCAAGGCTT TCGCTTTTTC AGGATCGTAG 
087641 GTGTAGTCCT GAACGTCGTC GTTATAGCCC CACATGGTTG GCGGGATCAG GTTTTTCGCT GATACGCCCG 
087711 CGCCCTGATA AACCGCTTTG ATGATCGCGT CTTTGTTCAC CGCGTAGGTC AGAGCCTGGC GAACTTTCAC 
087781 GTCATCGAGT GGTTTTTTCT GCACGTTATA CGAGAGATAA CCGACGTTCA GCCCCGGCAT TTCCATCAGA 
087851 TTGATGGATT TATCCTGCTT CATGCGAGCG ATATCTGCCG GGTTCGGGTA CGGCATCACC TGGCATTCAT 
087921 TCTTCTGCAA TTTCGCGTAA CGCACGGAAG CGTCAGGGGT AATAGAGAAA ACCAGCGTAT CGATCTGCGG 
087991 TTTGGTGCCC CAGTAGCCAT CAAACGCTTT GTAGCGGATA CGGGAATCTT TTTGATACTG CTGTAACTGG 
088061 AACGGACCGG TTCCGATTGG GTTGAGGTCC AGTTTTTCCG GTGTACCGGC TTTCATCATC GCATCAGCAT 
088131 ATTCTTTTGA CAGAATAGAG GCGAAGTCCA TTGCCAGGTC AGCGAGGAAC GGCGCTTCCG GGCGAGTCAG 
088201 CACAAACTGA ACGGTGTTGT CGTCCACCTT TTTCACTTCA CTGATCAGCT CTGGCAAGCC CATGCCTTCG 
088271 AAGTATTCGT AGCTGCCGCC AGAAACTTTA TGGTACGGGT TTTGCGCGTT TTTCTGACGA TCGAACGAGA 
088341 ACACCACATC ATCGGCGTTC AGTTCACGCG TCGGTTTGAA TTCTTTATTG TCGTGCCACT TCACACCTTT 
088411 ACGCAGATGG AAGGTATAGG TTTTACCGTC TTCGCTGACT TCCCACTTTT CAGCGAGGCC CGGGATCACT 
088481 TCGGTGGTGC CGATTTTAAA TTCAACCAGA CGGTTATAAA GCGGGACGGA AGAGGCGTCA TAGGTGGTGC 
088551 CGGAGGTAAA CAGCTGCGGG TTAAACCCTT CCGGAGATCC TTCTGAGCAA TAAACCAGAG TTTTAGCCTG 
088621 AACACTTGCT GCGACGGTCA TAGCCACCAG GCTGAGACCA AGCTTCAGCA TCCCTGACTT TTTCAAGGAA 
088691 ATACGCATTA TTCTGCTCCA ATTGTGATGT TTGTTGTTTT AACCCTTTGC AGTGGGTTGT CGCTGCCTGA 
088761 CCTTTTTTGT TTTTTGCCCG GTCGGGTCAA CGTTATGAGG TGGGGATGCC GTACTAATTA ACATCAGTGT 
088831 AACAGTGCGG ATCCTCCATA AAATGCCCCT CGTGACCTAC AATCTGTCAA CAGAATGTGA AAACGTCAAT 
088901 ACAGCCAACC GGGATTTACA CCAACGGTGA GAATCCACAC ACAAAGATTA AAAAAACTTC AAACAGCTAT 
088971 TTGCAGCAGA GAAATTTGTG CTACTCCAAC ATGACCAGAA CAATCAGCTT AATATTTAGC AACATTTGGT 
089041 GATTAAGTTT TATGCATTTA ATGAAAAAAA TCTGAGGAAA AGGTGGATAT CTGAGCGATT AATACCATGA 
089111 ACGCTAAAAC GCACAGCGGA AAATGCCAGG GCCAGCCATA AGTAACGCAA AAAAAGATTT AAGCAAATAT 
089181 AAAAAAAGAC AATGGTTTCT GTCACAAATC CGTTAATGGA TAGTGAGATA TGGGGCGCAA ATTTGGCAGG 
089251 GAAATGTGTG TCGTGTAGGT CGAATAAGGC GGTCGCGCCG CATCCGACAA TGGCCGGCAC ATTTGCCTGA 
