MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 13.seq
 Deletion 13
 Length 41411
 Fasta Format

>13
CTGCTGTGCCAGGATGAACACCCTTCCCTTCTGGCGGCGCTGGAATCCCACAATGTGGCG
GTTGAGTACCAGTGTCGCGAAGGTTACTGCGGCTCCTGTCGCACACGCCTGGTTGCAGGT
CAAGTTGACTGGATTGCCGAACCGTTAGCCTTTATTCAGCCGGGGGAAATTTTGCCCTGT
TGTTGCCGGGCAAAAGGCGATATTGAAATCGAGATGTGAATTGGTTGTAGTGCCAGATAC
AACGCTTATGCGTCTTATCTGGCCTACAACGATTACATGGCGTAGTAATACGCTTTCACC
TGCTCCCAGTCCGCTTTGGGGATTGGCTCCAGATATTTTTCCAGCTGGCGGAAGTCATGA
TTAATCGCTTTATCGCGACGCAAGCGGCGACGACTTTTCTCCAGGTCAAGAAAACCAGCT
TCTGCATTACCTTCTGTTTTCACATAGATATGGCGAACATAACAACAGCCATGCTGACGA
TTAATGCTATGCATTTTCTTAAACGCCAGCGCCACTGCTTTCAACATGGCTTGCCGTACT
TCGTCAGAATAAGGCGATACTGCATGCTGGGCATACCAGTCAGCAATGCTGATGAACCCC
GCCATATCTTCAGTCACCAGCAACGCTCGCCATTCACCCTCAATTTTCACCGCTTCACCA
AAAACGATCTTCGGCACGATGACACCGGCCCGTTCCAGTTCTTTAATTACCGCAACCTCA
CGGACAATCGTTGGTCGGCCGAACGGATAACGTACGGAATGAAACAGATGATGCGTCATG
CGCTTTACATACAGCTTTTTGCCGTTGCGCTCGACGCATTGCACCCCGCTCATACCATTA
CGGCGATAGTTAGGCTCTTCAACCCAGTCGCCCTCTGTTGCCCACCAGTGATTAAATTCG
TCGTACTTTGCTGAAACTGCCATACCCTATCGCCTGTCATTTTTATTAACGACAATGACT
ATAGGTGGTTACCTGAGGAAAATCTTAATGAAACGTGTCGTATTAATGAATTTCTTTTGC
CACTACTAGCTTGACACCGCTTTTACCCTTCATTTGCAGCGCATAGATTCCACCAGCCAC
TACCACTAATAGTGCGCCCAGCAGATAAAATGTGAATTTAATCAGGCGGATACAGCGATG
AATTTTATTCGACAGGGATTAGGCATCGCCTTACAACCAGAGTTAACGCTGAAAAGCATT
GCAGGTGAATTGTGTTCCGTTCCTCTCGAACCAACTTTCTATCGACAGATTTCGTTGCTG
GCTAAAGAAAAGCCGGTAGAAGGCAGTCCACTGTTTTTACTACAAATGTGCATGGAACAA
TTAGTGGCGATTGGAAAAATTTGATATGAGACAGGATGGCGCATGAACGCCATCCTGCAG
TAACATTACTCTTTATTAAGAAATTTTACTGCCTTATCAGGGAAATCAGTAAACAGCCCA
TTTACACCCGCTTTGTTATACAGAGCATCATATAACTGATTCACATCAGGAGTGTATTCA
GGCAGTTTATCTGACCGCACGGTATAAGGATGCACTACCAGTTTATTCTGCTGAGCATCT
TGCACCATGCCAGTGAGTTTGATATTACCCGGCTGCGATGTCTCCTCAATCAACATATGG
TAATCCGGACCAATACCATCTGCATATTCCGCCACCTGTTTCATGGCACCCGGCTTAAAC
ATCCAGTCGTAGTTGTAATTAACCCAGCTTCCATCCGGCTGTTTCTGCTGCGTTTCATTC
CAGTCGGTATAGGCAATCAGCTGTACCAGATTGAGCTCCATGCCCATTTTGGGTTCCAGC
TCATTCTTAATACGCTTCAGCTCATCAGCATCAAAACATTGCAAATAAACTTTATCGTCT
TTACCGGTGTAACCATATTTCTTCAGCACTTCCAGCGTTTTTGCCGCAATATCCTTCCCT
TCCTGATGATGGAACCACGGCGCTTTGATTTCTGGATAAATACCGATATTTTTCCCGGTA
GAGTGATTTAACCCCTGAACAAATTCAATCTCTTCTTCAAAGGTGTGCACCCGGAAGTCG
GACTTACCCATTGGGAAACGCCCCGGATAAGTCTGCACTTTTTTACCGTTTTCAATATCG
AAACCTTCGGTAAATTTCAACGACTTAATTTCATCCAGCGTGAAATCTATCGCGTAGTAA
CGACCGTCTTTGCGCGCCCGATCCGGGAAACGATCGGCAACATCAGTAACACGATCGAGG
TAATGGTCATGCAGAACAACCAGATTGTCGTCTTTGGTCATCACCAAATCCTGTTCCAGA
TAATCCGCTCCCTGCGCATACGCCATCGCTTTTGCTGGCAGCGTATGCTCCGGCAAATAT
CCACTGGCACCGCGATGGGCGATGACTATTTTTTCGTTGCTGTCCGCCGCCATTGCACTG
CTTCCCATGACTATAGTGCTCATCATGATCGCCATGCTAAGGTTTTTCAGCGTCAATTTC
ATGCCATTAGCCTCCGTTGCGTTCTTGCAGTAATTGTTCATGGCGACGTTTTTCGCCAAT
CATCACAACAATCAACAAGATAACCGCCAGAATGCTGCCGCCAATCATTACCATAAAGCC
GCCATCCCAGCCGAAGAAGTCCACGGTGTAGCCAACAATCGCGCTCGCCGCCACCGAACC
GCCCAGGTAACCAAACAGCCCGGTAAAGCCCGCTGCCGTACCTGCCGCTTTTTTCGGTGC
CAGTTCCAGCGCATGCAGACCGATCAGCATCACAGGACCGTAGATCAGGAAGCCGATAAC
AATCATACAAATCATATCGACGGTTGGGTTACCTGCCGGGTTCATCCAGTAAACGATAGT
CGCGATGGTCACCAGTGTCATAAAGAAAACGCCGGTTGCCCCACGGTTGCCACGGAAGAC
TTTATCCGACATCCAGCCGCACAGCAGAGTGCCCGGAATACCTGCATATTCATAAAGGAA
GTAGGCCCAGGAGGATTTATCTAGCGCGAAATGCTTAACCTCTTTCAGATAAGTCGGTGA
CCAGTCGAGGATGCCGTAACGCAGCAGATAAACGAACACGTTGGCGATGGCGATATACCA
CAGCAGTTTGTTCGGCAGTACGTACTGCATGAAGATTTGCTTCGCCGTCAGCTCCTGTTC
CGCTTTTTCGTTATAGTCGTCCGGATAATCATTTTTGTACTCTTCGATCGGCGGCAAGCC
ACAGGATTGCGGGGTATCGCGCATCATCGCAAAGGCGAATAATGCCACCAGAATGGCGCA
GAAAGCAGGCATATAGAGCGCCGCATGCCAGTCATTGAACCAGGCCATCCCCAGCAGGAA
CAGCAGCGGCGGAATACCACCACCGACGTTGTGCGCACAGTTCCACACTGACACAATGCC
GCCACGTTCTTTCTGCGACCACCAGTGCACCATAGTACGACCACACGGCGGCCACCCCAT
CCCCTGGAACCAACCGCAGAGGAACAACAGTACAAACATCACCGCAATGCTCGACGTCGC
CCATGGCACAAAGCCCATAAACAACATCACTGCCGCCGCCAGAATCAAACCTGCGGGCAG
GAAAACGCGCGGATTCGAGCGATCCGATACCGAACCCATGATGAATTTCGAAAATCCATA
AGCAATCGAGATCCCCGAAAGGGCAAAACCTAAATCACCGCGTGAGAATCCCTGCTCAAC
CAGATAAGGCATAGCAAGCGCAAAGTTCTTACGAACCAAATAGTAAGCCGCATAGCCAAA
GAATATCCCCAGGAAAATTTGCCAGCGCAATCGACGATAAGTCGGATCGATCTCCGCGGC
AGGTAAGCGCGCTTTGTGTGGCGCTGGTTTAAAAATACTCAACATTGATAGCCTCCGTGG
CCCGTGGTCTTATTTATGATTAACAGCCTGATTCAGTGAGAGAACCTGCCGTTTCTTGAG
TTGCCGCGATGTTAAGAAAACATTCATAAATTAAATGTGAATTGCCGCACACATTATTAA
ATAAGATTTACAAAATGTTCAAAATGACGCATGAAATCACGTTTCACTTTCGAATTATGA
GCGAATATGCGCGAAATCAAACAATTCATGTTTTTACTATGGCTAAATGGTAAAAAACGA
ACTTCAGAGGGATAACAATGAAAACTCGCGACTCGCAATCAAGTGACGTGATTATCATTG
GCGGCGGCGCAACGGGAGCCGGGATTGCCCGCGACTGTGCCCTGCGCGGGCTGCGCGTGA
TTTTGGTTGAGCGCCACGACATCGCAACCGGTGCCACCGGGCGTAACCACGGCCTGCTGC
ACAGCGGTGCGCGCTATGCGGTAACCGATGCGGAATCGGCCCGCGAATGCATTAGTGAAA
ACCAGATCCTGAAACGCATTGCACGTCACTGCGTTGAACCAACCAACGGCCTGTTTATCA
CCCTGCCGGAAGATGACCTCTCCTTCCAGGCCACTTTTATTCGCGCCTGCGAAGAAGCAG
GGATCAGCGCAGAAGCTATAGACCCGCAGCAAGCGCGCATTATCGAACCTGCCGTTAACC
CGGCACTGATTGGCGCGGTGAAAGTTCCGGATGGCACCGTTGATCCATTTCGTCTGACCG
CAGCAAACATGCTGGATGCCAAAGAACACGGTGCCGTTATCCTTACCGCTCATGAAGTCA
CGGGGCTGATTCGTGAAGGCGCGACGGTGTGCGGTGTTCGTGTACGTAACCATCTCACCG
GCGAAACTCAGGCCCTTCATGCACCTGTCGTGGTTAATGCCGCTGGGATCTGGGGGCAAC
ACATTGCCGAATATGCCGATCTGCGCATTCGCATGTTCCCGGCGAAAGGATCGCTGCTGA
TCATGGATCACCGCATTAACCAGCATGTGATCAACCGCTGCCGTAAACCTTCCGACGCCG
ATATTCTGGTGCCTGGCGATACCATTTCGCTGATTGGTACCACCTCTTTACGTATTGATT
ACAACGAGATTGACGATAATCGAGTGACGGCAGAAGAGGTTGATATTCTGCTGCGTGAAG
GGGAAAAACTGGCCCCCGTGATGGCGAAAACGCGCATTTTGCGGGCCTATTCTGGCGTGC
GCCCGCTGGTTGCCAGCGATGACGACCCGAGCGGACGTAACGTCAGCCGTGGCATCGTGC
