MG1655
W3110
Search for
Japanese | English
Deletion Report : 22
General information
Deletion 22  
Location (BP) 2,754,437 - 2,812,234   Go Linear View
Length (BP) 57,798
Related strains
     Strains ME5105    ME5106    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer R_2754434_C_22B_L  
Sequence TGCAGGAACTGCACATCTAGTCAGTGTCTTTCGCCAATAAAACTTTAGAT  
3' Primer L_2813227_C_22B_R  
Sequence ATCTAAAGTTTTATTGGCGAAAGACACTGACTAGATGTGCAGTTCCTGCA  

 Linear View (Whole Mode)
View Location
   2750.0  –  2850.0 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             AAGCAGCGAA CCAAACAGAG CTTCGGTGCC 
-00070 TATCCTGCCG TCTCGCTTTC TGATGCACGT AAACTCAGAG CCGAATCTAA AGTTTTATTG GCGAAAGACA 
000001 TTGATCCTCA GGAACATCAG AAAGAACAGG TGAGGAATTC TCAAGAGGCC AAAACCAATA CCTTCTTGTT 
000071 AGTTGCCGAG CGTTGGTGGA ATGTGAAGAA AACCAGCGTA ACAGAGGACT ATGCCGACGA TATCTGGCGC 
000141 TCGCTTGAGA GAGATATTTT CCCGGCAATC GGTGATATCA GTATCACTGA GATTAAGGCT CATACTCTGG 
000211 TTAAAGCAGT TCAGCCGGTT CAGGCCAGAG GTGCATTAGA GACTGTTCGC CGCCTTTGTC AGCGTATTAA 
000281 CGAAGTCATG ATTTATGCGC AGAACACAGG CCTGATTGAT GCTGTTCCTA GTGTAAATAT CGGAAAAGCT 
000351 TTCGAGAAAC CGCAAAAGAA AAACATGCCA AGCATCCGGC CGGATCAACT TCCGCAGCTA ATGCACACCA 
000421 TGCGTACGGC AAGTATCAGC ATGTCCACAA GATGCCTGTT CATGTGGCAA CTTCTAACCA TCACCCGCCC 
000491 TGCCGAAGCT GCTGAGGCTC GATGGGATGA GATCGATTTC AATGCTAGCG AATGGAAAAT TCCTGCAGCT 
000561 CGAATGAAGA TGAACCGGGA CCATACGGTT CCACTATCTG ATGGGGCTCT TGCTATTCTG GAAATGATGA 
000631 AGCCTCTCAG TGGTGGCCGA GAATTTATCT TTCCTAGCCG TATCAAGCCC AACCAACCAA TGAATAGCCA 
000701 AACAGTGAAT GCAGCACTCA AGCGTGCTGG CTTAGGAGGT GTACTTGTTT CACACGGCTT GCGTTCTATC 
000771 GCCAGTACGG CACTCAATGA GGAAGGATTT CCACCTGATG TCATTGAAGC AGCGCTTGCT CATGTAGACA 
000841 AAAATGAGGT GCGTCGCGCT TATAACCGCA GTGATTATCT TGAGCAACGT CGTCCGATGA TGCAATGGTG 
000911 GGCTGATCTC GTAAAAGCAG CAGATAGTGG TAGCATCGTT TTAACTCATT TGAGCAAAAT TCGTCTTGTC 
000981 GGATAAAATA TTTATCAGCC CAGCTCTCTG GGCTGATATT TCTAAAAGAT CGCACTAAAT AGCTACGCGG 
001051 AATAGTGCTC TACTTTCGTT TAGCCCTTTC AGAGGTAAGA CATTAGGGCA ATTTCACTGT ATGACTGCGC 
001121 AGTCATCGAG TCTGTGGGGT GTTGCTCCTT TTGCAACGTA TCACTTGTCA ATAAATAGAA AGTGTAGATG 
001191 TATTAGGCGC AGCTATTTAG TCTATATGGC AAGTAGTAAT TATTTACTTC TTTTTTTTCT ACGAACAGCG 
001261 CTATCGAAAG CTTGTTTTAC ATCTTCATTT TTTAAAGACC ATTGATTTAA AATAGTATCA ACCAAAGCAT 
001331 CTTGACTCAT TGTTGCTACA CGATATTTTT TATTTTGATT ATTTATCTCA AACTCTGACA TTTGAATAAA 
001401 ATCCCATAGC GGTTCGATAA GTTCATTAAC TGCTACAACC TTATTTTTCC ACCCATCATT CGGAACAGAG 
001471 TCATTAATTA GCTCAACCAA CTTCAGTTGA ATGATATGGT ACACTTCCGC TTTGCTTTTG CCACCCTTCT 
001541 TTCCTGCACT CCGCCTGACT TCTGATAATT TTTTTTGATT ACAAACAGAG ATGTTAAACC AAGTCATACC 
001611 TATGCACTTA TCAAATAACT CCGCAGCCCG ATGAAATGCT TTAAAGGCAA CGTTTTCATT TTCAGACATG 
001681 ATAGATTTTC CCCAGAAAAA AGAGATTGAG GCGAACATAA GGTGTGCCTT GAAAATGTCA TTAATGGAAA 
001751 ATGGCTCGAT AACAAGAGGT AAAAACGTTT CCTTGGTAAG GTTTGAACTT AGATTTTTCC AGCATTCTTG 
001821 AGCTGGATCA TATAATTCAG TGTATTCTTC CTTTATCTCC AGTTGCCCAT TCACTGTATG GTGCCTTGTT 
001891 TCCCATGGTA CATCGCAGGA ATATAACCTC ACACGAGTAC CTATTTTCTC AGAGCTCCAG AATTGCTCTC 
001961 GCATTCTGCC TAGCTCAATC CGTATTTCCG GATGATCTTC CTCTAGAACA TCAGTATCCA CCGCCCATTC 
002031 GCATTCGGAC ATGTGATAGG CGAGATCACG TCGTTTTCTA CAAATTTGTT CATAAAAATC ATTCAGAGAA 
002101 ATCATAAAAC CACCATAAAT CAATGTATTA GAGGTTGTAA AAATTGTATT TTTGGTACAT GGGTTTTTTG 
002171 CCTTAAAGAT ACCCATTAAT CTCTCTGCAA CCAAAGTGAA CCAATGAGAG GCAACAAGAA TGAACAATCG 
002241 ATCGGCCGTT AGAATACTAC GGTTACCAGC GGTTATCCAA AAAACAGGTA TGGCACGGGC CACCATCTAT 
002311 GACTGGTTGA ACCCCAAATC ACCACGATAC GATGCCACCT TTCCCAAAAA GCGAATGCTC GGCGTGAAAT 
002381 CTGTCGGATG GATTGAGGCC GAGATTGATG AGTGGTTATC ACAACGCTGT AAACTTATTT GAGGGTGTTA 
002451 CATGAATTCA TACTCAATTG CTGTCATCGG AGTGTAAACA TCCTGCTATT TCCGCCATTA ATAGCGGAAT 
002521 AGCCATATTT GCTAAACAAT TTCTTAATTT AATTAAATAA GAGGCATTGC ATGTTCAATG GTCGTCCTTT 
002591 CCCTGTAGAT GCATTTCCTA AAATTATCAG GAATGCAATT TATGAAGTGG AACAGCATAC GCAGGCCCCT 
002661 CAAGGTTTGA TTGCTGCTTC TGCTCTTGGG GTAATTTCTC TTGCCTGTCA GAACCGGATT GATGTTTGCC 
002731 GATTGAATAA TCTACGTGGC CCGGTATCAC TTTTCTTAAT GACTCTGGCT GAATCAGGTG AACGTAAGAG 
002801 TACGGTTGAT AAACTGCTGA TGAAGCCATT ATATCAACTG GAAGAGGATT TATTTGAAAA ATACACCCAC 
002871 GATCTTACCG CATGGAGAAA TGATGAAGCA ATTTTTAATA TTGAAAAAAA AGCACTGATG TCAAAACTTA 
002941 AATCAGATAT TCGACGTAAC AAAGATCACT TGGCAACAAA TGAAAGACTT AAAGAACTAC TTACGACAAA 
003011 CCCGAAAGCT CCAGTGAGAT TCAAATTTTT ATTTAACGAT GCCACACCTG CAGCTATTAA AGCTCATCTC 
003081 TGTGGGCACT GGCGATCAGT CGGCATCATG TCTGATGAAG CTGGGATCAT TTTTAATGGT TACACACTTA 
003151 ACGAGCTGCC GTTTATCAAT AAGATGTGGG ATGGTTCAAT ATTTACGGTG GAAAGGAAAA ACGAGCCCGA 
003221 GAAATTAATT AGAGATGCAA GAATAACACT GTCGCTGATG GTCCAGCCTA ATGTTTTTAA GGGTTATATC 
003291 GACAGGAAAG GAGATATGGC AAAGGGGATT GGATTTTTTG CACGGTGCCT CATGTGCCAG CCTGCTTCAA 
003361 CACAAGGTAA CAGAAAAATT TCCAACCCAA TTTTTTCAAA TGAACATTTG CCGGTATTTC ACCAACGTCT 
003431 TATGGAAATT GTTAATGAGA GCATCATTAA AATTAATGAA AATAATCGCA TCTGCCTCCG ATTCTCTGCA 
003501 GAAGCAGAAA GACATTGGAT CGAATTCTAC AACCAGGTCG AGTCAGAAAT GAGAATGATT GGCCTTCTTT 
003571 ATGATTTTAA GGATTATGCT TCTAAAATGG CGGAGAACAT GGCGAGGCTT GCTGCCTTAC TTCATTACTT 
003641 CAGCGGTGAT GGAGGCGATA TATCTGTTAC CGCAGTAAAA GCAGCAGTGG AGATAGTGGC TTGGTATATT 
003711 GAAGAATACA TCCGCTTGTT CTCTAAAAAA GAAGAGTTTT CTTTAGATGT TTCAGAAGCA GATGAGCTTT 
003781 ATTGTTGGAT AAAAGATTAC TGCACGCAAA AATTTTCTTC CTGCATCAAG AAAAATATTA TCTTACAATT 
003851 TGGGCCAAAT AAATTTAGAA ATCGTGACAA GGCAAATGAA TTAATTAGAA TCTTAATTTC ACAAAACAAA 
003921 ATATTTATAT CTTCATGGGG TAAAACAAAA ATAATAAACA TAACTCATTG TGTTTTTTGA TTTTAATGAC 
003991 AATCTAAAAG GACTTAATTT AAGAGTAAAA ACAAACTCTA AACCCAGTTC GGATAAAAGC TTGTCATCTT 
004061 GATAGGTAAT ATATAGGTAC ATAGACACAT CAGAACGATC ACTTACTCCA ATATCATTGG CCAGGATACT 
004131 ATATGACATA CGATAGTGAA TTCGGATCAC ATGTATCCCT ATATCGGGAT AGAATCAAAC AGGTTATTGA 
004201 TGACTCCCTA AACGAACATC TTAACTCAAT GATTCTACGT GTTGATCTGC ATGACCCAAT TGATACAGAA 
004271 AATATGGATA ACCCATTCTT TCAACCCAGG GTTGACTCTG GTGCTATATC TCGCTTTACC AGTGCGTTAA 
004341 AAGCAAAGCT TAAACATGAT AAGCATATTA AAACTCAACG GAAAGACTGG CCTGATAGTC GACATTCCAC 
004411 TTTACGTTAC GCATGGGTCA GAGAATATAC CAAAAATAGA AAGCGGCATT ACCATTTGAT ACTGTGTTTC 
004481 AATCAGGATG CTTATTATCA TTTAGGTGAT TACGACTTAA ACCGTAACAC GTTACGTACA ATGATAACGA 
004551 CAGCTTGGTA CAGTGCACTT GGCATCCCTA TAGATAGCTC GGGGAAGTTA GTTAATTACC CGCCAAATGG 
004621 CAAATACCTT CTCAATCGTA AAAGGGACAA CTTTGAGCAG ACTTATAGCG ATTTGATGAA TAGGGTGGAT 
004691 TACATGACCA AAGTAAGGAC TAAAATAGTC GGTGACGGAG ACCGTAATTT CGGCTGCAGT CGCGGGTAAT 
004761 TTATTTTTTA CAACAATGGC CTTTCTTATG GCTGGAAAGG CCTGATTTGT TTGTATTAAG ATATCGGTAA 
004831 TCTTTTGATG GTTGGAAGCC CGTCCTGGTA GACGACCTAG CCTACCGAAG ATGTGAGTTA TTCAAAAATG 
004901 TCGCTTTCCC GCGTTCCGTA GACAAACGTA CCTAAATCAA TGTCGTCTAA TACCGAGCGC GCGCCTGATA 
004971 AACATCTGAT CAACGTACCC AATCGATCTA CTCCAAATGT CCTGAGTATC CCGAAGATAC TGGCTCAACT 
005041 CATCCACATC AGCCTCGTCG GAAAATTCCA GCAAGTCTAC CAGTCGGTGT AACGTCTGAA TGGGAATGCC 
005111 AATCTCTTCT AAGGCATTGA CACCTGGTGG TAGATGGAAA CTTTCGAACG CCAATTTGAC ATGTGTGTAA 
005181 TCGACTTTGC TGCGTATACC ACGCTTTACA GCGTGGTGTT TAACTACATC CTCCATCAAG CTGAGCACCT 
005251 TAGGTAGGGT ATAGCCGAAG GTATTGGTTA TGAGCTTCAA ATCATTGTTG AGGGCAATGG AAAGAGTACG 
005321 TTTCTCCCCT TCAGAAATCC ACTGTCGTGC ATAATCGATC TGATTTTTCA GATATTCCGA ATAACTTTCA 
005391 GCACTTAAAT AGCCGGCAAG TTTTGCGATC ATGACATCCG TAGGCTTAAC AGGGACCCCA TTGCGACTGA 
005461 ACGTATGGGG AACCAGTCTG GCAATGATCT TTGCAAAGGT CTTGAGGAAG TTTGTCGCGG GAGTCCAGTG 
005531 AAACACTAAC GAGGAAAATT CGTTATCGTC CATCATCTCG AACATGCTTT GCAGCATTTC GAACTGCTCG 
005601 ACACGGAAGT ACGAATGCTT CTTCACAAGG TCGATGGAAA CACGGTCGTT TATGAAAACC TCATCAAAGC 
005671 GATCCTGTGA AAACTCGGAC AAGTGGTCTG GTTGAACGCT GGCTAACAGG TTGATTGGGG TATCAATGCC 
005741 CTGAATACCG AGCGGAATAT CCACCTCTTG ATTGAGATTG TCTTCCGGGA TTTCCTCCAG GCAAAAGATT 
005811 TTGCCGACGA AGTGAACGCC CATGCGCCCG GCGCGACCTT TGATGTTCCC ATGGGTGAAT TTGTCAATGC 
005881 TGCGAGTTCC ATCGCGGTTG TCGTAGATCA CAACGTTCTT AGCGATAGTG TTGACTCCTT CAATGATCGT 
005951 GGAGGTGCAG AGCAAAAAGC GCAGTTTTCC AGCATTGAAT TGGTCGGCAG TGTATTGCTG CAGTGCCCTC 
006021 GGTAGCGCGC CAAAATGCAA GCCAATACCG TTTCTAAGGG CGACTGTGTA ATCCCAGTCG GCATCGAACT 
006091 CTTCGCTGAC CCAGTCGACA TGGGGATTCT CAGTCGGAGT GCCATGCCCA AGCCTGATCA GCTCGCGCGC 
006161 CACCAGGCCC GCAACAGTTG GTGACTTGCA ATAAATGATC GTTGCGTCGA CACATGCGTG CGCGATTTCC 
006231 CCCAGCGCTT TGAGCTTGGC TTTGTCGTCA TTCGCTTTGA TGCCGAACGT CTTAACATCT AGCGCGACTG 
006301 TATTGAAGTC GGTAGAAACG AAAGTATGCG GATATCCAAG TTTTTCGAGA CCGCGAATGC TGTTAACGAA 
006371 CGGTCCCGTC AGGTAAAACT GCCTGGAGAC CTTAAGCAGT TTGCTTAACG CAATGTTGAG CTCGATGACT 
006441 CGTTCGTCTT GATGATCAAT GTCCCCGCTT TTCAGTTGTC GGAACGCCAA CTTGTAAAAC TCGTCAATGA 
006511 CGAAGAGGTC AATGTCGACG ATGTCGTCAC GCTCGTTCAC TCGCTCCTGA GTTAACACAT AAACAGCCTG 
006581 ATCGGAATGG CACACTTGGG AACTGTGGTG GATGATCTGA TATCGGTCAC CGAATCGCTC TTGCAGTCGG 
006651 CGACGGGTTT CGTCGGCAAG AGCCACGGTT GGAACAACCA GAACAAGCCG TTTCAAAGTT CCCATGCCGA 