089321 TGCGACGCTG ACGCGTCTTA TCAGGCCTAC GTCGAGTCGA ACCTCCCTGC CCCCGGAGGT TCTCATCCTC 
089391 ATGAGCTGCA GATGCAAAAA AGCCTGCTCG TTGAGCAGGC TTTTCGAATT TGGTCGGTGA TAGAGGATTA 
089461 CTCGCCACTT CGTGGCTCGC CCTGCGGGCC GTTGCTGGCG CAACGTTCTC TCGCTTCGCT CGAGTCGAAC 
089531 CTCCCTGCCC CCGGAGGTTC TCATCCTCAT GAGCTGCAGA TGCAAAAAAG CCTGCTCGTT GAGCAGGCTT 
089601 TTCGAATTTG GTCGGTGATA GAGGATTCGA ACCTCCGACC CCTTCGTCCC GAACGAAGTG CGCTACCAGG 
089671 CTGCGCCAAT CACCGAATGC GGGGCGCATC TTACTGCGCA GATACGCCCT CGTCAATCCC TTAATAGCAA 
089741 AATGCCTTTT GATCGGCGAG AAAGTCAGCA GGCCGCTTAG TTAGCCGCTG CCTCTTTTGC CTGCGGGATG 
089811 TGACACCAGT TGTTGTTTTC GTTAATTCCA CCATCCGGTG AAGTATAGCC AAGACAACCC ATGATGGTAT 
089881 CGTACAGCTC TACGTGACGG CGTGGCACTT TCATGTCGGC TTCTTTTTTC AGCTGCGCAA ACGCCTGCGC 
089951 ATTGGCCGGA TTTTCCAGAT ATTTATCTGA CATCCAGACC ATCATCGGTA CGCGGAACTG CTCCGGCGGT 
090021 GCCAGTTCAC GCGGCGTGCC GTGCAGGTGC TCGCGTTCAT TAATTGACTC ACCGTGGTCA GCTGCGTAGA 
090091 ACACAATCGC TTTCTTATCG CGAACCTGAT CAATCACGCT GGAGATAAAG TGATCCACAT AGGTCACCGA 
090161 GTTGTCATAG GAGTTGATCA TCTGCGCTTT GGTACAGCCG CTATCAACAC CAATACATTC CGGCTTCCAC 
090231 TGCGCGAAGC TACGCGGATA ACGCTGGGTG TAGTTAAAAT GCGAACCTTT GGTATGCAGA ATGATCAGAT 
090301 GCTTACCATC CGGGTTGCGC CCTAGCGATT GCTGCATTTC GTCTACCAGC AACATATCAT CTACCGGCTT 
090371 GCCACGATTA CGTGGCTCCG CACCAATCTG CTCACGATAA GCAATGTTGT CCGCCATCGT GTTGCTGTAG 
090441 AACCACATTT CGCTCTGCAT AGCGTAGAGG TCAGAACTGA ATCCTAACTG CTTCAGAACC GCGAAAATGT 
090511 TCTGTTCTTT TAATGTGCGC TGCGGATTAT CTTCCGCGCC CCCCTGACGT ACAAACATGC AACGCAGTGA 
090581 GAGTTTGGTT GCGGTATCAC AGGAGTAACC ACGGAACGCC GCCAGATTTT TCTCCTGGGC CAGTTTCGGC 
090651 GTGGTATTAC GCTCATAGCC GAAAATACCC ATATGGTCCC AACGCGTGGT TTCACCGATG ATAAACACGA 
090721 CATAAGTGTC ATCAACGTTT TGCGGTGCCT GATAAGTGAA TTTCTTCGCC GGATTAAGCA ATGAATTATT 
090791 ATCGGAAGAT TCATCGACCC GCGCCCAGGC ATACAGCCCC AACGCAGAAA GCCAGTTTGA TGGCAGATAA 
090861 GAGTTCGCTA CGACACCGCC ATAACTCGGC AAATCAACGC CGGTCGCCCT CTCCACTTTC TTCTGCTGGA 
090931 TATCCAGCAA ACGAATCGGT GCCCAAACCA TAATACCCGC CAGTACGACG ACCGCCAGGC TGCGAATACG 