TGCTCGACCATGCTGAACGCGATGGTCTGGACGGATTTATCACCATCACCGGTGGCAAAC
TGATGACCTATCGGCTGATGGCTGAATGGGCTACCGACGCGGTATGCCGCAAACTGGGCA
ACACGCGCCCCTGTACGACTGCCGATCTGGCACTGCCTGGTTCACAAGAACCCGCTGAAG
TTACCTTGCGTAAAGTCATCTCCCTGCCTGCCCCGCTGCGCGGTTCTGCGGTTTATCGTC
ATGGCGATCGCACGCCTGCCTGGCTGAGCGAAGGCCGTCTGCACCGTAGCCTGGTATGTG
AGTGCGAAGCGGTAACTGCGGGTGAAGTGCAGTACGCGGTAGAAAATTTAAACGTTAATA
GCCTGCTGGATTTACGCCGTCGTACCCGTGTGGGGATGGGCACCTGCCAGGGCGAACTCT
GCGCCTGCCGCGCTGCCGGACTGCTGCAACGTTTTAACGTCACGACGTCCGCGCAATCTA
TCGAGCAACTTTCCACCTTCCTTAACGAACGCTGGAAAGGCGTGCAACCCATCGCCTGGG
GAGATGCACTGCGCGAAAGCGAATTTACCCGCTGGGTTTATCAGGGATTGTGTGGTCTGG
AGAAGGAGCAGAAAGATGCGCTTTGATACTGTCATTATGGGCGGCGGCCTCGCCGGATTA
CTCTGTGGCCTGCAACTGCAAAAACACGGCCTGCGCTGTGCCATTGTCACTCGTGGTCAA
AGCGCACTGCATTTCTCATCCGGATCGCTGGATTTGCTGAGCCATCTGCCAGATGGTCAA
CCGGTGACAGACATTCACAGTGGACTGGAATCTTTGCGTCAGCAGGCACCAGCCCATCCT
TACTCCCTTCTCGAGCCACAACGCGTGCTCGATCTCGCTTGCCAGGCGCAGGCATTAATC
GCTGAAAGCGGTGCGCAATTGCAGGGCAGCGTAGAACTTGCTCACCAGCGGGTTACGCCG
CTCGGCACTCTGCGCTCTACCTGGCTAAGTTCGCCAGAAGTCCCCGTCTGGCCGCTGCCC
GCGAAGAAAATATGTGTAGTGGGAATTAGCGGCCTGATGGATTTTCAGGCGCACCTTGCG
GCAGCTTCGTTGCGTGAACTCGGCCTTGCCGTTGAAACCGCAGAAATAGAGCTGCCGGAA
CTGGATGTGCTGCGCAATAACGCCACCGAATTTCGCGCGGTGAATATCGCCCGTTTCCTT
GATAATGAAGAAAACTGGCCGCTGTTACTTGATGCGCTTATTCCTGTCGCCAATACCTGC
GAAATGATCCTGATGCCCGCCTGCTTCGGTCTGGCCGATGACAAACTGTGGCGTTGGTTG
AATGAAAAACTACCTTGTTCACTGATGCTTTTGCCAACGCTGCCGCCTTCCGTGCTGGGC
ATTCGTCTGCAAAACCAGTTACAGCGCCAGTTTGTGCGCCAGGGTGGCGTGTGGATGCCG
GGCGATGAAGTGAAAAAAGTGACCTGTAAAAATGGCGTAGTGAACGAAATCTGGACCCGC
AATCACGCCGATATTCCGCTACGTCCACGTTTCGCGGTTCTCGCCAGCGGCAGTTTCTTT
AGTGGCGGACTGGTAGCGGAACGTAACGGCATTCGAGAGCCGATTCTCGGCCTTGATGTG
CTACAAACCGCCACGCGGGGTGAATGGTATAAGGGAGATTTTTTTGCGCCGCAACCGTGG
CAGCAGTTCGGTGTAACCACTGATGAGACGCTACGCCCGTCACAGGCAGGGCAAACCATT
GAAAACCTGTTTGCCATCGGTTCGGTGCTGGGCGGATTTGATCCCATCGCCCAGGGATGC
GGCGGCGGTGTTTGTGCCGTCAGTGCTTTACATGCCGCTCAACAGATTGCCCAACGCGCA
GGAGGCCAACAATGAATGACACCAGCTTCGAAAACTGCATTAAGTGCACCGTCTGCACCA
CCGCCTGCCCGGTGAGCCGGGTGAATCCCGGTTATCCAGGGCCAAAACAAGCCGGGCCGG
ATGGCGAGCGTCTGCGTTTGAAAGATGGCGCACTGTATGACGAGGCGCTGAAATATTGCA
TCAACTGCAAACGTTGTGAAGTCGCCTGCCCGTCCGATGTGAAGATTGGCGATATTATCC
AGCGCGCGCGGGCGAAATATGACACCACGCGCCCGTCGCTGCGTAATTTTGTGTTGAGTC
ATACCGACCTGATGGGTAGCGTTTCCACGCCGTTCGCACCAATCGTCAACACCGCTACCT
CGCTGAAACCGGTGCGGCAGCTGCTTGATGCGGCGTTAAAAATCGATCATCGCCGCACGC
TACCGAAATACTCCTTCGGCACGTTCCGTCGCTGGTATCGCAGCGTGGCGGCTCAGCAAG
CACAATATAAAGACCAGGTCGCTTTCTTTCACGGCTGCTTCGTTAACTACAACCATCCGC
AGTTAGGTAAAGATTTAATTAAAGTGCTCAACGCAATGGGTACCGGTGTACAACTGCTCA
GCAAAGAAAAATGCTGCGGCGTACCGCTAATCGCCAACGGCTTTACCGATAAAGCACGCA
AACAGGCAATTACGAATGTAGAGTCGATCCGCGAAGCTGTGGGAGTAAAAGGCATTCCGG
TGATTGCCACCTCCTCAACCTGTACATTTGCCCTGCGCGACGAATACCCGGAAGTGCTGA
ATGTCGACAACAAAGGCTTGCGCGATCATATCGAACTGGCAACCCGCTGGCTGTGGCGCA
AGCTGGACGAAGGCAAAACGTTACCGCTGAAACCGCTGCCGCTGAAAGTGGTTTATCACA
CTCCGTGCCATATGGAAAAAATGGGCTGGACGCTCTACACCCTGGAGCTGTTGCGTAACA
TCCCGGGGCTTGAGTTAACGGTGCTGGATTCCCAGTGCTGCGGTATTGCGGGTACTTACG
GTTTCAAAAAAGAGAACTACCCCACCTCACAAGCCATCGGCGCACCACTGTTCCGCCAGA
TAGAAGAAAGCGGCGCAGATCTGGTGGTCACCGACTGCGAAACCTGTAAATGGCAGATTG
AGATGTCCACAAGTCTTCGCTGCGAACATCCGATTACGCTACTGGCCCAGGCGCTGGCTT
AAACTCCTTTCTGATGCCCGGTAAGCATGTGGTTACCGGGCATTTTTGCGTACACGATTC
CGTGCCCAATGTATGCGTTGCAACGCAGTGAAAATTCCTCTGAAAACGTCTCGCAAAGGC
TGAAACTGGCAGATGTCAAAGGCCTGGGATAACCGTAATGTCGCGTCATCATAAATATCA
GGTGACGGACAACCATGACCGAATCAACAACCTCCTCCCCGCATGATGCGGTATTTAAAA
CCTTTATGTTCACACCCGAAACCGCACGGGATTTTCTCGAAATACATTTACCAGAACCAC
TGCGCAAGCTTTGCAACCTGCAAACCTTACGCCTGGAACCCACTAGTTTTATTGAAAAAA
GTTTACGCGCTTACTACTCGGATGTTTTGTGGTCCGTGGAAACCAGCGACGGTGACGGCT
ATATCTACTGCGTGATTGAACATCAAAGCTCTGCAGAAAAGAATATGGCTTTTCGGCTAA
TGCGCTATGCCACTGCCGCCATGCAGCGTCACCAGGACAAAGGCTATGACAGAGTCCCGC
TGGTGGTGCCGTTGCTGTTTTATCATGGCGAAACCTCGCCTTACCCGTACTCACTCAACT
GGCTGGATGAGTTTGACGATCCGCAACTTGCCCGGCAGTTGTACACCGAAGCTTTTCTGT
TGGTGGATATCACCATCGTACCTGACGATGAGATCATGCAACATCGGCGTATAGCTCTGC
TGGAACTGATTCAAAAGCATATTCGCGACCGCGATTTAATCGGCATGGTCGACAGGATCA
CCACGCTTTTGGTTAGAGGCTTCACTAATGACAGCCAGCTACAAACACTGTTTAATTATC
TGCTGCAATGCGGCGATACCTCCCGTTTCACCCGTTTTATTGAGGAGATTGCCGAACGTT
CACCACTACAAAAGGAGAGATTAATGACTATTGCTGAACGGCTACGGCAGGAAGGGCATC
AAATTGGCTGGCAGGAAGGTATGCATGAACAAGCCATTAAAATTGCTTTGCGCATGCTGG
AGCAGGGCTTTGAACGTGAGATTGTGCTGGCGACAACCCAACTCACTGATGCTGATATTC
CGAACTGTCATTAAAAGGAGAGATTAATGACTATTGCTGAACGGCTGCGGCAGGAAGGAC
ATCAAATTGGCTGGCAGGAAGGTAAATTAGAAGGTTTGCATGAACAAGCCATTAAAATTG
CTTTGCGCATGCTGGAACAGGGCTTTGATCGTGACCAGGTGCTCGCGGCCACCCAGCTAA
GCGAAGCCGATCTGGCAGCGAATAACCACTAATTAACACAGGCCCACAGCCGATCCCCAT
GGGCCTTTGATATCAATAACTACCTTTTATGCGTGGCCCATTTTTGCCTGATTTAAACAT
CGCCAGTCGTTGATCCAGGGCATCGCTGTAGAGCATCGTGTCAACGCCAACAGCGACAAA
GTTCGCTCCCCACGCCAGGCATTGCTGCGCCATATCAGGAGCCACAGCCAGAAAACCAGC
CGCTTTACCCGCAGCACGGATCCGCCGAATACTGGTTTCAATAATTCGCTGCACTTCCGG
GTGCCCGGCGTTATCCGGGTAGCCCAACGACGCAGAAAGATCCGCAGGTCCAATAAACAC
GCCATCAATCCCTTCGACGTCGAGGATTTCGTCCAGGTTATCCAGTGCCGTTTTACTTTC
CACCTGCACCAACAGACAAAGCGAATCGTTAACTTGCGCCATGTAATTCTCAATGCGTCC
CCAGCGCGCAGCCCGTGCCACACTGGCCCCGACACCACGCTCACCGTAGGGAGGATAGCG
CGTGGCAGACACCACCTGACGTGCCTGTTCGGCAGTATCGACCATCGGGATCAGTAGAGT
TTGCGCGCCAATATCCAGGACTTGTTTAATCAGCGGTTTACTGCCTTCCACCGGACGGAT
CACGGGTTGGCTGGCATAGGGCGCTACCGCCTGTAGCTGATGATAAAGATCCTGAATGGT
GTTTGGCGCGTGCTCCCCGTCAATCAGCAACCAGTCATAACCAGAAGTGGCGGCAATTTC
TGCCATATAGGCAGTCGTTGAGCTTAACCACAGACCAATTTGCACTTCGCCCTTGCGTAA