006721 GCAATGAATC GACGATTGCA CTTTTGCCCA TGCTTGTAGG TGCACTCAGC ACCACGTTTT GACCAGACTT 
006791 GAGCAGATCG AATATGTGGA ACTGCATTGA GTGGAAAACA TAACCATCCG AGAATGGCGT CCGGTATAGC 
006861 TCAAGCACCC TCAGGTCATC CGGTGTCAGG CTGGTGAACT CCTTTTTGAG ATACGGGAAC AAACCTGATT 
006931 TTCTCACCAT ATTTTTCAAA ATTGTGGTGT GCTCGGAAAA CCGCTCGCGC GAATCGAGAG CTCGCACGAT 
007001 CAAGTCCCGT CCCAAGTCAT ACGAAACAGG GTTAGACAAC AGCTTGTTAA CCGCAAACAG ATAATTGAAC 
007071 GATGAGAAGT CCTCACCCTG CAGGCTATGT TTCGCCTGTT CATAGATCTC TGTCATACGA CCTCTCTCAC 
007141 CTTCTCATCA ACTAATTGGG TTAACCGCTC AAGACTCGGG GCTGGATAAA TGAATACGTG GATGCAAAGA 
007211 TTCGCAAACG GCGAATCCTC GATGAGGTCA GCCGCGAATT TTTCGAACAG CACCGCTGTT TCTTTCTCCA 
007281 GGTCATCCTC GAACCCCGGC GTTTCAGGCT CGGTTAGTAG ATTAGAGTCG TAGCCCACGA ACAGAACAAA 
007351 CGTGAAACGA TCGAGGTGAG CATCGAAAGG TTGGCTGCCA TCAAGAATTT CGTCAATGTC GTGGCGAAGC 
007421 AGGTAGTTAT CGTCTTTAAT GTCGAGGATT TTTTTGCGCG CGGTATCGAT GCAATCCGAA ATGTCCTCGT 
007491 ACAACTGATC CCGTATCTCC GGCAATCTGA CGGCAATGTT AATATCAGTC ACCAACTCGC TGAAGCCAAT 
007561 CCAAAGCTGA TCACCTTCTG GATCGCGGCG AACGATATGC ACGTTTTCAA GAATTTTTTC GGCCCCTGCT 
007631 TTTTCCACGT ATAGCATGCA AGGAATAGGC TGGCTTTCGT GGTGCTGCCG GATCGTTGCG TGCAACAGCA 
007701 CTCGACCCAA AAATTCGCTG ACGTCATGGA GCGATTTGAA GACGGAATTC TTTAGTCGTT CTCGCTTTTC 
007771 AATGAATGTC AGTTTATGAA TATCAGACAT TTCTTTTGGT CGGAGAAAAA CCTCATCCAA CCATTGACAG 
007841 ACGTTATCCG CGATGTGCTT GTAGCGGTAT TTCTTAAGTG AGTACTGCTG ATGTAGAACC TGGCCTTTAC 
007911 GCTTAGCGCA GACCGAAGCC ATAGGCGCTC TAAATGGCGT AAGGATGTGG GGTAAGTCCC GTTTGACGTA 
007981 GATTTTGCGG CCTGACCGAG ATTGGTCATC TTCGACACGC TGCTTGAACC ACTCAAGTAG GTCTGGTCGT 
008051 AAGTAGGACT TGTCATCAGC ACTGTGAATG CGTCGAGAAT GCTCGCCCTT GCGCGTCACA GTATCAAGGA 
008121 TGCGGCACCA AATGTCTTCG GCGACGGTTT CGGAACTGAG AATGACCCCA TGTAGATCTT GGGAGGCCAG 
008191 CCGTATGTTC TTGATCCCTA GAAGTTCCAG TTCGCGCAGG GATGAAAACA CTTCCCATGT AGCCGCATCG 
008261 ATCCAATCTG AAACGCTTAT ACCTGAGTCT GTTAAAAAAT TGTCTGTGCG TTTGTTGAGG TCATCGATGA 
008331 GTTCCTGTCG ACCTGGCTTA TCTAGTCGGG CGTTTGGGCT GATCGTCAAG TACTCAAGGG TTTTGTTGAC 
008401 CTTTTCCTCT GTGACGATGG AGTACCTACG TCCAAGGGAC AGGTCAGACT CACACTGCAT TGATTTGTGC 
008471 AAAATTGAAC TGCAGGGGAT CGTCTTTTTA TCAGCACCTT TTGAATTCTG AACGATGTCC GAAATGTTCC 
008541 AACGTGTTTT GCCGGTGCTT TTTACCTGAA CGAAGTCGAT GTATCCATCA GATACAATGT CGATATCGTC 
008611 TGTGACCTCG CAGCGCACAC TGCGGATAGT CTTGTCACGA AGCATTCGGG TGACATGGTA AGCGGCTACG 
008681 CAGTCCTGAA ATAAGAAACC GTGCTTGGCG GCTACTCCGC CTGAATCGTT CGACTCCATT TAGACATCCG 
008751 TGACAATTTT GCGAAAATTA AGGAGATGTT ATGACACAGT CCAATCGGAT CACTGCATCA TCACCAGTGA 
008821 TCTAAATACT TCACAGCCAT TCTCGGTCGC AGGTATCAAG CTTTTCAGGA TTCCACAAAT ATTGTAACCC 
008891 TGACGTCTAA TTTGGTTATA TAACATACTG CCCCAACTAA CGTAAGGTAG GCACAGCCTT AATCAAGGTT 
008961 TTGGTTTTCA AATAGTTCAG AGCTGAGACC GCCAACCGCA CTATGGCACT ATGGCACTAT GGCACTATGG 
009031 CACTATGGCA CTATGGCACC GCCAGCGATT GTAATCACAC TTGATATTAT AAAACACAGT TGCACGCATT 
009101 ATTTCCTGGT TGGTAGGGTC ATATCTCGAT GCTCTTTGAG CAATGTCAAC ATCGCGTGTT CATGGCTTTC 
009171 TATATTGTTG ATGCCTTGCC CATCCGGACC CCACTCCTTA TAGCTCATCA TGATGGCTTG TTTTGGGCTC 
009241 TCTGCTCGTT CTGTTTCGAC GTAGAATTTT TTCTTGTCTG CTGGCGAATA ATTACTAAGT ATCGAGTTGC 
009311 TGCTTGGTGA GATCAGGAAG AGGTTACCGA AACGATGGAC ATCATCCCCC ATTTTGTGGA CTGCCCCCCC 
009381 GGTAGACGAT CCTGCCCTAT AGTTGGAGTG CCCCCTATTC AGGTGGCTAA ATTTAGCAAA TCAATACACT 
009451 TCAGGGGGGT ATTATTGTAG AGTTTCCCCA TATGTTTCTA TGGGATCCAG GAAATGACAA TCAGGAGTTA 
009521 CAAAAACTTA AATCTGGTCA GGGCAAATAT CGAGACTGAA TCCAGACAAT TCATTGAAAA TAAAAACTAT 
009591 TCAATCCAAT CAATTGGTCC TATGCCAGGG TCAAGGGCTG GGCTTCGGGT CGTATTTACC AGACCAGGGG 
009661 TTAACTTGGC AACTGTGGAC ATTTTTTATA ACGGGGACGG TTCGACTACA ATTCAATATC TCACTGGAGC 
009731 CAATCGTTCT CTGGGCCAAG AGTTAGCGGA TCATCTTTTT GAAACCATCA ATCCTGCTGA ATTTGAGCAG 
009801 GTAAATATGG TACTGCAAGG ATTTGTAGAG ACAAGCGTTC TACCTGTACT TGAGCTATCA GCAGATGAAT 
009871 CGCATATAGA GTTCAGAGAA CACTCTCGTA ACGCTCATAC CGTAGTGTGG AAAATTATTT CCACCAGCTA 
009941 TCAGGACGAA TTGACTGTGA GCCTGCATAT CACAACAGGT AAGCTCCAGA TTCAGGGCCG ACCGCTGTCA 
010011 TGTTACAGAG TTTTCACGTT TAACTTGGCA GCCCTGCTTG ATTTACAGGG TTTGGAGAAA GTGCTAATCC 
010081 GCCAGGAGGA TGGTAAAGCT AATATTGTTC AACAGGAGGT TGCCCGCACT TACTTGCAGA CTGTAATGGC 
010151 CGATGCTTAC CCGCATCTCC ACGTGACTGC CGAAAAATTG CTCGTTTCAG GGCTATGTGT TAAACTCGCC 
010221 GCCCCTGATT TGCCTGACTA CTGTATGTTA CTTTATCCTG AACTACGCAC CATTGAAGGT GTCTTAAAAA 
010291 GTAAGATGAG TGGGTTAGGC ATGCCAGTAC AGCAGCCGGC AGGTTTTGGA ACTTACTTTG ATAAACCTGC 
010361 TGCTCATTAC ATTCTGAAAC CGCAATTTGC AGCTACTCTT AGACCGGAAC AGATTAACAT CATCAGCACA 
010431 GCCTATACTT TTTTTAATGT GGAACGTCAT TCTCTGTTCC ACATGGAAAC TGTGGTCGAT GCCAGCCGTA 
010501 TGATTTCTGA TATGGCCCGG TTGATGGGTA AAGCCACTAG AGCGTGGGGA ATAATCAAGG ACTTATATAT 
010571 TGTTTGAAAT CACCGGAATT AACGTCTCAG GGGCTCTAAA AGCTGTCGTT ATGGCGACCG GCTTCGAGAA 
010641 CCCTTTGTCC TCAGTTAATG AAATTGAGAC GAAACTTTCT GCCCTACTGG GTAGTGAGAC CACTGGTGAA 
010711 ATCCTTTTTG ACCTCTTGTG CGCTAACGGT CCAGAGTGGA ACCGCTTCGT TACGCTGGAA ATGAAATATG 
010781 GCCGGATCAT GCTGGATACG GCCAAAATTA TTGATGAGCA GGACGTTCCG ACACATATCC TGAGCAAACT 
010851 GACTTTTACT TTACGTAATC ATCCTGAGTA CCTAGAAGCC TCTGTTTTGT CTCCCGATGA TGTACGCCAA 
010921 GTCCTGTCAA TGGATTTTTG AAACTCTTCT TTCTAAACGA ACCAGTATAG AATTCGCCCT TTTGGCATGA 
010991 TATTAACTTG TCCAATATGA TCAAATAGCA TTAACCCCCC CTCACAACGT CCTGCATAGG GAACACGTTT 
011061 TCCCCTGTGC ACCCACGACT AAATTTCCCC CCCTTTAAAC TTCTCAATAA TGTCACCAAT TTTCTGGAAA 
011131 TCCTATGATG CCTTTCCCGG TAAATGGTGC TGTGAGTTCA GAAAGATTCT GCAATCTATG TGCATTGAAA 
011201 AAATCTTCAG ATAGATATCA TTCTCCTGAA CAATCCGATG AACGGCAGAA CCTCGCGGTT CTGCCGTTTT 
011271 TGTTTTACTT TTCAGAGGAG TGGTGATGAA AAATTTTGAA GTTCTGCAGC CACTACAGAA CTCCCTTTCC 
011341 GGTCTACCGC TATGGGTATC TGAACGTATA TTGCAGCAGA TAAATCAGTT AACCCACTAC GAGCCAGTGA 
011411 TCGGCATCAT GGGTAAAACT GGGGCGGGAA AGAGTAGCCT TTGCAATGCC CTGTTTGCCG GTGAAGTATC 
011481 GCCGGTCAGC GATGTAGCGG CCTGTACACG TGATCCTTTA CGCTTTCGCC TGCAGATTGG AGAACACTTT 
011551 ATGACCATCG TGGATCTGCC CGGCGTGGGC GAAAGTGGCG TTCGCGATAC CGAGTATGCT GCGCTGTACC 
011621 GCGAACAACT TCCCCGGCTC GACCTGATTC TGTGGCTGAT TAAGGCTGAT GATCGGGCAC TGGCGACTGA 
011691 TGAGCATTTT TACCGTCAGG TGATTGGCGA AGCATACCGG CATAAGATGC TGTTTGTTAT CAGCCAGTCA 
011761 GACAAAGCTG AACCCACCAG CGGTGGAAAT ATCCTTTCCA CAGAGCAGAA ACAAAATATC AGCCGCAAAA 
011831 TCTGCCTGCT GCATGAGCTA TTCCAGCCCG TGCATCCGGT GTGTGCCGTG TCGGTTCGCC TGCAGTGGGG 
011901 ACTAAGGGTG ATGGCAGAGC GGATGATTAA GTGTCTGCCG CGTGAGGCCA GCAGCCCGGT AGTAGCGCTA 
011971 CTGCAACATC CCTTTCGAAC AACGGTAGCC CGGGAGCAGG CACGTGACGA TTTCGGTGAA ACCGTAGGTG 
012041 CCATACTCGA TACGGTAAGC ACCTTTCCCC TTATTCCCGC CCCGGTGCGG ACCATTATTC AGGCCGTGCG 
012111 TTCCTCGGTG GTGTCAGTGG CCCGCGCTGT CTGGGATTTC TTCTTCTGAG TGTTTAATTC TGCCCTATTA 
012181 TTCTCCGAGC CCTGTCGCAA GTGCGGCAGG GCTTTCTTTA TTTGTTTTAC CCATACTGAG GAGTCTGCTT 
012251 ATGACCCGTC TGGCTTCGCG CTTTGGCGCT GCAAATCTTA TTCGCCGTGA CCGTCCGTTA ACCCGTGAAG 
012321 AGTTATTTCG CGTGGTGCCC AGCGTATTCA GTGAGGATAA ACACGAATCC CGCAGTGAAC GCTACACGTA 
012391 TATACCCACA ATTTCCCTGC TGGACAGCCT GCAGCGGGAA GGCTTCCAGC CATTCTTTGC CTGTCAGACA 
012461 CGGGTACGTG ACCCCCGTCG TCGTGAGCAT ACTAAGCATA TGCTGCGCCT ACGTCGGGAG GGGCAAATTA 
012531 CCGGTAAACA GGTTCCGGAA ATTATCCTGC TTAACTCTCA CGATGGCACC AGTTCGTACC AGATGCTGCC 
012601 GGGCATGTTC AGGGCGGTGT GCCAGAACGG TCTGGTCTGC GGCGAGTCGT TTGGCGAGGT GCGGGTGCCA 
012671 CACAAGGGGG ATGTGGTGAG TCAGGTTATT GAGGGGGCGT ATGAAGTGCT GGGGATTTTT GAGCGTGTGG 
012741 AAGAAAAGAG GGATGCCATG CAGTCGTTGC TTTTACCGCC ACCTGTGCAG CAGGCACTGG CAAAAGCAGC 
012811 GCTTACGTAT CGCTTTGGTG AGGACCACCA GCCGGTTACT GAATCGCAGA TACTCTCCCC ACGCCGCTGG 
012881 CAGGATGAGA GCAATGACCT TTGGACCACC TATCAGCGGA TTCAAGAAAA CCTGATTAAG GGCGGACTCA 
012951 GTGGGCGTAA TGCTAAAGGC GGACGAACTC ATACTCGTGC CGTGCGTGGC ATTGACGGGG ATGTGAAGCT 
013021 TAACCGTGCG CTGTGGGTGA TGGCAGAAAC ACTGCTCACG CAACTGCAGT AGACGTTTCA TGTTGCCACG 
013091 TTGTTAATAT CGGACACCAC CTGTCCGCAT CGCTATGTGC TCGTGTGCCT CAATCCCCCG GTTATAGCTT 
013161 TTAACCCCCG TTACATCTGG CTTTTGCAGA AATAAAAAAT AGTTTCTGCG TTGTCCATAC CCTGTCCGCC 
013231 CCCCTCTTTA AAGTAATCAC ATCATTTTCA GTCAGTTAAC TTTCCTGGAG AATCTCTCAT GACACAGGCA 
013301 GAACGCCGCC ATGACCGGCT GGCTGTCAGG CTGTCACTGA TAATCAGCCG TCTGGTTGCG GGTGAAACGT 
013371 TGAGCGTGCG CAAACTGGCG GCTGAGTTTG GCGTGTCAGT GCGCACGCTG CGGCGTGATT TTCGTGAACG 
013441 ACTGATGTAT CTGGACCTGG AGTATCAGTC CGGATACTGC CGCTTACGCA CTGCTGGCAG TGAGATGCAG 
013511 ATGGTGCCCG ACGTGCTTAT CTTTGCCCAC CGCAGCGGGC TGGCCGGGCT TTTTCCCGGC CTTGACCGCC 
013581 GTCTGGTGAA TGCACTGCTG ATGTGCGATG AGTCTCCCTG CGTGATAGCA CCAGCCAATC CGGTTCCTTC 
013651 GCCTTCAGGA GCATTGTCTT TCTGGAGACT GATTCAGGCC ATTACCGGGC GCAGGCGGGT GACGCTGATT 
013721 GCAGAGGGGC GACGCTGTGA GCGCCTAGCT CCCTGCCGGT TACTCATCCA CCAGCAGACC TGGTATCTGG 
013791 TGGCTGAACA CGAAGGGCAT ATCGCCGTAT TCACACTTGA TGAAATCCAT CTGATTCAGC CTTTGCAGGA 
013861 GACTTTTCGC CGCAATGACA GTCTGTGTCG CCTGGTTGAA GACCCGGTCT TCATTCAGGC CTTACCCCAT 
013931 TTTCGCTTTA TCCAGCATTC ACTGCTTACG TTTGTTCCGG CCGACAGCCC ACCGGAATAG CGCAGGCGTT 
014001 GTTATCAACC CGGCAACATG GAGGAGCCCA GTGCCCGTTA TTGCCATTAT CGCCATTGTT ATCATCGTCA 