091001 CTGCCCTGGG GTTCGCAGTT GTCGGAGCAA GGTGTAGCGA CAGCGGTTAT TCCAGATAAG GATAAGAGGC 
091071 AATGCACTAA CGGCGATTAA CCAGAGAATA AAGTTCAGAC CAACAACTTC TTTTGACAGG TCGATATCGG 
091141 TGGTCATGAC GGAAGCGATG ATGCCATAAC CAATGACCAC ATTAAGGAAG GTCATGTAAT AGCTGGCACC 
091211 TGCGGAAAAG AGCACCACCA GCGATGCCAG AATACGCCAG CTGCGGCGGC CAAACAGCGA AAGAAGACGT 
091281 AGTAAAAAGA AGGTCACCAG TACGGTGGCG GCCAGTTCAA CAACAGCAGA AATGCCTTTC CAGACGGTAA 
091351 AATCGTGCGC ATAGCTGCCG AAGCGGCGGT AAAAAACCGC GCCATTCATA AAAAGGCCAA TATAGATTGC 
091421 AAGCAAAAAG CTCAGCTTCT GCTGTGTAAT CGATTTGATG TATCTCATGC AAACAAACCC TGGACAAACA 
091491 GGTGATAACA CCCTGCTTAG TGGCTTTTCA GGCCCGGCAG GGAAAAAGTG CGGAGGTAGT CAGATAAGTA 
091561 AAATCTACAC GCGCGAATAA GTAGACCACA GCAAAGGGAA AAAGTGTGGG GAAAGAGTGT GCATGAAGCA 
091631 CAAATTTACA AAAATGCAAG TTTGAAAAGA GACTTTAGCG TTACAAAAAG CAGTAAAAAG GGCCAGTTAA 
091701 TTGGCCCAAA TTTTACGAGT CATTGTTTAT ACATTTCGTT GATGCGTTTG ATGCACACGG AAGCTGAAGC 
091771 CCAGTAGCTC GCGGCTGAGC ATTAAAGGGA GCCATGCGCC TCACGCAACA TTTTCTGCTC TGGCTGACGA 
091841 ATCGTCGTAG AAAGCGCCAA TGACAGAATC AGCAGGGCGA AAATCACGTA GAAGGTCACA TAGAAGCCGC 
091911 CAAACAGTGA GGCGATAATC GAACCACAAA TGCTACCGAT ACCGAAACCG AGATAAATCA CACCGTAGTT 
091981 TTTCGCCAGG TTATTGAGGC CAAAGAACTC ACTGACCAGT GACGGAAAGA CGGTAATAGT GCCGCCAAAG 
092051 TTAAATGCCA CGCAGGCAAT CGCTGCAAAG AACGTCACTG CATTCAATGG TGCAAACAGC AGGGCCGCCA 
092121 TACCCACCAG CGATATCACC TGACCAATGG TAATAACACG GATACGGGCG ATTTTGTCAG ACAGAATACC 
092191 CAGCACCAGA CGACCTGAAA GGTTGGCGAT GGAAATAACA GTGACTGCAT TGGCTGCGGA AACCACATCA 
092261 AGGTGTGCCA GACTTTGGGC GATATCTTTC GCTACCCCAA TCACGTACAG GCCGCTCATG CAGGCGGTCA 
092331 GGAACATTAC CGCTAACATC CAGTACTGCG GTTTACGCAT CGACTCTGCC AGCGTGTAAT CTTTCTCCAC 
092401 CACACCATTG CTGGTTTTCA CTTCCTGTTT TGGTGCGTCT TTCATTAACG TTGCGCCGAA AACAATCATC 
092471 AACAGCGCAA TCGCTCCCCA AATCACAAAG GTTTTTTCCA GACCGACCGT TTCCAGCAGC TGCGTGTCGA 
092541 TAAATTTGAA ACCCAGGCTA CCCAGACCAT AAGAACCGAT AGCGAACGCG GAGATCAGAC CTTTACGCTC 
092611 CGGGAACCAC TTCACACAGT TAGAGAGCGT CAGCAGATAA CCCGCGCCAT CTGCCAGTCC CACCAGCACA 