ACGTTCTTTAAAGGGATTGCTTAATAATGCGTTCATCGTGTTCCTTAACCTATTTAATGA
TGTGCCACGTCGGTCTGCGCAACAGTGCGATTTACACGCAGAGTGAAAATAATCAGCGAA
CCGATGACCGCCACCGCTGCCAGCGTCAGTAATCCCGCCGCATCGCTGGCAAATAACGTT
TCTGCTTTCACGCGCAGGATCGGGGCAATAAACCCGCCCACTGCACCAAACAGGTTTACA
AAACCAATTCCCGCAGCCAGCGCCGTACCGGAAAGCAGTTGTGTCGGCATCGTCCAGAAC
ACTGGCTGCACGGCAATAAACCCGATAGCTGCAACACACAGCGCTACGATCGCCATTACT
GGAGAAAGCAGCCCGGACAGACCAATACCAATGCCCGCCGCCAGTAATGTCAGCGCTGCG
ACATTACGCCGTTCGCCGGTTTTATCGGAATAGCGCGGAATAAGCCAGGTCCCAAACAAG
GCCGCAACCCACGGAATGGCGGTGACCACCGACGCTGTAAAGCCCACTTTTGTTCCCAGC
AATGCCGCAACCTGGGTCGGCAGGAAGAAAATTAATCCGTAAACCGCCACCTGAATGGTC
AGGTAGATAATCGCTAGTTGCCAGACTCGGCCATTACGCAGCGCATCGCTCAGCCGAGAA
GTCACTTTCTGTTGTTCTTCACTTGCCAGTTGATTGATAAGCAACGTTTTTTCTTGTTTA
CTCAGAAAACGTGCCTGCTCCGGTGTGTCATCAAGCCAAAAGAATGTGAATACCCCAGCA
CCGACTGCCAACAATCCTTCAATCACAAACATCCAGAACCAGCCGGGATGCCCCATAAAT
CCATGCATCTCCAACAGCGCGCCGGAAAGCGGTGATCCCAGTGTTAACGCCAGCGGTGCG
CCCATATAGAACAGCCCCATAATGCTGGCGCGATTACGCTGCGGAAACCATTGCGAGGTG
AGATAAATCATACCAGGGAAAAATCCGGCCTCCGCAGCACGAAGCAGAGTGCGAACTATC
AGAAATTTCGCTTCAGTATCGGCCCATGCCATGGCTGCCGAAAGAAATCCCCACAGCAGT
GTTGTCGTACCAATCCAGGTTCTGGCCCCCAGTTTGCGCATCAAAAGATTCGCCGGAACA
CCCAGAAACGCATATACCACAAAGAAAATGCCTGCTCCCAGCGCATAAGCTTCATTACTC
AACCCGGTATCAATCTGGTAGGTCTGTTTGGCAAAACCGATATTCGAACGGTCGAGAAAC
GCCAGCACATACAGCGCCAACATAAACGGAATTAAACGCACACGGTTTTTCTTCACCACG
GCGTCAAGCAAAGCGGTGCTCATAAAAAGCTCCTTAGAATATGTGGGCGTTACCGTTGTC
ACAGCAACGCCCGGAGTGATTAGTGGCTGTAGGGGCGTTTCAAATTGCAGTCACGATTGA
GTTCGACGCCAAAACCGGGTTTATCAAGCACTGATTTATGAATACGACCATTCACCGGAA
CCGGCTCATTGAGCAGAATCGGGTCAAACTGCGGACGCATCGTTGAACAATCCGGGCTGG
TCATCAGGAATTCGCTGAATGGCGTATTGGTGAAGGTGATCACCGCATGGTGAGAGTAAA
CAGACGAACCGTGCGGCACCACCAGTTGCCCCCTGGATTTGGCGATTGCGGCAATTTCCA
CCAGCGTGGTTAAACCACCGCACCAGCCAACATCCGGCTGCATAATGTCGATACCGGTTT
CTGAAAGCGTACGAAAAGATTGCAGTGTGCCGTGGTGCTCACCGCTGGTGACCATCATTC
CGACTGGCGCGTTGCGTTTCAGTTCGCGATAACTTTCATACTGCTGTGGCGGCAGGCACT
CTTCGATCCATTTCAGGTTATAGGGCGCGCAAGCGTGGGCCAGTTTGGTCGCATAGTTCA
CGTCCTGACTCATCCAGCAGTCGAGCATTAACCAGAAATCCTCACCGCATTTTTCACGCA
TATCCGCGACCATAGCGGCATCTTTGCGGATCCCCGCATCGCCATCATGTGGCCCCCAGT
GCGTCGGCATTTTGCCACCGATAAAGCCCATCTCTTTTGCCAGATCCGGACGCGCACCTG
TGGCGTAGAACTGAATCTCATCACGAACAGCGCCGCCTAAAAGTTTATAAACCGGAAGCC
CGACCACTTTGCCGAACAGATCCCACAGAGCCAGATCGACACAAGAAATCGTATTCATCA
CCAGGCCACCAGAGCCGGAGTAATACAGGGTGGCACTGAGCATTTGATCGTGGATCAGTT
TGATATCACTGACACATTTACCCTCAATGAAACGGTTAAGATGTTTTTCGACAATAAAAC
AGCCCATTTCACCGGCTGTCGAAACGGCGAATCCGGTCTGGCCGTTTTCTGCTTCGACTT
CAACAACCAACGTGCCAAGAACGTTAATGCCAAATGACTGGCGTGACTGCTCGTAATCGC
GGTATTTACTCATCGGGGTGGCAATATGATCGTCTATCCAGTGATTCGCCCCCTGGTCGT
GATAATCACCGCCGCCAGCGCCTTTTTCTGCTGTCGCACCGCCAGTAAACCAGGCGCGAA
CCTGTTTAATTTTTGGTAGGGTCATGATGTTCTCCATTGTTATGAGGCTTGTAAGTCAAA
GGGACTTTTCCATCCCAACAGACGTGAAATATCCCTGGCGCAGGCAATGGCCTTGCCCGC
CAGATAATCACGGTATTCTTCATTGATTTGTAAGCGGGTACCGACCACCGAGATCGCAGC
GGTAAGCTCGTTATTGGCGTTAAACACCGGCGCAGCGACACAACGGACATCGGCGTAATC
TTCGCCGTTGTCATAGCTCCAGCCCTGACGGCGAATACGCGCCAGTTCTTCGTGAAGTTG
CTGTGGATGAGTAATCGTTGTGGGTGTCGCCTGCTCCCAGACCAGCCCTTCGATAATACT
TTGCTGTACCGCTGCAGGTTGCCAGGCAAGCAGGCATTTACCTATTCCGGAGCGATAAAG
CGAAAGGCTTTTTCCTTCATGGGAACGCACGCTGATAGTGGCTGATGACTCCACTTTCAA
AATGTAATAAGCGCTGCCGTTATCAATAATCCCCAGGTGACATAACAGCCCGGTGGTATC
CATCAGTTGCGTCAAACGCGGTCGAGCCAGTTCCCGGAGATCCATCTTGCTTAACGCATG
ACCGGAAAGCTCCACCAGCCTGGTCCACAAACAAAAATTTTCCTGGTGATCAAGGCTAAG
AAAACGCTGACGCCTGAGTTCATTAAGCAGCAAATAGGCCGTGCTTTTAGGGATTCCCAA
TGTGTCAATGATCGTCGCAGCACTACAGGGGCCAATGCGGGCAATCAAATTGAGAATATC
AATAGCCCGTGTCAGGGCGGGAACTTTGCTTGATTCCAACATACTGGACTCCAGTCTTAG
ATACTGGAATCAGTCTCGTTGCTCAGGGGGAGTAAAATTGTGAAGCGCATCAAATCCCGC
TCCTCGTCCAGCAGACTGGAGAAATTACGCACAAATTTGTGAATCAGCGCACGGATTTTT
TCTTATTGAGTACAACAGGTTGGACAAATTTTGCCGGAGGGGGAATGTGCCGGTGCAGTA
AACCGGCACAGAGTGGCGGAATCAGACAGATAAGGTCATGGACTCAACAACCTCAATCCA
GCCATGCTCACTGGCGATATCCTGGCCGTTTAACCAACGGCGCAGCATATTCAGTGCCAT
CATTGCGCACACTTCCTGACGGATAGCCAGGCTGTAGCGCGTAGTGCTGAAACGCACACG
CAGAGCGAAAGTGCCGTCTGGCGTGGCTAGCGCAAAGTTGAGATGCTCGTTCTCGAAACC
CGAAACAGCCAGTGCCAGCCCGGCAAAATGGTTGGCCCGCCGTTCTGTAATCCAGTGCGC
AGTTTGCGCCAGGGTTTCCTCCTGTGAAGGAACCACTTCACACGCCAGCAATGGAGCACC
TGCGCGAGAAAGTTGCAAAGCCAATAAACCACCGGTGAATTGCTCGCTCAACGTCAGGCT
GAACTGGCGGTTTTGCAATTCGCGACTGATCTGCGCGGGCAGTCCTTCAGTGCCTTCGAA
AATCACGCTCTGTCCGGCAACACGTTTAACATCCAGCCACAGTTTTTCCATCGCCTGTTG
CTCGCTTGCCGGTCCGGTGAGTTTCAGTTCGATGATAGGCATTGAGGAGCGATAGCCCAT
TGTTACGCCCGGCGGCAGTTGTAGAGTGTCCAGGCTTTGTGCCAGATCGCTTTCCGAACG
ACCAAAAGTAGTCAAACGCAGACAAACCGGCGGCTGCGGTAAAGAAAAACGCTCGCGCAG
GCGCGGCAGGATTTCGTGCTCGACCATCACCTTAAATTCTGACGGTACGCCGGGAGTAAA
GAACATCAGGCAACGATTAAGCTGCACGGCAAAACCACAGGCGGTGCCTACCGGGTTATT
GATAAATTCAGCACTGGCAGGCAGCTCCGCTTGTTTACGGTTGCTCGGTGCCATTACTCG
TCCACGTTCGTGGAAATAGCGTTCCATCTCTTTGAGCCAGGCTTCATGCAGCACCAGGCC
TTCACCTTTTGCTGTCGCAGCGGCGAGTGCGCTTAAATCATCGCTGGTCGGTCCCAGCCC
GCCGTTAACGATCAGCACATCGGCGTGCTGACTACGTTCGCGAAGAATGGTGACTAAGTC
ATCAAGGTTATCCCCCACCGTATTGCGGCGAGATAATGGCAACCCCTGATGAAAGAAAAA
ATCGGCCAGCCAGGCAGCGTTAGTGTCAACGATTTGCCCGTGTAACACTTCATCCCCGGT
GGATAACATTTCCACTTTTAACATGGTTATCTCCTGCTTTTGTTATCGAATCACTATAAC
GCAAAGGGAGATAAGGCGTAGTAAGAAACTGAATGGCGCGACAGAATGCCGCGCCGGAAG
GGATCAGAAACTGGCGTTAACCCCAACATACGGGCCGTCAGCCACGGCGTTGTCGCGGTT
ACCGTCTTTACCCGACAGATTCAGGTAGCGATAACCCGCCTCAATACTGACTGGACGCAT
AATGGTGTAACGCGCGCCAGCATTCGCTTCTTCATAACTTTGAATACCGCTGGAGAGCGA
ATCCGGAGAGTAGTAATACTCGCCAAACAAACGGAAGCTGTTGCCAATTTTCCACTGCAA
ACCACCTCCTACCGCTGCGGCATAACCTTCATCGCCGTAATTCGGGTTGGTGTAAACGCC
