MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 14.seq
 Deletion 14
 Length 50434
 Fasta Format

>14
CCTGTTTATTTTCTGTTATCAGAACGTCCAGACCACACCCGCCTGAGTATTCCACGGCGA
TTCTACCCCTGCGCCATTGCCATAGCTGACTGACAAATGACCGCTTAACGTCGGGGTAAA
CGATGACCTTATACCAGCCTGATAAACGCCACTGGTTCCAGCCACATCATTATTAAATTT
GCCATCGTCATTAACTTTCACCTGGTTAGAATCGGCGTATTCCTGACGCACGGCCGCTTT
CAGCCAGGGTTCCAGCGTCGTACCGTTTTGCAGGTCCATGTGATAGCTTACCGCCGTTCC
CGCTTCAGCGCGTAATATCCGGGTATTTCCCACATCCGCGCGCATGCCGTTTGATAACGT
GTAGTCCTGACCATCTGTGGTAAAGCCGGTAAAGGCCAGATAGGGTCTAACACTCCACAA
TCCGTCAACCCAACGGAACCCGCTCTCAACATGAGCACCCGCGCCGTTACTATTGTAATC
GCCAAACGCTGTTGCCCCATTACTCATCTTGCCATGGATGGTGTTGGCAAAACGGTCAAC
TTTCACCACCCCATCAACATAGGCACCGTTCTGATGCTCCCAACCGGCATAAGCCCCCAG
GGTATAGCTATCGATATTACCTTTGCCGCCGCGATCAAAACCAATATCAGAATGAGAGTA
ACCAAAGATCAAGCCGCGAATTGTACTGCTTTCTTCACGGGAGAAACGGCTATCGATACC
GAGCGTCAGGCCCGTCAATGTTTGCTCAAAACCAGCTCCCGCATCAGTGGTCACGTTGTT
GCGGGTGTTAATTGCCGAACTCCACATCGCCGTATCGTAACTAACGCCTTTTACGCTACC
AAGACGCTCACGCACGGTGTCCAGTTCTGCATCAAATACCAGCGGTTGTGCGGCCGCCAT
ATTCAGCACATCAGTGGTTGAAGGGGTAATTTGCGCGCGATTCTCTGCCAGACTCCAGCT
ATGGTTGCCATTATCCAGCAAGGTATATTCATACGTACCGATATCAACAACGCCTCCGGC
ATTGCCCAACGTAAATGCAGCATCACCGCCGCCCGTTGTTACCAGTGTAAGGCTATCTCC
TGCTGCCGGGCTGGCACCGGTGTCCGTCACGAATATTTTGAAATCACCTGTTGCCTGACC
GGTGACGTTGAGCTGATCGCTCTGATGATTAGCCATATCGGTACGCATATAAAAATTGCC
GTTTCCCGACAGGGTATTGGTGGTCAACGTAATGAAATTTTCCGCACTTGCCGTCACTGA
TGAACGAGTCACTGGCTCATCCATCATAATCACATTTGCGTCAGACATCGCAAGGTTGGC
TAAGTTGAGGAGGGTGTTTTGGTTCGTCGTAGTGATATCGGCAATGATGGTCCATACGCT
ATTTTCGAGCGAAACGTCCGCTTTGCTGGTATCCACGGCACCATGCGTTCTAAAAGAAGC
GCCCTCAGAAACCACTACCTTACCCACCAACATTGCGGGTGCATAATTTATTTGCGGCTT
CATGACCTCAAGAATGCCATCATTCCCTCTGACTGAAACGTTAACCATTGTGCCAGCCCA
GACGTTAGCGCGGCCATTGTTGATAACCATATTTTCAGAGATGGCTTTTGAGGAATACGT
GATACTTCCATTCTGATATGATCGACCGAGATCATATACCGCATTTGCCTGCACTTTCGT
ACCAGTATCCTTTCCCAGCGATTGCATAGTGGCATGCTTATCAAGGATAGTATCAATGGC
CTGCGTGTCCTCCATAACAATGAGCCCGGAACCATCATCCAGTTCATAATTTTTTGACAC
ACCATCTTTTATACTAAATTGGCCTTTACTGTTTGGACCACTCACTTCCAGCGCATTCGT
TGAGACAATTAATTTTCCGCCTGCTTTTTTATCAACGCCAGTTACAGTCCCGCCATCCAT
AACCTCCAGTAAGCCGCCACTATCTACAGTGGTATTATAAGCGAAGTCATTTTCTTCAAC
TCGCAAACTTCCGCCGTTTTCCAACAACATATTATTAGCAATACCATTCTTGATATCGAA
CTGACCGAGACGGTTTGTTCCGAATACCTCCATGGCCCGCGTGGTTGTTTTAATAGCACC
GCCTGCTTTCTGATCTACCGCAAATGCAAATCCCCCCTCTTTAACCTCCAGTAGTCCTCC
CTTTTCGATAGCGACAAAGACGGCCCCCCCATCTTTTTCAACGATTAAGCGCCCGCCTTT
AATCGTGGTATCATTCGCTGCGCCATAAACCTGTAGCACACCATTATTGAGCGTAGTCTG
GTTTGCCGCGCCACCCATTTGAACAATTTGATAACCGTCATTTAATACTGAGTATTCTGC
GGCGCCATTCATTTCAATGTACTGATACCCTCCGTTAATTTCAGTATTATTACTTACACC
AAATTCTTTTATATGCTGTTCTCCGCCAGGATTGATTTTCGTATTATTGGCGGTCCCATA
AACCAGCTGGATATCTTTTTCCAGGACAACACCATCAACTGTCTCACCATACTCAACAGT
TGATGCCAATGCTATGGGTGAATATAAGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCG
GCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTT
GAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGA
GATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAAC
ATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAAC
TGTCGCTTGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTAT
TCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCG
GGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCC
CCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGC
TGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTG
GCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGA
TGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATG
GTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTG
ATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATG
ATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAG
GCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATG
CAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGG
TAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGAC
AAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTA
AGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATAT
CAGGGACTTGTTCGCACCTTCCATAACGCTGTAGCCACCAGAACAGATATTGCGGAACGA
CAAAGAGAAACAGAACCAGATTGATGCATTGAGCTTTCATCCTATGAAATTAATTGCTGT
TAAAAGCATTGGGTACAGAAAATACCCATAGCTCCATACCCGGAGTCAGTTTTTAAAAAC
TGTTTAAAGAAATGCACAAGTATTGTGATTGATTTTTTAGTTGTTTTTCTTGATGAGAAG
CTGATGCAAAATTCCGTCTTTATAATGAAAATGATGCCAAAGCGAACGACAAGGTTGTAG
TTTTCACTACATGTCCATACATAAAATGGGGTAACATTCACGCGCCTGGTAGCGTTACCA
ACGCTACGCTCAAACATAATGATTCTAATAAAACCTCAGGAGACTACTATGCCTGAAGCA
ACACCTTTTCAGGTGATGATTGTGGATGATCATCCACTTATGCGACGCGGTGTTCGTCAG
TTACTGGAGCTTGATCCTGGCTCTGAAGTGGTCGCCGAAGCGGGCGACGGCGCGAGCGCT
ATCGATCTGGCGAATAGACTGGATATCGACGTGATCTTGCTGGATCTCAATATGAAAGGT
ATGAGTGGCCTGGATACTCTCAATGCCTTGCGCAGGGATGGCGTTACCGCGCAAATTATT
ATCCTGACCGTATCCGATGCCTCCAGCGATGTCTTTGCGCTGATAGACGCAGGCGCAGAC
GGTTATCTGTTGAAAGACAGCGACCCGGAAGTATTGCTGGAAGCGATTCGTGCCGGAGCG
AAAGGCAGCAAAGTCTTTAGCGAACGCGTCAATCAGTACTTACGTGAACGTGAAATGTTT
GGCGCGGAAGAAGATCCCTTCAGCGTGCTGACGGAGCGCGAGCTGGATGTTCTGCACGAG
CTGGCACAGGGGCTGTCAAATAAACAGATTGCCTCGGTGTTGAATATTTCCGAGCAGACA
GTAAAAGTACATATTCGCAATCTGCTGCGTAAACTCAATGTCCGCTCACGCGTGGCGGCC
ACCATTCTGTTCCTGCAACAACGCGGGGCACAATAAAAATAGCCCGATGGATTTATCATC
GGGCTGAGATTTATGACAAACGCAAAACTGCCTGATGCGCTACGCTTATCAGGCCTACGT
GGATCGATCAATTTATTGAATTTACACAATTTTGTAGGCCGGATAAGGCGTTCACGCCGC
ATCCGGCATAAACTAAGCGCACTTTGTCAACAGTCTAGCCCGATGGCATCACCATCGGGC
CTCTTTTTATTTACTCTCCTGCGGCGACAAATGTTGCATCGCCTGCGCGATACTACGTTC
AATCACCGCACGGCGAGTATCGTTGGCAGGTAAGAGTTTCAACATCATCTCCCACGCGGC
AACGGCTTCGCCAAATCGCTGCTGCTCAAAGGCATTAAACGCATACATGCTTAGCACACG
GATATTGCTATGGTCCGTTCTCACCAGCTGACGTAGCAGTTCACCGCCGAGGCGGTTGTC
GTTGGGATCAGATGAACGAGTCAACGCTTCAGCGTATCCCAGTGCAGCATCACTGTTTTT
CGGATCGAGGCGATACGCAGTGGCGTATGCATCGGTGGCGATACTGGCGTTACCCAGCGC
CATGCCAACGCGGCCCAACATAATCCAGCCTTCTATATCTCCCGGATTTTTTTGCAGTTG
AGTACGCATCCCCAGCGCAAGACGCGACATCTCTTCTTCGTTGAGCGGATCGGCTTTCGG
ATCCAGCGCCCTGTCCAGCAACGCCGGAGCCTGTGCCGTGGCCTGCTGCCAGATTTTCAC
CTGCTGATAATTGCCAGTCTGGTAGTAGCTGACGCCAGCCACAATTAACGCCACCACAAT
ACCCGGCAGATAAACAACATATCCGGCACGCTTACCTTCCGGCACGCTTTGTTCAGGAAA
CGCTTCCGGCACCACGCGTACCCGACGCCGCGAGCGGGCGTATATGACCCAACCGCCAAT
GCCAATAGCCACTACTGGCAGCACCCACAGCAGCACGGTCAGCGGCGTTAACGGCGGATC
GTAAGTGACGAAGTTGCCGTAACGCGCCACCATATAATCGACAATCTCTTTTTTACTTTT
ACCTTCCTGCATCAGTTCATACACTTTCTGACGCAGGTCGGTGGCAATCATCGAGTTGGA
ATCGGCAATGCTGTTGTTCTGGCATTTCGGGCAGCGCAGTTCTTCAGTGAGCTGACGGAA
CTGTTGTTCCTGTGCTTCATCTTTAAACTGCAACACATCGATGGTCGCCAGCGCTGAGCC
GGAGATCATCAGCATCAGCACGCCCAATAAAAACCTCATTGTGCGGCCTCCTTACTGTAT