014071 TCATTCTGAA CAAAACCGGA GTGTCCGACA GCCTCACGGC CCTGACACTT GCAACCGTTG CCGCACTACT 
014141 GACGGGAGGT GGTGCAGCCG GTGCTGCCAG TGTCGCGCTG ACGCCGTTCG TCGGCGTGCC GGTGGGTATT 
014211 TTTGTGGGAA TTTATGTCTT TGCCAAAGTG GTTCGTCTGA TTTCAGGGAA AAAATAATGA AACGTAAAAC 
014281 ACTACCTCTG CTGGCGCTGG TTGCCACCTC TCTGTTTCTG AGCGCCTGCG ATGACAGGAG TGATGACCTC 
014351 AAAGCTATCA GTAAATTTAA GGACCTCACG CCCCCGCGCT TCAGCGATGT GGTCAGCCGT CAGGATGATG 
014421 TCAGCGAAGA ATGGTCACAG GTTGGCTTCT CATCCGGTCT CACCCTGCAG GTCTTACGTA CCCGTGAGTC 
014491 GCCCGATGGT TGCGAGGGTG GCAGTTACTA CTATCTGGTA GATATGGAGG AGAAAACCGT CCAGCCGCTG 
014561 ATGAATGCGC TTTGTATTGC CGACAATATC AAACTGGAAT ACCACGAAGT TACGGACCCG TATACGAAAG 
014631 AAAAATACTT CGAATATTCC CATGACGGCA AACTGATGGG ACGGCTGCTG ATACCGTCAA ACCCTGATAA 
014701 CCGGGAATAA AAACAACGAG AAAGGAGACA TAAATGAAAA TACGTTCACT AAGCCGGTTT GTACTGGCAA 
014771 GTACAATGTT CGCCAGCTTT ACAGCCTCTG CGGTCCCCGG ACTCTGGCAA CAGGGGTACG GTCAGGGCAA 
014841 TGCGGAATAC AGTGTGACGG ATGCCAGCGG AAAGATGTTT ACCATCAACT GCACGGGAAA TCCGGACCAG 
014911 AACGGTATTT ACCAGCACTC GGTTTTTCTG ATCCTCGCCG GGGATAAAAC GGTCAGCTCG CATGATGACA 
014981 GTACCGGCAT CACAGTGGTG ATGGACCATA AGCAATATGC CATTCCCTCA ACCCTTGGCT GGCGTAACGG 
015051 AGATAATGCC TGGTTCAGCT TCATCATGGA TATCCGTAAG GCCCGGCAGT TCGACGTCTA CGTCAATGAC 
015121 CAGAAAGTTG GATCGTTTAA CCCTGATGTT CGGAATGCAC AAAAGGTCCT GCCAACATTA GCGGACTGCA 
015191 CTAACGACTG ACGGCTGCGC CTTCCCTACC ATAACAACCC TGATTGCCTC CGGCGGTCGG GGGTTTCTTT 
015261 TTTCTCCTTA ATCTCCAGAG GTAGGCCACG TACTTTCGAA CGATGAGCGC AGTGGTCAGT TTTTTTCAGA 
015331 TATATTTATC TTTTTTTGGC TGTAAGCTCC GCTGTGAGCG CAGGCTGTGT TAAAACTCCT GATCACTTTT 
015401 TGGTCTAAGC GATGGTTTCA TATGATCAAC CATTCTTGAT AAACCCATGA GACGGACTAA CTTTTTCATT 
015471 AAAATTAAAA AGATATGAAT GAATACTGCG GATATCAACA TGGCCAATCA CATTCAAGGA CAAGGCAGGC 
015541 ATCAGGTGAC ATTGCTCCCT GATGCACTCG ATGATTTTGT CACTGAAGAT ATCTGAAATA AGTTTAATCA 
015611 GTTCATCACG GGTCGGTGGC ATATCGAGAT AATTAATTAT TGTCGGTTCG TTGCCGTTGT TATGAAGCAT 
015681 CTCCAGCGTG TTGCGTGAGG TGCCACAGGC CGGGTTGTGA TAGATGGTAA TGTTGCTCAT ATCAGTATCT 
015751 AATTACAAAG TGACAGAGAG CCGCCACGCC AGCGCGGCCA GAGTGACAAA CAGCACCGGC ACAGTCATGA 
015821 CAATGCCGGT ACGGAAGTAA TATCCCCAAG TGATTGTCAT ATTTTTCTGG GCAAGCACAT GCAGCCACAG 
015891 CAGAGTTGCC AGACTGCCAA TCGGGGTGAT TTTCGGGCCT AAATCACAGC CAATCACATT GGCATAAATC 
015961 ATTGCCTCTT TGACGACGCC AGTCGCCGTA CTCCCGTCAA TCGACAGCGC ACCAATCAGC ACCGTCGGCA 
016031 TATTGTTCAT CACTGATGAG AGAAATGCCG TCAAGAAGCC GGTGCCGAAC GTCGCTGCCC ATAACCCCTT 
016101 GTCTGCCAGC AGATTCAGCA CGCCAGACAG GTACTCCGTG AACCCTGCAT TGCGCAGGCC ATAGACCACG 
016171 ATGTACATGC CCAGTGAGAA AATAACGATC TGCCATGGCG CACCGCGCAG GACTTTTCCG GTGTTGATCG 
016241 AATGACCTCT TTTCGCCACC ACAAACAGCA CTGCTGCGCC AGCGGCCGCT ATCGCACTGA CCAGGATTCC 
016311 CTGCGGCTCC AGAAAGAAGA AACCGACAAG CAGCAATAAC AGGACAATCC AGCCCGCCCT GAAGGTTGCC 
016381 AGATCCTTGA TCGCACTGGC AGGCGTCTTC AGCAGCGAAA CTTAATACGT TGCCGGAATA ACTCTGCGAA 
016451 AGAAGAGATA CAGCATAATC AGCGTGGCCG CAATCGCTGC CGCATCCACG GAGATCATAA CGGAGGCGTA 
016521 CTGCGCAAAG CTCAGACCGA AGAAGTCCGC CGAGACGATA TTCACCAGGT TAGAAACAAT GAGCGGCAGG 
016591 CTGGCCGTAT CTGCAATAAA TCCTGCAGCC ATGACAAAGG CCAGTGTCGT GCCCTGGCTG AACCCAGTGC 
016661 GATCAGCATC GCAATCACAA TCGGCGTCAG GATCAGCGCG GCGCCGTCAT TGGCAAACAA CGCATCAACA 
016731 GCGGCACCGA GCAAGACTTT CCAGGTGAAC AGCGCTCTAG GTAGGAACTT TGTCGTTGAT AGAGTCTTCA 
016801 GCCATCAACA CTGTATCGAG TAATGAAATT GGTTGCTAGA AAGTCGATGA TTTGTTGCGT ATGATTAAAA 
016871 ATCAACCTTA AAGGCTTTAT ACATGGATTT GCTATGGCTT TTGTATCAGA AAGAGAAATT GTAAGAAAGA 
016941 TATTTAGCAA AAAAATTGAC TTTACGATCT TGGCATTTTT CTATATTTCC TCTATTTTTT TTCTTCTTTG 
017011 TAGTGGCGTT CTCTTTCAAT ATTTTACCGC TGCCTTCACA AAAGGTAATT GTTATGAATG CTCAATGAAA 
017081 CTTGATTACA TAAAACAATT TTATTTTTCA CTGGAAACCG CATGGTACCT CATATCTGCT GTTGCAGTAT 
017151 TTATTGCATC TGTTTTTATA CAGCATAGAA TTAAAGCTTA TTTAACATTA TTAGCTATTA CATGGATTGT 
017221 ACTAACAATA ACAGATGTGG CGTTAATACA CGCCTTAGAC AATATAGCCA TGAATAATAT TTTGTTAAAT 
017291 ATACTATATA ATCTTTTTGG GGCGATTTTA TTGTCACTGT TTATGTGTTT ATCAAATTCC CTCCTTTTCC 
017361 ACCTTAATAA GATAAAACAT ATTCCAATGA TTTTATCGGC AATGATTCCA TTAGTTTCCG CAATAATAAT 
017431 AGCCATACTC ATAACCGCTG TTATATATTT ATTGTTTGCC CGGCAGGCGG TAGAGATTGA GATGGATATA 
017501 TCTGAAGGTT CAGACATCGC ATATGTAGGT GTAAAAGATA ATGAGGAATC ATTTGGGTTT TTAAATGATA 
017571 AAAAAACAGA CACACCAACG TATCTGGATG TAATCAAAAA TGGTAGTTTG ATATATAATG ATACACAGGG 
017641 TTTAAGTGGT GCTGATATTT ATATTGTCTC CGGTTGTTAT GCCCTTCCAG ATTTACTTCG CAATGTACCG 
017711 CTTGATGCTA AAAAATCTTT TCTGAATGTA AAAAAGCTAG AAATCACACA GAAACTTCCA ATGATGGGGT 
017781 TCATACAAGG TGAATCCGCT GATGTGATGC CTAAAGCAGC ATCCAGGTTA AGTTTGAGCA AGCAAGATGA 
017851 TAAATTTATG CTAGCCTCAA GTGTTACTGA CTCTCAAATA AAATTTAAAT CAAACAATGC ACAATTGATG 
017921 GTTGCTTTCG CATTTATGCC AATAACAACG AATGGTATTT TACATGATTA TACATACGAT ATAATAATAA 
017991 ATGATAAAAA ATATAAAATT GAAAATCATG TTGCACCTCT ATCTAGGCTT GATAAAAATA AGAAGATGAA 
018061 GTGTGAATAC CAGCAAATAT CGGATTTAAC AAATACGTAT AACATTAATG CAAATTACTT AACGGGTTTT 
018131 TTACTTGTCC TAAAACCAGA TGATATTATT AATTACAACA ATAGCCCTTC CGTACTACTC AAGACTGATT 
018201 TTGCGTTCTA TAAAAAAACA TACCAGAAGC TTGATAAAAT ATATGATGAC ATAAGCAATG GAAAATTATC 
018271 TTCACTGAGA GCAACAGGTA TCTCCCAGTT TAGTATCAAC GGGAAACATT TGTCGTTAAG GCCAGAATCG 
018341 GAGATTATTA TTTCTGAAGG GAGTTTGTAT GGACTAGTTA ATAAAAGCAA AAAAATCAAA ATATATGGCA 
018411 CAGCAGATCT TGTTTTTGTT GATAACAAGA TAATGAACCT TCGTAAAATA ACTTATTTGC AATCTAAGCT 
018481 AGAAATTTTT GGTTCTTCTA TTATGGATAT ATTAAAGTAT ATATTTGGTT TAGGTCTGCT AGCAATTTCT 
018551 ATAAAATTCA TTCATTCTTA CTTTAAGAAT GATGTGAATG AAAATTTATT CTTGTAACGC ATTTGGCTCC 
018621 AATTGGAGCC TTTTTATGAC TATTTATTAA AATATCCTAA GTTAAGCCTG TTTTTAAAGC AGGCTTGAGC 
018691 GTGAAGCGGA CACTCATACC TGCTTTAAAG TGGCGTTTTT GTCGTTACCC ATACCTATAT TTTCTGTTGT 
018761 TTAACTGCCA GAACTGAGCG GTTGAAAAGC CAGAAATATG CCGAGCCAGC GGCATGGAAG CGCCAGCAGC 
018831 TGTTGAATGG AGTACTGTAG GCAAATGGTG CCGTAACCGG CTTTCGTACT GAAAGGTTCT GTCTATCCCA 
018901 TCCCTTCTCT TGTATCTAAC ATTTAGTTGT GAATAGCTAC TGTAAATGCC CCTACAAAAT GAACCATTAT 
018971 TTTTAGAGGG CGTCTGGCAC TCCAACTTCC GCTTTTGGCA CAGAACGGCC TATCAGCAAT ATAAAAGCAT 
019041 TCAGATATAT ATCATTTCTA CAAACATACC CGATTAACGG CAGAATCTCA GGATTCTGCC GCTTTTTTAT 
019111 TATTTTTCAG GGGAGTAGTA ATGAGCAACT CTGAAGGTTG GTAGTCATTT TAGCAAACGC TTTCTGGTCT 
019181 GCCGCAGTGG GCATCGGCTG ATTGCGTAGC AGGGCCACTG GTATCTGCCG GTATCACCGA CATTAACATT 
019251 GAAGACGACC AGGGCATTCA CGTCCGCCTG ATAGTTCGTG ATGCCGAAGG TCGGATGGTT GGCGGGCATG 
019321 GAACTTTGAA CCGGACGCCG GTGAAGGTTT TAACCGCTAT ATCCACAGGT CAGGCATCCG CACCGACACC 
019391 TTCCCCCGCT GACTCCGAAT CATTTACCAG CAACATTTCA CCTTCCCAAA CGCGCTTTAT TACCTCATAC 
019461 GCCAGCCATC GCCGCTGGCG TTTTTTATTC ACGGAGACAT ACCCATGACA ACACAGACAC AGTACGACCT 
019531 CGTACCCGCT AACGGATCCG AATTTGAGTT GAGCGTAACG CAGGTACCCG ATGAACAGCA TATCCGCTTC 
019601 TGGCCGCAGC ACTTTGGCAC CATCCCGCAG TGGATAACGC TGGAACCGCG CATTTTCGCC TGGATGGACC 
019671 GCTTCTGTGA TGAGTACTGC GGGGGTATCT GGTCCTTTTA CACGCTCAGC AATGGCGGAG CGTTTATGGC 
019741 TCCTGATGCT GACGGTGACG ATAAATGGCA TTTGCTCAAC GGCATGAATG GCAATGGTGC GGAAATGAGC 
019811 GCGGAAGCCG CAGGTATCGC TGTCTGCCTG ATTGAATATA GCCATCACGC CTGCCTCACC GAATGCGATG 
019881 CCATGACGGA GCACTATTAC CGCCTGCGGG ATTACGCTCT GCAGCACCCT GAATCCAGCG CCATTATGCG 
019951 CATTATTGAT TAAGGATACT CATGATGGAA CAGTCACTCA TCCCACAGAC ACCGGTACTT CCACTGACCG 
020021 CACAACGCAC GGTAAAACGC GCCTTAACGC TGCTTGACCG ACACCTGCGC GAAACAGGCG TGGCATTCAC 
020091 CTCCACTCAG GCTGCTCGTG ACTGGCTGAA GCTGAAAATG GCGGGGCTGG AGCGTGAAGA ATTTATGATG 
020161 CTGTATCTGA ACCAGCAGAA CCAGTTGATT GCCCACGAAA CCCTGTTTGC CGGTTCTATT AGCAGTACCG 
020231 AGGTACATCC CCGTGAGGTG GTCAAACGCG CCCTGTATTT CAATGCAGCA GCAGTGATAC TGGCGCATAA 
020301 CCACCCCTCC GGCGACACTA CTCCCAGCCA GGCAGATAAG ACTATAACGC AGCGTCTGGT GCAGGCGCTT 
020371 CAGCTCGTTG ATATCCGTGT CCCTGACCAT CTGATTGTTG GTGGCAGGCA AATCTATTCG TTCGCAGAAC 
020441 ACGGTCTGCT TTGAGGTATT ACATGAGAAT TATCAGTAAA CGCCGGGCAA TGACGATATA CCGCCAGCAT 
020511 CCTGAGTCCC GAATCTTTCG CTACTGCACC GGAAAATATC AGTGGCACGG TAGCGTCTGT CATTACACCG 
020581 GCAGGGATGT TCCGGATATC ACAGGAGTCC TGGCTGTGTA CGCCGAACGC CGCAGGACCG CAGCGGACCG 
020651 TATGCTTGAC TGATGAGTAT CACCCTGAAC TGACAATAAA GAGGTTATGA ATGAGCAACA CCACATGGGG 
020721 CCTGCAGCGA GATATCACGC CGCGCCTGGG AGCACGTCTG GTGCAGGAGG GCAACCAGCT GCACTATCTG 
020791 GCTGACCGGG CCAGTATCAC CGGTAAGTTT AGTGACGCCG AATGTCCTAA GCTGGATGTG GTATTTCCAC 
020861 ATTTTATCAG CCAGATAGAG TCGATGCTGA CCACTGGTGA ACTGAATCCC CGCCATGCCC AATGCGTCAC 
020931 CCTGTACCAC AACGGTTTTA CCTGCGAAGC CGATACTCTT GGTAGTTGCG GCTACGTATA CATCGCTGTT 
021001 TACCCCACTC AACGCTAACT AATTTCACGA GAGCAAGCAT GAACACTCTA CCTGCTACAA TTTCGCAGGC 
021071 GGCGAAGCCC TGCCTGTCGC CAGTGGCTGT CTGGCAAATG CTACTGACAC GCCTGCTGGA ACAACACTAT 
021141 GGCCTGACAC TGAACGACAC GCCGTTCAGT GATGAAACTG TTATTAAGGA ACATATCGAT GCTGGTATCA 
021211 CTCTGGCCGA TGCAGTCAAT TTTCTGGTGG AAAAGTACGA ACTGGTACGT ATCGATCACA GAGGATTTTC 
021281 GTGGCAACAA CAGTCTCCAT ATATTTCCGT AGTAGATATT CTGCGAGCAA GGCGCTCTAC CGGCTTGCTA 