TTTTCCGCCAACGGTCGCCATTAACGGCCCGAGAGGCAGATTCAACCCCAGCCCCACGCC
AGCGACATCACCGTCGTCGTCGTTATGTGTCCAGTTACCGCTTAACGCCAGGCCCGTCGT
TTCAGTCCCAAAACCGACACCAATATTGGTGTATTCTTTACCCGCCTGACCGCTGATGCT
CATTGCATTGACCGATGCAGAAACCAACAGCATTCCGGCCAGACCTGCTAGCGCAATTTT
TTTCATTATCCCCTTTCCCACAAGCAATTAATCAAAATTCCCAAAGCTGCGGGATTGTAC
TGCCTGGCACAGAGGATTCAATGAGCGAAAAAAAGGATCTAGTCACTTATTGTAACTAAA
TACTTCTTAAATAATTAAATGCCGAAAAAATAAACACACTTTATCGATACACACAAAAAT
AATAATAAGTACAGTTATCATCGCAAAAGAGATTACTGTCACTTTCACATATTTGTGAGT
TACCGTATTCTCATGGTTTCTTTTTATTTATAAGGAATATCCCTGTGCGACAACGGACTA
TTGTATGCCCTTTGATTCAAAATGATGGTGCTTATTTGCTGTGTAAAATGGCCGACGATC
GCGGCGTTTTCCCCGGTCAATGGGCGATTTCGGGTGGCGGCGTGGAGCCTGGCGAACGAA
TTGAAGAGGCACTACGCCGCGAAATTCGCGAAGAACTGGGAGAACAGCTGCTTTTGACAG
AAATCACGCCGTGGACCTTCAGCGATGATATTCGCACCAAGACGTATGCAGATGGTCGCA
AGGAAGAGATTTATATGATTTACCTGATTTTTGACTGCGTTTCTGCCAACCGAGAAGTGA
AAATAAACGAAGAGTTTCAGGACTACGCGTGGGTAAAACCTGAAGATCTGGTGCATTATG
ATTTGAATGTCGCCACCCGAAAAACGTTACGTTTGAAAGGTCTTCTGTAACAATGATGAC
AGCCATTACTGGCTGTCAGATTGAAAATTTAGTGGTTAACGAATTCCCCATCCAGATAAA
CTTTGCCTTTTTCCACATGCATGACTAAACCATCCAGATAATCAGGTTTAAATGTCGCGT
CACGCTTATCTTTAGCAATATATGTCAGGCAATGATTATGGGTGAAAATAACGATATTTT
TATCAGGCGCTTTGCTTTGTAAGTCCTTAATTGCACTATAAATCTCATTACCGCACTGAA
GAAGTCGTTTATCTACCGTCAATTTTTTACCCGCTGAAAACCAGGTAGCCGACTGAATGG
TCCGGACGGTATTACTGGAATAAAGATCGAAATCAGGGATATCAGCACTAAAAGCGTTGC
CCAGTTCACGGGCATCCTGGGTACCTTTAACCGTAATACCTGTTTTATCTGACAAGCATT
GATTGGTTGAACGGTCGCAACGTTCAGCATGACGAAACAAAACGACAACCGGGTGCTGCT
GTGCCAGTCTGGCCAGTGTTTTATTGTCGATACGTGGCAAACCATTGCTACTCCAGGCGG
CATGAGTACCCAGTCCGGCAATTGCAGCGAGCGCCAGTAAAATGATGATATATTTTTTTG
ACTTCAACGAAGAGCGGCAAAAAGCTAACACGTAAACTCCACCTATAGACAAGCGCAACC
AGACAATTACCGTGAAATTGAGCTACATTTCTGGCGATAATTCGCAGTTGGTGTAATATT
AAAAATCCTACGATGTCGGCAAAATGCCTCAAAATTTTGCCAAATGCAAAGCCTAAATAA
GAAAAAATATAAAAATTTCAATATTTACGTCTAATATTAGTTTCTTAAGGTTAAGTTAAT
ATTCTATCCTTAAAATTTCGCTCCAAATGGCAAAATATACACAACACTCTTTATAGCAAA
TATAAGTGGACAGGTATTCAATGGCGGAAGGAAAAGCAATGTCAGAATTTTTGCCTTTTT
CGCGACCAGCAATGGGCGTGGAGGAACTCGCTGCAGTTAAAGAGGTTCTCGAATCCGGTT
GGATCACAACCGGTCCGAAGAATCAGGCGCTTGAGCAAGCTTTTTGCCAGTTGACGGGAA
ATCAGCATGCCATCGCGGTCAGTTCAGCCACCGCCGGAATGCATATCACGCTAATGGCGT
TGAAAATTGGCAAGGGCGATGAAGTGATTACGCCTTCCCTGACCTGGGTTTCAACCCTCA
ATATGATTTCCTTGTTGGGTGCAACGCCGGTAATGGTGGATGTCGACCGCGATACGCTGA
TGGTCACGCCTGAAGCTATCGAGTCAGCCATTACGCCACGCACTAAAGCCATCATTCCGG
TGCATTATGCCGGTGCGCCAGCAGATATTGACGCCATTCGCGCCATTGGCGAACGTTACG
GCATCGCAGTTATCGAAGATGCTGCCCATGCCGTCGGTACGTATTACAAAGGGCGACATA
TTGGCGCAAAAGGTACCGCTATTTTTTCATTTCATGCCATTAAAAATATTACCTGTGCTG
AAGGTGGCCTGATTGTAACTGATAATGAAAACCTTGCCCGCCAGCTACGGATGCTGAAAT
TTCACGGTCTGGGTGTCGATGCCTATGACAGACAAACCTGGGGCCGTGCACCGCAGGCTG
AAGTCTTAACACCGGGCTATAAGTACAATCTGACCGATATTAACGCCGCGATTGCCCTGA
CACAGTTAGTCAAATTAGAGCACCTCAACACCCGTCGGCGCGAAATTGCCCAGCAATATC
AGCAAGCACTGGCAGCTCTCCCCTTTCAGCCATTAAGCCTTCCCGCCTGGCCGCACGTTC
ACGCCTGGCATCTGTTTATTATTCGTGTCGATGAACAACGTTGTGGTATCAGTCGCGATG
CGTTGATGGAAGCGTTAAAAGAAAGAGGCATTGGTACCGGGTTACATTTCCGCGCCGCTC
ACACACAAAAATATTATCGCGAGCGTTTTCCCACGCTGTCGTTACCGAATACCGAATGGA
ATAGCGAACGCATCTGTTCTTTGCCGCTGTTCCCGGATATGACTACCGCCGATGCCGACC
ATGTCATCACAGCCCTTCAGCAACTCGCAGGACAATAAGCCATGTTTGAAATCCACCCTG
TTAAGAAAGTCTCGGTGGTTATTCCCGTTTATAACGAGCAGGAAAGCTTACCGGAATTAA
TCAGGCGCACCACCACAGCCTGTGAATCGTTGGGGAAAGAGTATGAGATCCTGCTGATTG
ATGACGGCAGTAGCGATAATTCCGCGCATATGCTGGTCGAAGCCTCACAAGCGGAGAACA
GCCATATTGTGTCTATTTTGCTTAACCGCAATTACGGGCAACATTCAGCGATTATGGCGG
GATTCAGTCACGTTACTGGCGACTTAATTATTACCCTTGATGCCGATCTCCAGAATCCGC
CAGAAGAAATCCCCCGCCTGGTGGCAAAAGCCGATGAAGGTTACGACGTGGTAGGGACTG
TACGCCAGAACCGCCAGGACAGCTGGTTTCGTAAAACCGCTTCGAAGATGATTAACCGGC
TTATTCAGCGCACCACTGGCAAAGCGATGGGTGATTACGGTTGTATGCTGCGCGCCTATC
GCCGTCATATTGTCGATGCGATGTTGCACTGCCATGAACGCAGCACCTTTATCCCGATTC
TGGCGAATATCTTCGCCCGCCGTGCCATTGAAATTCCAGTACATCATGCCGAGCGTGAGT
TTGGTGAATCCAAATACAGTTTTATGCGCCTGATTAATTTGATGTACGACCTGGTGACCT
GCCTTACCACAACGCCGCTACGTATGCTGAGTCTGCTCGGCAGCATTATTGCGATTGGAG
GTTTTAGCATTGCGGTGCTGCTGGTGATTTTACGCCTGACCTTCGGACCACAATGGGCGG
CAGAAGGCGTCTTTATGCTATTTGCCGTGCTGTTTACTTTTATTGGCGCTCAGTTTATCG
GCATGGGATTACTCGGTGAATATATCGGCAGGATCTACACCGATGTCCGCGCCCGCCCCC
GCTATTTTGTTCAGCAAGTTATCCGTCCATCCAGCAAGGAAAATGAATAATGAAAACCGT
CGTTTTTGCCTACCACGATATGGGATGCCTCGGTATTGAAGCCCTGCTGGCTGCCGGTTA
CGAAATTAGCGCCATTTTTACCCATACTGATAATCCCGGTGAAAAAGCCTTTTATGGTTC
GGTGGCTCGTCTGGCGGCGGAAAGAGGCATTCCGGTTTATGCGCCGGATAACGTTAATCA
TCCGCTGTGGGTGGAACGCATTGCCCAACTGTCGCCAGATGTGATTTTCTCTTTTTATTA
TCGCCATCTTATTTACGACGAAATTTTGCAGCTCGCTCCCGCAGGTGCATTTAATCTGCA
TGGTTCGCTGTTACCAAAATATCGTGGTCGCGCGCCGCTGAACTGGGTGCTGGTCAACGG
TGAAACGGAAACTGGCGTTACATTGCACCGAATGGTGAAACGTGCCGATGCCGGGGCCAT
TGTGGCGCAACTGCGCATTGCCATTGCGCCAGACGATATCGCTATTACGCTGCATCATAA
ATTGTGCCATGCCGCGCGCCAGCTACTGGAACAGACATTACCCGCCATTAAACACGGTAA
TATTCTGGAAATCGCCCAGCGCGAAAACGAAGCCACCTGTTTTGGTCGCAGAACGCCGGA
TGACAGTTTCCTTGAATGGCATAAACCGGCATCCGTACTGCACAACATGGTACGTGCCGT
TGCCGATCCGTGGCCGGGTGCCTTCAGCTATGTTGGCAATCAGAAATTCACCGTCTGGTC
GTCGCGTGTTCATCCTCATGCCAGCAAAGCACAGCCGGGGAGCGTGATTTCTGTTGCGCC
ACTGCTGATTGCCTGTGGCGATGGCGCGCTGGAAATCGTCACCGGACAGGCGGGCGACGG
CATTACTATGCAGGGCTCGCAATTAGCGCAGACGCTGGGCCTGGTGCAAGGTTCACGCTT
GAATAGCCAGCCTGCCTGCACCGCCCGACGCCGTACCCGGGTACTCATCCTCGGGGTGAA
TGGCTTTATTGGCAACCATCTGACAGAACGCCTGCTGCGCGAAGATCATTATGAAGTTTA
CGGTCTGGATATTGGCAGCGATGCGATAAGCCGTTTTCTGAATCATCCGCATTTTCACTT
TGTTGAAGGCGATATCAGTATTCATTCCGAATGGATTGAGTATCATGTCAAAAAATGTGA