TTCTCCCACAGCGGCTTGATCTCTTCTTCCCAGACGCGAGGATTCAGATCGCCCGCATGG
CGATAGCGAATGATGCCGTTGCCGTCAATAAGAAACGTTTCTGGCGCGCCATAGACACCG
AGATCCAGCCCTAACATGCCATCGCCATCAAACAGGCTTAGCGCGTAAGGATTGCCCAGC
TCTTTCAGCCAGCTGATTGCCTTCTGGCGATCGTCTTTATAGTTCATGCCGACCACGCGG
ATGCCCTGCGCAGAAAGCTGATTCAGATATTGATGTTCCGCACGGCAGGTCGGACACCAG
GTCGCCCAGACGTTAAGCAGTACTGGTTTGCCCTGAGTCAGCACATCCGCCTGATAAAAC
TGCCCCGGATTGTCCAGTGATTCGAGACGAAACTTCGGCACAGGCTTGCCAATGAGCGCC
GATTCCAGATTGGTCGGATCATCCCCTTCGGCATTACGCGCCAGCTGCCACAGCAGCGCC
GCGGCAATCGCCAGGAAGATAATCAACGGAATTAACAATACTTTGCGCTTCATACGGCCT
CCGGCGCAGTTTTTTGCGGACTCACGCGCTTACGATAGCGAGGATCAAACAGACACAGCA
GTCCGCCCAACGCCATCATCAGCCCGCCCGCCCAAATCCAGCGAACAAATGGTTTGTAGT
AAAGACGCACGGCCCACGCGCCGTTTTCCAGCTCTTCACCGAGGGCCGCGTACAGGTCAC
GCGTGATGCCGCCGTCAATTGCCGCTTCGGTCATCATCGACCCGGCAGTGTTGTAATAAC
GTTTTTCCGCATACAGCACCGTTTCCGGCTTGCCATCGCGCGTTACGCCGATAGTCGCCA
CACCGCCACGCCAGTTCGGGCCAGTCACCTCTTTGACATCACGGAAGGTGAAGCGATATT
CATGAATATCGACGCTATCGCCGGACTTCATGCGCACATCACGCTCAACGCTATAGTTCT
GGCTAAAGGCAATGCCAACAATTGTCACTGCCAGCCCAAGGTGAGCCGCCACCATCCCCC
AATAACTGAAGGTGGTTTTCGTGCCGCGTGAAATACGTAGCGCAGCTTCCGCAATTGCCA
GCACCGCAATCCAGCAGGCCATTGCCAGGCCGAGCACCGTCATCGCCACAACTTTGCTTT
CGAACAGCCACGGCAACAGCAGCGACAGCACCAGCGTAGAGATGAAGGCGATAATCAATA
AATTGCGGATCTTACGCGGGCGATCCCGCCCCCAGCGCACCAGAGGACCGACACCAAGCA
GTAGCGCAAACGGCACCATCAGCCAGGTAAACATGGTGTTGAAGAACGGTTCGCCAATCG
AAATACTGCCCAGTCCCAGTTGCTTATGCACCAACGGCAGCAGCGTCCCCAGCAACACCA
CCAGCATCGCAGCGACCAGCAAAACATTGTTCGCTAACAGCAAAGATTCCCGCGACCACA
GCGCATTGTTTACGCGTGAGCGAACTTTGTGTCCACGCGCGGCAAACAGCAGCAGCGAAC
CGCCAATCACCAGCACCATAAAGGCGAGGATAAACATACCGCGCGCCGGATCAGACGCAA
ACGCGTGTACCGATACCAGCACGCCGGAACGCACGAGGAAAGTCCCCAACAGACACAACG
AGAAGGCACTGATTGCCAGCAGTAATGTCCACGCTTTGAAGCTGGCGCGTTGTTCAGTGA
CCGCCAGTGAGTGCATCAGCGCAGTCCCCACCAGCCACGGCATAAACGAGGCGTTTTCTA
CCGGATCCCAGAACCACCAGCCACCCCAGCCGAGTTCGTAATAGGCCCATGCGGAACCGA
GCACGATGCCGAGCGTCAGGAAGATCCACGCTGCCAGCGTCCACGGACGAGTAAAACGCG
CATAAGTGCTGTCCAGACGCCCGCTCAGCAAAGAAGCAATGGCAAAAGCAAACGCCACCG
AGAAACCCACGTACCCCATATAAAGCAGAGGCGGATGGAAGATCAGCCCCGGATCCTGCA
ATAGCGGGTTAAGATCGCGACCTTCAATCGGGAAGTTCGGCAACGTGCGAGAGAACGGGT
TAGAGGTAAAGAGAATGAACAGCAAAAAGCCGACACTGACCATCCCCATTATCGCCAGTA
CACGGGCCACAATATCCAGCGGAATACGCTGACTAAAAATCGCCACCGCAAAGGTCCAGC
CGCTCATCAGCAGCACCCACAGCAGTAGCGAGCCTTCATGCGCGCCCCAGGTAGCCGCCA
CGCGATACCACACCGGAAGCTGGGTATTGGAGTTGCTGGCAACATAGGTGACGGTGAAGT
CGTTGACCACGAAAGCATTGACCAGCACCAGAAATGCGCCAGCCACAGACATAAACAGCA
GCCAGGCAAACAAGCGGGAAGACGCCATCATGCGCGCATCTCCGCGCGCCACGCCCCATA
GCGGATACACGGACAGCAGCAGCGCAATTCCCAGCGCCAGGCACAGCAGTCCGTTACCAA
TTTCTGGCATCATGATGCTGGGTCCTTATAAACACTCGCCGGGCGACGGTGGTTAGCTTC
CATCGCTTTCTCAACTTCTGGCGGCGTATAGTTTTCATCGTGTTTCGCCAGCACTTCTTT
CGCGAGGATATGATTGCCTTTTTCCAGTTCGCCCTGCACCACAACGCCCTGCCCTTCACG
GAACAGATCCGGCAAAATGCCTTCGTAAGAGACATCCACTGAGCCTTCAGCATCGTAAAT
GGTGAAGGTCACTTTCAGCGAATTGGGATCGCGCTGCACACTACCCGGCATCACCATCCC
GCCAACGCGCAGACGCTGACCGACTTCCGGCATTTGCTGAGTTTCACGCTTGCCGTAGAG
AATTTCCCCCGGCGTATAAAAGAGATCGATATTCGAGCGCAGCGCATATAGCACCAGACC
GATAGTCAGCGCCAGCCCTGCCAACACGGCACAGGCAATCCACAAGCGGTTTTTACGGCG
AATATTCATGCAGCCTCCTGCTGTTGCGCAGCACGTAAACGCGCCTCACGCGCCCGCTGT
TGCGCCACGCCACGCAGAATTGCGCGATGTTGCATCACCGAGTGCACGACCAAAACCACC
AGCGGAATAACGGTCATCACCACCGCCAGCCAGACAAAAAAGGCGTAACCGCCCATTGCG
AAAAATTCATTCCAGGAAGCAAATGCAGGGGTCATTTACGGCCTCTTTTCAGTATCAGTT
CACTCACCCACGGACGGCGTTTTTCCATCAGCAAAATCAAATTACGCATCCGCATCAGCG
TCAGCGTGGCAGACAGGAGCAGGAAGCCAAAAATCGACCAGCGCAGCGGCGAACGCATCG
CCGGATCGATACTTTGCTGCATCCGCGTTGATCCCTGATGCAGGGTGTTCCACCACTCCA
CGGAGTAATGAATAATCGGCAGATTCACCACGCCAATCAGCACCAGGATACCTGCCGCAC
GGCCCGCCAGACGGCGGTCGTCGAAGGCGTGCCACAGGGCAATCACACCCACATACAAAA
ACAGCAGCACCAGTTCAGAAGTCAGACGTGCATCCCATACCCACCAGGTGCCCCACATCG
GTTTTCCCCATGCAGAGCCGGTAACCAGGGCAATAAAGGTAAACACGGCACCAATGGGGG
CCATCGCCGCCACCGCCAGGTTGGCCATTTTCATCTGCCAGACAAGGCCAATAAACGCTG
CCACTGCCATTGATGCATAAATGCCCATCGACCAGATCGCCGCAGGCACATGCAGGTAGA
TAATGCGGTAGCTATTTCCCTGCTGATAATCAGCCGGAGCAAAGCCGAATCCCCAGATCC
AGCCGACGGTAAGCACGACCACACTGGCAATTGCCAGCCACGGTATAAACCAGCCACAGA
TTTGATACAGCCGTGGTGGGATCGCCAGTTGATGCAGTGTTTTCCACATAGTTTCGATAC
CAGACTCGAACAAAAATCAGTAATCCAGCGTTATTGAATGCTGATTCGTAACGCTGCCGC
CGTCGCAAAAGGACTTAATGTCGCGGTGCCTGCCAGCAACGCGCCTAAAATTGCCAGATA
CCCGTCAACGGGCAAATGCATAGAAGCCGCGTCCATCGCGGCGGTGGCAAAGATGAGTAA
TGGGATAGTCAGCGGTAACACCAGTATGCTGAGCAGCACACCACCGCGCTTAAGTCCCAC
TGTCAGCGCCACGCCCGGTGCACCGAGAAAGCCAAGCGTAGGCGTTCCCAGCAGCAGCGT
CAGCGCCATCACTTGCCAGCCATAAACATCCATTCCCAGTAGCATTGCTACCAGTGGCGA
AAGGATGAGTAACGGCAGACCGGTTACCATCCAGTGCGCCATCACCTTCGCCAGCACAAC
GGCGGGCAAGGGTAACGGCAACAACATCAATTGTTCAAGACTGCCGTCCTGCAAATCGTC
ACGGAACAGTCGTTCCAGCGCCAGCAAGGATGAAAGCAGCGCAGCAACCCAGATAATGCC
CGGTGCAATACGCGCCAGCAGTTGCGGCTCCGGACCGATACTGAGCGGAAAAAGGGTAAT
TACAATCAGGAAGAACCACAGCGGGTTGGCGATTTCGGCGCTATGGCGAAACGCTACACG
CAGCTCAAGACGGAAAATGCGCCAGAACATCATGCGGCCCTCGTTTGCGTCAGTGAAATG
CGGCGAATTTTACTTTCAGCAACGTTGAGCGGCTGGTGGGTAGTCAGAATCACAATCCCC
CCCTGCTCCGTATGCTGCGCCATACGCTGGGTCAGACGATCGACACCGTTAACGTCAATC
GCGGTAAAAGGCTCGTCGAGGATCCATAACGTGGCACGGGTCAGCCACAGACGCGCTAAA
GCGACGCGGCGTTGTTGCCCGGCCGAGAGCTGATTTACAGGAATATCTTCGAATCCGGCA
AGCCCGGCCTGCGCCAGGGCTTCCAGACATTGTGCGGTATCGCCATCGCGATGATAAAAG
TGCAGATTTTCTAACGCCGTCAGCCGGGTTTTGATCCCCGGCTGATGGCCTATCCATAAC
AGGTTTTGATGGTAGCTGTCGCGTACCTGATGCAAGGGCTGCCCTTGCCAGAGAACCTCG
CCTGCGTCAGGGCGAGACAACCCCGTCAGCAAACGGAGAAGCGTTGTCTTCCCCGCGCCG
TTGCTACCGGTGATTTGTACCCACTCTCCTGCGTTCAGCGTAAATGACAAGCCACTAAAT
AAGGTTCGTTCATCCCGCTCACAAAGTAACTCTCTGGCTTCAAGCATACCCACGCAATAA
CCCTGTTAAAAACCTGGCTCGACTTCACGCATATCGGGCAGCTTGTGCGCTATCCCTTTA
TGGCAATCAATACAGGTTTGCCCATCTTTCACCGCCTGGTCATGCATCTTCGCGGCAACC
GATTTCTGGGCGGTTGTATCCATATACTCGAAGTTGTGACAGTTACGGCACTCCTGCGAG
TTATTGTCCTTCATGCGCCGCCACTCATTCTGTGCCATCGTCAGACGATGAGCTTCAAAT
TTCTGCGGCGTGTCAATAACGCCAAAAATTTTACCATACAGCTCTTTACTTGCTTTGAGC
TTGCGTATCATCTTCGGCACAAACTCGTGCGGAACGTGACAATCCGGACAGGTCGCACGG
ACGCCGCTACGGTTGTTGTAGTGCACGGAATCCATGTATTCCTGATACACCGTGTTGCGC
ATTTCGTGGCAGCTAATGCAGAACTCTTCGGTATTGGCTTTTTCCATCCCGGTGTTAAAG
CCACCCCAGAAGACGATGCCGCCAACAAAACCGATCAACAGCAGCGTCCCCAGCGCCAGA
CGGCTGGGGGTACGCCACCATTTCCACAGGCGCTTAATCAGACCAGGCTTACGGTCAGAA
TTTCCCATAATAACCTCTTATTTCCCGTAACCTTTTGATGGGGTAAAGGTATTCCCCACG
ATTGGCGCGGTATCGGCCTGCGGTACGTGACATTGCAGACAGAAATAACGACGCGGAGCC
ACTTCCGCGCCCACTTTGCCGTCGCTGTCCATAAAGTGAGTAGGACTGATACGCGGCGCG
CCAGTGGTGCGATAGCTTTCGACACCGTGGCACTGCAAGCAGCGATTGGTATTGGTCGTT
ACCTGATAACCTTCAACGCTATGCGGGATCATTGGCGGCTGATTCACATAGTTCAGCGGC