092681 CCGGCGCTTA ACCACAGCAT CATCAGGTTG TCAGAATGCG CTGTCAGGAA GAAGCCTAAT CCCAGCAAAA 
092751 TGCCGGAAGC CATGGTGACG CGTTTAACGC CAAAACGTTC CTGTAATTTG CCCGCAACAG AAGACGAAAT 
092821 TGCCAGCCCC AGACTTAACA AGCCGAAAGA GAAAGCGACC TGGCTTACCG GCGCATCCAG CTTGGCGGAA 
092891 AGCGCGCCAT TAAACAGGCT CCAGGTATAA ACCGACCCCA GCGCAAACTG GGTAATGATA GTACCGATGA 
092961 GTGTCAGCCA GCGGGTACGC TGATAATTTG AAGGTGTCAT GGCAGTATTC CTGCAGTAAT AAAAAGGAAA 
093031 AATCTCTGCC GACAACCATA ACGAAGTGCA CTTTATGCCT GGGGAAAAAC GGCATGAAAT GCCATCAGAA 
093101 CGGAATGAAA TGCCTTAGTT CAGGAATGAA TGACGCGACA ATTATTCACC AAATTTATTA TTTGGTAAGT 
093171 TAGCACCCAC TATCGCCACA ACTATTGTTA TTTAATGGTT TCAATTGTGA CTGTTACGTT AAAATCTGGC 
093241 GCTAACCCCC ATCGTATACA GATAGTCGCT ATTATTAGTG GTATTTTCTG CCTGAGTTAG CGCGGCATAG 
093311 GCGGCAATAT TTTGATTGAG CAACATATCA GCGCCTACGG TGACATCCAG CCAGTTGCCG TTCTGGTTTG 
093381 TCGCCGTCAT CCGGCTCAGG CCTGATTGCG CCTTCCAGAT ATTCTCGCCA AATTGCTGGT TATAGCTGAT 
093451 TTGCGCCCAG GGTCGGAGAT CGCCAAGCCG GGAGTCAACA CGCCAGCCTA AGGTACTCAC GCTGGCATGC 
093521 CATAACGGAT CGGTCAGCGT GGTAGTACTG TCGCCAAACT CGTTATACAT CGAGGTGGTT GTGCCATCGT 
093591 AATGTAATGC CGCGACCGGG CCGGTTGTAA CCTGTTCATA TAAAGGAAAA TTCCAGCCCA TACTCATACT 
093661 GCTGGTCACA TCCACAGGGG TTTCTTCCGC CAGATTGACT TCCAGTCCCA GCGCCCTTTG GCTACTTTGA 
093731 ATACGTTGCG ACAAAATATC GTTGTAATCA GGTTGATGAT CACTATCCCA GGTGTAACGC TCTGTGGAAA 
093801 GTCCGGGTTG CGTATCAACG ATATATTCTT GTTGCCAGGC GTAAGCTGTG TTGAGAAAAA AGGCACTGAT 
093871 TACCACGCTC GCCAGCAGGC TTAGCTGCCA GCGACCACCG CTTTTTTTTA TGATCATTAA CACGACTCCA 
093941 GGGAAGAGCC GAATTCGGCA ATATTATTGT CATTGTATGA AGGATATCGG GCATAGTAGC CCTGTATTAA 
094011 ATATTGACTT TTTCACCGAT GCGTCAAGAA AAGCGGCTGA AATTTTTACG ATCGGGTACA TAGCGAGGGA 
094081 AAGTATGGAA CGTTGCGGCT GGGTGAGTCA GGACCCGCTT TATATTGCCT ACCATGATAA TGAGTGGGGC 
094151 GTGCCTGAAA CTGACAGTAA AAAACTGTTC GAAATGATCT GCCTTGAAGG GCAGCAGGCT GGATTATCGT 
094221 GGATCACCGT CCTCAAAAAA CGCGAAAACT ATCGCGCCTG CTTTCATCAG TTCGATCCGG TGAAGGTCGC 
094291 AGCAATGCAG GAAGAGGATG TCGAAAGACT GGTACAGGAC GCCGGGATTA TCCGCCATCG AGGGAAAATT 