TGTCGTCTTGCCGCTGGTGGCGATAGCCACGCCGATTGAATATACCCGCAACCCGCTGCG
CGTATTTGAACTCGATTTTGAAGAGAATCTGCGCATTATCCGCTACTGCGTGAAGTACCG
TAAGCGAATCATCTTCCCGTCAACTTCAGAAGTTTATGGGATGTGTAGCGATAAATACTT
CGATGAGGACCATTCTAATTTAATCGTCGGCCCGGTGAATAAACCACGCTGGATTTATTC
GGTATCAAAACAATTACTTGATCGGGTGATCTGGGCCTATGGCGAAAAAGAGGGTTTACA
GTTCACCCTCTTCCGCCCGTTTAACTGGATGGGACCACGACTGGATAACCTTAATGCAGC
GCGAATTGGCAGCTCCCGCGCTATTACGCAACTCATTCTCAATCTGGTAGAAGGTTCACC
GATTAAGCTGATTGATGGCGGAAAACAAAAACGCTGCTTTACTGATATTCGCGATGGTAT
CGAGGCGTTATACCGCATTATCGAAAATGCGGGAAATCGCTGCGACGGTGAAATTATCAA
CATTGGCAATCCTGAGAACGAAGCGAGCATTGAGGAACTGGGCGAGATGCTGCTGGCGAG
CTTCGAAAAACATCCGCTGCGCCATCATTTCCCACCGTTTGCGGGCTTTCGCGTTGTCGA
AAGTAGCAGCTACTACGGCAAAGGATATCAGGACGTAGAGCATCGTAAACCGAGCATCCG
CAATGCCCACCGCTGCCTGGACTGGGAGCCGAAAATTGATATGCAGGAAACCATCGACGA
AACGCTGGATTTCTTCCTGCGCACCGTTGATCTTACGGATAAACCATCATGACCAAAGTA
GGCTTACGCATTGATGTCGATACCTTTCGTGGCACCCGTGAAGGCGTGCCGCGTCTGCTG
GAAATCTTGAGTAAGCATAATATTCAGGCCAGCATTTTTTTCAGCGTCGGCCCGGACAAT
ATGGGCCGCCATCTCTGGCGACTGGTGAAGCCACAGTTTTTGTGGAAGATGCTGCGCTCA
AACGCGGCATCGCTTTATGGCTGGGATATTTTACTGGCAGGTACGGCCTGGCCAGGTAAA
GAGATTGGTCATGCCAATGCCGATATCATTCGTGAAGCGGCTAAACATCACGAAGTCGGC
CTGCACGCCTGGGATCACCATGCCTGGCAAGCCCGTAGCGGTAACTGGGATCGGCAAACA
ATGATCGACGATATTGCACGCGGTCTTCGCACTCTGGAAGAGATTATCGGTCAACCGGTA
ACCTGTTCTGCCGCTGCGGGCTGGCGTGCCGACCAGAAGGTGATCGAAGCAAAAGAAGCG
TTCCATTTGCGCTACAACAGCGATTGTCGTGGGGCCATGCCGTTCCGTCCATTGCTCGAA
TCAGGAAACCCTGGCACTGCGCAAATTCCGGTGACCTTACCCACCTGGGATGAAGTGATT
GGTCGGGATGTGAAAGCAGAAGATTTTAACGGTTGGTTACTCAACCGCATCCTGCGAGAT
AAAGGCACGCCGGTTTATACCATTCATGCAGAAGTTGAAGGCTGCGCTTATCAGCATAAT
TTTGTGGATCTCCTCAAACGCGCAGCTCAGGAAGGCGTGACATTTTGCCCTTTAAGCGAA
CTGTTATCAGAGACGTTGCCGCTCGGACAAGTTGTTCGCGGAAATATTGCCGGACGTGAA
GGCTGGCTGGGTTGCCAACAAATTGCGGGTAGTCGCTGATGAAATCGGTACGTTACCTTA
TCGGCCTCTTCGCGTTTATTGCCTGCTATTACCTGTTACCGATCAGCACGCGTCTGCTCT
GGCAACCCGATGAAACGCGTTATGCGGAAATCAGTCGAGAAATGCTGGCATCCGGCGACT
GGATTGTGCCCCATCTGTTAGGGCTACGTTATTTCGAAAAACCCATTGCCGGATACTGGA
TTAACAGCATTGGGCAATGGCTATTTGGCGCGAATAACTTTGGTGTGCGGGCAGGCGTTA
TCTTTGCGACCCTGTTAACTGCCGCGCTGGTGACCTGGTTTACTCTGCGCTTATGGCGCG
ATAAACGTCTGGCTCTACTCGCCACAGTAATTTATCTCTCATTGTTTATTGTCTATGCCA
TCGGCACTTATGCCGTGCTCGATCCGTTTATTGCATTCTGGCTGGTGGCGGGAATGTGCA
GCTTCTGGCTGGCAATGCAGGCACAGACGTGGAAAGGCAAAAGCGCAGGATTTTTACTGC
TGGGAATCACCTGCGGCATGGGGGTGATGACCAAAGGTTTTCTCGCCCTTGCCGTGCCGG
TATTAAGCGTGCTGCCATGGGTAGCGACGCAAAAACGCTGGAAAGATCTCTTTATTTACG
GCTGGCTGGCGGTTATCAGTTGCGTACTGACGGTTCTCCCTTGGGGACTGGCGATAGCGC
AGCGGGAGCCTAACTTCTGGCACTATTTTTTCTGGGTTGAGCATATTCAACGCTTTGCAC
TGGATGATGCCCAACATAGAGCTCCGTTCTGGTACTACGTGCCGGTCATCATTGCCGGTA
GCCTGCCGTGGCTGGGATTACTCCCCGGTGCACTGTACACAGGCTGGAAAAACCGCAAGC
ATTCCGCAACCGTCTATTTGTTGAGCTGGACGATAATGCCGCTGCTGTTTTTCTCCGTCG
CTAAAGGTAAATTGCCCACCTATATTCTTTCCTGCTTTGCATCTCTGGCAATGCTGATGG
CGCATTACGCTTTGCTGGCAGCAAAAAATAATCCTCTGGCGCTGCGGATTAATGGCTGGA
TTAACATCGCTTTTGGCGTCACTGGCATTATTGCCACATTTGTGGTCTCCCCGTGGGGAC
CAATGAACACGCCGGTGTGGCAAACCTTCGAGAGCTATAAAGTCTTTTGTGCCTGGTCGA
TTTTTTCGCTATGGGCATTTTTCGGCTGGTACACCTTAACAAACGTCGAAAAGACCTGGC
CTTTTGCCGCGCTTTGCCCGCTGGGGCTGGCGTTGCTGGTAGGATTTTCAATTCCTGACA
GAGTTATGGAAGGAAAACATCCGCAATTTTTTGTCGAGATGACACAAGAATCACTTCAGC
CAAGCCGCTATATTCTTACTGATAGCGTCGGTGTTGCCGCAGGTCTGGCATGGAGCCTGC
AACGCGATGACATCATCATGTATCGCCAGACAGGTGAGTTGAAATACGGCCTTAATTATC
CGGATGCGAAAGGGAGATTTGTCAGCGGTGATGAGTTCGCAAACTGGCTTAATCAACATC
GTCAGGAGGGGATTATTACTCTCGTGCTTTCGGTTGACCGCGATGAAGATATCAACAGTC
TCGCCATTCCGCCCGCAGATGCCATCGATCGTCAGGAGCGTCTGGTGCTGATTCAGTATC
GTCCCAAATGATCTGGCTAACATTAGTCTTTGCCAGCTTGCTTAGCGTTGCCGGGCAGTT
GTGTCAGAAACAGGCAACCTGCTTTGTGGCGATAAACAAACGGCGCAAACATATCGTGCT
GTGGCTGGGACTGGCGCTGGCTTGTCTTGGTCTTGCCATGGTGCTCTGGCTGCTGGTCTT
GCAGAACGTACCGGTAGGCATTGCTTACCCGATGTTAAGTCTGAATTTTGTCTGGGTGAC
GCTGGCTGCAGTAAAACTGTGGCACGAACCGGTATCGCCGCGTCACTGGTGTGGGGTGGC
GTTCATTATTGGCGGCATTGTGATCCTCGGGAGTACGGTGTAATGGGCCTGATGTGGGGA
TTATTCAGCGTCATTATTGCCTCAGTTGCGCAATTAAGCCTGGGTTTTGCGGCGAGTCAT
CTGCCGCCGATGACGCACTTATGGGATTTTATCGCGGCTCTGTTAGCTTTTGGCCTGGAT
GCCCGGATACTGTTACTCGGGCTGCTGGGTTATCTGCTTTCCGTTTTTTGTTGGTATAAA
ACGCTTCATAAACTTGCGCTAAGCAAAGCCTATGCCTTGCTCAGTATGAGTTATGTGCTG
GTATGGATTGCTTCAATGGTACTTCCCGGCTGGGAAGGGACTTTTTCGCTGAAAGCACTA
CTGGGAGTAGCCTGTATTATGAGCGGGTTGATGCTGATTTTCCTGCCCACGACAAAACAA
CGTTACTGAGTTTTCCCTGCCACTTTACACTGCCGTTCCCACTCATCGGGGCTATAACTG
CTTGCCGAGAGGACTTTCACCGTATGCAGCTTTTCACGATTAATACAATAAAGCGCATTC
TGCAAAGGCGAGAGTAAATCCCCCACTTTCACGGCGAAGTCACTCTTCACTTCGGCGATC
ATTTTTATCGCGCCGCCAGCATCGCAGAGCATAAGTACATGTCTGTTATCTTGTTTATTG
CAGCACGATTTTTTGACCAGCCATTCCATTGCATTATCCTGTTTGCTAAGAGTTTTCACA
TCAATTTACAGATTAACAGATAAACTCTTTATCAACGGCAATGGAATGGCAGAAATGAGA
AGTGAAACGGAGGGTTAATTATTGCTGACGTTGCACCCACTCTTTTAGCGCCTGACGTGA
AATTTTAATACCGCCGTTTTTCAGCTCCGGCGGCAGAGTTAGCCAGCGCACCGGTTGTTG
AAAACGGGCCAGCTTATCTTTCACCCATTCACTAAGATCAACGCTCTCGTGGTCATACTC
CATCACCGCCACCGGTCGATGACCAAACTCCTTGTCGGCAACGGGGACGATAAACACCTG
CAAAACCGCAGGATGTGCAGCAATTACGCGCTCGACTTCTTCCGGCTGAATACCCTCTCC
GCCACTGAAGAATAGATTGTCTAAACGTCCGACAATGGTCAGCTTGCCATTATGCATCTC
ACCGCGATCGCGCGTAGCGTACCAGCCTTCGTCATTAACCAGTGAAACCAGTTGCCCGTT
ACGCCAGTAACCTTCTGCCATACTGGCAGCCCGCAGCCACACTTCATTATTAACGATTTT
CACTTCCCGACCCGGCAGCGGCGAACCAACGTCTGCCAGGCCGTCGGCTTCTTTCGCACA
CACCGTGGAGGCAAACTCGGTCAGACCATAGCCGCAAAAGCAACGAATCCCCTGCTCGCG
CGCCTGTTCCGTCAACTCGACCGGGATAGCCGCGCCGCCAAGTAACACCGCTTTCAGGGA
AACGGAACTACGGTTAACCAGCAAACGCCAGAGTTGTGTTGGCACCAGTGAAGCGTGAGT
ACAGCCTGCCAGCATTTGCTCCAATGGCTGTTTATCACGTACCGTCATCCGCGCACCAGC