ATCCGATCCTGCTCTTTTGGCATCCGAATGGCCCCTTCCTGTGTCCCGGATACTTCCGGC
GACTGGCTAAAATCGACGCCATTAGCCGCCCAAACCGCGCCGCTTACCACCAGGGCCAGC
ATCGCCGTCCATTGACACAGCGCTTTCTTCAGGTCATGGCTTTTCATGATTTCGCTCCCG
AACTCCATCGTGTAGTTATTGTAAATACATCCTCAGAACAGACATCCACGCAGCGACCGC
ACGTCATGCAATCGCGGCTGGTGACCTGCACCGGGCTTTGTTCATCCAGCACCGGGGCAC
GTAGCACATGCGGTTCCGGGCAAACATGAAAACAATCCATACAGCGGTTACATTTCTGCC
GATCGGTGGCCGCAACGGTAATCACACCTTTGCTACCCAGCACGCCATACAGCGCGCCAA
CCGGACAAATGTGCCCGCACCAGCCGTGTTCAACGACCAGTAGATCAAATAAAAACAGCG
CGAGAATAAGCAGCGCGCCGCTGCCGAAGCCCATTACCAGGCTACGCCCCATCAGAGAAA
CGGGGTTGATCCATTCCCAAATGAGCGTGCCAGTTAAGGCTGATCCCACCAGAATGACCA
CCAACAGCACGTAGCGAATGTGGCGAGGGATCGTCGCAGACTGATTGAGGTCAAAGCGCC
TGCGTAACCAGTTCGCTAAGTCGGTAATCGGGTTCAGCGGGCAGACCCAGCTGCAAAATA
ATCGCTTTCCCGCCAGGGCGTAGAGCACGGTGATAATCACCGCACCGGTCAACGCCACCG
TGGCAGGCAGATGACCACTGGCAAGACTTTGCAGCGTCATCAGCGGATCGGTCAGCGGAA
CGGTGTCGAATAACAGGCTACTGCTGTAGTTGCCGTGCAAGATCCACACACCAAACCATG
GACCGCTCAAAAACATCCCCAGCACGAAGAACTGACAAAGGCGACGTAACACCAGCCAAC
GGTGACTGCGCCACCAGCCTTTTTTCTCCAGCGCCTCGCGCCCGGCGTCACGTTTACGAT
TTGCCATTGTTCCCCTCCAGCCAGCCGAAGCGGTAATGGTGACCTAACTCCCCTTTCGCC
AGTGACAGCGGTAACACCTTGATTGCCGGTTGTTCCAGCACGCATACTTTTTCGCACTTA
CCGCAACCGGTACAGGCGTCGCTGTGAACCGTCGGCAGAAAGCGGGCGTGCTTACCGGTA
CGCGTGTTGCGCTCCAGCTCCAGGGTGATGGCCTCATCAATTTTCGGGCATTCGCGATAA
CAAACATCGCAGCGCAGCCCCTGAAAGTTGAGACAGTTTTCCTGGTCCACCAGTACCGCC
AGCCCCATCCGCGCGTCGTCGATCGATTCAATCTCACGATCCAGCGCACCGCTTGGGCAC
ACTTTGGCGCACGGAATGTCCTCACACATTTCGCAAGGAATATCCCGTGCGACAAAATAT
GGCGTGCCCGCCGACAGACCAGAGGCCAGCGTCGCCAGTTTTAAGGTGTCGTAAGGGCAA
GCCTGAACACACTGACCGCAACGCACACAGGCACTGGCAAAGGCGTTCTCGTTTATGGCT
CCGGGCGGGCGCAACCGCACGCCAGATGCGCGTGCGGTTTGCTGTTGTAACCCCAGCGCC
ACACCCACGGCAGCCAGCCCGCCTGCTGTGCGAACGACATCGCGCAGAAAGCGGCGGCGA
CCATTTTGAGGTTTCGCTGACCGGGACATAATGGCTTACACCTTCTCCAGTTTGACCGCG
CACTTCTTGAAGTCCGTCTCTTTCGAGAGCGGATCGGTCGCATCCAGCGTCAGTTTGTTA
ACCAACTGTGCGGCGTCGAAGAACGGCATGTACACCAGGCCCTGTGGCGGACGGTTACGA
CCGCGCGTTTCAACAATCGAGATCACTTCGCCACGGCGAGAAACCACTTTCACTTTGTCG
CCACGGCGCAGATCGCGCGCTTTCGCATCCAGCGGGTGAATAAACAGGACCGCTTCCGGG
AAGGCGCGGTGCAGTTCTGGTACACGGCGAGTCATACTGCCGGTGTGCCAGTGCTCCAGA
ACGCGTCCGGTAGAGAGCCACAGGTCGTACTCTTCATCCGGTGCTTCCGCCGCCGGTTCG
AATGGCAGTGCGAAGATCACCGCTTTGCCATCCGGTTTACCGTAGAACTTATAGCCTTCG
CCCGCTTTCACGTACGGGTCGTTACCTTCGCTGTAACGCCACTGCGTTTCTTTACCGTTC
ACCACCGGCCAGCGCAGACCGCGCGCTTTGTGGTAGTCATCGAACGGTGCCAGATCGTGA
CCGTGACCGCGACCAAACCATGCGTACTCTTCGAACAGCCCTTTTTGCAGATAGAAGCCC
AGCTCGCGGGATTCATCGTTCAGCTGATCTTCCGCCAGTTCGGATACCGGGAATTTGCTC
ACTTCCGGTGTGGCATACAGCACTTCGTACAGCGTTTTGCCACGCAGTTCCGGTTTCTTC
GCCAGCAGATCTTCCGGCCATACTTCTTCAGTTTTGAAGCGGCGGGAGAACTGGACTAAC
TGCCAGAGATCCGATTTCGCTTCGCCCGGTGCCTGTACCTGTTGACGCCAGAACTGAGTA
CGGCGTTCGGCGTTACCGTAAGCGCCCTCTTTCTCTACCCACATTGCGGTCGGCAGGATC
AAGTCGGCGGCCAGCGCACTGACTGTCGGATACGGATCGGAGACGATGATGAAGTTGCGC
GGATCGCGCCAGCCCGGCATACGCTCTTCATTGATGTTCGGCCCGGCCTGCATGTTGTTG
GTACACATGGTCCAGTAAACATTCAGTTTGCCGTCTTTCAGCGCACGGTCTTGTGCCACC
GCGTGCAGACCGATTTTCGCCGGAATGGTGCCGCTCGGGATATTCCACTTCTTCTCGCAG
ATATCACGGTGTTTCTCGTTGGTCACCACCATGTCCGCAGGCAGACGGTGAGCAAAGGTG
CCCACTTCACGCGCAGTACCACACGCAGAAGGTTGCCCGGTCAGGGAGAACGGACCGCAA
CCCGGCTGGGAAATTTTGCCGGTCAGCAGGTGCAGGTTGTAGACCAGGTTGTTAGCCCAC
ACGCCACGAGTATGCTGGTTGAAGCCCATCGTCCAGTAGGAGATGACTTTCTTGTTCGGA
TCGGCATACAGCTGCGCCAGTTGTTCTAACTGGTCTTTCGGCACGCCGGTCATTTCGGCA
GTTTTTTCCAGCGTATACTCGGCAACGAAGGCTTTGTAATCTTCAAAGCTCATCGGTTCG
GAGGCGTCAGAACCCGGATTCTTCGCTGCTTTTTCCAGCGGATGGGTCGGACGTAAACCG
TAGCCGATGTCCGTCGCCCCTTTGCGCAGGTTAACGTGCTTGCTGAAGAAGTCCTGATTT
ATCGCATTGTTTTGAATGATATAGTTGGCGATGTAGTTCAGGATCACCAGGTCAGATTGC
GGCGTAAAGATGATGCCGTTATCCGCCAGCTCGAAGCTACGATGCTGGTAGGTAGAAAGC
ACCGCCACGGTGACGTTCTGGTTAGAGAGACGACGGTTAGTGATGCGCGACCAGAGGATC
GGGTGCATTTCCGCCATGTTTGCGCCCCACAGCACAAACGCGTCAGCCTGCTCGATGTCG
TCATAGCAGCCCATCGGCTCATCCATACCAAAGGTACGCATAAAGCCAACTACTGCCGAC
GCCATACAGTGACGCGCGTTCGGGTCGATGTTGTTCGAACGGAAGCCCGCTTTAAACAGC
TTGGACGCGGCATAACCTTCCCAGATAGTCCACTGACCAGAACCGAACATACCGATCGAT
TCCGGCCCTTTTTCTTTCAGGGCGGTTTTGAATTTCTCTTCCATCACATCGAAGGCCTGA
TCCCAGGTGATTGGGGTAAATTCGCCTTCTTTGTCATATTTACCGTTTTTCATACGCAGC
AGCGGCTGCGTCAAACGGTCTTTACCGTACATGATTTTGGGCAGGAAATAGCCCTTAATG
CAGTTCAGGCCACGGTTAACCGGTGCGTCCGGGTCGCCCTGACAGGCCACCACACGTCCC
TGCTGCGTTCCGACCAGAACGCCGCAACCAGTACCGCAGAAACGGCACGGCGCTTTATCC
CATTTGATGGCTTCCTGCTGACCAACAACGGCGCGGGCAACGCCCGGCACGCTGAGACCG
GCAGCCGCCGCAGCGGCCGCAACGGCGTTAGCTTTCATAAAGCTACGACGACTGAGTTTC
ATGGTGTTTCCTCACCTTGCTCTTCCTGCTGGTGATAAACCAGCGACACCGCCAGCACGC
CCTCTACGTTGCGTACTGACTCAATGGTTTGGATCAGCGTTTCGCTGTCTTCTGCTTCCA
CCACCACAATCAACTGACCGCTCGGCGCGTCGCTGACAGCAACTTCACAGCCGGGAAAGG
CGTTCAGTTGGGTGCTGATGTCTGAAATTCGTTCGCTTTTGGCCTGCACGACCAGGCTGC
AAACTTGCCAGTTAGTGTGCATGGAGATACTCCGCAGTTATGGCTGATACCGGACAGCTG
GCTGCACATGCTCCACATCCGTTGCAAAGTTGGCTATTAAGTTGCGGCTGGTAGATCCCG
GAGAGCGTCGGGCGAAAGATAATTGCCATTGGCTCACAGCTATCCTGACAGCGGCGGCAT
TCAACTGACTGATACGCCAGGCACGCGTCCCCGATGGTGAACTGCAAATCCCAGGCCCTG
GTGTGGCGCGGAGAAAATAGCGATTCGGGGCAAGCCTGCGCGCAGGCGTAACAGAAGCTG
CACTCGTTATTTTTGAAATTAACGCTCGGATAGCCGCCCGCGCCGCGTTGCAGAATGTTG
TTTTCACAAGCATTAATACAGGCGTCGCAGCGGGTGCAATGGGTCAGAAAATGAGATTCA
TCACCGGACCAGGGCGGACGGATACCGTTACTGGCTTTGCGCCAGCGACCAGTGAGTATG
CCCCGACGGGATGCATCAATCTTCACATTGACCTTCCATCATTAACGCGCTCTGAAAATT
GAGAGCGACCAAATAAACCGCATAATTAATAAGCCATTTTTATAGCCGCTAAGATATTAA
AGGATGTGTCAAAGATGCATACCCCGATCGGGGTAAAACCTGTAGCAGGATCAAAAGAGT
GGCGGGAAGCGTGGCAAAAACGGGCTTTTGCTCACATTTCAAATGGTTATAAATATATTT
ATATAGCGATTGATTCACCAGAGATATTTCTGCTGGTTTGCTCTCTCATTAGAATTTAAC
ACTAAAAGAGCAGGTAAAATTGTCTGAATGTTCTTTAAGTTATTCATAAAGCAAATTAAT
AAATCTGATGAATATGTTAACCTTCAGCGACATCATCGGTGAAAACCTATAAATGAAGAA
GGAAAGCAAAAAAATGAAGACCATTCTACCTGCAGTATTGTTTGCCGCTTTCGCTACCAC
TTCCGCCTGGGCGGCAGAAAGCGTCCAGCCACTGGAAAAAATCGCGCCTTATCCACAAGC
TGAAAAAGGGATGAAGCGTCAGGTGATTCAGTTAACCCCGCAAGAAGATGAATCTACCCT
GAAAGTAGAACTGTTAATCGGTCAGACGCTGGAAGTCGATTGCAATTTGCATCGTCTCGG
CGGGAAGCTGGAAAACAAAACGCTGGAAGGCTGGGGCTATGATTATTATGTCTTTGATAA
AGTCAGTTCCCCGGTTTCAACGATGATGGCCTGCCCGGATGGCAAGAAAGAGAAGAAATT
TGTCACCGCGTATCTGGGCGATGCTGGAATGCTGCGTTACAACAGCAAGCTGCCGATCGT
GGTGTATACGCCAGACAATGTAGATGTGAAGTACCGCGTCTGGAAGGCGGAAGAGAAAAT
TGACAACGCGGTAGTTCGCTAAACTGCCGTGAAGTGCGGCACCCCGTAGGTCAGACAAGG
CGGTCACGCCGCATCCGACATCCAACGCCCGAGCCGGTTGCCTGATGCGACGCTGGCGCG
TCTTATCAGGCCTACACCGCTGTGAAGTGCGGCACCCCGTAGGTCAGACAAGGCGGTCAC
GCCGCATCCGACATCCAACGCCCGAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATC
AGGCCTACACCGCTGTGAAGTGCTCCACCCCGTAGGTCGGATAAGGCGGTTACGCCGCAT
CCGACATCTAACGCCCAAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTA
CACCGCTGTGAAGTGCTCCACCCCGTAGGTTGGATAAGGCGGTTACGCCGCATCCGACAT
CCAACGTCCGAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACACCGCT
GTGAAGTGCTCCACCCCGTAGGTCGGATAAGGCGGTTACGCCGCATCCGACATCTAACGC
CCAAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACACCGCTGTGAAGT
GCTCCACCCCGTAGGTTGGATAAGGCGGTTACGCCGCATCCAACATCTAACGCCCGAGCC
GGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGCATACGCCACATCCGGCATACCATGC
CGGATGTGGCGTATCATTACAACGCAATATCCGCCACTTCTTTTTGAACGGGTTGCGGTT
TCAACTGCGGTTTCGGCGTACTATCTGCTGCCTGCGGCTTGTCGTAGTTCAACCCCAGCA
CTTCGCTGGTGTACTGCAACTCGCGTTCTGTTGCCGCTACATCACCGTTCAGCTTGCGTC
CATAAGACGGAACGATCGCTTTCAACGTAGCCTGCCATTGCGGGCTGGAAACACGATCGC
CAAATACTTTTTCCAGCAGATTCAACATAATCGGCGCGGCGGTTGACGCCCCTGGCGATG
CCCCCAGGAGCGCGGCAATGGTTCCTTGCTGGTCACTGACGACTTCAGTACCCAGACGCA
GTACGCCACCTTTCTCGGCATCACGCTTGATAATCTGCACGCGCTGCCCCGCTTGCCACA
AACGCCAGTCCTCTTTTTTCGCCTGCGGATAGTACTCTTTCAACGCTTCAAAACGATCCT
CTTCACTCAACATCACCTGACTCACCAGATATTTCACCAGATCGAAATTATCCAGCCCGA
CGTGCATCATCGGCATCACGTTAGAGGTGGTGGTGGAACTCATTAGATCCCACAATGAAC
CGTTTTTGAGGAATTTGGTTGAGAAGGTGGCAAATGGCCCAAACAGCACTACGCGTTTAC
CGTCCAGAACGCGGGTATCGATATGCGGAACCGACATCGGTGGTGCGCCAACGGATGCTT
TACCGTAAACCTTCGCCAGATGGTGATTAACCACGTCCGGGTTTTCCGAAACAAGGAACT
GTCCGCCCACCGGGAAACCGGCGTAGTCTTTCGCTTCCGGAATCCCCGATTCCTGTAACA
GCTTCAGCGCCGCACCGCCCGCGCCGATAAAGACAAATTTGGCACGAATGTTCTGTGCAG
TGCCATTTTTCAGATCGGCAACGGTAACGGTCCAGGTGTTATCGTCATTACGCTTTAGGG
CGCGGACTTCGCTGCTGAGTTGCAGCGAGAAGTTAGATTTCTTCTGCAAGGAAGCAATTA
ACTGGCGGGTGATCTCGCCGTAGTTCACATCGGTACCAATTTCCGTACGCGTGGCTGCCA
CTTTCTGTTGCGGATCGCGCCCTTCCATCACTAACGGTGCCCACTCTTTGATCTGCGCGT
GATCTTCAGAGTAACGCATACCGCGAAACAGCGAGCTTTGTTGCAACGCGGCGTAACGGG
CGCGCAGGAAATTGACGTTATCCTCGCCCCAGACAAAGCTCATATGCGGAACGGTATTGA
TAAATGAACGCGGAGTACGCAGCACGCCGCGCTCAACCTGGTGCGCCCAGAACTGGCGGG
AAATCTGAAATGCTTCGTTAATGGCGACTGCTTTTTCAATACTGATGCTGCCATCGGCGT
TTTGCGGGGTGTAGTTCAGTTCCATCAGTGCAGAATGCCCGGTTCCGGCGTTATTCCAGC
CGTTCGAACTCTCCTGCGCGACACCCTCCAGGCGCTCCACCATGGTCATCGACCATTCAG
GCTCCAGCTCGCGTAAATAGGTCCCCAACGTGGCGCTCATAATGCCGCCGCCAATCAACA
GTACATCAGTTTCCTGCTCCTCGGACGCTTTCGCTTTTGCCGCCATCGAAACGGCATTAA
GCCCCACGGCCATCGAGAAGAGCATGGCAGTCACTTTTTTCATCTTGTTAATGCCTTACT
TTTAGTCGCTTTATTGCAGGTGAGATTTGCGCGGCATCAACGGTAACACTTAAGTAACAA
CATTTAAATAATGTTTATAAATTATATTCTAATTTTAGAAACATTATAATTTCGTTGATT
AATTATAGGGTTATTAGAAATGAAGGGATTTTTAGCATATTGACCTGACGGCAGCAGTCC
GCCAGGTCAGCGTCGTAATATTATGCCGTCCGGGCAACGGCATCACGCGAAGCGGCATCG
CGCTCTTCGCCCGTCAGCTCGCTAAGTTGCCCATTGCGCATTTCCAGCAGGCGGTCGGCG
TGGATAAAGTAATGATCATCATGACTGATAGCGAAAATAGTTTTACCCATCTCCTGCATC
AGCGGCAGCAACACCTGATAAAACTCACGACGGAAGTGTGGATCCTGATCCGCCGCCCAT
TCATCCAGCAGGATAATATCGCGTTCTTCTGCCAGCGCCAGCAACAGCGCCACGCGTTTT
TTCTGCCCTTTTGATAACTTCAGGTTAACAATACGCCCGTTGCTTAACTCAAGCTTATGA
GCCATTTTCAGCTGCGCCAGCCACTTCTCAACCAGTTGCGGGTTAGCGGGTTTACCCTCC
GGCCCCAGCAGTTGATCAAACAGCCAGACATCGGTAAACACTGCCGAAAACAGTTTGCGA
TAATCTTCCGGTTGTTCGCCGCTGACAGGTTTGCCATCCAGCAAGATTTCGCCGCTTTGT
GGCTGATACAAGCCCGTCAACAACATCGCCAGCGTCGATTTTCCGCTACCGTTGCCGCCA
ATCAGAAACAGCAGCTCGCCACGTTTGATGGTGAGATTAATCGGACCAACGGAAAACGCG
TTATCCTGATAAGCAAACGTCACGTTACGCAGCTCCAGCGTTTGCCAGTTGGGAAACGCC
TGCGGGCGCGGAAACTCTGCTTTGAAAGGCGCGAGCGCGAATTTGTTCAGCTTGTTAAAC
GCCACCTGCGCCGTCAGCAGCGTCGGCAATGCGCCAACCGCCGAAAGCAGCGGCGTACGC
AGGAATAAAAGCGTCAACGAATAGGTCGCGGCAACGTTGGTATCAGCCCAACCGAGGCTG
TTCGCCATCCAGAACACCAGGCCGATTGCGCCCAGCATCATGATGTTTGACCAGTTCACG
GCACTAAGATGGAAGGTGTCTGCGCGAATAATATGGTGGCGATACTCTTGCGCATCAGGA
ATGTAGAGGTTGTTAAACACATACTCGGCGCGTTCCCGGTTCAGAGTCAGCTCTTTGCGC
CCTTCAAGTACAGTTTGAAAATCCGTGTACAGCTTGTCTTCGGTTTCACGCAGGGTCGCC
ATATGTTTGTACACCCGCGCCACCAGCACAAAACCGCCCCAGATGGTGATCGCCATCCAG
ATAGCCGTTACCAGCAACATTTTGCCCGACAGCATCCACAGATACGCCGCTGAACCGATA
GTGAGAATGATCCCCTGCACCAGTTCCGGCAGACGCACAAAAGCAATGGTGATATTGCGC
ACATCGCTGGTTAACCCCGCCAGCAACGAGGCGCTACCGAGTTGTTCAATGCGCTCGACG
TGAGTATCCAGAATCCGCTTGATAAATTCACTACGCAGTCGGTAAACGAAGTGATGCCCC
AAAGTGGTGAGCGCCAGTTGCGATCCGAGAGTGACTGCCATCAACAGCAGCAATAATCCC
AGAAACTCCGGCAACACCAGCAGACTGGTATCCGCCGTTTCGATAAGGCGCTGATTGATA
AAAGCAATTAAGCCAATGCCTAATGCCGCACTGGCGAGGCTTAGCGCCATCACACTGATA
AATGGCCAGCGATACTGCCGCCAGACAAGTACAAGAAGTTCCATGCAGAAAACCCGGACA
ATGAATTACAGCCCGCAGTTTAAACATCTTCGCGCGCACAGCAATAATAATTCTTATTTT
TATTCTTTTTTACCTGCCTGACGGAATGTCAGGTTGTAGCGGCAGTCGATGGTGAGTGGA
TGAAACCCCGCTTTCAACGGTTGAATACCGTGATAAAACAGCCGCGATTCACCGCCCCAT
ACCACCACATCGCCATGTTCCAACAACAAACGTTTGAGCGGATCATTTCGTTTCAGGCCG
CCAAATTGAAAAATCGCGGGTAAGCCCAGAGAAACAGAAACAATTGGCGCGCGCAGATCC
GGTTCGTCTTTATCCTGATGCAGCGACAGTTTCGCGCCAGGAGCGTAGCGGTTGATAAGA
CAAGCATCTGGCTGGAAATCTGGATAGCCCGCCGCCGTAGCCGCACGTTGACATAAATTA
TGAAAACTCTGTGGCATGGCGGGCCACGGTTTATTTGTTTGCGGATCAATGGGCGAATAG
AGATAACCTTGCCGATGGGTCGTCCAGCCCAGATGCCCACAGTTGGTCATCGCCACCGAC
ATGGTATATCCCCCGGGGGTGACCATCTGGCGAAACGGCGACTGGCTGGCAACGTCATTA
ATATCGCGGATCAGTTGCTCCGCAGCGTTAAAAGCAAAACGCCGTAAAATTACCGCACCA
GCCGCCAGTGGCTCTTGCCACGGTTCAGCATCGGCAAACAGATCCAACATTACCTCTCCT
CATTTTCAGCTTCGCGGCGCAGCAGTTGCGCTTTACGCGACACGCCCCAGCGGTAACCGG
AAAGTGTGCCATCACCACGGACCACCCGATGACAGGGTATTATGATAGCCAGCTTGTTGG
CGGCACAGGCGCTGGCAACGGCCCGTACCGCTTTCGGTTTGCCGATGGCGTTAGCCAGTT
GCTGATAACTGACGGTTTCACCGCAAGGTATCGTGCGCAGTGCCTGCCAGACTTGTTGCT
GAAAAGCAGTGCCGCGAATGTCCAGCGGTAACGTCAGCGGCGTATCGCGTTGATTGAGGC
TGGCGATCACTTCACGCACATGTTGCTGAAACATCAGATCGGCAGGCGCGTTGTCGGCAG
CGGGAAACATCTGCTGCAACTCGCTGATTAGTGTCGCGTCATCATCGCCCAGCAATATCG
CGCAAATCCCCCGCTCGCTTTCTGCCACCAGGCAACGACCCAGCTCACAATCAGCCAGCG
CGTAACGCACCGCCAGATTTTCGCCACCGTGACGGAATTGTTTAGCCGTCATGCCCAGCG
TTTCGTCAGCTTTGCGATAGTAACTGCTGCTGTCGGGGAATCCGGCGTTAAGAATAGACG
TCGTCACGCTCTCCCCTTTCGCCAGCGATTCGCGCAAACGGCGAGCGCGCCAGGCCTGTT
GCCAGGCTTTAGGCGTCATTCCGGTAGTCGCTTTAAACAACCGATGTAGATGAAATGGAC
TCATCGCCACCTGGTCGGCTAAGGCTTCCAGCGTTACAGGCGTTTCCTGTTCCAGCAGTC
GACACGCGTGGGTGATTTTATCCAACCGATGTTGCTGGGCATTGGCTTTTTCTGGCTGAC
AACGTTTGCAGGGGCGAAAGCCAGCGGCGAGTGCCTCGCTGGCATTTGCGTAGAAGGAGA
CGTTTTCCCGCAAAGCATGTCTGGCGCGGCAAGACGGACGGCAAAAGATGCCTGTGGTAC
GCACGGCGAAAACGAATTCGCCGTCGGCATTCGGGTCGCGGGCTAAGACAGATTGCCAGC
GTTGATCGTCAGTTAAGCATGTGGCTTTTTTCATAATCAGCTCCCTGGTTAAGGATAGCC
TTTAGGCTGCCCGGTCACCATCACGCAAAAACCAACAATCTTGCGCTTTAATTTTTTTCG
CTGACAAGGAAGCTTTTAAACTGTGGTGACATCCAGGTTTTAAAGCTATCGCCTTCTTTG
GTGATCATATAAACCGCCAGCCCTTCCCGGCGAACAACCTCTTTAGCTTTCTCCGGCCCG
AGTACCATCAAGCCAGTATCCCAGGCATCGGCTTCCAGCGCCGTCGGAGCAATCACCGTC
ACGGATACCAGATTGTGTTCGATGGGACGCCCGGTTTGCGGATCGATAACATGGGAAAGA