021351 AAAACTAATG TGAAATAAAC GCTTAAATAC AGAGCAGACT GAAGGAAAGC AAAATGCTAA TCTCATAGAC 
021421 GAAGAGACTC CCGCTGTAAC CTCCCCTCCC CCGAAAAAAC CTGACATTTT CTTTTAGGAC CAACAATGGG 
021491 ACCAAAATGA AAATTGAACT GAAGATTACA ATCAATTTAA CAACAAGTTA CACAACCAAT TCAGACTCCG 
021561 CCAGCCCACC AATCATGATT GGACGGTGTA AGGACAACAC CAACAAAAAC AGGAAGTTAG AAGTCTCAGC 
021631 AAAACACCGA CCAGACGGTG AGGAGACATA AAAGGATACG CAAAGGAGCC GCGGCTCCTG GTAACATGAA 
021701 AGCCCACAGA TGTGGGCTTT TTCGTTGATG GTCAGAACGA CCAGTTCACA CCAGCTACCG CGTTCCACGG 
021771 GGATTCCACA CCGGCACTAT GGCTATACCC CACCCCAAGA TGCCCGCTTA ACGTACTGCT GAATGAGGCT 
021841 TTAATACCTG CCTGGTATAT TCCACGTCTG CCCGACAAAT AATTGACGAA ATTACCGTCA CTATTCACTT 
021911 TCACCCGGTT ATCATCGACA AATTCTTTGC GCACAGCCGC CTTCAGCCAC GGCTCAACTT CCATACCGTT 
021981 CCCCAGACGC ATGTTGTAAC TCAGCGTTGC GCCCAGTTCA CGATATATAC TGCGGGTATC GACTGATTTC 
022051 GATTTCATGC CATTGGATAA ATGATATTCG GGGTTATCAG CGGTGAACCC CGTTAACGAT GCATACGGCG 
022121 TCAGGTTCCA GTTACCATCG GTAAATCGCA TCCCGGTTTC AATGTGACCG CCCAGCCCGT TGCTGTGGTA 
022191 ACTGCCATTG GCGGCTCCAC CGCTGCTCAT TTTACCTGCT ACGTTACTTT TAAAACGGTT CAGCTTCACG 
022261 ACACCGTCCA GATAGAAACC ACTTTCATGT TCCCAACTGG CATAGCCGCC CAGAGAATAA CTGCCCACAC 
022331 TGCCATGTCC TCCGCGATCA AAACCGATAT GTGAATGGGA ATAGCCCATA AAAGCGCCTA GCGTGGTAAT 
022401 TCCTTCAGGA ATATCATTAC GGCTGTCGAT CCCCACTGTC ATTCCGGTCA GCGTCTGCTC AAACCCGGCA 
022471 CCCGCATCGG TGGTGACATT ATTACGGGTG TTATACGTCG CCCCCCAGAC ATTATTGTTG TGTGGACTCG 
022541 CTTTCATTAT GTTCAACCGC TCGCGAATAC TGTTTAGCTC AGCATCAAAT ACCAACGGTA ATGTTGCTGC 
022611 CATATTGAGT ACGGCTGCCG TAGAAGGCGT AATGCGTTTC TCCGGAACGG GTGTCGGCGT TGGATCGGGA 
022681 GTAGGGTCTG GTTTTGGATT TGGGTCTGGC TTTGGATCGG GTTTTGGGTC TGGCTTTGGA TTTGGGATGG 
022751 GGTCCGGGTT GGGTTTGACA TCATTGGTCA GGTTCCAGTT GCTGTTGCCG TCACTTTTCA GGACATACTC 
022821 ATAGGTCCCA AGATCAACGA AACCGCCGGT ATTGCCCAGC GTAAACGAAG CATCCCCTCC CCCTGTTTTC 
022891 ACCAGCGTCA TCGCGTCGTC AGACTGTGGG CTGACGCCGG TATCCTGAAC AAAGATTTTA AAATTACCAG 
022961 TGGCGTTGTT GTTGACGACC AGTTGATCGC CCCGGGAGCC TGCAACGTTG GTATGCAGGT AGAAATTACC 
023031 GCTACCGGAA AGTTCATTGG TTGTCAGCGT ATTGTAGATA CCGTTAGTTG TGGCAGGCGC TGCTGTTTGT 
023101 GCTGACAAAT AAACATCACC GTCGTTGAGT AGCAAACTGT TTACTCTATA TTCGCAGTTG CTGGTACCTG 
023171 CACAGGAATT ATTGCTGTTA AGCCAGACAC TGCCCCGGCT GGCAGCCGTC AGGTCGGCAA GCGTGGTATC 
023241 GACGCCATTT CCCAGAGTCA ATGTCGCGCT ATCGGTAATC CGGACCGCCC CTTCGAGTTT AACTGGCGTA 
023311 ACATTATCCC GTGGCGTCAT TAACGACAGG CTTCCTGTCG CGCCACTGAC CGATGCATCC GCCAGCGTAC 
023381 CTGCGTAGAC GATTGCCGTA CCGCCAGCGA CCTGGAGATC TTCTGCCCGG GCCAGAGCCT GAAACTCATC 
023451 TTTTGACCGC CCAAGGGTAT ATTGCCCGCC AGAGTTAACC TTTGTGGCGG AGTCCTGACC CAGGTTTTGC 
023521 ATTGCCCCAC CCTTGCCAAC CGTGGAGTCG CGAGCTTCGG TACCTGCTAA TACCAATAAA TTACCGCCAT 
023591 TTTCCAGCAA CATATTGGTC GCTAAATTGC CGGAAATGGA AAAAGTACCG TACTGGTGAG TACCGCTGAT 
023661 TTCAATACCG TTAGCCGTGC TCGTCTGGAG AGCGGCACCG CTGTTCTGGA CGATATCTGT CGCTTTGCCA 
023731 TTATCGTTGA CTGTCAGCGT ACCGCCTTCA TTGATCTTTG TTTTTATTGC CTCTCCGTTA GCTGAAACTG 
023801 TTTGTATTCC GCCGTCGTTA ATTGTTGTCT CATTCGCCAC ACCCTCGACA ATTTGTTCAC CGCCGGTGAG 
023871 CGTCGTGCCT GTCGCAGTGG CTTTTGTTTT GACGATCTCC CGTCCGCCCA TATTGACCTG TGTTTTGTCA 
023941 GAAGAGGTGT CTGACTCCAC GGTTAACACG CCGCCATTTG CCAGCAGGAT ATTGTTCGCC GCACCCTGCT 
024011 CGATGCTGAA CGCGACGCCA TCCGCGCGTG TTCCTGTGAC CCGCGTCGCC CTGGTGGTTG CAACCAAAGC 
024081 GCCCTGGCTA CTCTGCTGTA TCCCCGTTGC GCTGCCTTTC TCCCGCACAT CGAGTGTGCC GCCGTCATTA 
024151 AGCACCGAGT TTTCAGCCAG GCCGCCCTCA TTAACTACCT GTGAACCCCC ATTAATAATG GAACCTTCCG 
024221 CTGTCCCGTT TGCCATAATT TGTTGTAGGC CAGAGACGAT ATCGGTATTG ATTGCCTTAC CATAATTCTG 
024291 AACGGTTTGC GTGCCACCAT TGATGTGTGT TTTCTCTGTT GACCCACCAT CAACAATTTG TTCACCACTT 
024361 TCGATATTTG CTTCAGTGGC TAAACCATAT ACCGTTTGCT TGCCACCTTT GATATTTGCT TTATCAGAAG 
024431 TGGCACTGGC ATATATTGTT TGGGTGCCAG CACTATTGAG TACAGTGCCA ACATCTTTTC CATAAACATC 
024501 CATTTTGCCG TTGGCATTAA TAATCGTGTC AACTGCGCGG GAACCAGTGA CGACTGTTAA TGAGCCAGCG 
024571 TTTTCCAGCA CTACATTTTT AGCTTCTGAA TTCCTGATGT AGAAAGCATC ACCATAACTG TTGGTTCCTT 
024641 CGATAAGTGT TCCGGAGGTC GTGGAAGCAA TTAATGCGCC GCCGGATTGT TGCTCAACAT GCTTAGCCTC 
024711 ACCACCGTCC TGAACCTCCA GAACGCCGCC ATTATTAAGT CTGGTGCTAT CTGTTTTAGC CTCCTTCTGG 
024781 ACAATCAGCT TACCGCCAGT ATCAATGGTA GTATTTTTCG CCGAGGTTTT AGCCACTACC GTCAGTTCGC 
024851 CGGTATTTTC CAGCACAACA TAATTAGCCT CCCCTCCGGT AATAGTGAAG TGAGAGAGCT TGTTGTATCC 
024921 TTCGATATCA GTCCCTGCAC CCGTGTTGGC AACTAAAGCA CTGCCCGTCT CCTGGTTAAC CCCATGTGCA 
024991 ATACCGCCGG TATAGACAAT CAGCGAGCCT CCGGCGCTAA TATTGCTGCC AATTGCCGTA CCATCTTTCT 
025061 CAACAACCTG CCGGCTCCCG GAGGATATAA TTGTTGTGTC AGCTTTCCCG CCGCTTTTGA TATTTTGCGT 
025131 TCCGCTGTTG ATATTGGTGC CTGTGGCTAT GCCATAATTA TTAATATTCT GTGTGCCACC ATTAATTATG 
025201 GTATTTGTCG CGTTTCCTGC AACATCCATA ACCCCGCCAT TATCTATTCG GGTCGCATCA GCTTTAGCAT 
025271 TGGTTAAAAC TGACATTGTT CCTTTATCTT TAATAATCGT CTTGTTTGCC GAACCATATG CGTTTATGTC 
025341 TAAATGACCA CCGTTTTCCA GCAACACATT GTCTGCCACG TGATTGTGGA TGGAGAATGC ACCTTCACTA 
025411 TTCGTACCGC TCACCGTCGT ACCGTTAGTG TTAGTTTTTA AAATTGCACC ATCGTGCTGG GTAACATTTG 
025481 TTGCCGTACC ACCCCTAACA TCAAGCACGC CACCAGAATA AACTTCAATA ACATCCGAGG TGCTGGTGTT 
025551 ATCAACAATT TGCGTGCCAC CAGAATAGAT ATGCGTATTT TTTGCCGTTG ACTTACTATT CAGAGACTGA 
025621 GTTCCGCCTT CAATCGTCGT GTCCAGCGCA CGGCTCTCAT ATACTCTTTG CTCACCGCCA TTTTTAATGG 
025691 TTGTTGTTTC TACTGTGCTC TGTTCAACAT ACTGTCGACC ACCATTTATG GTTGTGTTCG TTGCCAGACT 
025761 TCCTTGTACT ACGTCCTGAG AGCCAGACTT ATTTATCGTT GTACCATCAG CATGCCCTTG AACTTTTACT 
025831 ATCTGGCTAC CACCATCAAT GAGTATTCCA TTCGCACTCC CTCCCTCTAC GCGTGAAGCA CCGCCCTTAA 
025901 TTGTCGTTCC ATTGCTGATA CCCCCTTTAT AAACGTCCTG ATTGCCACTC TCGATTGTCG TACCTGTGGA 
025971 AATACCCCCG TCATGAATTG ACTGTCTGCC ACCGTTAATG GTTGTATTAT TAGCCTGCCC CACAAAATTG 
026041 TTATGACTTC CTATATCTTG ATATCCACCA GATTCAATAA GACTTCCATT AGATACCCCG CCATGAACAT 
026111 TCTGCTGGCC ATGGTTGATA ATATGAGTGT TATTTGTTGT ACCTCGTTCA TCCACTTTTT GGTTGCCATC 
026181 TACAGTCTCA TCGTTTACCA CACCAATAAC ATTAGTAGTG AAGGCAGCCA TCCCGGGCGG GGCATATATC 
026251 AAGGCAGATA TCAATAAGGA AAGTACTGAG CGGCGACAAT AATAGGGACT GGTCCTGTTC ATAAATTTCA 
026321 TCCTCTGAAA AGTGAATACT GAGTAGCGTT TAAGCGACCT TAGCTTTGCT GCAACATCAG CCCACAGGCA 
026391 CCAGACCAGG GGATTCATCC TGAAGAGACA GCGCAAGTGT ATTGTGTTCA CCGCTCATCA AAGACATCAT 
026461 GATGAAATGA TGATATTCCG CATAAGAATG AGGCATTTTT TAAACGCAGT GCGCTGAAGT GTGGTTGGAT 
026531 AAAAAAGTCA ATCCATTCAG GAAATACGGG CGTATTCTTT TCTTTCGACA ATGAGGCCGT TGGCAAAATA 
026601 AAATGATTTA CATAATCGTT TCTGATGAAT ATCTTCTGCT CACATAAAAA TCACACAATA ACTTTGAGAT 
026671 CGCAGATTGT TTTACTTTTA CAGCATTCGT CCCCCCATTG TTGGGCAAAT ATAGATTGGG CCAGAGCACG 
026741 AAAGTTAATA CCACGTTCGC ACAGCTCCTC CAACAGCACG ACAAGATGCC ACATACTGCG CCCCAGTCGG 
026811 TTCAGTTTAC AGACTAGCAG TGCGTTCCCT GCCGATGATG TCCTGACCAG TTTTTTCAGT CCGGACCTCC 
026881 TGCCACGGTT TTACGTTGAA GTGGTAACCC TGAGCACGCA GTTCTTCAGT CAGGCGTGGT GCACCGTAAC 
026951 GCTGTTATTG CTGGGTAAGA TCAAAAAACT TTCAGGCAGC TAAGGAAAGT TGAACCAGAC ATTAGATGAA 
027021 ATATTTCAAC CAATTACAGC ACCAATTCAG TCACTGCCAG CCCACCAAAT AAATCAAGGG GTTACATGAA 
027091 AACGTAGCCC CTTTTTCTTT GGTAGTGACA CTAAAATGGA TGTAGTGTGA AGAATAATCC CGTTTACTCA 
027161 ATCAATAATA CATATTGTTT CAATCTACGT TATTATCTCT TTGTAAAAAT TGCCATTTAT TAATCATTGA 
027231 AAACTGCTTT TAGAACTTGA TACAACGGGA CTAGTCACAA CAGGACTATT CTCAACGGGA TCATCCTCAG 
027301 AGGAACTATC ATCAAAGTCA TCATCCATAA ATAAAATATC ATCGAATGGT GCCACGCCCG TGATGAGTTT 
027371 TATTTTATTA TTACGATCAG TCAATACTCC ACTTAAACCG TTTTCGCTCA CAGGTTTTAA TGATTTTTCA 
027441 TTACTCTTGT TGTAAGCAGG CGCATTAAAA ATACACGGAG TATCAACATC AAACAATGAC GTTCCCCAGT 
027511 TCACATATTG AATATCATAG TTACTGAAGT TCTGTCCAGA AAAGAAGCAC CCCTTAAAAT CCAATCCACG 
027581 TAAATTATAT AAACCACCCT CTTCTTTTTG GAGAGTAATG TTAATTTTGG CTATCTCCCG GACATCATCG 
027651 CCATTTTTGT ATTTGAATAC CGTTTCAAGA TGTTCTCCAG ACAGCTTGAC TTCAGGAAAT AATTTGAAAT 
027721 CAAAGCCTAT ATTATTATGT GTCAACGTAG ATGAACAAAA AATGGAAAAA GCTTGCAGTG CTGAATTATA 
027791 GCTATCGATT TTATCTTGAG GCTGAGCTCT TGGTAAAAAC TTATAGCAAC ACTCATAAAA ATTAAACAGA 
027861 AGCTCTGAAG ACCTTGTATT TTTATCAAAT AATACCCCCT TGAACTCATT CACAAACGCA TCTTTTTTTT 
027931 CTTGAATATC TATGGGGTGT TCCTTTGACT CTGACAAAGA TGAAATCTCA TCTATTTTGT TTTCATATGA 
028001 ATTACGTGAT TCCATACAGA CATTTGGCGG CGTTTCTAAA ATAACACTAC GCGTACTACT TGGCTTAAGT 
028071 AAACCAACAT GAAAATCACT TTTTCTTATA TTATCGAAAA GGTTCTATTC ATTTCTTTTA GCGCATTCAA 
028141 AAAACTGATC GGCATTATTT TTATTCGATA ATTTTTTAGT TTCAGAAAAC ACATTTTCAT TGTTTTCCAG 
028211 CTTTAGTTTA ATGAGAAGAT TTTCCCAGAC CTGCTTGCTT AAACATATTA CGTCAGGCTC ACCAGAACTA 
028281 ACTAACTCGT GATTATTATT AAAGTGTACG TTGAATACCT TTAAGTTATT TTCACCAACT TCATATTTAA 
028351 TACGTTTTAA TTGTTCTCCA GCTCCCATAA TGACAAAGGC GTTGCCTTCT TGATATATAC ATTCAGACAT 
028421 CATTTTTTGT AAAGTTTCAA GAGCACCGCG ATACGTCTCT GATGCAGCTT CCTTACAAAT TAATTTTAAA 
028491 ATACTATGAG CTAGTAGCTC CATGTGTTTA GAAGATTTAT TTTCATTATA ACTTCCACTA CCCAAAACTG 
028561 CGCTAGCGTT AAATCCGTTG CTTTTACTAA CTAACATTGT CTATTCCTCA ATTAATGTCT ACATGGCTAT 