094361 CAGGCAATTA TTGGTAATGC GCGGGCGTAC CTGCAAATGG AACAGAACGG CGAACCGTTT GTCGACTTTG 
094431 TCTGGTCGTT TGTAAATCAT CAGCCACAGG TGACACAAGC CACAACGTTG AGCGAAATTC CCACATCTAC 
094501 GTCCGCCTCC GACGCCCTAT CTAAGGCACT GAAAAAACGT GGTTTTAAGT TTGTCGGCAC CACAATCTGT 
094571 TACTCCTTTA TGCAGGCATG TGGGCTGGTG AATGATCATG TGGTTGGCTG CTGTTGCTAT CCGGGAAATA 
094641 AACCATGATT CGGGAAGCGC AACGTTCAGA ACTCCCCGCG ATCCTCGAAC TGTGGCTGGA AAGTACAACC 
094711 TGGGGGCATC CCTTTATAAA AGCGAATTAC TGGCGTGACT GCATTCCGCT GGTGCGGGAT GCCTATCTTG 
094781 CCAACGCGCA AAACTGGGTC TGGGAAGAAG ACGGTAAGCT TCTCGGTTTT GTCAGCATTA TGGAAGGCCG 
094851 ATTTCTGGCA GCGATGTTTG TCGCACCGAA GGCCGTCAGG CGCGGTATTG GTAAGGCGCT GATGCAGTAT 
094921 GTGCAGCAGC GCCATCCCCA CCTGATGCTG GAGGTTTATC AAAAAAATCA ACCGGCGATA AATTTTTACC 
094991 AGGCACAGGG TTTTCACATT GTCGATTGCG CATGGCAGGA TGAAACCCAA CTACCCACAT GGATTATGAG 
095061 CTGGCCGGTG GTTCAAACGC TGTAAGTGTC AGTTCCGGAC CGTTGTATTT TTCCAGCCAT GCCAGCGCCG 
095131 TATTACCCGC ACAGCCATTC CCCAGCCGCG AGCTGGGGAG ATCTTTGGTC AGCACGTTCA CTGCGCCGTT 
095201 TTTACAAATA CCGTCAGCGG TTAAATCCAG ATCCGGCCAT GCCCCTTCGT GAATGCAAAT CACGCCAGGT 
095271 TTAATTCCCT CGCTAATGAC CGCTCCGGCA AGAATTTGCC CGCGTGCGTT CCACAACCGA ACAGTATCGC 
095341 CATCTTGTAT GCCGCGCTCC TGGGCATCGT CAGGATGAAT GGTGACAGGC TCACGATTTG CCACCGCGTA 
095411 CAATTCGCGC AGAGAACTGT AATTCAGCTG GCTGTGCAGG CGGTGCGCCG GATGGGCAGA AAGTACCTGC 
095481 AACTGTTCTG GTTCGGCATT GCCCTGCCAT TCGTCCGGCT CCAGCCACAT TGGATGCCCA GGGCAATCCG 
095551 GGTAACCGTA ATCGGCAATA CGCTGTGAGA AGATTTCAAT CTTGCCGCTG GCGGTTTTTA ACGGATGCGC 
095621 CAGCGGATCG CGGCAAAAAT CAGCGAAGCG AATAAACCGC TCGCTGTCCG GGTTTTCCGG CATCTCAATT 
095691 AACTGGTTGG CTTGCCAGAA CTCAGCAAAT GGCGGCAATT CAACCTGCTG GCTTGCCCCG CGCTGTCGGG 
095761 CAACGTTATA AAACGTTTCC AGCCATTGCA GCTCACTTTT TCCTTCCGTA AAACGTGCAT AACCGCCCTT 
095831 CTCCCAGCGT TCACTTAACT CGGCAAAAAC ATCAAAATCA TTACGCGCTT CATAGCGTGG CGGCACCACT 
095901 TGCTTCATCG GCACCAGATG CTGATTACTG TAATCACCGG TCATGGTGAG ATCATTACGC TCAAAAGAGG 
095971 TAGTCGCAGG CAGAACGATA TCCGCGTGTT TTGCCGCCGC CGTCCAGAAG CATTCAGAGA TCACCACCAG 