CGTTTGCCGTCCAGTTCGTAATAGTTACGGTAGCTGCCAGAGGTGCTAATCCCATGACCG
TTGATATCCACCACAGCCTGAACCGCGTTTTCTTTATCGGTTGGTTTTTGAATCGCTACC
CGCCACGGCAGGCCTTCACCGTTCATACCACGGCTGTTCAGCGCGCCGCCCACCGACACC
AGATAGCGGGAAATCCCTTCCTGCTCCATCAAGCGTGCCAAATGATCGGCCGCATAGCCT
TCGCCGACGGTGGAGAGATCGACATATAAATCCGGCAGGTCTTTTTGCAGATATTGCTGA
TGCGACTGATTGATGACCGTCAGGTGCTGTAAGCCGGTTTTGGCTTTCATCGCATCGATC
TGTTCCTGGCTCGGAATTTGAACCGGCTGTTGTTCCGGGCCAAAGCCCCACAGATTCACC
AGCGGCCCGACGGTTATATCCATCGCGCCATCGGTCTTCGCGCCAATGCGCAGCGAGGTG
GTGACGATATCGGCCATCGCTTCACTTACCGGCCACGGCGATAAACTTTGCGAGTCGTTA
AAGCGCATCAGCGCGGAATCTTTTTTATAGGTCGAAAGCAGCTGATCGTCGGCGTCCAGT
TGGGTCTGAATCTTTTCTTTAAGTTCGGCGCTGCGTTTGGCGTCAATGCCCGGGATGCTG
GCACGCCAGAAGGTACCCATAGTTTTGCCTTCAAGAACGGTAACTTCAGTAGCGTGGGTT
TTGGCGGGTTGTGGTTTTTGATCGCAACCAACAAAGAAGAGCGCGGCAGCCAGCAGTGCC
ACGCGGGTAAAGCTTATTTCCATACGTGATTATCCTCATGCGAACGGTCGCAAGAGTACA
CCAAAAAACTGAGTTTGTACGCTGAAAACAATGAAAAAAGGGCCCGCAGGCCCTTTGTTC
GATATCAATCGAGATTAGAACTGGTAAACCAGACCCAGAGCTACGATGTTATCAGTGTTG
ATGCCAGCGTCACGAGTGAACTGGTTGTCGTCCAGCAGGTTGATTTTGTAGTCAACGTAG
GTGGACATGTTTTTGTTGAAGTAGTAGGTAGCACCAACATCAACATATTTCAGGATATCT
TCGTCGTCGTAGCCACGACCCAGGTTTTTACCTTTAGACTGCAGGTAAGCCAGGGACGGA
CGCAGACCGAAGTCGAACTGGTACTGAGCAACAGCTTCGAAGTTCTGTGCTTTGTTCGCC
CAACCCAGGGAACCTACGCGAGTTGCGTTGTAGGTCTGGGTGTACTGAGCAGCCAGGTAG
ATGTTGTTAGCGTCGTATTTCAGACCACCAGTGTAGGTTTCAGCACGGTCGCCGTTACCG
ATGTAAGCAGCGGTGTTCTGAGCATCAGTACGTTTGGAGCTGGAGATCGCACCACCGATA
CCGAAACCTTCGTAATCATAAGTGATAGAACCGCCGACGCCGTCGCCGTTTTGACGCAGT
GCGTCACGACCGTTGTTAGTTACGCCACTAGTAAAGCCTTCACCAGATGGGTTGCCGTTT
TTACCCTGGTACTGAACAGCAAAGTTCAGGCCGTCAACCAGACCGAAGAAGTCAGTGTTA
CGGTAGGTCGCGAAGCCGTTACCACGCTGCTGCATGAAGTTGTCAGAACCGTAGGTGTCA
CCACCGAATTCTGGCAGTACGTCGGTCCAGGAAGTTACGTCATAAACAACGCCGTAGTTA
CGACCGTAGTCGAAAGAACCCACATCCTGGAATTTCAGACCTGCGAATGCCACACGGGTC
CAGGAGTTGTTTTCGTTTTCAGCGCTGTTGCCCTGGATCTGATATTCCCACTGGCCGTAA
CCGGTCAGCTGGTCAGTAACCTGAGTTTCACCTTTGAAGCCAAGACGCATGTAGGTCTGG
TCGCCATCTACATCTTTGTTGTCAGAGAAATAGTGCAGGCCGTCTACTTTACCGTACAGA
TCTAATTTGTTGCCGTCTTTGTTGTAAACTTCAGCAGCGTTTGCTGCGCCTGCTACCAGC
AGAGCTGGGACCAGGAGGGACAGTACTTTAACTTTCATGTTATTAACCCTCTGTTATATG
CCTTTATTTGCTTTTTTATGCCACTGCATACTGATTAACCCTCATTAATCAGTCGGCAAG
TCCATTCTCCCCAAAAATGCAGAATAATCCAACACGAATATGATACTAAAACTTTTAAGA
TGTTTCATTTATCGCTATAGATGTTTCAAAATGTAAATGCAAGGGAACTTTTTAAGATTA
TTGCGGAATGGCGAAATAAGCACCTAACATCAAGCAATAATAATTCAAGGTTAAAATCAA
TAACTTATTCTTAAGTATTTGACAGCACTGAATGTCAAAACAAAACCTTCACTCGCAACT
AGAATAACTCCCGCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTC
TGTTTACCCCTATTTCAACCGGATGCCTCGCATTCGGTTTTTTTTACCCTTCTTTACACA
CTTTTCATTATTCTGTGCTACCACAGAAAAACTATAACGCTTGTTAACTATTTCACAAAT
AATTAACATCCGCATAATTTCCAGCAATCTTTGTTTATTTGCAATTATTTTTGTTGGGCT
TTTTGTAGGTTATTTGTACAGCAAAATGGCGCTTGTACATCTATTTCCCCCAATGCAGGA
TGATAAATATCACGGGAGAATAGAGAATCATCAATCAGGTAAGAGTCTGGAATTTCACAC
TGTACCCTTTATACTGCCCTATCACTTCGCGAAGTTTTAACAGGTCATAAACACGAATGC
GTCAGAAAGAGACAACGGCCACGACCCGCTTTTCACTCCTACCGGGGAGCATTACCCGCT
TCTTTTTACTGTTGATCATTGTGTTACTGGTGACGATGGGTGTAATGGTACAAAGCGCCG
TTAACGCCTGGCTGAAAGATAAAAGTTACCAGATTGTCGACATTACCCATGCTATCCAAA
AGCGCGTCGATAACTGGCGTTACGTGACCTGGCAGATCTACGACAACATTGCCGCGACGA
CCTCCCCCTCCTCCGGCGAAGGTTTACAAGAGACGCGCCTGAAACAGGATGTCTACTATC
TGGAGAAACCACGCCGCAAAACGGAAGCGTTAATCTTTGGCTCTCACGACAACTCAACGC
TTGAGATGACTCAGCGGATGTCCACTTATCTGGATACATTGTGGGGCGCAGAAAATGTAC
CGTGGTCGATGTATTACCTGAATGGTCAGGATAACAGTCTGGTGCTGATCTCAACCCTAC
CCCTTAAAGATCTCACCTCCGGATTTAAAGAATCGACCGTCAGCGACATTGTTGATTCAC
GTCGTGCAGAGATGTTGCAACAGGCCAACGCCCTCGATGAACGCGAAAGCTTTTCTAACA
TGCGCCGCCTGGCCTGGCAGAACGGTCATTACTTTACATTGCGTACTACCTTTAACCAGC
CAGGACATCTGGCAACGGTCGTGGCTTTTGATCTGCCGATTAATGATTTGATCCCACCGG
GTATGCCGCTGGACAGTTTCCGCCTTGAGCCAGACGCGACGGCAACGGGAAACAATGATA
ATGAGAAAGAAGGGACGGATAGCGTCAGTATCCACTTTAACAGTACGAAGATTGAAATCT
CCTCGGCACTCAACTCTACCGATATGCGCCTGGTCTGGCAGGTTCCTTATGGCACCTTAT
TGCTGGATACGTTGCAAAACATTCTGCTGCCACTGCTGCTGAACATCGGTTTGCTGGCGC
TGGCGTTATTTGGCTATACCACATTCCGCCATTTCTCCAGCCGCAGTACAGAAAACGTCC
CCAGCACGGCGGTCAATAACGAATTGCGCATTTTACGGGCAATCAATGAAGAGATAGTCT
CACTGCTGCCGCTCGGCCTGCTGGTTCACGATCAGGAATCGAACCGCACTGTCATAAGTA
ACAAAATTGCCGATCATTTGCTGCCGCATTTGAATCTGCAAAACATCACCACCATGGCGG
AACAGCATCAGGGGATTATTCAGGCGACGATCAATAACGAGCTGTATGAGATCCGCATGT
TCCGCAGCCAGGTCGCGCCGCGCACACAAATTTTCATTATTCGCGATCAGGATCGCGAAG
TGCTGGTAAACAAGAAACTCAAGCAGGCGCAGCGTCTGTATGAGAAAAACCAGCAGGGGC
GGATGATCTTTATGAAAAACATTGGCGATGCGCTGAAAGAACCCGCACAGTCCCTGGCGG
AGAGCGCGGCTAAACTCAACGCCCCGGAAAGCAAACAACTGGCGAATCAGGCAGATGTGC
TGGTGCGGCTGGTTGATGAAATACAGTTAGCGAACATGCTTGCGGATGATAGCTGGAAAA
GTGAGACGGTGCTGTTCTCCGTGCAGGATTTAATTGATGAAGTTGTGCCTTCAGTGTTGC
CTGCCATCAAGCGTAAAGGTCTGCAACTGCTGATTAACAATCATCTGAAAGCACACGATA
TGCGCCGCGGCGATCGCGATGCCTTACGACGTATTTTGCTGCTACTGATGCAATATGCCG
TGACCTCAACGCAATTGGGAAAAATCACCCTTGAGGTTGATCAGGATGAGTCCTCCGAAG
ACCGCCTGACGTTCCGCATTCTGGACACGGGAGAAGGCGTAAGTATTCATGAAATGGATA
ATTTGCACTTCCCGTTTATCAACCAGACCCAAAACGATCGCTATGGCAAGGCGGACCCGC
TGGCATTCTGGCTGAGCGATCAACTGGCACGTAAACTGGGCGGTCATTTAAACATCAAAA
CGCGGGATGGGCTTGGTACACGCTACTCTGTGCATATCAAAATGCTCGCAGCTGACCCGG
AAGTTGAAGAGGAAGAAGAGCGTTTACTGGATGATGTCTGCGTAATGGTGGATGTTACTT
CGGCAGAAATTCGGAATATTGTCACTCGCCAGTTAGAAAATTGGGGTGCAACCTGTATCA
CACCCGATGAAAGATTAATTAGTCAAGATTATGATATCTTTTTAACGGATAATCCGTCTA
ATCTTACTGCCTCTGGCTTGCTTTTAAGCGATGATGAGTCTGGCGTACGGGAAATTGGGC
CTGGTCAATTGTGCGTCAACTTCAATATGAGCAACGCTATGCAGGAAGCGGTCTTACAAT
TAATTGAAGTGCAACTGGCGCAGGAAGAGGTGACAGAATCGCCTCTGGGCGGAGATGAAA
ATGCGCAACTCCATGCCAGCGGCTATTATGCGCTCTTTGTAGACACAGTACCGGATGATG
TTAAGAGGCTGTATACTGAAGCAGCAACCAGTGACTTTGCTGCGTTAGCCCAAACGGCTC
ATCGTCTTAAAGGCGTATTTGCCATGCTAAATCTGGTACCCGGCAAGCAGTTATGTGAAA
CGCTGGAACATCTGATTCGTGAGAAGGATGTTCCAGGAATAGAAAAATACATCAGCGACA
TTGACAGTTATGTCAAGAGCTTGCTGTAGCAAGGTAGCCTATTACATGAACAATATGAAC
GTAATTATTGCCGATGACCATCCGATAGTCTTGTTCGGTATTCGCAAATCACTTGAGCAA
ATTGAGTGGGTGAATGTTGTCGGCGAATTTGAAGACTCTACAGCACTGATCAACAACCTG
CCGAAACTGGATGCGCATGTGTTGATTACCGATCTCTCCATGCCTGGCGATAAGTACGGC
GATGGCATTACCTTAATCAAGTACATCAAGCGCCATTTCCCAAGCCTGTCGATCATTGTT
CTGACTATGAACAACAACCCGGCGATTCTTAGTGCGGTATTGGATCTGGATATCGAAGGG
ATCGTGCTGAAACAAGGTGCACCGACCGATCTGCCGAAAGCTCTCGCCGCGCTGCAGAAA
GGGAAGAAATTTACCCCGGAAAGCGTTTCTCGCCTGTTGGAAAAAATCAGTGCTGGTGGT
TACGGTGACAAGCGTCTCTCGCCAAAAGAGAGTGAAGTTCTGCGCCTGTTTGCGGAAGGC
TTCCTGGTGACCGAGATCGCTAAAAAGCTGAACCGCAGTATTAAAACCATCAGTAGCCAG
AAGAAATCTGCGATGATGAAGCTGGGTGTCGAGAACGATATCGCCCTGCTGAATTATCTC
TCTTCAGTGACCTTAAGTCCGGCAGATAAAGACTAATCACCTGTAGGCCAGATAAGACGC