GTATAACCAGCGCCACATAATTCCCTGACCGGAGACGTGAAACAGCGGTAAAGAGAGCAA
CCAATCATCGTGATCGCCAAACGGAATCAGCGATAACACACCTTGCGCACTGGCAAGATG
GGCCTGATAAGTATGGACAGCGGCTTTCGGCAAACCGGTAGAACCCGAGGTCAACGTCAT
TGAGCACAGACGCGTCGGCTGCCACGTAGCGGCATGTGCGCCTTCAACCAGCTGAATGTG
CAGCGACGTTAATGCCGGAAACGTGTTTTCCCCATCCGGCACCAGAGCAAATTGCAGCGT
CAGATTGGGCAGCAATTCTTCAAGCAACGGTTGCGGCAGCTGAGGGTTCACGGGCAACAC
CCGCGCCCCGCATTGCAGTAACGCCAGCCAGGCGAGCAGCGTTTGCGGCGTATTCCACGC
CCGCAACATCACGCCGCTGCCCTCAACCACCCCCTGCACCGCAAATCCGGAGGCTAATTC
ATCGACGCGAGCACAAAGCTCGCGCCAGTTGAGTTGCTCGTCATTAAGACGTAAGGCGAT
GGTTTCTCCCCGCACTTGCCGCCAGTGACGCCACGGCCAGTCAGAGAAGATCATAACAAC
CGCTCCAGTGCATCAACTTCCACGACAGGCAGCGTGCTACCCGGCCAGCGACGTACCTGC
TGCGCCTGCATCAGATCCAGCGTGTCCAGCCCTGGAATGGTGTCCGGCGTTAACCAGGCG
GCAATCCGCGCCAGTTGCGTTAAGCCTAAGCTCGATTCAATGGAAGAACTGATCACCGCC
GTCAGCCCCAGCGCGTGCGCCGCCTGTACCTGCTCGCGTACTTTTTCCAGACTGCCCGTG
AGCGTGGGTTTGATAACTACCGCGCGCACGCCCTCTTCAGCCACAAAGGCAAAATCCGGC
TCGCGCAGGCTTTCATCCCAGGCAATGGCAATGCCGGTTTCACGGGCAAACGCTCGCGAA
TCATCGCGGGTTTTGCACGGCTCTTCGAGAAACGCGATGCGGTCGCGATAATCCGGGTTA
ACGTATTTGGCAAACTGCTGACCTTTCAGCGGTGTCCAGGCGCGATTTGCGTCAAGACGC
AAATGCAGATCCGGAATTGCCTCCAGCAACAGATTCACCACCATGCCGTCGCGCACCGCT
TCGTACAATCCCACTTTGACCTTCGCCACTTTCTCGCCTGGCATATCTGCAAGTTTGAGG
ATCAGATCGTCCGGATCGCCATTACACAGCGGTGCCGCACGGTAGTTGGCTGCTTGCGGC
AACGTATCTGTCAGTTCTGCCAATGCACAGCTTACGCCAAAGGCCACGGAAGGCATCTGC
GGTAGCTCGCAATCGCCTGCCAGCCAGTTATTTACCCAGGCAAGCAGCACACTTTGCGCC
TCTTCCCAGGTTTCCTGACTGAAGCCCGGCAGTGGGGAGATCTCCCCCCACCCTTCGCGC
TCGCCTTCACGCAGGCAAACATACAGCCCGTCGCGGGTTTTTAACCGCCTGTCGCGCAGA
ACCACCCCCGCGTCCATGGGGATCTGCCAGCGGTATACCTGCGCGCTACGCATTACGGAT
TCCGTTTGAATTTGCTGAAGTCAGGCTGACGTTTCTGGTTGAAGGCGTTGCGACCTTCCT
GACCTTCTTCCGTCATGTAGAACAGCATGGTGGCGTTGCCCGCCAGCTCCTGCAGCCCCG
CCTGCCCGTCACAGTCGGCGTTCAGTGCAGCTTTCAGGCAGCGCAGCGCCATCGGGCTGT
TTTGCAGCATTTCGCGGCACCAACGGACGGTTTCTTTTTCCAGATCCGCCAGCGGTACCA
CGGTGTTCACAAGGCCCATATCCAGCGCCTGTTTTGCGTCGTACTGACGGCACAGGAACC
AGATTTCACGCGCTTTTTTCTGCCCGACGATGCGAGCCATGTAGGAAGCGCCCCAGCCGC
CGTCGAAGGAACCGACTTTCGGGCCAGTCTGACCGAAGATGGCATTATCTGCCGCGATAG
TCAGGTCGCACATCATGTGCAGAACGTGACCGCCGCCGATGGAGTAGCCAGCCACCATCG
CGACAACCGGTTTCGGACAGGTACGGATCTGACGCTGGAAGTCCAGCACATTCAGGTGAT
GTACGCCGGAATCATCTTTATAGCCGCCGTAATCACCACGCACTTTCTGGTCACCACCGG
AGCAGAACGCTTTATCGCCTGCACCAGTCAGAATGATCACGCCGATGTTGTCGTCATAAC
GCGCATCTGCCAGCGCCTGGATCATCTCTTTTACCGTCAGAGGACGGAAGGCATTGCGCA
CCTGCGGACGATTAATGGTGATTTTTGCGATACCGTCGGTGGATTTTTCATAACGAATGT
CCTCGAAACCTTCGGAGCAGTCGTGCCATTCAACCGGTGCGTAAAGCATTGCTTCATCAG
GATAAATCATATTGTGTCCTTTAGTCAGAAACGCAAGATCTGCGCCAGACTTGCGATTAC
GCCAGCGGGATTTTCCCGATGCGCGTTATGTCCGGCGCGAGGAATGACATGGCAGTCGGC
AGCCAGTTCCGCCGCCAGGGCGCGGAATTTGCTGTCACGTTCACCACATAAATAATAAAA
CGCAAATGTGCGGGCGCTAAGGTTAGCACGTAAATCAGGCTGGACGGCGAGAGAAGTCGC
CTCCAGCATGGCGGCAAGCGTTGCGCCATTATTGTTGCTGCGCAGCGCCACCAGCTCCCG
GCGTTGATCGTCATTGAGTGAGGCAAAAACAGGCTGTTGATACCAGTCGGCAAATACCGC
CGTTAACGGTTCTGTGAGAAAACGCTGCACCCATTGGCGATCGGAACGCTGACGTTCCGC
ACGTTGTTCAGCATTTTGCAGCCCCGGATGCCCGCCTTCGACAATAACCCCACAAAGCCC
CGCCAGCCCCTGGCAAGCCGCCATCATCGCCACCCGTCCACCAAGCGAGTACCCCACCAG
CCAGAAGTCAAGGATGTTGTAACTAACCAAGGTTTTACGCAGTAAGTCGGTGACATCATC
AAATCCATCGACGCTAATCGCCGCCGAACCACCGTGACCTGGGAGATCAACATACAACCG
TGAGTAGTCGGCAAACGCCTCGCCCACTTCTTGCCATTCGTGGCAATCGCCGGAAAAACC
GTGCAAAAACACCAGCCAGGGTAAACCTGGTTTTCCGTGTTTTGCCTGCGCGTGCAGGAT
CATAAATGGCTTACCTGCGCCAGAAGTTGCTGGAGCGTTTGCGCACCATCGGTGTCGTTA
ACCACCATTTCAATCACCGTGGTGGTTGGCGTGCGCCAGGCGTCGGCAAATGCCGTTTCA
AGTTCCTGCCAGTTTTGCGGACGATGATATTTCAGCTCGAACATCGCGGCGGCGTGCTCA
AAATGGACGTTTTGCGGCATCAGATAGAAACGCTCACGCTCGCTTTGCGGCGTTGGCAAC
AGCGAGAAAATTTGCCCGCCGTTGTTGTTCACCACAATTAATACCAGCGGCGCAGAAACC
TGACGCAATAACGCCAGCGCGTTGAGATCGTAAAGTGCGGAGAGATCGCCCACAATCGCC
AGCGTCGGTTTGCCGCTTGCCCGCTGAACGCCGGCGGCGGTCGAAAGCAGCCCGTCGATA
CCGCTGGCCCCACGGTTGCTGTACACCGGGTAACCTGCCGGAAGTTGCGAAAGCGCATCA
ATCAGACGTACCACCAGGCTGTTACCAACAAACAATTGCCCCTGTTCAGGCAGATAGTCG
CAGATGCGATGCGCCAGTTGCGCTTCGCCAAACGCATCACGGCGGGCAATAACCGCCTGC
ATTGCCTGTTCCGCCAGGCGCGGGATTTCAACGCACCAGGGCTGGCGTTTTTCTGCCGGA
TGCAGCTCCAGCCAGTCGGCAATATTGGCAATTAAGCGACGTCCGCGATGGTGTGCCGGA
TCAAGTCGCCCTTCAATGTCATCAACAATCCAGTACTCTTCTGGTTCACAGCTTGCCTGC
CATTGCAGGAGCCGTTTCCCCGTCAGGCTGCTTCCCAGTTGCACCACAATTTGCGCCTGC
TGCAGCTCGCTGGTCGCTTTGGCATTGCCTAACCAAAGATCGGCACACGGCAGCGGCTGC
CCGGTTTGTGACAGCACATCGCCAATCAGCGGCCAGCCAAGAGTTTGCGCCCACAGGGCA
ACTTTTTTGCCCTCTTCCGCACTCATGCGCCCGGCAACCACCACGCCGCGCTTTTGTCGC
CAGAAGAACCAGTCGCGCTGTTTTTCACTTTCCAGACGAGGCGCTTCACGCAGCCACGGT
TTGTCGTCCTGCCACCAGTCACCCAGACGCTGTTGCCAGCTAAGCCCGGTATCGTCCATT
TCGCCATACAGCGGTTCAGCAAACGGGCAGTTGATATGGACTCCCCCCGCATGAAGCGTA
CCGAGAGCGTGGTCGATGGTAGAAACCAGCCAACGTGCGGGGATATCCTGGGTCGGGCGC
GGCAATGAAATACTGTGCGTGGGGTGAGAGGCGAACATTCCCGGCTGGCGAATTGCCTGA
TTCGCGCCGCAGTCAATTAGCTCCGGCGGGCGATCGGCGGTTAAGAGAATCAGTTTTTCT
CCGGTTAACCCGGCTTCAATCAGTGCCGGATAGAGATTTGCCACCGCCGTGCCGGAGGTC
ACAATCACCGCCACCGGCTGCTTGCTGACTTTCGCCAGCCCCAGCGCCAGATGCCCCAAC
CCACGCTCATCGAAATGGGTGTGGTGAATGAATGCGGAATTCTCCGCCGCCGCTAACGTT
AACGGTGTAGAACGCGAGCCTGGGGCGATACAGATGTGTCTGACGCCGTGACGCGTTAAT
GCTTCCAGAATGACCGCCGCCCAGCGTCGGTTAAATGCGCTTACTGACATGAGTTTGTCC
GGTATCAATATTGCGGCTAAGTATAAGGAGCTACAAAAATAGATTATTGATATGAATCGG
TAATGATGCGACTCATTACTATTCCATTTGTAATAAAGTACGCAGCCCTGCCGCTTTGTT
GTCGATTTCCTGCCACTCTTGCTCGGGGTCGGAACCACGGACAATGCCCGCGCCAGCATA
TAATCGCACGACATTGCCGCTAATTTTTGCTGAGCGCAGGGAAACGCAGAATTCGCTTTG
TTGTAATGAGAGATAGCCCGCAGAACCGGCGTACCATTCTCGGGTGAACGGTTCGTGACG