028631 TTTTAATGTT ATTACTGTTT GTCACTATAA AAAAACGCTC ATTTGAGACA ATTACTGACA TTAACTGCTT 
028701 CACTTGCTAC GCATGGAACT TTTAATTAAA TTAGCACAGG AATGTTAAAT TTAATAAACA AAAGGTTATT 
028771 TCGCTGTATG ATAAAAAAAA CCGTTATAAT TTATTAGTGA AAATCGTTTT TCAAGTGTTA GAAATTTATA 
028841 TCTCAATAGC GTTGGTTAAT GAGCATAGCC ACGCTCCTGT AACGCTCACA AAACTCATCT GCCTGCGGCG 
028911 GGTGTTCTGG TCAGTAGTAG ATGTTTAAGG CGTGGCAGAG ACATTTCATC CTTACTCTAC GGCATTGTTC 
028981 TACATACATT GGTTGTGGTA CTCACTTATC ATCAGTGAGC GAACAGAGAA TAGTTCAGTG ATTTGAGTAA 
029051 TTAACCTGAT TAAATGAAGG GGTATAATAA ATGATAATAC TCTGGCTTTA TCGTTAATTA CTTAATTCCA 
029121 CATGTAAGCA ATTTGCCCGC TTGGCATAGC AGGCATTTTT TCCAGGTACT TTTGAATGAG TACTGATGGA 
029191 TAAATACATT GCAGTGGCGT GCCACGTACC AAAACACCAG CCCTCATTCG AAACCACCCA CCGCACTTCT 
029261 TCCTTGAAAT GGCGTTAGTC ATGAAATATA GACCGCCATC GAGTACCCCT TGTACCCTTA ACTCTTCCTG 
029331 ATACGTAAAT AATGATTTGG TGGCCCTTGC TGGACTTGAA CCAGCGACCA AGCGATTATG AGTCGCCTGC 
029401 TCTAACCACT GAGCTAAAGG GCCTTGAGTG TGCAATAACA ATACTTATAA ACCACGCAAT AAACATGATG 
029471 ATCATATGAT GTAAATAACA GATTTTTATG CGTTCCCATT CACCTTGGGT CGTGATTACA CGCGACATAA 
029541 AACCCGACAC CGCCTCCATT CGCAAAGTCG ATACTCGCAG TCAACAAGCA AATGTTAATA ATTAGCACTA 
029611 TCTATAGTTA TCATCGATTC AATGATACTT TGTAATGATT TTGTATCTAA TAATATAACT TTATTACATT 
029681 AGCTGAAGAG TTTTCGCATC ATTATGATAT CTGTTACTTT TCACTCCATA AAAATAAACT TCGTATAGCA 
029751 ATATATTCTT TCATAGATCT TATTCTGCTA ATCATTAGTT TCGTATGAGC GATTTTTGAC AGTTGCCTCT 
029821 CCAGACCACA TCGATAATTA ATAAAACAGA TTTAAGCATT ATCCTTTTCC ATATAAATAT TGGATAAAAG 
029891 TAGGACATCT GTTTGCAATT ACTTTCACAA CAATTAAACA TTTTTATGTT TCCGTATACA TCATATTACT 
029961 CTACCATTAG AGGAACTTTA TTATGTTTTC TATAAAACCA GGACCCAGAA ATTTACCTAT CGACAACCCC 
030031 ACATTGTTAT CATGGAACAT TACTGACGGG GATCTAAATT CCAAATTAAA TACATTAGAA TATCTAAACT 
030101 GTATAACAAA TATTATTAAT TCTTGTGGAG TTTACCCTCA AGGATTAAAA GACAGAGAAA TTATATCAAC 
030171 TTTTCACGCA GAAAAAGTTA TTAATGATCT GTTAAAAAAC GATTATAAAA TTTCCCTTTC TCCAGATACA 
030241 ACTTACCGAG AGTTGAATAA AGCAGCACAG CGTAGCATTA CAGCGCCAGA CAGGATAGGA GAAAGAAAAA 
030311 CATAGGTTTA TCAACGAGAT ACAATGATTG AAAGAGGTGA TAACAGCGGT GTTTATCAGT ATGGTCGTGC 
030381 TGAACATTTC ACCCACATTA TATCTGACAA ACCTTCCCCA AAAGATAAAT ATGTTGCATA TGCTATTAAC 
030451 ATTCCTGACT ATGAGCTGGC AGCCGATGTA TATAATATTA ACGTGACGTC ACCTTCCGGA CAGCAAGAAA 
030521 CATTTAAAAT ATTAATCAAT CTAGAACATC TACGGCAAAC ACTTGAACGT AAATCTCTTA CTGCTGTTCA 
030591 GAAATCACAA TGTGAAATCA TCACCCCCAA AAAACCTGGC GAAGCGATTC TTCATGCTTT TAATGCCACC 
030661 TACCAGCAGA TCAGAGAAAA TATGTCTGAA TTTGCACGTT GCCATTATGG GTATATACAA ATCCCTCCAG 
030731 TGACAACTTT CCGCGCCGAC GGACCAGAAA CTCCCGAAGA AGAAAAGGGT TACTGGTTTC ATGCTTATCA 
030801 ACCCGAAGAT CTTTGTACCA TCCATAATCC AATGGGAGAT TTGCAGGATT TTATTGCATT GGTTAAAGAT 
030871 GCTAAAAAAT TTGGTATCGA TATCATTCCT GATTATACCT TTAACTTTAT GGGAATTGGG GGTAGTGGTA 
030941 AAAATGACCT GGATTATCCC TCTGCTGATA TACGAGCGAA GATCAGTAAA GATATAGAAG GTGGTATCCC 
031011 TGGCTATTAG CAAGGTCAGG TTTTGATTCC ATTCATTAAA GATCCAGTAA CAAAAGAACG TAAACAAATC 
031081 CATCCAGAAG ATATACATCT CACTGCAAAA GACTTCGAAG CAAGTAAAGA TAACATCTCT AAGGATGAAT 
031151 GGGAAAACCT CCATGCATTA AAAGAAAAGC GTTTAAATGG AATGCCTAAA ACAACACCCA AAAGTGACCA 
031221 GGTTATTATG TTGCAAAATC AATACGTTCG TGAAATGCGA AAATATGGCG TACGAGGTTT ACGTTATGAT 
031291 GCGGCAAAAC ACTCAAAACA TGAACAAATA GAAAGATCAA TAACCCCACC GCTTAAAAAT TATAATGAGC 
031361 GGTTACACAA TACTAACTTA TTTAACCCAA AATATCATAA AAAAGCCGTT ATGAATTACA TGGAATATCT 
031431 GGTAACTTGT CAGTTGGATG AACAACAAAT GTCATCACTG CTTTATGAAA GAGATGATTT AAGCGCCATT 
031501 GATTTTTCAT TGCTCATGAA AACGATAAAA GCCTTTTCAT TTGGTGGAGA TCTTCAAACC CTTGCATCAA 
031571 AACCGGGTTC CACAATCTCA AGTATCCCAT CAGAAAGACG GATATTGATT AACATTAACC ACGATTTTCC 
031641 TAACAATGGT AATCTTTTCA ATGACTTTCT ATTTAACCAT CAACAAGATG AACAATTAGC AATGGCATAT 
031711 ATAGCCGCTC TGCCGTTCAG CAGGCCTTTA GTTTACTGGG ATGGCCAAGT ATTAAAATCA ACGACTGAAA 
031781 TTAAAAATTA TGATGGGTCC ACGCGTGTCG GCGGTGAGGC GTAGCTTAAT AAAGGTTGCT CTACCTATCA 
031851 GCAGCTCTAC AATGAATTCC ACGCATTATA TATAGATAAA GCAGGAATAT GGAGCGCATT TGAGGGTGTA 
031921 TCTGCAACTA AAAACGTTCT GGCCTTTAGT CGTGGGGATT CTGTGAACAT TAATCACTCT CCTCATGATG 
031991 GACTAGTTAT AATAAATAAA GGAAACGAAG AAGTTGAAGG TACCTGGCCT AACAAATTGC AACCTGGAAT 
032061 ATACAAAAAC ATGGGGAGTA ATAGCGTTAA CATTATTATT AATAATACCC GAAAAATTAT CCCCCCTGGT 
032131 AAAGTATTTA CGCTTAGAGG CGGAACTCTA AATATCAATA TTCCTGGGCG TAGCGCTCTT CTTTTAGGGA 
032201 AAACAGGAGA ACCGCCGAAC TATCTCTATT TATAATTTAA TGTTATATCT GCCCCGATAA AACGGGGCAG 
032271 ATAATATGTT TAGTTTACTA ACGGTCATTT TGCAGTGAAG CCATTTACTG TTTTTTATCG ACCAGATAAT 
032341 CTGTTCTCTA ATGTTAACTC CCCCTAACCT GTTGCTTTAG TTATTCATTT CCTGTCTCAC TTTGCCTTAA 
032411 TACCCTACGT TAAATGTTAC TAATTTGTTG CTTTTGATCA CAATAAGAAA ACAATATGTC GCTTTTGTGC 
032481 GCATTTTTCA GAAATGTAGA TATTTTTAGA TTATGGCTAC GAAATGAGCA TCGCCATGTC ACCCTACATC 
032551 TCATAAGAGG ATCGCTTCTG ATGAATGCAC TGACCGCCGT ACAAAATAAC GCTGTCGATT CAGGCCAGGA 
032621 CTATAGCGGA TTCACCCTCA CCCCGTCGGC GCAATCCCCG CGTCTGCTGG AACTCACCTT CACCGAACAG 
032691 ACGACCAAAC AGTTTCTTGA GCAGGTTGCC GAGTGGCCCG TGCAGGCGCT GGAGTACAAA TCGTTTCTGC 
032761 GTTTTCGGGT AGCCAAAATT CTTGACGATC TATGTGCGAA CCAGCTGCAA CCATTGCTGT TGAAGACGTT 
032831 GCTAAACCGC GCTGAAGGTG CGTTGTTGAT CAATGCGGTG GGTGTCGATG ATGTGAAGCA AGCGGATGAG 
032901 ATGGTGAAGC TGGCGACGGC GGTGGCGCAT CTGATTGGCC GTTCCAATTT CGATGCGATG AGCGGTCAGT 
032971 ATTACGCGCG TTTTGTAGTG AAAAATGTCG ATAACTCAGA CAGCTATCTG CGCCAGCCGC ACCGCGTGAT 
033041 GGAGCTACAC AACGACGGCA CGTATGTCGA AGAGATAACC GATTACGTGC TGATGATGAA AATCGACGAG 
033111 CAAAACATGC AGGGCGGAAA TTCGCTGCTG CTGCATCTCG ATGACTGGGA ACATCTCGAC AACTATTTCC 
033181 GCCACCCGCT GGCGCGTCGC CCGATGCGCT TTGCCGCGCC GCCGAGTAAA AACGTCAGCA AAGATGTTTT 
033251 TCATCCGGTG TTCGACGTCG ATCAACAGGG TCGCCCGGTG ATGCGCTATA TCGACCAGTT CGTCCAGCCG 
033321 AAAGACTTCG AAGAAGGCGT GTGGTTGAGC GAGCTTTCCG ACGCCATTGA AACCAGCAAA GGCATTCTTT 
033391 CTGTGCCCGT TCCCGTTGGC AAATTCCTGT TGATTAACAA CCTGTTCTGG CTGCACGGTC GCGACCGCTT 
033461 TACTCCGCAC CCGGATCTGC GCCGTGAACT GATGCGCCAG CGTGGCTATT TCGCTTACGC CTCTAACCAC 
033531 TACCAGACGC ATCAGTAAGC GCAAAGGAAT TGAGCGGATG TATGATTTTG TGATTATTGG CGGCGGCATC 
033601 ATCGGCATGT CGACCGCCAT GCAACTGATT GATGTCTATC CGGACGCCCG CATTGCGTTG CTGGAAAAAG 
033671 AGTCCGCCCC GGCCTGTCAC CAGACGGGCC ACAACAGCGG CGTGATCCAT GCCGGGGTCT ATTACACGCC 
033741 CGGCAGCCTG AAGGCGCAGT TTTGCCTGGC GGGAAACCGC GCCACCAAAG CCTTTTGCGA TCAAAACGGC 
033811 ATTCGCTACG ACAACTGCGG CAAGATGCTG GTTGCCACGT CCGATCTCGA AATGGAACGG ATGCGCGCCT 
033881 TATGGGAACG CACAGCGGCG AACGGTATCG AGCGCGAATG GCTTAACGCC GACGAACTGC GCGAGCGCGA 
033951 ACCGAATATC ACCGGGCTCG GCGGCATTTT TGTGCCGTCC AGCGGCATTG TCAGCTACCG CGACGTGACG 
034021 GCGGCGATGG CAAAAATCTT CCAGTCCAGA GGCGGTGAAA TTATCTATAA CGCCGAAGTC AGCGGGCTTA 
034091 ATGAGCATAA AAACGGCGTG GTGATACGTA CCCGTCAGGG CGGCGAATAT GAAGCATCAA CGCTGATTAG 
034161 CTGTTCCGGG CTGATGGCTG ACCGGCTGGT GAAAATGCTC GGACTCGAAC CGGGCTTTAT CATCTGCCCG 
034231 TTCCGTGGCG AGTATTTCCG CCTTGCGCCG GAGCATAACC AGATTGTTAA CCACCTGATT TACCCCATTC 
034301 CCGACCCGGC AATGCCGTTT TTGGGCGTTC ATCTCACCCG CATGATCGAC GGCAGCGTGA CCGTCGGGCC 
034371 AAACGCGGTG CTGGCTTTCA AACGCGAAGG CTATCGCAAG CGCGACTTCT CATTTAGCGA CACGCTGGAG 
034441 ATTTTGGGCT CGTCGGGGAT TCGCCGGGTG CTGCAAAACC ATCTACGCTC AGGACTGGGC GAGATGAAAA 
034511 ACTCGCTGTG CAAAAGCGGC TATCTGCGGC TGGTGCAAAA GTATTGTCCC CGGCTTTCGT TAAGCGATCT 
034581 CCAGCCCTGG CCCGCCGGTG TGCGGGCGCA GGCGGTATCG CCGGACGGCA AGCTGATTGA CGATTTTCTG 
034651 TTTGTCACCA CCCCGCGCAC GATCCACACC TGCAATGCGC CCTCCCCGGC AGCGACATCA GCAATTCCTA 
034721 TTGGTGCGCA TATTGTCAGC AAGGTACAAA CGCTGTTGGC AAGCCAGAGT AACCCCGGAC GCACGCTGCG 
034791 AGCGGCACGT AGTGTGGATG CCTTACACGC CGCATTTAAT CAATAACCTT TGAAAACAGG ATGTAGCGAT 
034861 GAAACTTAAC GACAGTAACT TATTCCGCCA GCAGGCGTTG ATTAACGGGG AATGGCTGGA CGCCAACAAT 
034931 GGTGAAGCCA TCGACGTCAC CAATCCGGCG AACGGCGACA AGCTGGGTAG CGTGCCGAAA ATGGGCGCGG 
035001 ATGAAACCCG CGCCGCTATC GACGCCGCCA ACCGCGCCCT GCCCGCCTGG CGCGCGCTCA CCGCCAAAGA 
035071 ACGCGCCACC ATTCTGCGCA ACTGGTTCAA TTTGATGATG GAGCATCAGG ACGATTTAGC GCGCCTGATG 
035141 ACCCTCGAAC AGGGTAAACC ACTGGCCGAA GCGAAAGGCG AAATCAGCTA CGCCGCCTCC TTTATTGAGT 
035211 GGTTTGCCGA AGAAGGCAAA CGCATTTATG GCGACACCAT TCCTGGTCAT CAGGCCGATA AACGCCTGAT 
035281 TGTTATCAAG CAGCCGATTG GCGTCACCGC GGCTATCACG CCGTGGAACT TCCCGGCGGC GATGATTACC 
035351 CGCAAAGCCG GTCCGGCGCT GGCAGCAGGC TGCACCATGG TGCTGAAGCC CGCCAGTCAG ACGCCGTTCT 
035421 CTGCGCTGGC GCTGGCGGAG CTGGCGATCC GCGCGGGCGT TCCGGCTGGG GTATTTAACG TGGTCACCGG 
035491 TTCGGCGGGC GCGGTCGGTA ACGAACTGAC CAGTAACCCG CTGGTGCGCA AACTGTCGTT TACCGGTTCG 
035561 ACCGAAATTG GCCGCCAGTT AATGGAACAG TGCGCGAAAG ACATCAAGAA AGTGTCGCTG GAGCTGGGCG 
035631 GTAACGCGCC GTTTATCGTC TTTGACGATG CCGACCTCGA CAAAGCCGTG GAAGGCGCGC TGGCCTCGAA 
035701 ATTCCGCAAC GCCGGGCAAA CCTGCGTCTG CGCCAACCGC CTGTATGTGC AGGACGGCGT GTATGACCGT 
035771 TTTGCCGAAA AATTGCAGCA GGCAGTGAGC AAACTGCACA TCGGCGACGG GCTGGATAAC GGCGTCACCA 
035841 TCGGGCCGCT GATCGATGAA AAAGCGGTAG CAAAAGTGGA AGAGCATATT GCCGATGCGC TGGAGAAAGG 
035911 CGCGCGCGTG GTTTGCGGCG GTAAAGCGCA CGAACGCGGC GGCAACTTCT TCCAGCCGAC CATTCTGGTG 