GTTAGTGTCTTATCTGGCATTTGCACCGATTGCCGGATGCGGCGTAAACGCCTTATCCGG
CCTACGATTCCCATTATTTCAACAAATTACATTAAAGTAGGCCAGATAAGACGCGTCAGC
GTCGCATCTGGCATTTGCACTGAATGCCGGATGCGGCGTAAACGCCTTATCCGTCCTACG
AATCCCGCGATTTCCTGACCCTCTCGGCATATAACGTCAGCGTCTGTTTTATCACATCCA
GCGTTACCGGCTTCGACAGGCAGCTGTCCATACCGGACTCCAGACACCGCTGCTTCTCTT
CAGCCAACGCATTAGCAGTTACTCCGATTACCGGCAACGTCAGTCCCAACTGACGAATGC
GTTGCGTCAAGCGGTAACCATCCATATTTGGCATGTTGACGTCGCTAAGCACGATATCAA
TATGATTCTTGCTAAGTACATTAAGCGCATCGACGCCATCATTCGCGGTTTTACATTGAT
AGCCCAACGATCCCAACTGATCTGCCAGCAAACGCCGGTTAATCGGATGATCATCCACGA
CCAGAATCATCATATCGTCATTATCGCTGACCGCTTTGTCCGTTGACGGCAGAGCGTTAG
CAGGATCGTCGCTCTCCATCTCGATCAAATAAATACGCGCCAACAATGCCGGTAGCTCAT
GCGGAGCAGCCACACTGTGTACCCACTCCCCTGGCGCTTTCTCCAGCGGAATACCAATAT
GGCGACGACAGAAGGTCACTACCGCTCTGCCCTGCCATTTTTTACTCACTACCTCGTCAG
TGATCAACACATCTTCGGGAGTCGGTTCCTGCCCTTCGTATGTTGTAACGACGATGCCGC
TGCGCTGCAAACTGGTTTCCAGGAACTGACAGAGCGACGCATTGCGGACCGCCAGCCAGC
AGCGTTTACCACTCAACCCTTCCACGCCTTTTTTCTGCGGGTACTGAGCGCCGTACAACG
GAATACGCACGGTAAACTGGCTGCCCATTCCCGGTTCTGAATCTACCGAGATATCGCCGT
CCATCATGCTGATCAGTTTTTCACAAATCGCCAGACCCAGACCGGTCCCCTGGAAATTAC
GCTGTACGCCCGTTCCGACCTGGAAGAAGGGATCAAACAAGCGCACCACTTCTTTCGCCG
GTATCCCCACGCCGGTATCGCGAACACGGATAGAGAGATAATCGCCATCCGCGCGAACAT
GCAAAACTATACAGCCGGTATCGGTGAATTTTATGGCGTTACTCAACAGGTTGGAGATGA
CCTGCTGTAAACGCATCGGGTCGCCATTTAAGGCCACTGGCACATCCGGTTCAATAAAGC
AGTACAAGCCTAACTGCTTGCGTACCACCAGCGGTAAATAGTTGGCGGTGATGTGGTTCA
TCACTTCACGCGGTGAAAACTCACGCGGTTCGATCTTCAACTGTTCCGATTCAATCTTCG
AGAAATCGAGAATATCGCTGATAATTTTCAACAACAGGCTGGAAGAGTTGTTCATTGCCG
TCACCAGCCGATCGACGCCTTTCGGTAACTCTTTGGTTTGCAACAGATCCAGGTTACCGA
TAATGCCATACAGCGGCGTTCGCAGCTCATGACTGACGGTGGCAAGGAACATCGATTTTG
ACTGGCTCGCCTGTTCCGCTGCTTGTGCCATCTCCTGCAACGACTCTTCCATCTTCACGC
GCGAAGAAACATCCACCAGCACACAAATGGCCACGTTTTCATTACGATAGCGCGAATGGA
CGAAGCTGATTTGCAGATTGGTATTGTTGCTGGTCAGGACATCAACAAAATTGACCTGCT
GCCCACAGATAATTTGCGTCAGTCGTTGGCGGTCCTCATGCGTAAGCATATTGAGATAGG
TATGCGCCAGTTCGTTACTTAAAATATTGACGCCATCAGCGGTACGCAAAATGCAGATAC
CCACTGGCGCGGAGGCGACAATCTTGCGATTGAACTGCTCATGTTCTTCCAGTCGCAGGG
CGTCGCTTTCCGCCGGAATGAAAATACGTCGCTCGTACATCCGTGCGAGAGTAAACAATG
CAGCTCCGGCAAGCACATTCAGCAAAATTGCGTTAAGGATCAACATGCGAATGCGTTCCA
GCACCTTATCAACCGGCACCGAATACACGATGCTTAGCGATGAGGGTGGCAGATTTTTCT
TCAGCACCAGCTCCCGGAACCCTTCCGTATAGCCAAACCAGGAGCGTTCCTGCATCCAGC
GAGGATCGCCCTTAATTTTACTTTCTGGTCCGGTAAGCGAAATCAGGGTATGACCATTTT
CATCAAGAATGGTAACCCCCATCGGCAACGTACCCGGTAAGAAAAAGTTCTCCATCCGGA
TGGTCTGCTCGACACCCAAAAGCGCCTGCAACCGGTTCGCCAGATAAACTGGCGTCAACG
CGTAAAAATACCCGACGCCAGGGCGCGGACCTTCGCTGATCCAGTAGAGGTTACTGCCGC
TATCATCTTGTGGTGCATTTCGATATTTATTGATGCGTTCATGCAAAGCTTTCAACGCGG
TATCGCGTTCCACTGGCATATCACGCAGACCGAAATTGGCCATGCAGAGGTTATCGCTGC
CGATTAAAAATACCCGGTTTAGATCGTAAGCCGCAGAAAAATTATCGCGCCAGTAGCGCA
TAAACCACGCCAATGACTCCAGAGAACCTCGCCAGGTGTTACTCATTGCGGAACAATCGG
AGTCGGCAAACAGCGGTTCAAACGCAGGCACATCCGCCTGCGTTTCTCGTCCACGCGGGG
AAAGCACACCGTTTTCTGCCGATAAGCGATTTTCGGCGATGTACTTCAGCTCTTTCATCA
CATCAGAGGTGCGTTGAATAAAGCGCTGAGCCTGATCGGAACTCAGATTAAATTCCTGAC
GAATTTCCGATTCTCGCTGATGTAACGCATTAACGATGTAAAAAACGGATGAAAAAGCAA
TCAACAGCCAGAGCACTAACGCCAATGCTCTGAACATGTAGCGCGAGGCTTTCAGGGTTG
TACGAAAAGAAGCAAGGTATTTCAAAGGGGCGAAGCTCCGCCTCAGGTGACCGATGGAGT
GTGGTTAAGGTAGCGGTAAAAGCGTGTTACCGCAATGTTCTCTCTTCTCTGGAATATGAT
ACACCGCCGAGAAATCATCACCTTAACCTCTGATAATCGTCATATACCGGACAAGACTAG
TGGATTTCAGCATGCATTATATGAAGTGGATTTATCCACGCCGCTTACGCAATCAAATGA
TCCTGATGGCAATCCTGATGGTCATTGTCCCAACGCTTACTATTGGTTATATCGTAGAAA
CGGAAGGACGTTCAGCAGTCTTATCTGAAAAAGAGAAAAAACTTTCTGCCGTGGTCAACC
TGCTTAATCAGGCACTAGGCGATCGCTATGATCTCTACATCGACTTACCACGTGAGGAGC
GTATCCGCGCATTAAATGCAGAACTTGCCCCCATTACCGAAAATATCACTCACGCCTTCC
CTGGCATCGGTGCTGGTTATTACAACAAAATGCTGGATGCGATAATCACCTACGCGCCTT
CAGCGCTATATCAGAATAATGTCGGCGTTACCATTGCCGCAGATCACCCTGGTCGCGAAG
TGATGCGTACAAATACCCCTTTAGTTTATTCAGGCAGGCAGGTGCGCGGCGATATTTTGA
ATTCAATGCTCCCCATTGAGCGTAATGGTGAAATCCTCGGCTATATCTGGGCCAATGAAT
TAACCGAAGATATTCGCCGCCAGGCCTGGAAAATGGATGTGAGGATTATCATTGTGCTCA
CCGCTGGTTTGCTGATAAGCCTGCTGTTGATTGTCCTTTTCTCCCGTCGCCTGAGCGCCA
ATATTGATATCATCACCGATGGCCTCTCGACTCTGGCACAAAATATTCCCACTCGATTAC
CACAATTGCCCGGTGAAATGGGGCAAATCAGTCAGAGTGTTAATAACCTCGCCCAGGCAC
TGCGTGAAACGCGGACACTTAACGATCTGATTATTGAAAACGCTGCCGATGGCGTCATTG
CCATTGACCGCCAGGGTGATGTAACCACCATGAACCCAGCAGCAGAAGTTATCACTGGCT
ATCAACGCCATGAACTGGTAGGGCAGCCTTACTCCATGTTGTTCGACAATACTCAGTTCT
ACAGTCCAGTACTGGATACGCTGGAACATGGCACCGAACATGTGGCGCTGGAGATCAGTT
TTCCAGGTCGTGACCGCACCATTGAACTCAGTGTCACTACCAGTCGTATTCATAACACGC
ACGGTGAAATGATAGGTGCTTTGGTGATTTTCTCTGATTTAACTGCCCGCAAAGAAACCC
AGCGCCGCATGGCGCAAGCAGAACGCCTCGCCACACTGGGTGAGCTGATGGCTGGCGTCG
CGCATGAAGTACGTAATCCGTTAACGGCTATTCGTGGTTATGTACAGATCTTGCGCCAAC
AAACCAGTGACCCAATACATCAGGAATATCTGTCCGTAGTACTCAAAGAAATCGATTCAA
TTAACAAAGTTATTCAGCAATTGCTCGAATTTTCACGTCCACGCCACAGTCAATGGCAAC
AAGTCAGCCTCAATGCATTGGTTGAAGAAACTCTGGTACTGGTACAAACCGCCGGCGTAC
AAGCGCGGGTCGACTTCATAAGCGAACTGGATAATGAATTAAGCCCGATTAACGCCGATC
GTGAACTGCTCAAACAGGTACTACTGAATATCCTGATCAATGCCGTCCAGGCTATCAGCG
CACGAGGGAAAATTCGCATTCAAACCTGGCAATACAGCGACTCACAACAGGCCATTTCGA
TAGAGGACAACGGCTGTGGCATTGATCTCTCGCTGCAAAAAAAGATCTTCGATCCCTTTT
TCACCACCAAAGCCTCAGGAACCGGGCTTGGTCTGGCGTTAAGTCAACGCATCATTAATG
CCCATCAGGGTGATATTCGCGTCGCCAGTTTGCCGGGCTACGGCGCAACCTTCACGCTTA
TTTTACCGATCAACCCGCAGGGAAATCAGACTGTATGACTGCTATTAATCGCATCCTTAT
TGTGGATGATGAAGATAATGTTCGCCGTATGCTGAGCACCGCTTTTGCACTACAAGGATT
CGAAACACATTGTGCGAACAACGGACGCACAGCATTACACCTGTTTGCCGATATTCACCC
TGATGTGGTGTTGATGGATATCCGCATGCCAGAGATGGACGGCATCAAGGCACTAAAGGA
GATGCGCAGCCATGAGACCCGGACACCCGTTATTCTGATGACGGCCTATGCGGAAGTGGA
AACCGCCGTCGAAGCGCTACGCTGCGGAGCCTTCGACTATGTTATTAAACCGTTTGATCT
CGATGAGTTGAATTTAATCGTTCAGCGCGCTTTACAACTCCAGTCAATGAAAAAAGAGAT
CCGTCATCTGCACCAGGCACTGAGCACCAGCTGGCAATGGGGGCACATTCTCACCAACAG
CCCGGCGATGATGGACATCTGCAAAGACACCGCCAAAATTGCCCTTTCTCAGGCCAGCGT
CTTGATTAGCGGTGAAAGCGGCACCGGGAAAGAGTTGATTGCCAGAGCGATTCACTACAA
TTCGCGGCGGGCAAAGGGGCCGTTCATTAAAGTCAACTGCGCGGCGCTGCCGGAATCGTT
GCTCGAAAGTGAACTGTTTGGTCATGAAAAAGGTGCATTTACTGGTGCACAAACCTTGCG
TCAGGGATTATTTGAACGAGCCAACGAAGGTACTCTGCTCCTCGACGAAATTGGCGAAAT
GCCGCTGGTACTACAAGCCAAATTACTACGCATTCTACAGGAACGGGAATTTGAACGGAT
TGGCGGCCATCAGACCATAAAAGTTGATATCCGCATCATTGCTGCCACCAACCGCGACTT
GCAGGCAATGGTAAAAGAAGGCACCTTCCGTGAAGATCTCTTTTATCGCCTTAACGTTAT
TCATTTAATACTGCCGCCTCTGCGCGATCGCCGGGAAGATATTTCCCTGTTAGCTAATCA
CTTTTTGCAAAAATTCAGTAGTGAGAATCAGCGCGATATTATCGACATCGATCCGATGGC
AATGTCACTGCTTACCGCCTGGTCATGGCCGGGAAATATTCGAGAGCTTTCCAACGTTAT
TGAACGCGCCGTCGTGATGAATTCAGGCCCGATCATTTTTTCTGAGGATCTTCCGCCACA