GGCGATAAACTGTCGCGCCAGATCGCGCGGTAAGCCAGCAACTGCTGCCGTTGGCTGCAA
CTGATGTAAACAGATCACATCATCCGCTTTGTTGAGTGAAGTCCAGATACAGCGGCGAAG
ATGCTGCACTTTACGCAGACGCAGTACCTGCGGCGGTAAAACATCCAGCGTCTGGGTATC
GGCCTGTAATCGTTGACAGATATCTTCCACCACCAGCATGTTCTCGCGCTGGTTTTTATC
ATCCGCCATCAGCCACTCTCCTAACTGCTGCGCCTGCTTATCATCAGGATTATTTGCTAC
TGTTCCCGCCAGCGCTTCAGTACGCAGCGCTTTGTCACGCCGCCGCCATAACCGTTCCGG
TGAAGAGCCAAGAAAAGCATTTTCGCCATCAAAGGCCATGTAAAAATGGTAGCAATTCAG
ATTCAGTCGACGACTGGCAGCCATCATCGCCGCCGCGTTGACCGGACTTGCGAAATGCAG
GTCAGTTGCCCGAGCGAGCACCACTTTGTCGAGCTCACCTTCGGCGATGGTTTTCGTTGC
CAGTTCGATTAATTGCGTCCAGCCCGTTTTGTCCGGCCAGTGTTGTTCTCGCGTGGTGGT
TAAATGTAACCCAGGCAAGGGCTTGATACTCACCAGTGTGGCGATAAATTCTTTTGCCTG
AATCGCATCGTGCTGAAGGGAGCTTTCGCTGAATAGCGTCAGCCGCAGCGTGGCTTTACC
GCCACAGCGTCGCCATTCCAGGCGGGGTAAAAGTAAATTGCCCTGCGACGGGTCAAAAGC
ATTCAGCCCCCAAATGCGTAAGTCGGCGTGTTCCGGGTGCTGGCGAAGAAAACGTTGTGC
CTGGTCCAACGACGTAAAACGGGTAATCGCGCCCAGGACGACAGCTTCTTCATCACCATT
ACGTTGTTGCCAGTAGAATTGCGGGTATGTTTGCTGACTGGCCAGCCAGCTCAAGGCATC
AAAAGCGTCTTTGAGAGGGAAAGGAATATCGATAACCCGAATGCCGGGTGTCGCCGGAAT
CTCTTGCGACAAATGGCGCAGTAGATTTTCCAGCGCCGTAGTAAGTGATTGCACGCGGAC
CTCTCCCTGTTAAAAGCCTCACATTATACGGGGTACTACAAAAAAAATGCAGTACCCCGG
TGTAGGGAGGTTTTAACGGCGTGCCAGCAACAGTCCTAGTACCAGCCCAACGGCCGCGCC
CACACCAATTCCTTGCCAGGGTTTTTCGTGGACGTAGTCATCAGCACGATAAACTGCCTG
CTTCGCCCGATAGTAATAACTGTCTGAAGCCTGGCTAACCCGTTTTTTCACATCATCCAG
CGCTTTTTCTGCACGCGCTTTCAGCTCAACATATTTCTGATCGGCGGGATCGCCAGAGGA
GCGGAGCACCTCTTCCAGTGTTTCACTAAGCAGCGTCAGGTCGTCATCGATACGTGTATC
ACCAAACTGATTAGACATTCTCGTTCTCCATTTGCGTAAAACCTGTCACTAACTATAGAC
AAGGGTTGTTGATTACGCCTGAATTACCTCGCGTGCCATCCCAATGTGTGGGATACCATC
TTCTTCATAGACCTCCGTCACAGGGATAAAACCGAAACTCTGGTAGAAGTTTTGCAGATG
CGCCTGCGCCCCGAGGTAAACAGGCTTATCAGGCCAGTGATGCGTACATGTTTCGAGTGT
TTTACTCATCAGCTGCTGCCCCACTTTTTCGCCACGCAACGCTTCACTGACAATCACCCG
ACCTATAACGACCGGCTCAAGATCATCATCACTTTTCAGAATCCTCGCATACGCCACCAG
TTCATCATTTTTCCAACCGAGAATATGGCGATTATCCCCCGTCAAATCATCACCATCGAT
ATCCTGATAAGGGCAATTCTGCTCGACAACAAACACCGCGCAACGCAGTTGTAATAAGGC
ATAAAGCTGGGAAACCGATAATTCAGAGTGATGCAGATCTTGCCATTCAATCATAATGCT
CTCCTTTTAGATGTATGCCTTATACTAGCCGGAATATTTTTTGAAACGTGATGAACTCAT
GGAATTAATTTTTTTAGGTACTTCAGCCGGTGTGCCAACCCGCACGCGCAATGTCACGGC
AATATTGCTTAACCTGCAACATCCGACCCAGAGCGGACTTTGGTTGTTTGACTGCGGTGA
AGGCACCCAGCATCAGCTACTGCATACCGCCTTTAACCCTGGAAAACTGGACAAGATTTT
TATCAGTCACCTTCATGGCGATCATCTTTTTGGTTTACCCGGCTTGCTGTGCAGTCGTTC
TATGTCAGGCATTATCCAACCCTTAACGATTTATGGTCCGCAAGGTATCCGTGAATTTGT
GGAAACCGCGCTGCGGATTAGCGGCTCATGGACCGATTATCCGCTGGAAATTGTCGAAAT
TGGCGCTGGCGAAATTCTCGATGATGGCCTGCGCAAAGTAACCGCTTATCCGCTGGAACA
CCCACTGGAATGTTATGGCTATCGTATTGAAGAACATGATAAACCGGGTGCATTAAATGC
CCAGGCATTAAAAGCTGCTGGCGTGCCGCCTGGCCCACTGTTTCAGGAATTAAAAGCGGG
CAAAACAATCACGCTGGAAGATGGAAGGCAGATTAACGGCGCAGATTACTTAGCTGCTCC
AGTGCCAGGTAAAGCGCTCGCTATTTTCGGCGATACCGGCCCCTGCGATGCCGCACTTGA
CCTGGCTAAAGGTGTCGATGTCATGGTGCACGAAGCGACGCTGGATATAACCATGGAAGC
CAAAGCCAATAGTCGCGGCCATAGCTCTACACGCCAGGCTGCGACACTAGCCCGTGAGGC
TGGAGTCGGCAAGCTAATCATTACCCACGTCAGCTCGCGCTATGATGACAAAGGTTGTCA
GCACCTGTTACGTGAATGCAGGTCAATTTTCCCGGCGACTGAACTGGCGAATGATTTCAC
CGTGTTTAACGTTTAACTCTGCTTATTATTAAAAACAGGGCGAAACTTGCCCTGTTATCG
CAACCCGCGCTACATATATCCACCCACACAGGCATATTGAGCGATTTTTGATATTTATTC
ATCTCCTTACGCACTATATTCAGAGCAATAAGTTGCCTCTTTTCATCTTGATTCAGCACA
ACCTTTGCAACTAAAAGGAGCCCATGATGGTTACAGTTGTCAGCAATTATTGTCAATTAT
CTCAAACGCAACTCAGTCAGACATTTGCAGAAAAATTTACTGTGACCGAGGAATTACTGC
AGTCTTTAAAAAAAACAGCGTTATCCGGAGATGAAGAAAGCATTGAGTTACTGCATAATA
TTGCGTTAGGTTATGATAAATTTGGGAAAGAAGCTGAAGATATTCTTTACCATATTGTTA
GAACCCCAACAAATGAGACCCTATCGATTATCCGACTTATCAAAAATGCTTGTTTAAAAT
TATATAATCTGGCACATATCGCAACCAACTCCCCCCTCAAATCACATGATTCAGATGATC
TCCTGTTCAAAAAACTATTCTCCCCTTCGAAATTAATGACAATTATCGGTGATGAAATTC
CTCTTATATCTGAAAAACAGTCGCTTTCAAAGGTGCTTTTAAATGATGAGAATAATGAAC
TGAGTGATGGTACAAACTTCTGGGATAAAAATCGTCAATTAACCACAGATGAAATAGCTT
GCTATCTTCAGAAGATCGCCGCTAATGCAAAAAATACTCAAGTCAATTATCCTACTGGTC
TCTACGTCCCCTACTCCACCAGAACTCACCTGGAAGACGCTCTCAATGAAAATATTAAGA
GCGATCCATCATGGCCGAATGAAGTCCAGTTATTCCCCATAAATACTGGCGGACACTGGA
TATTAGTTTCGCTACAGAAAATAGTAAATAAAAAAAATAATAAACTACAAATAAAATGCG
TCATATTCAACTCATTGCGTGCACTAGGCTATGATAAAGAAAATTCACTTAAGCGTGTCA
TTAATAGTTTTAATTCTGAACTCATGGGAGAAATGTCGAATAATAATATAAAAGTTCATT
TAAATGAACCAGAGATAATATTTTTACATGCCGATCTTCAGCAATACTTAAGCCAAAGTT
GCGGTGCATTTGTGTGCATGGCAGCCCAGGAAGTGATTGAACAAAGGGAAAGCAATTCTG
ACAGCGCCCCCTATACGTTATTAAAAAACCATGCTGACAGATTTAAAAAATATTCAGCAG
AAGAGCAGTACGAAATTGATTTTCAACATCGACTGGCAAACAGAAATTGTTATTTAGATA
AATATGGCGATGCAAATATCAATCATTATTATAGAAACTTAGAAATAAAACACTCACAAC
CCAAAAATAGAGCATCCGGCAAAAGAGTGAGTTAACATCATTGTTAATTAATTCGACCAG
TCAGCAAATATGCTGACTGGTCGAACATAGTTTGCTAAACAGTCATCACTGACTGATGTC
AGTCACACCATCCGCCAGTTCAATCAGGCGAATAAATTCCGCCCTGTAACCCTGTGGATC
TTCCCCTTTTGCCTGCTGAGCCCACTGTTTGATCTGCTGCCAGGAGGTATTGTTCAGGTA
TTCAGAACCGCGTAACTTTTGCCCATATGCAGCTACTGCTGCGCGAAAACGCATATCTTC
AGAGGGCGCGTTTATTGTTGGCCCCAGCGGGAATTCAACTAACTGACTTTCTTTTCCCTG
CGGGTATTTCCAGCGAATTTTTAACCAGGCCAGTTCTTTCGTTTTGTCCGATTTCGCTAA
TTTGTTATCCGGGGCATAGCGTAACTTATCAATTGATGCTTTTTGCCCGTTCAGCGTTAA
TTCGAATAACAACGTTATATGTTTGCCTGCGCCTATATCCCCTGCATCAACGTTGTCGTT
ATTAAAATGTTCCACCCGAAGTTGGCGCTTTTCATAACCAATCTGACGGTATTCCGTTAC
CCACGCGGGGTTAAACTCAATTTGCGCTTTGACATCTTTTGCTACGGTAATCAACATCTG
CCGCATTTCACTATTCAATACTTTCTGCGCTTCAGAGAGGGTATCAATGTAGCTGTAGTT
GCCGTTACCAACATCGGCAATTCGCACCATCATTGCCTCGTTGTAATTGCTATTCCCCAC
GCCAAACGTCGACAGAGTAACACCAGACTCCCGCTGTTTTTTGACCATTGATTCAATCGA
TTTTGGATCGTCAATGCCAACGTTAAAGTCACCGTCAGTGGCTAATAAAATGCGATTGAT