035981 GACGTTCCGG CCAACGCCAA AGTGTCGAAA GAAGAGACGT TCGGCCCCCT CGCCCCGCTG TTCCGCTTTA 
036051 AAGATGAAGC TGATGTGATT GCGCAAGCCA ATGACACCGA GTTTGGCCTT GCCGCCTATT TCTACGCCCG 
036121 TGATTTAAGC CGCGTCTTCC GCGTGGGCGA AGCGCTGGAG TACGGCATCG TCGGCATCAA TACCGGCATT 
036191 ATTTCCAATG AAGTGGCCCC GTTCGGCGGC ATCAAAGCCT CGGGTCTGGG TCGTGAAGGT TCGAAGTATG 
036261 GCATCGAAGA TTACTTAGAA ATCAAATATA TGTGCATCGG TCTTTAACTG GAGAATGCGA ATGAACAGCA 
036331 ATAAAGAGTT AATGCAGCGC CGCAGTCAGG CGATTCCCCG TGGCGTTGGG CAAATTCACC CGATTTTCGC 
036401 TGACCGCGCG GAAAACTGCC GGGTGTGGGA CGTTGAAGGC CGTGAGTATC TTGATTTCGC GGGCGGGATT 
036471 GCGGTGCTCA ATACCGGGCA CCTGCATCCG AAGGTGGTGG CCGCGGTGGA AGCGCAGTTG AAAAAACTGT 
036541 CGCACACCTG CTTCCAGGTG CTGGCTTACG AGCCGTATCT GGAGCTGTGC GAGATTATGA ATCAGAAGGT 
036611 GCCGGGCGAT TTCGCCAAGA AAACGCTGCT GGTTACGACC GGTTCCGAAG CGGTGGAAAA CGCGGTAAAA 
036681 ATCGCCCGCG CCGCCACCAA ACGTAGCGGC ACCATCGCTT TTAGCGGCGC GTATCACGGG CGCACGCATT 
036751 ACACGCTGGC GCTGACCGGC AAGGTGAATC CGTACTCTGC GGGCATGGGG CTGATGCCGG GTCATGTTTA 
036821 TCGCGCGCTT TATCCTTGCC CGCTGCACGG CATAAGCGAG GATGACGCTA TCGCCAGCAT CCACCGGATC 
036891 TTCAAAAATG ATGCCGCGCC GGAAGATATC GCCGCCATCG TGATTGAGCC GGTTCAGGGC GAAGGCGGTT 
036961 TCTACGCCTC GTCGCCAGCC TTTATGCAGC GTTTACGCGC TCTGTGTGAC GAGCACGGGA TCATGCTGAT 
037031 TGCCGATGAA GTGCAGAGCG GCGCGGGGCG TACCGGCACG CTGTTTGCGA TGGAGCAGAT GGGCGTTGCG 
037101 CCGGATCTTA CCACCTTTGC GAAATCGATC GCGGGCGGCT TCCCGCTGGC GGGCGTCACC GGGCGCGCGG 
037171 AAGTAATGGA TGCCGTCGCT CCAGGCGGTC TGGGCGGCAC CTATGCGGGT AACCCGATTG CCTGCGTGGC 
037241 TGCGCTGGAA GTGTTGAAGG TGTTTGAGCA GGAAAATCTG CTGCAAAAAG CCAACGATCT GGGGCAGAAG 
037311 TTGAAAGACG GATTGCTGGC GATAGCCGAA AAACACCCGG AGATCGGCGA CGTACGCGGG CTGGGGGCGA 
037381 TGATCGCCAT TGAGCTGTTT GAAGACGGCG ATCACAACAA GCCGGACGCC AAACTCACCG CCGAGATCGT 
037451 GGCTCGCGCC CGCGATAAAG GCCTGATTCT TCTCTCCTGC GGCCCGTATT ACAACGTGCT GCGCATCCTT 
037521 GTACCGCTCA CCATTGAAGA CGCTCAGATC CGTCAGGGTC TGGAGATCAT CAGCCAGTGT TTTGATGAGG 
037591 CGAAGCAGTA GCGCCGCTCC TATGCCGGAG GCGACGCTGC GCGTCTTGTC CGGCCTACGG GGATCCAGGT 
037661 CGGATAAGGC GTTTACGCCG CATCCGACAA TCTGTACGTG AACAGGAAGA AATCTATGTT GGCCGGGTAA 
037731 GGCGGAGCCG CTCTCCGGCA AAAAGAATCA ATAACAATTA TACGCGTGAC CCGGCGCGGG AAATGTCGGG 
037801 GCGCTCTCCC AAGTGACACA CTTTCGAGAG GATTCAGGAT GGGGCAATCA TCGCAACCAC ATGAGTTAGG 
037871 CGGCGGGCTG AAGTCACGCC ACGTCACCAT GTTGTCTATT GCCGGTGTTA TCGGCGCAAG TCTGTTTGTC 
037941 GGTTCCAGCG TCGCCATCGC CGAAGCGGGC CCGGCGGTAT TACTGGCCTA TCTGTTCGCC GGGCTACTGG 
038011 TGGTTATGAT TATGCGGATG TTGGCGGAAA TGGCGGTTGC CACGCCCGAT ACCGGTTCGT TTTCCACCTA 
038081 TGCCGATAAA GCCATTGGTC GCTGGGCGGG CTATACCATC GGCTGGTTGT ACTGGTGGTT TTGGGTACTG 
038151 GTTATCCCGC TGGAAGCCAA CATCGCCGCC ATGATCCTGC ACTCATGGGT TCCAGGCATT CCCATCTGGT 
038221 TATTTTCCCT CGTCATTACC CTCGCCTTAA CTGGCAGTAA CTTATTAAGC GTTAAAAACT ACGGCGAATT 
038291 TGAGTTCTGG CTGGCGCTGT GCAAAGTCAT CGCTATCCTG GCCTTTATTT TCCTTGGTGC AGTCGCAATT 
038361 AGCGGTTTTT ACCCGTATGC CGAAGTGAGC GGGATCTCAA GATTGTGGGA TAGCGGCGGC TTTATGCCCA 
038431 ACGGTTTCGG TGCGGTATTA AGCGCGATGT TGATCACCAT GTTCTCGTTT ATGGGCGCAG AAATTGTCAC 
038501 CATTGCCGCC GCGGAATCCG ACACGCCGGA AAAACATATT GTCCGCGCCA CCAACTCGGT TATCTGGCGT 
038571 ATTTCTATCT TCTATTTATG TTCTATTTTT GTCGTCGTGG CATTAATTCC GTGGAATATG CCCGGACTAA 
038641 AAGCCGTCGG TTCTTATCGC TCGGTACTGG AATTGCTCAA TATTCCCCAT GCGAAATTAA TCATGGACTG 
038711 CGTGATATTA CTTTCCGTAA CCAGTTGCCT GAACTCGGCG CTGTATACCG CGTCAAGGAT GCTCTACTCC 
038781 TTAAGTCGTC GCGGTGATGC TCCCGCGGTA ATGGGTAAAA TCAACCGCAG TAAAACCCCG TACGTGGCGG 
038851 TGTTACTCTC CACCGGCGCG GCATTCTTAA CGGTGGTGGT GAACTATTAC GCGCCTGCGA AGGTATTTAA 
038921 ATTTCTGATC GACAGCTCCG GCGCTATCGC CCTGCTGGTT TATTTAGTCA TCGCCGTTTC ACAGTTGCGG 
038991 ATGCGCAAAA TTCTGCGAGC AGAAGGAAGC GAAATTCGCT TGCGAATGTG GCTTTATCCG TGGCTCACCT 
039061 GGCTAGTCAT CGGCTTTATT ACCTTTGTGT TGGTAGTGAT GCTATTCCGT CCGGCGCAAC AGTTAGAAGT 
039131 GATCTCCACC GGCTTATTAG CGATAGGGAT TATCTGTACC GTGCCAATTA TGGCTCGCTG GAAAAAGCTG 
039201 GTATTGTGGC AAAAAACACC CGTTCATAAT ACGCGCTGAT CATGATCAGG AGTCACACCA TGACCATTAC 
039271 GTCTCTGGAT GGCTATCGCT GGCTGAAGAA CGATATTATT CGCGGTAATT TTCAACCGGA TGAAAAATTA 
039341 CGAATGAGTT TGCTGACATC GCGTTATGCA CTTGGCGTTG GGCCGTTACG GGAAGCTCTT TCGCAACTGG 
039411 TGGCGGAACG GCTGGTCACG GTGGTGAATC AAAAAGGGTA TCGGGTGGCG TCTATGTCAG AGCAGGAGCT 
039481 GCTCGATATT TTCGACGCCC GCGCCAATAT GGAAGCGATG TTAGTGAGTC TGGCGATTGC CCGCGGTGGC 
039551 GATGAGTGGG AGGCAGACGT TCTCGCAAAA GCGCATCTGC TGAGTAAGCT TGAGGCCTGT GACGCCAGCG 
039621 AGAAAATGCT TGATGAGTGG GATCTGCGTC ATCAGGCGTT TCATACGGCA ATTGTGGCGG GCTGTGGTTC 
039691 TCACTATTTG CTGCAAATGC GTGAACGGTT GTTTGATCTG GCGGCGCGTT ATCGATTTAT CTGGCTGCGG 
039761 CGAACGGTGC TTTCGGTGGA AATGCTGGAG GATAAACACG ATCAGCACCA GACCCTGACT GCGGCGGTAC 
039831 TGGCGCGAGA TACCGCGCGC GCCAGTGAGT TAATGCGCCA GCATTTACTG ACGCCAATTC CCATTATCCA 
039901 GCAGGCGATG GCTGGCAATT AACTACTCTT CCGGAATACG CAACACTTGC CCCGGATAAA TTTTATCCGG 
039971 GCTTTTTAGC ATCGGTTTAT TCGCTTCGAA GATTTTATTG TACAGATTAG CGTTACCGTA GACCTGTTTG 
040041 GAAATGGCAC TCAGAGTGTC GCCAGACTTA ACGGTATAAA ACTGGCTGGC AGTGGCTGGT GTCGCCGTTT 
040111 TCACCTGATC ATCGACACTG GCAATACCGG AAATATTCCC CACCGCAACA AGGATTTTCT CCTTCGCCTC 
040181 CTGACTCAGG CCGTCACCAG TGACCGTCGC TTTGCCGTCG GCAATTTGAA TATTCACTTT ATCGGCATCC 
040251 GGTATACCGG TTTTGTTCAG ATGCTCCTGC ACCTTCTTCG CCTGATCGTC TTTATCGTGC TGACCTGTAA 
040321 CCGCGTCCCA GAGTTTTTCT CCGGCATCTT TCACAAAATT GAACAGACCC ATAGCTACCT CATTCGTTAA 
040391 CGGAAACACT CAGAAAGTGT AGCAGAGGAA CGCGGCGCGT TAACGCCGCG GGGATGAGCA CAGGTTTAAT 
040461 CGCGGGTTTG CACCCAGAAC GCGTGAATCA AACCGGGGAT ATACCCAAGC AGTGTCAACA GAATATTAAT 
040531 AATGAACGCC CAACCGAACC CTTTACCGAG CAGCACGCCG AGCGGCGGCA GAATGATGGT GATGACGATT 
040601 CTCCAGAAAC CCATATGTAC TCCCTATAAG AAAATTACTC ATTGTTTAAA AAGAGATTTT ATCTCTTAAG 
040671 CGTAGTAATT TTAGCGGAGC CTGCCAGTTT CAGCTTACGC TTTTACTCTC ATTTACGCTG CTGAGGCTGG 
040741 TATATGTTGC ATTTTTAGTT TAGAGTTTAC TTAATTTAGA AAATACTTAA ATAAATATGA CTGAACTCGC 
040811 GCAATTACAG GCCAGTGCCG AACAGGCAGC GGCCTTATTG AAAGCAATGA GCCACCCTAA ACGATTGCTG 
040881 ATTCTGTGCA TGCTTAGCGG TTCCCCCGGC ACCAGCGCGG GAGAGCTGAC GCGCATTACC GGACTGAGTG 
040951 CCTCTGCGAC ATCACAGCAT CTCGCTCGTA TGCGGGACGA AGGGCTTATC GACAGCCAAC GGGATGCCCA 
041021 ACGCATTCTA TATTCCATTA AAAATGAGGC GGTAAATGCC ATTATCGCCA CCCTGAAAAA TGTCTATTGT 
041091 CCGTAAGGAG TCACTATGGC TTTGACAACC ATTTCGCCGC ATGATGCACA AGAATTAATC GCACGCGGCG 
041161 CAAAGTTAAT CGATATTCGT GATGCTGATG AATATCTTCG TGAACATATT CCTGAAGCAG ATCTGGCTCC 
041231 ATTATCCGTG CTGGAACAGT CAGGTCTTCC GGCTAAATTA CGTCACGAGC AAATTATATT CCACTGCCAG 
041301 GCAGGTAAAC GCACCAGTAA TAATGCCGAT AAATTAGCAG CGATTGCCGC CCCCGCAGAA ATCTTTTTAC 
041371 TCGAAGATGG GATTGATGGC TGGAAAAAAG CAGGATTGCC AGTAGCGGTA AATAAATCTC AACCCTTGCC 
041441 GTTAATGCGC CAGGTGCAGA TCGCTGCGGG TGGTTTAATA TTAATCGGCG TTGTACTGGG TTATACCGTA 
041511 AATAGCGGTT TCTTCTTATT AAGTGGCTTT GTTGGTGCCG GGTTACTGTT TGCAGGAATC AGCGGTTTTT 
041581 GTGGAATGGC AAGGTTGTTA GATAAGATGC CGTGGAACCA ACGAGCTTGA GAAGCGACGC CGGACGCGCC 
041651 CTAGCAGCGA CATCCGGCCT CAGTAATTAG ATCAGGAAAT CGTCGAGAGA TTTACCTTCT GCCAGCGCCT 
041721 GAGCAATTGG CTTCGGTGTA CGGCCCTGAC CGGTCCAGGT TTTAGTTTCA CCGTTAACAT CGGTGAATTT 
041791 ATATTTCGCC GGACGCGGCT GGCGTTTTTT ACCAGCGCGT GGTGCAGCAG CAGAGCTATT ACCCAATAAC 
041861 TCTTCCGGGT TAATTCCGTC AGCTTTCATC AGCTCCAGCC AGGTGCTAAT TTTTTCCTGG CGCTCTGCCA 
041931 GTTCACGCTG CTGCTGTTCT TCTTCTTCAC GTCTTTCTTT AGTGACAACC CTGAATTTTT CGAGCATTTC 
042001 TTCAAGAACG TCAATGGAGA ATTCGCGAGC CATCGCACGG AGGGTGCGAA TGTTATTTAA ACTTTGTAAC 
042071 ATTACGGACA TAATAAAGAA AACCTTTTAA CGCCAAAACA AAAAAAGTAT TTCGTCGCGT AGTGTAAGCG 
042141 ATCACTTATT ATATTTCCAC AAAATTTAAT CTATTTACAG TCCTGCGCGA GATTATTTCA GCTGTTATTT 
042211 TCTGAAACTC TCAGAATAAT TTCAAGATTA TATATTAGCC ATTTTGATGA GTAATTTAGA TTATTGGTGA 
042281 ACAGAGCGGC GCTCTCTGCT CGCTAATTCC GCAAGCCTGA CAAAATCAAA GTGAATAAAA ATGCAATATA 
042351 ACAGAATAAA AGAAAACATC CATCACTGGT GCTTTCTGCT GTTAATGTAC ATTGTCTGGC ATAAAAAATG 
042421 CTGAAAATGA CCCAGCTACT ACATACACCG AATTCTCTAC GCTTATAGCG TTACCTCACC CCCAAACTTT 
042491 CATTAGTGAT ATTAAAGGTA AGGCCATATC TAATTGATTT AATTAAAAAT AAATCATATC GGCATGTAAA 
042561 AATCCACAAT GTACAAAAAA CGAGCCGTTA CGGAATATTT TATCTACAAA AACTGACTAA ATAAAAATTT 
042631 TTCACTAATT GATTAGTCAT AGCCAGCGAT ATACGCTATG CGAAAATGCA GATGGCAATG AGATCCACTG 
042701 CTTTCATCTC CATTAACATC CCATTACGCT TTTATTAAGG AGCATTAGCA TGTTCTCACC GCAGTCACGC 
042771 TTGCGTCATG CAGTTGCAGA TACGTTCGCG ATGGTTGTTT ACTGTTCTGT CGTGAACATG TGTATTGAAG 
042841 TTTTCCTCTC CGGAATGAGC TTCGAACAGT CTTTTTATTC CAGATTGGTA GCGATTCCGG TGAACATCTT 
042911 AATTGCATGG CCATACGGTA TGTACCGTGA TCTGTTTATG CGCGCGGCAC GCAAAGTTAG CCCGTCGGGC 
042981 TGGATAAAAA ATCTGGCGGA TATCCTGGCT TATGTGACGT TCCAGTCACC GGTGTATGTG GCGATCTTGT 
043051 TAGTGGTGGG CGCAGACTGG CATCAGATTA TGGCGGCGGT CAGTTCAAAC ATCGTTGTTT CGATGTTGAT 
043121 GGGGGCGGTT TATGGCTACT TCCTCGATTA TTGCCGCCGA CTGTTTAAAG TCAGCCGTTA CCAGCAGGTA 
043191 AAAGCCTGAC TCTTCTTTTC GCGACTGGCA TCGCCAGTCG CGTCTTTAAC TGGCTTCGCC AAATAAACCA 