GATTCGTCAGCCAGTCTGTAATGCTGGCGAGGTAAAAACAGCCCCTGTCGGTGAGCGTAA
TTTAAAAGAGGAAATTAAACGCGTCGAAAAACGCATCATTATGGAAGTGCTGGAACAACA
AGAAGGAAACCGAACCCGCACTGCTTTAATGCTGGGCATCAGTCGCCGTGCATTGATGTA
TAAACTCCAGGAATACGGTATCGATCCGGCGGATGTATAACACCAAAACTTGCTATGCAG
AAATTTGCACAGTGCGCAATTTTCTGCATAGCCGCTCATTCTCCTTATAAATCCCCATCC
AATTTATCCCTTCATATTCAATTAGTTAAATAACTAAATCCAATAATCTCATTCTGGCAC
TCCCCTTGCTATTGCCTGACTGTACCCACAACGGTGTATGCAAGAGGGATAAAAAATGAA
AACAAAATTGATGACATTACAAGACGCCACCGGCTTCTTTCGTGACGGCATGACCATCAT
GGTGGGCGGATTTATGGGGATTGGCACTCCATCCCGCCTGGTTGAAGCATTACTGGAATC
TGGTGTTCGCGACCTGACATTGATAGCCAATGATACCGCGTTTGTTGATACCGGCATCGG
TCCGCTCATCGTCAATGGTCGAGTCCGCAAAGTGATTGCTTCACATATCGGCACCAACCC
GGAAACAGGTCGGCGCATGATATCTGGTGAGATGGACGTCGTTCTGGTGCCGCAAGGTAC
GCTAATCGAGCAAATTCGCTGTGGTGGAGCTGGACTTGGTGGTTTTCTCACCCCAACGGG
TGTCGGCACCGTCGTAGAGGAAGGCAAACAGACACTGACACTCGACGGTAAAACCTGGCT
GCTCGAACGCCCACTGCGCGCCGACCTGGCGCTAATTCGCGCTCATCGTTGCGACACACT
TGGCAACCTGACCTATCAACTTAGCGCCCGCAACTTTAACCCCCTGATAGCCCTTGCGGC
TGATATCACGCTGGTAGAGCCAGATGAACTGGTCGAAACCGGCGAGCTGCAACCTGACCA
TATTGTCACCCCTGGTGCCGTTATCGACCACATCATCGTTTCACAGGAGAGCAAATAATG
GATGCGAAACAACGTATTGCGCGCCGTGTGGCGCAAGAGCTTCGTGATGGTGACATCGTT
AACTTAGGGATCGGTTTACCCACAATGGTCGCCAATTATTTACCGGAGGGTATTCATATC
ACTCTGCAATCGGAAAACGGCTTCCTCGGTTTAGGCCCGGTCACGACAGCGCATCCAGAT
CTGGTGAACGCTGGCGGGCAACCGTGCGGTGTTTTACCCGGTGCAGCCATGTTTGATAGC
GCCATGTCATTTGCGCTAATCCGTGGCGGTCATATTGATGCCTGCGTGCTCGGCGGTTTG
CAAGTAGACGAAGAAGCAAACCTCGCGAACTGGGTAGTGCCTGGGAAAATGGTGCCCGGT
ATGGGTGGCGCGATGGATCTGGTGACCGGGTCGCGCAAAGTGATCATCGCCATGGAACAT
TGCGCCAAAGATGGTTCAGCAAAAATTTTGCGCCGCTGCACCATGCCACTCACTGCGCAA
CATGCGGTGCATATGCTGGTTACTGAACTGGCTGTCTTTCGTTTTATTGACGGCAAAATG
TGGCTCACCGAAATTGCCGACGGGTGTGATTTAGCCACCGTGCGTGCCAAAACAGAAGCT
CGGTTTGAAGTCGCCGCCGATCTGAATACGCAACGGGGTGATTTATGATTGGTCGCATAT
CGCGTTTTATGACGCGTTTTGTCAGCCGGTGGCTTCCCGATCCACTGATCTTTGCCATGT
TGCTGACATTGCTAACATTCGTGATCGCGCTTTGGTTAACACCACAAACGCCGATCAGCA
TGGTGAAAATGTGGGGTGACGGTTTCTGGAACTTGCTGGCGTTTGGTATGCAGATGGCGC
TTATCATCGTTACCGGTCATGCCCTTGCCAGCTCTGCTCCGGTGAAAAGTTTGCTGCGTA
CTGCCGCCTCCGCCGCAAAGACGCCCGTACAGGGCGTCATGCTGGTCACTTTCTTCGGTT
CAGTCGCTTGTGTCATCAACTGGGGATTTGGTTTGGTTGTCGGCGCAATGTTTGCCCGTG
AAGTCGCCCGGCGAGTCCCCGGTTCTGATTATCCGTTGCTCATTGCCTGCGCCTACATTG
GTTTTCTCACCTGGGGTGGCGGCTTCTCTGGATCAATGCCTCTGTTGGCTGCAACACCGG
GCAACCCGGTTGAGCATATCGCCGGGCTGATCCCGGTGGGCGATACTCTGTTCAGTGGTT
TTAACATTTTCATCACTGTGGCGTTGATTGTGGTGATGCCATTTATCACCCGCATGATGA
TGCCAAAACCGTCTGACGTGGTGAGTATCGATCCAAAACTACTCATGGAAGAGGCTGATT
TTCAAAAGCAGCTACCGAAAGATGCCCCACCATCCGAGCGACTGGAAGAAAGCCGCATTC
TGACGTTGATCATCGGCGCACTCGGTATCGCTTACCTTGCGATGTACTTCAGCGAACATG
GCTTCAACATCACCATCAATACCGTCAACCTGATGTTTATGATTGCGGGTCTGCTGCTAC
ATAAAACGCCAATGGCTTATATGCGTGCTATCAGCGCGGCAGCACGCAGTACTGCCGGTA
TTCTGGTGCAATTCCCCTTCTACGCTGGGATCCAACTGATGATGGAGCATTCCGGTCTGG
GCGGACTCATTACCGAATTCTTCATCAATGTTGCGAACAAAGACACCTTCCCGGTAATGA
CCTTTTTTAGTTCTGCACTGATTAACTTCGCCGTTCCGTCTGGCGGCGGTCACTGGGTTA
TTCAGGGACCTTTCGTGATACCCGCAGCCCAGGCGCTGGGCGCTGATCTCGGTAAATCGG
TAATGGCGATCGCCTACGGCGAGCAATGGATGAACATGGCACAACCATTCTGGGCGCTGC
CAGCACTGGCAATCGCCGGACTCGGTGTCCGCGACATCATGGGCTACTGCATCACTGCCC
TGCTCTTCTCCGGTGTCATTTTCGTCATTGGTTTAACGCTGTTCTGACGGCACCCCTACA
AACAGAAGGAATATAAAATGAAAAATTGTGTCATCGTCAGTGCGGTACGTACTGCTATCG
GTAGTTTTAACGGTTCACTCGCTTCCACCAGCGCCATCGACCTGGGGGCGACAGTAATTA
AAGCCGCCATTGAACGTGCAAAAATCGATTCACAACACGTTGATGAAGTGATTATGGGTA
ACGTGTTACAAGCCGGGCTGGGGCAAAATCCGGCGCGTCAGGCACTGTTAAAAAGCGGGC
TGGCAGAAACGGTGTGCGGATTCACGGTCAATAAAGTATGTGGTTCGGGTCTTAAAAGTG
TGGCGCTTGCCGCCCAGGCCATTCAGGCAGGTCAGGCGCAGAGCATTGTGGCGGGGGGTA
TGGAAAATATGAGTTTAGCCCCCTACTTACTCGATGCAAAAGCACGCTCTGGTTATCGTC
TTGGAGACGGACAGGTTTATGACGTAATCCTGCGCGATGGCCTGATGTGCGCCACCCATG
GTTATCATATGGGGATTACCGCCGAAAACGTGGCTAAAGAGTACGGAATTACCCGTGAAA
TGCAGGATGAACTGGCGCTACATTCACAGCGTAAAGCGGCAGCCGCAATTGAGTCCGGTG
CTTTTACAGCCGAAATCGTCCCGGTAAATGTTGTCACTCGAAAGAAAACCTTCGTCTTCA
GTCAAGACGAATTCCCGAAAGCGAATTCAACGGCTGAAGCGTTAGGTGCATTGCGCCCGG
CCTTCGATAAAGCAGGAACAGTCACCGCTGGGAACGCGTCTGGTATTAACGACGGTGCTG
CCGCTCTGGTGATTATGGAAGAATCTGCGGCGCTGGCAGCAGGCCTTACCCCCCTGGCTC
GCATTAAAAGTTATGCCAGCGGTGGCGTGCCCCCCGCATTGATGGGTATGGGGCCAGTAC
CTGCCACGCAAAAAGCGTTACAACTGGCGGGGCTGCAACTGGCGGATATTGATCTCATTG
AGGCTAATGAAGCATTTGCTGCACAGTTCCTTGCCGTTGGGAAAAACCTGGGCTTTGATT
CTGAGAAAGTGAATGTCAACGGCGGGGCCATCGCGCTCGGGCATCCTATCGGTGCCAGTG
GTGCTCGTATTCTGGTCACACTATTACATGCCATGCAGGCACGCGATAAAACGCTGGGGC
TGGCAACACTGTGCATTGGCGGCGGTCAGGGAATTGCGATGGTGATTGAACGGTTGAATT
AATCAATAAAAACACCCGATAGCGAAAGTTATCGGGTGTTTTCTTGAACATCGACGGCGA
AGGTAACCCCATTAATCACCAGTCAAAACTTTTCACCAGCGTCAGCTCGCCAGCATTACG
CATCGGTACAATAAATGTTTCCTGTTTCTCATTGACCGATCCTTCATCGGTGATCAGCGT
CAGTTGGGCGGTGGTTAATTCCGTTTCGCTGCGCCCACCATAGTAGTTGATATACACCTG
ATAGCGCCCGTGAATTGGCGCGGGCATGGCGAAAATCTCGGGTCCGTACCCCGTCGTGAC
ATCCATATCCAGTGCACCACTGTTTTTCAGCACGGTGTTACCGTACCAGGCGTGTTCGCC
ATCGGGCGTAACAACGTGAAGGTCGAGGTCGGTATTGTCCGTATCCCACGAGAGAACCAG
CCGTAAACGTGCACGAATCGTTCCTGTACCCGGCGTTGAGTAAAACTGCATTTTTTGTCG
GCTTTGCCCATCCGGGCTGATGACCTGCACGCTGTTGCTGCCTTCAGTGAAAATATAAGG
GCGTGCAAATGAACCATCGGATTCAATTCTCTGCGGCATACTGGCACCGTTGACCACCAG
CCGGCCCTGCTGAACTTTACCCGCCGCAGCATAATTCTTTATTTTGCCGCGGATCTGCGC
TGAGATATTTTGATCATCTGCCATGTTGACGGACGACGCCGGGTAATTGATCGATTGTGA
AAAACTGGCATCTTCGCCCTCTGCCGGATGCCAGCCTGAGAGCGGTGCATCAATCTCGAC
TTCCTGCACACCTTCACTGTGAGCGACAGGCGAAAGCGCCACCAGTAACAACGGAAGAAA
AATCTTTCGCATAGCATTAGTCCATTAATAATTGTCGGGTCAGCGTTTCGATATAGTTCT
CATCAAGCCCGGTGGGATAACCATCAAAGGCCAGGTGCAGATACTCATGGGTTAAATCCA
GCCGATCCTGAAGCGTAAAGAAGTTACGAATAAACAGCCGTTTCTGCTGCCGATCGGTAT
AGGGGAAACCTGAGACTAAACGGCAAACCGCAAACACGTCTGGTTCGTTGTACCCCGTCT
CAGCTTGTAATATACGCCGCCACTGCGGCATTTTTTTCGCCAGCCAGGCTTTCGCTTTGG
GTAATAACTGGCAGGTTGAGCGTGGCGCTCCCCAGCGGCTAAGACTGTTGTCGGGATAAG
CAAACGCGAGTATCTGATCGTAACGCTCTCCCTGCCCCGCCTGGGCCGTGGCTTGCCGCC
AGGAAAGTGTCCCTTCGGTAGCGCGACTGCCATGATAATGAACCGGATCGCCTGCATAGA
TGAGATCCTGCGTCCAGGCGGTCATCGTTCGCGCCCCCGTGGTCGCTGGCGAAGCAGAAA
CACGCTGCGTGGCGCTGCTGTCGGGGATGGTCAGGCAATCGCCTTCCCGATTGGCGTTTT
GCTGTAAAAAAGTGCGAATCGCCACGGTCATGGCTTTCGCTGCCTCAGGGGGCGTACTTT
TCGCCTCGCGATCCAGAACTCTGGCAACGTACTCTTCACGATCGAGATGCGACTGCAATT
TCAGTTTGCCCTTTTCGCTCAGTAAGGTCGTCTCACCGTGGCTGACAAACGTAATGTGGT
TACCATTAGTAAACGTCACACGATAGCGCCCATTAAGTACGCCGGGATTTACTGCCGTCG
TACTCTTTTCCGCTGTGATTTTCTTCAGCGGATAGCGGGCAAACAGCTCCACCTCTACAC
ATTGCCCACTGGCAACCTGCGTCGGCACTGGCAAAACCCGATTAAGCACCGTCGCATAAC
GGGTTAGTACCGTTTTGCTGGTGCCACTGCCAGTAACCCACAGCGGTGTACCATCGGTTA