GCCGCCCTTAATAAACCCCTTCGTCGCCTGCTGATAAGCCAGTTCCAGCCCGGCACCGCC
ATTGGTACTGCCTTCGGCATCCAGCGAATCAATTGCGGCATTAATTTCCGCCTTATGACT
CCCGGAGATAGAAGGCAATGCAATACGGGAGTCGCCAGCGTAGGTCACGATGGCAATGTT
ATCCTGCTCACGAAGTTCTTTGACCAATAATTTCAACGAAGACTGGATAAGTGGCAAACG
TTCATCAGAAATCATTGAACCAGAAGTGTCGATAAGAAAGACCAGATTAGAAGCTGGTAA
CTCTTCACTTTTGCGATCTTTCGCCAGGATATCAACTTTCAGCAATGTTCGCTGTTCATT
CCATGGTGCAGGTGCCAATTCGTAGCGCATAGCGAAAGGTATTGGCTTAGAGGCCGGAAT
AGATTGTTTGTCTTTGATATCCCAATCAGACGGGAAATAATTGACTATCTCCTCCACCCG
CACAGCGTCTGGCGGAGGTAACAGCCCTTGATTGAGGAAACGCCTTACATTCGCATAACT
GCCAGTGTCAACGTCAAGACTAAACGTCGCCAACGGATTTTGCGCTACCTGCTTAACCGG
ATTATCATCGAACTGCTGGTAGCGAGCGGTTCCTGGATTTGCGATATGTGTAGCTTTTGC
TTTAGCCGCTCTTGCAAATGTTGGCGCTTCCTGCAATCGCCCCTGTAAAGCCTGTTTGTC
TGAATATTGTTGCACTTCTTGCTGGGCCAAGGCTTTCGCGGCGGCGGCGCTTTGCTCAGC
CTCTTTTATTGCAGCTTGCTGCGCGGCAAGCACTTGCTGCTCTGTGGGAGTACTGGGTTG
TTGTTGCTGACTTTCCTTATTCTCAGGTTGCGGCCCACATCCTGACAAAATCAAACTACT
CATAAGCAACATGATTATATTTTTATTTCGCATATAAAATCCTTTTAAATAAACTCAGGC
ACCAGACATAAAATATACTCTTTGTATAATCCTGCTAATCTTAATAAAATACAATATCGA
AACCCATAGCAAATAATGATTCAACAACGCAACCCATTAATAATTTGCATATGAAAAAAA
TAATCTTTGCTTTTATTATATTATTTGTGTTTTTACTCCCTATGATTATTTTTTACCAAC
CCTGGGTCAATGCATTACCGTCAACGCCCCGACACGCAAGTCCTGAGCAATTAGAAAAAA
CAGTTCGTTATCTTACACAAACTGTGCATCCACGTAGTGCCGACAATATTGATAATCTGA
ATAGGTCCGCAGAATATATAAAAGAGGTCTTTGTCAGTAGCGGTGCCAGAGTTACCTCGC
AGGACGTCCCCATTACGGGTGGCCCCTACAAAAACATTGTTGCTGATTATGGTCCTGCCG
ATGGACCGCTGATTATTATTGGTGCGCATTATGACTCTGCCAGCAGTTATGAAAACGATC
AATTGACCTATACGCCGGGCGCGGATGATAACGCCAGCGGTGTGGCAGGATTACTCGAAC
TGGCACGTTTGTTACATCAGCAAGTACCGAAAACAGGCGTGCAGCTGGTCGCCTATGCGT
CGGAAGAACCGCCCTTCTTTCGTAGCGATGAAATGGGGAGCGCGGTGCATGCAGCTTCGC
TTGAGCGTCCAGTGAAATTAATGATAGCACTGGAGATGATTGGCTATTACGACTCTGCGC
CTGGAAGCCAGAATTACCCTTACCCGGCAATGTCCTGGCTTTATCCCGATCGGGGAGACT
TTATTGCCGTGGTCGGCAGAATACAGGATATCAACGCCGTTCGTCAGGTAAAAGCGGCAT
TGTTGTCATCTCAGGATTTATCTGTTTATTCTATGAATACCCCAGGGTTTATTCCCGGTA
TTGATTTCTCTGACCACCTGAATTATTGGCAACACGATATTCCCGCCATAATGATTACTG
ACACCGCTTTTTATCGTAATAAACAATACCACTTGCCCGGTGATACCGCAGACAGATTGA
ATTATCAGAAAATGGCTCAGGTAGTGGATGGTGTTATAACTTTGTTATACAACAGTAAAT
AATAAAAATTTCTCGAGGCGGGTCCAGAAAAAGCGACATGCACATTTTATTTTCCCTCAT
CTGTTTTAAGATGCGAAACATGAAATTCAACGGAGGAAAAATAAATGGGAATGATTGGCT
ATTTTGCAGAAATTGACTCAGAAAAGATTAACCAACTGCTTGAGTCTACTGAAAAACCTT
TGATGGATAATATACATGACACGCTTTCAGGATTACGCCGACTGGATATTGATAAACGCT
GGGATTTTTTACACTTTGGGCTGACAGGCACCTCTGCTTTTGATCCCGCGAAGAATGATC
CGCTGAGTCGTGCCGTGCTTGGTGAACACAGCCTCGAAGATGGCATAGATGGCTTCCTTG
GATTGACCTGGAATCAGGAGTTAGCCGCGACAATCGACCGACTGGAATCACTGGATCGAA
ATGAACTGCGTAAACAGTTTTCCATTAAGCGACTCAATGAAATGGAGATTTATCCGGGAG
TGACCTTTTCAGAAGAGTTAGAGGGGCAACTCTTTGCCTCGATCATGCTTGATATGGAAA
AGCTGATTAGCGCGTATCGACGTATGCTGCGACAAGGGAATCATGCGCTGACGGTTATTG
TTGGGTGATATAGCTTGATGCCTGGGGGAGAAAGACCCATTAGTTAAGATTTACGCCAGG
ATCATCTTGAAAAAATCTTTAACCATGGTCCGGTTTTTATCCCCTTGTATAAATATTACT
AAATGCTTGCTTAGTCGCATTGTTAAATGCAATACCGTATATTCGGTATGTAACAGCGAT
ATCCTCTGTGCTGGCAACGATCTGTCATGCTTGATGAAAACGGAATTGAACCTGTCATTA
CCAGGTAGATAAAAAGCCTGTTCAATTTTGGGATTATTTTTTATAACTCGTGTCTGTTAT
GGCGACACGGGAAAACATCAATATTGTCCTTCACAAATTGCAGTAATATAGAATCAACCT
CTCTTGCAAGTTGGTCACAATGTATTATAAGCATTTTGAATATGTCATCCTCTGTAATCT
CGTGAAAATTTTCGGCCTTGTCTTTTAGCTCATCATATCGGATTCTTGCAGTAACCATTT
TTTGGGCGAGTTCTAATAACCCCAAAGCTTGCAATTGCTGGTGAGTATGATCACTTTCAA
AAAATATCCCACACTCCATTCCTTCCCAACCAACATATTCATGCCATTCATAAACCAGCA
TAAATGTTTGTAAAACTGGCGGTAATAATTGGATATCTGCAAAACCAAACCAAAACTTAC
GCTTGAGATCCCACTCATATTCAATCGCCAATGCTATATTGTTTAAGGCATCTCCGGCAT
CCTTATTTTTACGCAAAATCAATTCCGTCAGTGTATAGCGTTGTTCATCAATACGCCGAA
GAGCTTCTGCAATATCATAGTTTGTAGCCAACAAAACATTCTCTGCTTCCTGATGAGTGA
CGTCTGCTTTTGCCGTCAATATATTGATTTGGTCAATATGAAACAACTTGATGGCTTCAT
CAACATCACCGCCAGTCCTCTCTAACAAACGTCTGGCAACCTGGATACCGACAGGTACGT
TCTTCCGAAGTTTACGAATTTCACTTAACCATTCCATGTCAAACCCCTTTAAATATTTAT
GATATTAAATATAACAACGTCTGGATAACGACCCGGCCTGACTGAATATCTCACGTTTTC
CTGCTTAACATTCATGTTATGATGCTCTTGAAACTAATAATACGTATGGAATTGTCACTA
TTTATCTGCTAATGAATTCAAACAATGTCATTCGTTTGATGAATATATTATTTCAGGGAA
TAATTATGACACCTTTAGAACGCATTACCCAACTTGTTAATATCAATGGTGATGTTAATA
ATCCTGATACTCCTCGTCCATTGTTATCTCTTGAGGATTTTTTTATTGACAATAATATCC
ATGGTTCAATATGTTGCAATGTGATTCCAGAACAATCTCCGCAAGCTATCTATCACCATT
TTCTGAAAATACGTGAGCGTAACAATGTTAGTGATGTTTTGGTAGAAATTACGATGTTCG
ATGACCCAGACTGGCCCTTTAGTGAAAGTATTTTAGTTATCACCACTGCTTCACCAGAAG
AAGTTCAGAGCTGGTTTGTAGAAGAAATTGCCCCTGATGAGTGCTGGGAAGGATGGTCAG
AAGATACGGAGCATGGATGGGTTGAAGTCCCTGTGGGTATGCATCCGGTTACTTGTTGGT
GGGATTAAAACATTTATATAAACAGATAAGCGGATGTTTACATAAATTTTTATGTGAAGG
AACATGATGAAACTTATTCCTCGCAGTAGTGATATTTCACCTGGCATTGATGGAATTTGC
CCGGGGCCTTTTCCTCCGAACGGATTTACCGTACTTACAGATGCAGCATATGGTAACGGA
GACTGTTTCGGTTTGTACTGGCCTATTGGTCAGGAGCATAAACTACCTATAGTGTGCGAA
ACGTACCATGACGAATGGCGAATCGTACCTGCCTTTTCCAGCATTAAGAAGTTCGAAGAA
TGGCTGGAAGTGAATGATGATGATCCCCATGAAAATGGCATCAGCATCGAAGATCAAGAC
TTTGCAGCAAATCTCTTCCGTGTTGCTCGGAAATGTCTTTCAACGGGAAGGCTTGATGAC
GCACTGCCACTGTTACAGCGAGCAACAGAACAATTGCCTGAAGTCAGCGAATATTGGTTA
GCACTGGCAATCCAGTATCGCCGATGTAAAAAAACAGAAGCTGCAGCACAGGCTGCGCTT
AATGCTTATCTTGGCAATTGGGCATTTGGTGTTCCTGACAATAAAGTCATTCATTTGCTG
TCACAGGCCGCAGATGTCCCGAATTTCCAGGATGATCCTGTGATTCAGTGCATTAAAGAA
CAAGGATTAGATCTTAGCTTTGGAGGAACAAAGGAAAATAATAATTACCCCTTGATGCAG
ATGTGTGTTGATACTTATTTTGCGCAGAGAAAACCGCTTCAGGCATTAACCCTGTTACAT
AATTATGCCTGGATAATGTCCAGTGAAACGACTGCATTTCAGGAACGCTATGATTTTAAT
ATCGATGAATGGCGGGCAAAATTCAGGCAGTTATGTTTAGAGTATTTTGGCGATAGTCGT
ACACAGTTCAC