096041 CTCCGGTTTT TGCCAGGCAC GGATCAGGCG ATTGGTATCC TGATGATGAG TAAAGTTGGC ACCGCCCGCC 
096111 CACCAGATAA AACGAATATC CGGGAAATGT CGGTTCATAC CGTTGTGTTG ATATGCGCCA CCAGGGTTTT 
096181 CCAGTGCTTC AACAATGCGG GCAACAGGGA TTTTATCCAC CGCATCGCAG CCACCCGGCA AGCTGCCCTG 
096251 CATGGAAGAG AGCACCGCAG AACGCCGCGT GGGGTTACCA CCATTGGCAA AATGGTAAGA AAGACCAAAA 
096321 CCGCCGCCGG GTGTGCCGAT TTGCCCCAAC ATTGCTGCCA GCGTGACGAT CATCCAGTGT TTTTGCTCAC 
096391 CAAACTGTTG GCGCTGCATT CCCCAGCCTG CCATCAGCAT GGTGGTATTT TGGTGGAAAA TAGCCGCCAG 
096461 CTCGCGGATT TTCGCTGCGC CAACACCACA AATCTCTGCT GCCCATTCGG CGGTTTTCGC TATTCCGTCA 
096531 CTCTCGCCCA GCAAATAAGA GGCGAAGACG GCATAACCTG TGGTGCAACG CGCCAGAAAC GCTTCGTCGT 
096601 GCCAACCATT TTCCACCAGC GTATGGGCGA TCCCCAGCAT CAGCGCAACA TCGGTGCCCA TGTGCGGTGC 
096671 CACCCACTCC ATTTTATCGC CAAAGAAATC GACGGTTTCC GATCGCATTG GATCAATGCA GATCAGCTTT 
096741 TTCCCGCTGT CACGCAGTGC AGAAAAGTAA GAAAGCCCCT GCTCATCGGA TGCATTCCAC GCAATTTTCA 
096811 GCGTATTGAG TGGGTTAGCA CTCCACAGCA CCACGACATC GCTATGTTCC AGCACCAGCG GCCAACTGGT 
096881 CTGCTGTTGA TAAACTTCAC TACCACCCAC GACATACGGC ATGATCGCCT GTGCCGCGCC GGTCGAATAA 
096951 TCCCCCAGAT GCCCGGTATA ACCGCCTGCC AGCGCCATAT AGCGTTGTAA TAATGTCGAG GCCTTATGCA 
097021 GCACGCCGTT TGAACGCCAG CCGTAGGAAC CAGCAAAAAT CGATGCCGGA CCATAAGCCT CACGAATGCG 
097091 TTTATGTTGT TGGTGAATAA GATCCAGCGC CTCATCCCAA CTCACGCGAA CAAATTCATC CTGCCCACGA 
097161 ATGCCTTGCG GGTTTTCCGG TGACGCAAGA AAGCCTTTTC GCACCATTGG AAATCGTACC CGCGTATTGC 
097231 TGTGAACCTG GTCGCGAACC GCGCTCTGCA AGGAGTTTTC CATTCCTGTG GCTAACGCGC CACGCGAGCT 
097301 AAACACGGTT TCGCCGTCGG TTTCAACCAG CATGGGCCCC CAATGGGCGG CAGTCAGAAC GGAATATCGT 
097371 GAGGATGAGT TGGCCAAACC GAAGACTCCT GAAAGGTTAG ATGTATTGAG CAGTTAAATA TTACTTACAA 
097441 ATTTCCGAGT ATTCCCAGGA ATAATCTTCA TGTTCACGCG GCATAATCTC CCGCCACGGA ACCCGTGGCA 
097511 AAGAATAAAA AGGTTATTAA GGATTAACAA TGAAGAAACG TGTTTATCTT ATTGCCGCCG TAGTGAGTGG 
097581 CGCTCTGGCG GTATCTGGCT GCACAACTAA CCCTTACACC GGCGAACGCG AAGCAGGTAA ATCTGCTATC 
097651 GGCGCAGGTC TGGGCTCTCT CGTGGGCGCG GGTATTGGTG CGCTCTCTTC TTCGAAGAAA GATCGCGGTA 