043261 TTCAAATAAC GTTCAAGCGC AACACGCGAA CTAAAGCCAT GCGGGATACC GTAATGCTCG TGTCGCTCGC 
043331 CTGCTAAATA GAGCGGAAAT TGCTGGTAAT GATCGCAAGT TTTAATATCG GAAGCGGGTT CAGCCAGTGT 
043401 CGAACTGCGT TCTTTTAATG TTGGATGAAT TACCAGAGCG GTACGTCCCA TTCGCGCTTC GCGATTAACA 
043471 TAGACATAAT TTTCCCCACG GCGGTAACCA TACGCTTTCT GGGTTACCAC ATCGACAGTA AAACCGACTT 
043541 TTTCAAGTAC GCGCGCCACC TCGTCTGGTC GTAAATACAT ATTTGATCCT CGTTATTATC AACCGCGGGC 
043611 CTACCTTACC TGATTGCGCA TTCACAACGC TTTCAGAAAA GTCCATAAAG CCGCGATGAA CCTCAGTTAA 
043681 GAAAATTATG GTCTACACTG AAAATTACAT CGAATTCTAA TGGGGGATCA TATGTTTAAC CGACCGAACC 
043751 GCAACGACGT TGATGATGGC GTGCAGGATA TCCAGAATGA TGTCAATCAA TTAGCTGACA GCCTCGAATC 
043821 TGTATTGAAG TCCTGGGGCA GCGACGCCAA AGGGGAAGCT GAAGCCGCAC GCAGTAAAGC TCAGGCATTG 
043891 CTGAAAGAAA CCAGGGCGCG AATGCATGGT CGTACTCGCG TCCAGCAAGC CGCGCGCGAT GCCGTTGGCT 
043961 GCGCGGATTC TTTTGTTCGT GAAAGACCCT GGTGTAGCGT GGGTACAGCA GCTGCGGTAG GTATTTTTAT 
044031 CGGCGCACTG TTAAGCATGC GCAAATCGTA GTGCAAAAAT GATAATAAAT ACGCGTCTTT GACCCCGAAG 
044101 CCTGTCTTCG GGGTTTCTTT TTGCCTGGTG AATCACAAAA ATCCCCCTAC CCCGTCACGC TCATATCCAG 
044171 GGTAATTTCG ACCACTATTT GCTATATATT GTGTGGTTGA ATCTTTTTTC AACTACATCT AGTATCTCTG 
044241 TATCAACAGA GAGACAACCC GACGCGTATC ATCGCGCCGT ATCTTCATTT TAAACGGAAA TACGAATCAT 
044311 GCGCATTACT ATTTACACTC GTAACGATTG CGTTCAGTGC CACGCCACCA AACGGGCGAT GGAAAACCGG 
044381 GGCTTTGATT TTGAAATGAT TAATGTCGAT CGCGTTCCTG AAGCGGCAGA AGCGTTGCGT GCTCAGGGCT 
044451 TTCGTCAGTT GCCGGTAGTG ATTGCTGGCG ATCTTAGCTG GTCTGGTTTC CGTCCGGACA TGATTAACCG 
044521 TCTGCATCCA GCGCCACACG CGGCCAGTGC ATGAGCCAGC TCGTCTACTT CTCCAGCAGC TCCGAAAACA 
044591 CGCAGCGTTT TATCGAACGT TTAGGTCTGC CCGCGGTGCG CATCCCGCTC AATGAGCGGG AACGGATTCA 
044661 GGTAGACGAG CCTTACATCC TGATCGTGCC CTCTTACGGC GGCGGCGGTA CGGCTGGCGC GGTGCCACGA 
044731 CAGGTAATTC GCTTTTTAAA CGACGAGCAC AACCGGGCGT TGCTTCGCGG CGTTATTGCT TCTGGTAATC 
044801 GCAACTTTGG TGAGGCGTAT GGCCGCGCCG GAGATGTGAT TGCCCGGAAA TGCGGCGTGC CGTGGCTGTA 
044871 CCGTTTTGAA CTCATGGGTA CGCAAAGCGA TATCGAAAAC GTTCGTAAAG GAGTAACCGA ATTTTGGCAA 
044941 CGACAACCGC AGAATGCCTG ACGCAGGAAA CGATGGATTA CCACGCGCTG AATGCGATGC TTAACCTCTA 
045011 CGATAGCGCA GGTCGCATTC AGTTCGATAA AGACCGCCAG GCCGTTGACG CCTTTATTGC GACGCATGTG 
045081 CGTCCGAACA GTGTGACCTT CAGTAGCCAG CAGCAGCGCC TGAACTGGCT GGTCAACGAA GGTTACTATG 
045151 ATGAAAGCGT TCTTAATCGC TACTCTCGCG ACTTTGTCAT TACGCTGTTT ACCCACGCAC ACACCAGCGG 
045221 TTTTCGTTTC CAGACATTCC TCGGGGCATG GAAGTTTTAC ACCAGCTATA CGTTGAAGAC ATTCGACGGT 
045291 AAACGTTATC TGGAAGATTT TGCCGATCGA GTAACGATGG TGGCGCTGAC GCTGGCACAA GGCGATGAGA 
045361 CGCTGGCGTT GCAACTGACC GATGAAATGC TGTCAGGACG CTTTCAGCCA GCCACGCCAA CATTCCTCAA 
045431 CTGCGGTAAG CAGCAGCGCG GCGAACTGGT TTCCTGTTTT TTGCTGCGTA TTGAAGACAA TATGGAGTCG 
045501 ATTGGTCGGG CGGTAAATTC CGCACTGCAG CTGTCGAAAC GCGGCGGCGG CGTAGCATTT TTGCTGTCGA 
045571 ATCTGCGAGA AGCGGGCGCG CCAATTAAAC GTATTGAAAA TCAATCTTCT GGCGTAATTC CGGTGATGAA 
045641 AATGCTGGAA GACGCATTTT CCTATGCCAA CCAACTCGGC GCTCGTCAGG GGGCTGGTGC AGTCTATTTA 
045711 CATGCTCATC ATCCCGATAT TCTGCGTTTT CTCGACACGA AACGGGAAAA TGCCGACGAA AAAATCCGCA 
045781 TTAAAACACT GTCGCTTGGC GTGGTGATCC CGGATATCAC TTTCCATCTG GCAAAAGAGA ATGCGCAGAT 
045851 GGCGCTGTTT TCGCCTTATG ACGTAGAGCG AGTTTATGGC AAGCCGTTTG CCGATGTGGC CATCAGCCAA 
045921 CACTATGACG AACTGGTTGC CGATGAACGC ATTCGCAAAA AATACCTCAA CGCCCGTGAT TTCTTCCAGC 
045991 GACTGGCAGA AATCCAGTTT GAGTCCGGCT ATCCCTACAT CATGTATGAA GACACGGTAA ACCGTGCTAA 
046061 CCCTATCGCC GGGCGCATAA ATATGAGTAA TCTCTGCTCA GAAATTTTGC AGGTTAACAG CGCCTCAGAG 
046131 TATGACGAGA ATCTCGACTA TACCCGCACA GGCCATGATA TTTCCTGCAA TTTAGGTTCG TTGAATATTG 
046201 CGCACACCAT GGATTCCCCC GATTTTGCCC GCACGGTAGA GACTGCCGTG CGCGGTTTAA CGGCAGTATC 
046271 AGATATGAGT CATATCCGCA GCGTGCCGTC CATCGAAGCC GGAAATGCCG CCTCGCACGC CATCGGACTG 
046341 GGGCAGATGA ATTTACACGG CTATCTGGCG CGAGAAGGCA TCGCTTATGG TTCGCCGGAA GCACTGGATT 
046411 TCACCAATCT CTATTTCTAT GCCATCACCT GGCATGCACT GCGTACCTCG ATGTTGCTGG CACGCGAACG 
046481 CGGTGAAACC TTCGCCGGGT TCAAACAGTC ACGCTATGCC AGTGGTGAAT ATTTTAGCCA ATATCTGCAA 
046551 GGGAACTGGC AGCCGAAAAC GGCGAAAGTT GGCGAACTGT TTACCCGTAG CGGTATTACG TTACCTACCC 
046621 GTGAGATGTG GGCGCAGCTG CGCGACGACG TGATGCGCTA CGGCATATAC AACCAGAATC TTCAGGCGGT 
046691 GCCGCCAACC GGTTCTATCT CTTATATCAA CCATGCTACG TCGAGTATTC ATCCGATTGT GGCGAAAGTA 
046761 GAGATACGCA AAGAGGGCAA AACAGGACGC GTTTACTACC CTGCCCCGTT TATGACTAAC GAGAATCTGG 
046831 CGCTGTATCA GGACGCTTAC GAAATTGGCG CAGAAAAGAT CATCGACACC TACGCGGAAG CGACTCGCCA 
046901 TGTCGATCAG GGGCTGTCGC TGACGCTTTT TTTCCCCGAT ACCGCCACCA CTCGCGATAT CAACAAAGCG 
046971 CAGATTTACG CCTGGCGCAA GGGTATCAAA ACGCTCTATT ACATCCGCCT GCGTCAGATG GCGCTGGAAG 
047041 GCACTGAAAT TGAAGGCTGC GTCTCCTGTG CACTTTAAGG AATATCTATG AAACTCTCAC GTATCAGCGC 
047111 CATCAACTGG AACAAGATAT CTGACGATAA AGATCTGGAG GTGTGGAATC GCCTGACCAG CAATTTCTGG 
047181 CTACCAGAAA AGGTGCCGCT GTCGAACGAT ATTCCTGCCT GGCAGACATT AACTGTCGTA GAACAACAAC 
047251 TGACGATGCG CGTTTTTACT GGCCTGACGC TGCTCGACAC GCTGCAAAAT GTTATCGGCG CGCCTTCTCT 
047321 GATGCCCGAT GCACTCACGC CTCATGAAGA AGCGGTATTA TCGAATATCA GCTTTATGGA AGCGGTTCAT 
047391 GCCCGCTCTT ACAGTTCGAT TTTCTCGACG CTATGCCAGA CCAAAGATGT CGATGCCGCC TACGCCTGGA 
047461 GTGAAGAAAA CGCACCGTTG CAGCGAAAAG CTCAGATTAT TCAGCAACAT TATCGCGGTG ATGATCCGCT 
047531 GAAAAAGAAA ATCGCCAGTG TGTTTCTTGA ATCTTTTTTG TTCTATTCCG GTTTCTGGCT GCCGATGTAT 
047601 TTTTCCAGCC GCGGAAAGCT GACCAATACC GCGGACCTGA TCCGTCTGAT TATCCGCGAT GAAGCAGTCC 
047671 ACGGTTACTA CATAGGCTAT AAATATCAGA AAAACATGGA AAAGATATCT CTGGGACAAC GTGAAGAGTT 
047741 GAAGAGTTTC GCCTTCGATT TGTTGCTGGA ACTCTACGAC AACGAGTTGC AATACACCGA TGAGCTGTAC 
047811 GCCGAAACCC CGTGGGCTGA CGATGTGAAA GCGTTTCTCT GTTACAACGC CAATAAGGCT TTGATGAATC 
047881 TGGGCTACGA ACCGTTATTT CCCGCAGAAA TGGCGGAAGT GAATCCGGCA ATCCTCGCCG CGCTTTCGCC 
047951 GAATGCCGAT GAAAATCACG ATTTCTTTTC CGGTTCAGGC TCCTCTTATG TGATGGGGAA AGCGGTTGAA 
048021 ACAGAAGATG AAGACTGGAA TTTCTGAGGG TGTTATTTTC AAAAATATCA CTACCCGCAG CAGGGAAATA 
048091 ATTCCCGCCA AATAGCTTTT TATCACGCAA ATAATTTGTG GTGATCTACA CTGATACTCT GTTGCATTAT 
048161 TCGCCTGAAA CCACAATATT CAGGCGTTTT TTCGCTATCT TTGACAAAAA ATATCAACTT TCTCGATTTG 
048231 CTCTCAGCCC TTATATCACG GGAAATTCCG GCGATTTGCT CGCATCAATA TTCATGCCAC ATTTGCCATC 
048301 AGGGGTTGCC TCAGATTCTC AGTATGTTAG GGTAGAAAAA AGTGACTATT TCCATTGGGT AATATATCGA 
048371 CATAGACAAA TAAAGGAATC TTTCTATTGC ATGGCAATTA AATTAGAAAT TAAAAATCTT TATAAAATAT 
048441 TTGGCGAGCA TCCACAGCGA GCGTTCAAAT ATATCGAACA AGGACTTTCA AAAGAACAAA TTCTGGAAAA 
048511 AACTGGGCTA TCGCTTGGCG TAAAAGACGC CAGTCTGGCC ATTGAAGAAG GCGAGATATT TGTCATCATG 
048581 GGATTATCCG GCTCGGGTAA ATCCACAATG GTACGCCTTC TCAATCGCCT GATTGAACCC ACCCGCGGGC 
048651 AAGTGCTGAT TGATGGTGTG GATATTGCCA AAATATCCGA CGCCGAACTC CGTGAGGTGC GCAGAAAAAA 
048721 GATTGCGATG GTCTTCCAGT CCTTTGCCTT AATGCCGCAT ATGACCGTGC TGGACAATAC TGCGTTCGGT 
048791 ATGGAATTGG CCGGAATTAA TGCCGAAGAA CGCCGGGAAA AAGCCCTTGA TGCACTGCGT CAGGTCGGGC 
048861 TGGAAAATTA TGCCCACAGC TACCCGGATG AACTCTCTGG CGGGATGCGT CAACGTGTGG GATTAGCCCG 
048931 CGCGTTAGCG ATTAATCCGG ATATATTATT AATGGACGAA GCCTTCTCGG CGCTCGATCC ATTAATTCGC 
049001 ACCGAGATGC AGGATGAGCT GGTAAAATTA CAGGCGAAAC ATCAGCGCAC CATTGTCTTT ATTTCCCACG 
049071 ATCTTGATGA AGCCATGCGT ATTGGCGACC GAATTGCCAT TATGCAAAAT GGTGAAGTGG TACAGGTCGG 
049141 CACACCGGAT GAAATTCTCA ATAATCCGGC GAATGATTAT GTCCGTACCT TCTTCCGTGG CGTTGATATT 
049211 AGTCAGGTAT TCAGTGCGAA AGATATTGCC CGCCGGACAC CGAATGGCTT AATTCGTAAA ACCCCTGGCT 
049281 TCGGCCCACG TTCGGCACTG AAATTATTGC AGGATGAAGA TCGCGAATAT GGCTACGTTA TCGAACGCGG 
049351 TAATAAGTTT GTCGGCGCAG TCTCCATCGA TTCGCTTAAA ACCGCGTTAA CGCAGCAGCA AGGTCTTGAT 
049421 GCGGCGCTGA TTGATGCGCC GTTAGCAGTC GATGCACAAA CGCCTCTTAG CGAGTTGCTC TCTCATGTCG 
049491 GACAGGCACC CTGTGCGGTG CCCGTGGTCG ACGAGGACCA ACAGTATGTC GGCATCATTT CGAAAGGAAT 
049561 GCTGCTGCGC GCTTTAGATC GTGAGGGGGT AAATAATGGC TGATCAAAAT AATCCGTGGG ATACCACGCC 
049631 AGCGGCGGAC AGTGCCGCGC AATCCGCAGA CGCCTGGGGT ACACCGACGA CTGCACCGAC TGACGGCGGT 
049701 GGTGCTGACT GGCTGACCAG TACGCCTGCG CCAAACGTCG AGCATTTTAA TATTCTCGAT CCGTTCCATA 
049771 AAACGCTGAT CCCGCTCGAC AGTTGGGTCA CTGAAGGGAT CGACTGGGTC GTTACCCATT TCCGTCCCGT 
049841 CTTCCAGGGC GTGCGCGTTC CGGTTGATTA TATCCTCAAC GGTTTCCAGC AATTGCTGCT GGGTATGCCC 
049911 GCACCGGTGG CGATTATCGT TTTCGCTCTC ATCGCCTGGC AGATTTCCGG GGTCGGAATG GGTGTGGCGA 
049981 CGCTGGTTTC GCTGATTGCC ATCGGCGCAA TCGGTGCCTG GTCGCAGGCA ATGGTGACTC TGGCGCTGGT 
050051 GTTAACCGCC CTGCTGTTCT GTATCGTCAT CGGTTTGCCG TTGGGGATAT GGCTGGCGAG AAGTCCGCGA 
050121 GCGGCGAAAA TTATTCGTCC ACTGCTTGAT GCCATGCAGA CCACGCCAGC GTTTGTTTAT CTGGTGCCAA 
050191 TCGTCATGCT ATTTGGTATC GGTAACGTGC CGGGCGTGGT GGTGACGATC ATCTTTGCTC TGCCGCCGAT 
050261 TATCCGTCTG ACCATTCTGG GGATTAACCA GGTTCCGGCG GATCTGATTG AAGCCTCGCG CTCATTCGGT 
050331 GCCAGCCCGC GCCAGATGCT GTTCAAAGTT CAGTTACCGC TGGCGATGCC GACCATTATG GCGGGCGTTA 
050401 ACCAGACGCT GATGCTGGCC CTTTCTATGG TGGTCATCGC CTCGATGATT GCCGTCGGCG GGTTGGGTCA 
050471 GATGGTACTT CGCGGTATCG GTCGTCTGGA TATGGGGCTT GCCACCGTTG GCGGCGTCGG GATTGTGATC 
050541 CTCGCCATTA TCCTCGATCG TCTGACGCAG GCCGTTGGGC GCGACTCACG CAGTCGCGGC AACCGTCGCT 
050611 GGTACACCAC TGGCCCTGTT GGTCTGCTGA CCCGCCCATT CATTAAGTAA CTCTGCACTT GCCCGGTGAC 
050681 GCCGGGCATT ATCACCCTGC CAAAAAAAGG AATAACAATG CGACATAGCG TACTTTTTGC GACAGCGTTT 
050751 GCCACGCTTA TCTCTACACA AACTTTTGCT GCCGATCTGC CGGGCAAAGG CATTACTGTT AATCCAGTTC 
050821 AGAGCACCAT CACTGAAGAA ACCTTCCAGA CGCTGCTGGT CAGTCGTGCG CTGGAGAAAT TAGGTTATAC 
050891 CGTCAACAAA CCCAGCGAAG TAGATTACAA CGTTGGCTAC ACCTCGCTTG CTTCCGGCGA TGCAACCTTC 
050961 ACCGCCGTGA ACTGGACGCC ACTGCATGAC AACATGTACG AAGCTGCCGG TGGCGATAAG AAATTTTATC 
051031 GTGAAGGGGT ATTTGTTAAC GGCGCGGCAC AGGGTTACCT GATCGATAAG AAAACCGCCG ACCAGTACAA 
051101 AATCACCAAC ATCGCACAAC TGAAAGATCC GAAGATCGCC AAACTGTTCG ATACCAACGG CGACGGAAAA 
051171 GCGGATTTAA CCGGTTGTAA CCCTGGCTGG GGCTGCGAAG GTGCGATCAA CCACCAGCTT GCCGCGTATG 
051241 AACTGACCAA CACCGTGACG CATAATCAGG GGAACTACGC AGCGATGATG GCCGACACCA TCAGTCGCTA 
051311 CAAAGAGGGC AAACCGGTGT TTTATTACAC CTGGACGCCG TACTGGGTGA GTAACGAACT GAAGCCGGGC 
051381 AAAGATGTCG TCTGGTTGCA GGTGCCGTTC TCCGCACTGC CGGGCGATAA AAACGCCGAT ACCAAACTGC 
051451 CGAATGGTGC GAATTATGGC TTCCCGGTCA GCACCATGCA TATCGTTGCC AACAAAGCCT GGGCCGAGAA 
051521 AAACCCGGCA GCAGCGAAAC TGTTTGCCAT TATGCAGTTG CCAGTGGCAG ATATTAACGC CCAGAACGCC 
051591 ATTATGCATG ACGGCAAAGC CTCAGAAGGC GATATTCAGG GACACGTTGA TGGTTGGATC AAAGCCCACC 
051661 AGCAGCAGTT CGATGGCTGG GTGAATGAGG CGCTGGCAGC GCAGAAGTAA TTTTTATTCG GGCGGATAAG 
051731 GCGTTTTTGC CGCATCCGCC GTTCTGTGCA CAATGCCTGA TGCGACGCTG GCGCGTCTTA TCATGCCTAC 
051801 AAACCACATC GCACATTTCA ACAATCTATC TTTCATCCCA TATTCATCAA CATCCGCTAT TATTGATTTC 
051871 CAGCTTAATC ATCACCTGAT GAACAAAAAT AATGACTAAA CCTAATCATG AGCTTAGCCC GGCGCTGATC 
051941 GTGCTGATGT CTATCGCCAC CGGTCTGGCG GTAGCCAGTA ACTATTACGC CCAGCCATTG CTCGACACCA 
052011 TCGCGCGTAA CTTTTCCCTT TCCGCCAGTT CGGCAGGCTT TATTGTTACC GCCGCGCAGT TGGGCTATGC 
052081 CGCAGGTCTA CTGTTTCTTG TTCCCCTCGG TGATATGTTT GAACGCCGCC GCCTGATTGT CTCGATGACC 
052151 TTACTGGCGG CATGTTGATT ACCGCCAGCA GTCAGTCGCT GGCGATGATG ATCCTCGGTA CGGCATTAAC 
052221 CGGTTTATTC TCAGTCGTGG CACAAATTCT GGTTCCGCTG GCAGCGACGC TGGCTTCACC GGATAAACGC 
052291 GGCAAAGTGG TTGGCACTAT TATGAGCGGT CTGCTGTTGG GGATCTTGCT GGCACGGACA GTTGCCGGAT 
052361 TGCTGGCGAA TCTCGGCGGC TGGCGCACCG TCTTTTGGGT TGCTTCGGTG TTAATGGCAC TGATGGCGCT 
052431 GGCATTATGG CGTGGTCTGC CACAAATGAA ATCAGAAACC CACCTCAACT ACCCACAGTT GTTGGGTTCC 
052501 GTTTTCAGTA TGTTTATCAG CGATAAAATT CTGCGTACCC GCGCGTTGCT GGGCTGCCTG ACCTTTGCCA 
052571 ATTTCAGCAT TCTCTGGACC TCAATGGCCT TTTTGCTTGC CGCTCCACCT TTTAACTACA GCGATGGTGT 
052641 CATTGGTCTG TTTGGACTTG CGGGAGCTGC CGGAGCGTTG GGCGCTCGTC CGGCGGGCGG TTTTGCCGAT 
052711 AAGGGCAAAT CGCACCACAC CACAACTTTC GGTCTGCTGC TGCTATTACT TTCATGGCTG GCGATCTGGT 
052781 TTGGTCACAC TTCCGTACTG GCGTTGATTA TCGGAATCCT GGTGCTGGAT CTCACCGTGC AGGGCGTGCA 
052851 TATCACTAAC CAGACGGTAA TTTATCGGAT ACATCCTGAT GCGCGCAATC GCCTGACCGC AGGTTACATG 
052921 ACTAGCTACT TTATTGGCGG TGCCGCCGGT TCGCTAATTT CAGCCTCAGC CTGGCAACAT GGCGGTTGGG 
052991 CTGGCGTTTG TCTGGCTGGC GCGACGATTG CCCTGGTTAA CTTACTGGTC TGGTGGCGAG GTTTTCATCG 
053061 TCAGGAAGCC GCAAATTAAG CAATCAGCAA CCGTTTTCGT GGCTTTACAC TTATAAGGGT GTTAAGAAGC 
053131 CCATCAGTCT GATAAGGTTA AGATATTCAT TCAGTCTATT TATAATATTA ACAATCGTTA AGCGTACACT 
053201 CTATGGAAAG CCCTACTCCA CAGCCTGCTC CTGGTTCGGC GACCTTCATG GAAGGATGCA AAGACAGTTT 
053271 ACCGATTGTT ATTAGTTATA TTCCGGTGGC CTTTGCGTTC GGTCTGAATG CGACCCGTCT GGGATTCTCT 
053341 CCTCTCGAAA GCGTTTTTTT CTCCTGCATC ATTTATGCAG GCGCGAGCCA GTTCGTCATT ACCGCGATGC 
053411 TGGCAGCCGG GAGTAGTTTG TGGATTGCTG CACTGACCGT CATGGCAATG GATGTTCGCC ATGTGTTGTA 
053481 TGGCCCGTCA CTGCGTAGCC GTATTATTCA GCGTCTGCAA AAATCGAAAA CCGCCCTGTG GGCGTTTGGC 
053551 CTGACGGATG AGGTTTTTGC CGCCGCAACC GCAAAACTGG TACGCAATAA TCGCCGCTGG AGCGAGAACT 
053621 GGATGATCGG CATTGCCTTC AGTTCATGGT CATCGTGGGT ATTTGGTACG GTAATAGGGG CATTCTCCGG 
053691 CAGCGGCTTG CTGCAAGGTT ATCCCGCCGT TGAAGCTGCA TTAGGTTTTA TGCTTCCGGC ACTCTTTATG 
053761 AGTTTCCTGC TCGCCTCTTT CCAGCGCAAA CAATCTCTTT GCGTTACCGC AGCGTTAGTT GGTGCCCTTG 
053831 CAGGCGTAAC GCTATTTTCT ATTCCCGTCG CCATTCTGGC AGGCATTGTC TGTGGCTGCC TCACTGCGTT 
053901 AATCCAGGCA TTCTGGCAAG GAGCGCCCGA TGAGCTATGA GGTTCTGCTG CTTGGGTTAC TAGTTGGCGT 
053971 GGCGAATTAT TGCTTCCGCT ATTTGCCGCT GCGCCTGCGT GTGGGTAATG CCCGCCCAAC CAAACGTGGC 
054041 GCGGTAGGTA TTTTGCTCGA CACCATTGGC ATCGCCTCGA TATGCGCTCT GCTGGTTGTC TCTACCGCAC 
054111 CAGAAGTGAT GCACGATACA CGCCGTTTCG TGCCCACGCT GGTCGGCTTC GCGGTACTGG GTGCCAGTTT 
054181 CTATAAAACA CGCAGCATTA TCATCCCAAC ACTGCTTAGT GCGCTGGCCT ATGGGCTCGC CTGGAAAGTG 
054251 ATGGCGATTA TATAACCCAC AAGAATCATT TTTCTAAAAC AATACATTTA CTTTATTTGT CACTGTCGTT 
054321 ACTATATCGG CTGAAATTAA TGAGGTCATA CCCAAATGGA TAGTTCGTTT ACGCCCATTG AACAAATGCT 
054391 AAAATTTCGC GCCAGCCGCC ACGAAGATTT TCCTTATCAG GAGATCCTTC TGACTCGTCT TTGCATGCAC 
054461 ATGCAAAGCA AGCTGCTGGA GAACCGCAAT AAAATGCTGA AGGCTCAGGG GATTAACGAG ACGTTGTTTA 
054531 TGGCGTTGAT TACGCTGGAG TCTCAGGAAA ACCACAGTAT TCAGCCTTCT GAATTAAGTT GTGCTCTTGG 
054601 ATCATCCCGT ACCAACGCGA CGCGTATTGC CGATGAACTG GAAAAACGCG GTTGGATCGA ACGTCGTGAA 
054671 AGCGATAACG ATCGCCGCTG CCTGCATCTG CAATTAACGG AAAAAGGTCA CGAGTTTTTG CGCGAGGTTT 
054741 TACCACCGCA GCATAACTGC CTGCATCAAC TCTGGTCCGC GCTCAGCACA ACAGAAAAAG ATCAGCTCGA 
054811 GCAAATCACC CGCAAATTGC TCTCCCGTCT CGACCAGATG GAACAAGACG GTGTGGTTCT CGAAGCGATG 
054881 AGCTAACGCG TCATCTCGCT CAAAAATCCA GATTTATAAA AGAAAAAATG ACTGGCCAGC ATCGCAACAT 
054951 GCTGGCCTTT TTGGCAAGCA GGTCGGCTCA GCCGATGAGT TAAGAAGATC GTGGAGAACA ATATGAGCGC 
055021 AAATGCGGAG ACTCAAACCC CGCAGCAACC GGTAAAGAAG AGCGGCAAAC GTAAGCGTCT GCTCCTCCTT 
055091 CTCACCTTGC TCTTTATAAT TATTGCCGTA GCGATAGGGA TTTATTGGTT TTTGGTACTG CGTCACTTCG 
055161 AAGAAACCGA TGACGCATAC GTGGCAGGGA ATCAAATTCA AATTATGTCT CAGGTGTCTG GCAGCGTGAC 
055231 GAAAGTCTGG GCCGATAACA CCGATTTTGT AAAAGAAGGC GACGTGCTGG TCACTCTCGA CCCGACAGAT 
055301 GCTCGCCAGG CGTTTGAAAA AGCCAAAACT GCACTGGCTT CCAGCGTTCG CCAAACCCAC CAGCTGATGA 
055371 TTAACAGCAA GCAGTTGCAG GCGAATATTG AGGTGCAGAA AATCGCCCTC GCGAAAGCAC AAAGCGACTA 
055441 CAACCGCCGT GTGCCGCTGG GCAATGCCAA CCTGATTGGT CGCGAAGAGC TGCAACACGC CCGCGACGCC 
055511 GTCACCAGTG CCCAGGCGCA ACTGGACGTC GCGATTCAAC AATACAATGC CAATCAGGCG ATGATTCTGG 
055581 GGACTAAACT GGAAGATCAG CCAGCCGTGC AACAGGCTGC CACCGAAGTA CGTAACGCCT GGCTGGCGCT 
055651 GGAGCGTACT CGTATTATCA GTCCGATGAC CGGTTATGTC TCCCGCCGCG CGGTACAGCC TGGGGCGCAA 
055721 ATTAGCCCAA CGACGCCGCT GATGGCGGTC GTTCCAGCCA CCAATATGTG GGTGGATGCC AACTTTAAAG 
055791 AGACGCAGAT TGCCAATATG CGTATCGGTC AGCCGGTCAC TATCACCACG GATATTTACG GCGATGATGT 
055861 GAAATACACC GGTAAAGTGG TTGGTCTGGA TATGGGCACA GGTAGCGCGT TCTCACTGCT TCCAGCGCAA 
055931 AATGCGACCG GTAACTGGAT CAAAGTCGTT CAGCGTCTGC CTGTGCGTAT CGAACTGGAC CAGAAACAGC 
056001 TGGAGCAATA TCCGCTGCGT ATCGGTTTGT CCACGCTGGT GAGCGTCAAT ACCACTAACC GTGACGGTCA 
056071 GGTACTGGCA AATAAAGTAC GTTCCACTCC GGTAGCGGTA AGCACCGCGC GTGAAATCAG CCTGGCACCT 
056141 GTCAATAAAC TGATCGACGA TATCGTAAAA GCTAACGCTG GCTAATCCAG AGGTGCGTGT GATGCAACAG 
056211 CAAAAACCGC TGGAAGGCGC GCAACTGGTC ATTATGACGA TTGCGCTGTC ACTGGCGACA TTCATGCAGG 
056281 TGCTGGACTC CACCATTGCT AACGTGGCGA TCCCCACTAT CGCCGGGAAT CTGGGCTCAT CGCTCAGCCA 
056351 GGGAACGTGG GTAATCACTT CTTTCGGGGT GGCGAATGCC ATCTCGATCC CGCTTACCGG CTGGCTGGCA 
056421 AAGCGCGTCG GGGAAGTGAA ACTGTTCCTT TGGTCCACCA TCGCCTTTGC TATTGCGTCG TGGGCGTGTG 
056491 GTGTCTCCAG CAGCCTGAAT ATGCTGATCT TCTTCCGCGT GATTCAGGGG ATTGTCGCCG GGCCGTTGAT 
056561 CCCGCTTTCG CAAAGTCTAT TGCTGAATAA CTACCCGCCA GCCAAACGCT CGATCGCGCT GGCGTTGTGG 
056631 TCGATGACGG TGATTGTCGC GCCAATTTGC GGCCCGATCC TCGGCGGTTA TATCAGCGAT AATTACCACT 
056701 GGGGCTGGAT ATTCTTCATC AACGTGCCGA TTGGCGTGGC GGTGGTGTTG ATGACACTGC AAACTCTGCG 
056771 CGGACGTGAA ACCCGCACCG AACGGCGGCG GATTGATGCC GTGGGGCTGG CACTGCTGGT TATTGGTATC 
056841 GGCAGCCTGC AGATTATGCT CGACCGCGGT AAAGAGCTGG ACTGGTTTTC ATCACAGGAA ATTATCATCC 
056911 TTACCGTGGT GGCGGTGGTG GCTATCTGCT TCCTGATTGT CTGGGAGCTG ACCGACGATA ACCCGATAGT 
056981 CGATCTGTCG TTGTTTAAGT CGCGCAACTT CACCATCGGC TGCTTGTGTA TCAGCCTCGC GTATATGCTC 
057051 TACTTCGGCG CTATTGTTCT GCTGCCGCAG TTGTTGCAGG AGGTCTACGG TTACACGGCG ACCTGGGCAG 
057121 GTTTGGCCTC TGCGCCGGTA GGGATTATTC CGGTGATCCT GTCGCCGATT ATCGGCCGCT TCGCGCATAA 
057191 ACTGGATATG CGGCGGCTGG TAACCTTCAG CTTTATTATG TATGCCGTCT GCTTCTACTG GCGTGCCTAT 
057261 ACCTTTGAAC CAGGTATGGA TTTTGGCGCG TCGGCCTGGC CGCAGTTTAT CCAGGGGTTT GCGGTGGCCT 
057331 GCTTCTTTAT GCCGCTGACC ACCATTACGC TGTCTGGTTT GCCACCGGAA CGACTGGCGG CGGCATCGAG 
057401 CCTCTCTAAC TTTACGCGAA CGCTGGCGGG GTCTATCGGC ACGTCGATAA CCACGACCAT GTGGACCAAC 
057471 CGCGAGTCGA TGCACCATGC GCAGTTGACT GAGTCGGTAA ACCCGTTCAA CCCGAATGCC CAGGCGATGT 
057541 ACAGTCAACT GGAAGGGCTT GGGATGACGC AACAGCAGGC ATCAGGCTGG ATTGCCCAGC AGATCACCAA 
057611 TCAGGGGCTG ATTATTTCCG CCAATGAGAT CTTCTGGATG TCAGCCGGGA TATTCCTCGT CCTGCTGGGG 
057681 CTGGTGTGGT TTGCTAAACC GCCATTTGGC GCAGGTGGCG GCGGAGGCGG TGCGCACTAA GTACAACTAA 
057751 GCCAGTTCAT TTGAACTGGC TTTTTTCAAT TAATTGTGAA GATAGTTTAC TGACTAGATG TGCAGTTCCT 
057821 GCAACTTCTC TTTCGGCAGT GCCAGTTCTT CGTTGCTGTT GATGCGTACG TCACGTTCCA GAATGCTACG 
057891 CGCAATAT