097721 AAGGCGCGCT GATTGGCGCA GCAGCAGGCG CAGCTCTGGG CGGCGGCGTT GGTTATTACA TGGATGTGCA 
097791 GGAAGCGAAG CTGCGCGACA AAATGCGCGG CACTGGTGTT AGCGTAACCC GCAGCGGGGA TAACATTATC 
097861 CTCAATATGC CGAACAATGT GACCTTCGAC AGCAGCAGCG CGACCCTGAA ACCGGCGGGC GCTAACACCC 
097931 TGACCGGCGT GGCAATGGTA CTGAAAGAGT ATCCGAAAAC GGCGGTTAAC GTGATTGGTT ATACCGACAG 
098001 CACGGGTGGT CACGACCTGA ACATGCGTCT CTCCCAGCAA CGTGCGGATT CCGTTGCCAG CGCGTTGATC 
098071 ACCCAGGGCG TGGACGCCAG CCGCATCCGT ACTCAGGGCC TTGGCCCGGC TAACCCAATC GCCAGCAACA 
098141 GCACCGCAGA AGGTAAGGCG CAAAACCGCC GTGTAGAAAT TACCTTAAGC CCGCTGTAAT CCCTTTCATG 
098211 CCAGGTGATG CAGAAATCAC CTGGCATTCT TCAGTTTTCC TTCATCATAT TTCAGGCTAA GGTGATCGCC 
098281 TTATCAGTGA ATGGAGAGAA GCATGAAGCC GTCCGTTATC CTCTACAAAG CCTTACCTGA TGATTTACTG 
098351 CAACGCCTGC AAGAGCATTT CACCGTTCAC CAGGTGGCAA ACCTCAGCCC ACAAACCGTC GAACAAAATG 
098421 CAGCAATTTT TGCCGAAGCT GAAGGTTTAC TGGGTTCAAA CGAGAATGTA AATGCCGCAT TGCTGGAAAA 
098491 AATGCCGAAA CTGCGTGCCA CATCAACGAT CTCCGTCGGC TATGACAATT TTGATGTCGA TGCGCTTACC 
098561 GCCCGAAAAA TTCTGCTGAT GCACACGCCA ACCGTATTAA CAGAAACCGT CGCCGATACG CTGATGGCGC 
098631 TGGTGTTGTC TACCGCTCGT CGGGTTGTGG AGGTAGCAGA ACGGGTAAAA GCAGGCGAAT GGACCGCGAG 
098701 CATAGGCCCG GACTGGTACG GCACTGACGT TCACCATAAA ACACTGGGCA TTGTCGGGAT GGGACGGATC 
098771 GGCATGGCGC TGGCACAACG TGCGCACTTT GGCTTCAACA TGCCCATCCT CTATAACGCG CGCCGCCACC 
098841 ATAAAGAAGC AGAAGAACGC TTCAACGCCC GCTACTGCGA TTTGGATACT CTGTTACAAG AGTCAGATTT 
098911 CGTTTGCCTG ATCCTGCCGT TAACTGATGA GACGCATCAT CTGTTTGGCG CAGAACAATT CGCCAAAATG 
098981 AAATCCTCCG CCATTTTCAT TAATGCCGGA CGTGGCCCGG TGGTTGACGA AAATGCACTG ATCGCAGCAT 
099051 TGCAGAAAGG CGAAATTCAC GCTGCCGGGC TGGATGTCTT CGAACAAGAG CCACTGTCCG TAGATTCGCC 
099121 GTTGCTCTCA ATGGCCAACG TCGTCGCAGT ACCGCATATT GGATCTGCCA CCCATGAGAC GCGTTATGGC 
099191 ATGGCCGCCT GTGCCGTGGA TAATTTGATT GATGCGTTAC AAGGAAAGGT TGAGAAGAAC TGTGTGAATC 
099261 CGCACGTCGC GGACTAAGCC GCGACTGCGT AGAGTAAAGC CCGATAATCG CTCGGGCTTT TACTCTTTAT 
099331 TGGGTTGCAG TAACTGCTGT AGTCCAGGCC TGATTAAACG CCTGATGCTG TGCCGGTAAT GGCGCAATCA 
099401 GTTTGT