ACCAGCCAGCAAAACCACCCTGACGGATTTCCTGTTTATCATCGGCAAACCAGCTCCAGG
TTTTCACCCGTACCCGACTACCGAGCATGGATGCGACACCGATTTTCGCCTCGTCCAGCA
CCACATCCAGTAAGACTTCCTGAGCTTTGTTTTGCGCGGGTAACGTCGCTAATGAATCAA
GCAGCGATTTAACCGTTACCGAGGTTTCTGGCTTCAGCGTAGTCAGAGACGCTAACCACG
CAGGTGCCTGACGCTGTTGCCAGTATTGCCCCCACACATCTGCGCCAATATGCAACCGCT
GCGGCGCAAAATAGAGCCCACAGGAACGTACCAGCGCGGTATCGCGCGTTATGCTCTCCC
CAGCCTGACAACAATAAACCTCTTCCGGGGAGTTTCCGCGACACTGGTAGGGCTGCTCCG
GTTGATGGGTATCCTCCAGCCAGGCGTAAACATACAGTTTCCACAAACTCCCTAACGGCG
TGGTGAGCGAGTCAGGTAATGCTGAGACTTTGGTCACGCCTGATGACGACAGCTGATACA
GTTGATCGTGCTGCGCACCGCGCAGCACCAGTTGTAACGGCGTCTCCTCCGCAAGTGTTG
GCAGAGTAACCAACGCCAATAGCCAGACGATTCTGCGCCAGTTCACTTATTTCACCTGCA
TCCCGGTCCATTCACTCCCTGCCGCAACACTTTGCTGCGCAGGTGCATAGGAACGCACAT
AACGAGCAGGAGGCAGAACGAATTGCCCTTTTTGCGAGAAGCGCAGCAAATGGCGGAAAG
TGACCGTTCCCGTCAGTTCTTTCACCGGCACCATATAGGCCAGTTCGCCCATTTCATTTC
GCGCTTTTTCCAGCAATTGCCCCTGCTGTTTCGCGGCGTTGGGTTTATTGACCGAAATGC
CCCATGTTGTGCGCTCAACGTCGGCTCCCGGTGGCAGCGGTACTTCCACCTGACCGTAGC
GCAGAACTGCATCCTGCTCGCTGGTAAGCGTGATTTCATCGAGATACAGCGCATCGCTGT
CAATCTCATTGCTGGTCACCGGTTGCAGAATAAAGCTCATCTCTTCTTCACCAGGGATAA
GCCGATACAACTGGCGTTCAACGGTCACCGGAATGTTACTTTGTTGAGCCATTTTTGCCG
GCTCACGTCAGCGGACCTGCACATTTTGCGGCGATAATTCGTCACCAAAAGAGAGAATGT
CCGGCACGCCCTGACCAACCCAACGCCAGTCTTCGCCCCCTCCAGTTAACTTATGTTTAG
CCCATGCGCCCGCAGGCGCAGGCAAAACAACTGGAGGCATTGTCGCCATATATTTCGCCA
GCCAGTTCATGGCCAGCGCGCGCTCAATAGTGGATTGCTCAGCGGTCAAACCACTTAAAA
TAGCGGCCGTCTGGGTAGCGTCGCCACCGCTATTAAGCAGCACAACCGTGTGCGCCAGCG
GCTGATTGCTGTTTGCCGCTTTATCCCACGCATATTGCTGAACCTGTGGCATCACCGTGG
ACTTCAACTGCGCTTTTTTCAGCAACGTCATGGTTAAGACGTTTGCCACCGCATCTGCCA
GTGGAGACTCCGGTGTATCGAGGATCAGGCTATCATTGATATCGCGGGTGTCTTCCTCAG
AGAAATCTTCAGTTTTAGTTCCGCGCCGGGCGATAGCTTCATCCAACCCTTTCAACAACG
TTTTGCACGGCAAATTCATCTCCTGCGCCCATGCCAGCACCAGCGCCCGATGCAATAACG
GCATGTTATCTGCCTGCTCCGCGTAGCTGTCGAGCATATGCTGCCAGTATTCCGGTTGTT
GCGTTACGCCGATCGCCTGGCTGGCCTGCCAGTCGGCGTACCATGCCCATGCCGTAAGGA
AGGCGTCACCATTGCCATCTTCACCCCACCAGGTAAAGCGCGCTCCGGGCCCCGCCAGTT
GCATCAGCCGCAGACGGTTATCCTGAATCATCTGACGAATGTCGTTAGCGGCGGCACTTT
GATGATCGGCAAGCGAACGCCAGGCGAGACTGAGCGGGATCAGACGGCTACCGGTGTTGA
TTACGCCACCCCACGGTTCATCGACTAACGCATCAAGATTGTTGCGGAAAATCTCCTGCG
GCGTTTCACTACTTTGTAGCCGGATATTGCTCGCCTGCTCGGGCAACATCAGCGCGTTAT
CGCCACCACCGAGCATGACATTTTTCTGCTGTTCAACGGGCCAGCTGTTATCCACAAAAG
ACAGTTTTGTGCTAATGCTGTCCTGCACTTGCCCATTTTGTTGCAGTTCTGCACTTAACA
AGCCAGATTGCTGAATATTCTGCGTCAGCGAAATATAATTCGCCCCTTTGTGCAGCGTCA
GCGTCTGGCGCATCTCAGCGCCTGCAAATTTAGTCACCAGCGCCACCGGTTCGTTATCCT
GCTGACTGAAGATAAACAGTCCTGCCGCCGGTTTGTCGCCCACGCGATACACCGTTGGCA
TACTCCACTTCATGTAGAGATTTTTTTCCGAACGCAGATAAGCACGCCCCTGCCCGACCA
GCCCGTCGCCGTTCATCCCACGCGCGGTGATACGCCAGCGGGTTAACGAATCAGGCATCA
GGAACGTGAAATACGCTTTGCCTTGTTTATCGGTTGTGAGTGACGGCATCCATGCCGCGG
TATCCACCTCTTCACGCCGTGGACGTTCAAGCATTTTTACTCGCCGCTCGCTGCGGTTAG
TTGCGCCAGGCGCAACCGGCTCGCTGGAGAGCGCCTGGTCGTAGCTGATAAACGACAGAC
TGGAGCTGGTACGCACATTGTTACGCCCCAGCGGATAGAAAAATTTGCCGATATTCGGCG
CGATTTCTGGTTGCAGCGCGTAGATCATTTCATCGACCACGCCTACCGTTAGCTGCGCAG
AAACAGGTTTACCTTTCAGCGACGAGGTTAATTCGACATTGACCAGTTCACCAGGCTGGT
AATGGGTTTTGTCCGTTTTCACCCGGATATCCAGCTGGGGAACGGCAACTTTGATCCCGG
CGTTCTGAAAACTGTACTGACCGTTACGGGTATACAGCACCGAAAAAGTGATGTTAGGCG
CAAAGGAATTGCTCACTGGAACCCGGGCTTCATACTGGGTATCGTTTAAACGTTGTAGCG
TTAGCCAGTTTGCCGGATGCGAAAGCAGCGACTGCTGTTCCACGCGATCGCGTTCCAGCG
TCAATAATGCTTCATCAATTGGCTCCGGAAAGGTAATCAGCATCTTCGCGGTTTCGCCTG
GCTGGTACAGCGTTTTATCCGCCACGATATCTACCGTACCAGTATGCGCCGTGCTGCCCT
TACCGCTGACGGCATGACTTAACCCAGCGAGAATTAAGCCGTCTTTATCGCGTAATGTCA
GATTGTAGTTGCCAGGTTTAGCGAAATTGACGGTAAAGGATTTGCCGCCTGACGGTAGCT
CTCCGCTATGGCTCGTGCGGTCTTCGAGACGCAACCATTCATACGTAACAGGAACCTGTT
TTGAAGATTCCAGCGCGGCATAACGGAACACAACCGACTCGCCGCTATTACTGTATTGTG
CGGCAGTACTTAATGAGTAATGCGCCAGACCGCGTTCAATGAGGATCTCTTTGGTGGTGG
TGACGCGATACGCCGCGCCGTCACTGGCGGAGACGGTTAACAAATAGCGGCTCGGTTTAT
CGGCGGCGGGGAGATTTAACGCCACATGACCGCTGGCGTCGGACACCGTTTCGCTGCCTT
CCAGCGACACGGGGAAACGTCCGGCATAACGCAAATCGTTACCGACCATTGATAATTGCT
GAGCGCGCAAACTTAACTGCACGCGGGCATTTTTTACCGGCTCGCCATCCGGGTAGAGCA
GTTGCAGTTTGCCGCTGACCGCTTCGCCAGTTTTGAACTCTTTTTTGGCGAGAGCTAAAC
CAATCTCGAAATGTGGCTTGATGTAGTTTGCCACGCGAAAACTGCTGCTATAGACCTGAT
TGCGGTAAGCAAGACGTAACTCATAACCTCCGGCTACGGCATTTTCTGGCAGGCGGAAAC
TTCCCTGCCCGCCATTGCGCGCATCCAGCGTGACATTGACGGTTTGCAACAGACTGCCGT
TGGCGTCCAGCACCGAAAGCTTCGCCGGGGCGCTGACGATGGGGGATGAATGCAACGGAT
CGTGGAACTCGCGGCCGATCACTTTAACATCGACACGATCGCCTGCGCGATATAGCGGGC
GATCGGTAAAAATATACAAGCGGGTGTTGTAGATTTCGCTTTCGTAGAAGAAGTTCTCGG
AGACAAAAACGCCGCCTTCAGCATCCTTACCCAGAATGTATGAACGTTCTGGCGATATAT
GTTGTAACTGCAAGGTACCGCTGTCATCGGTCACACCGCGGGTCATCACGCCAAGACCGT
CAGTCCACAAGATCTCTGAGCCGGGCTTCGCTTCACCCTGTTTTTTACCCGCGGTCCACA
CCAGAAGCTCTTTGCCTGACACTTTGCTAAGCGCCACGGTATCGGAAACAAACACCACCG
TCGTCGCCCGATACCCACCAACCATCGCCTCGACGAGGTACAGTCCCGGCTCTTGTTGGC
CGAGAGGAATATAAATGTTACCCGGCTGCGGCGAGATGAAATTGCTGGATGCGCCTTCCA
GTTTTACCCCTTGCTGCGGCTCGAACGGTTTAGCCTGCCATAGTGGATAACGGAACTGTT
TCACCAGGGGATATTTTTTCAGCGGGGAAAACTGGTTGTTCTGTACATAACGGGAAGGTT
TAATAATGGCATTGCCGAGCTGTAATTCGGGTAACGCCTGAGTCACATTCTGCCGTGACT
GAGAAGAGAAAGTACGCTGCATCACGCGGCGAGATTTGCCGTACCAGTTATCCCACAGCC
AGGTTAGCGTATTGTTCAGCCCGTCGCCCAGATATTGCGGTTGCACCACAATGCGATGCA
GGTTTTTCTGCTGGCGCAAAAATGCCATCGGGTCAGGAATACGATACAGGCGAACGTCCA
CGCCGCCGTACTCTTCCATCTGATAGCGCCGATAATCACGCCCCGGCGCTTCCAGTCGCA
CTTTCGCCTCTTCACTGCTGCTAAAACTGCTGTCAGCAAGCAAAAAGAATGTTCCCCCGG
CAGGCGGCGCATAGTTGCTGGAAGGAAGCGAATCATCAGCATTAGCAAGCCCTGTTCCCA
CAAGAGACAGGGACAAGCACGCTGCTATCGCGCCAGAAAATTTAAACGATAAATGCCAAT
GAAATTGGGATTGGAATCGTTGGGTATCCATCGGGTGTCCTTCCATGTCATAAGTTGTTG
CAGACTGACTGCGCGCATTCCGTTGTCAGTTTTCGTGGCGCTTCCGGTGTGGTAGATGAC
GTAACGCCCCATCCAGACCATTAAGTGCTGGGCATCGCCCTGATCGAAAAAAATCATATC
GCCAGGCAGCGCCTGGTTTATGTCCTGGCCAATAAACTGGCTGTTGTACTGAATCAAATT
AATCGCGGTCACATAGGGGCCGGTTTTCCCGTTCCCCTGATTCCAGTTTTGCGCCAGTTG
ACGCTGTTCAGGTGTTAGCGTCATCTCTGGCGGCAAATACTGGCTAGATAAACCGTTACT
TTTTAGCCATTTACTGTCGTGAACTTTCAGCGTCTCGTTCGCCGCAAATCGCACCAGGCC
CGCACAATCCTGCTGATACCAGCGTGGACTTGGCCCCTGGCGGAGCTGTTCTTGTGCAAT
GCGTACAAACCAGGCGCGAAACAGCCCGGATTGTTCGACATTCAGCATTTCGCTATGGGC
AACAACACAACACAGCCAGCAAATCAGCGCCAGCAGCCCGTGCCTCATAGCGGCTGCCAG
GTTATGGGTAGCCACTGCCAGGCGGCACCGGGTTCCATCTGGGCCAGCTTCATGACATAA
CGCGGTTGTTGAGATAAAGCGTCCAGCTTCGGCATTAATAAAGTTTGTGCGGCGTTATAA
AAAACCGGTTCGAGATTCTTCGGCAGACTGGTCAACGTTTCGTTACGCAGCAGTTTCGCT
ATTCCTTGTGGATTGATATAGAGCGGAACGATGCCATCAGTGGGTATTACATCCACCATT
GCCGGGCGGGTTTTATTCAGTGTTTGCAGCGCGTTATTAACCAGCGTGTCATCGAGGGAG
AAAAGCAGCGTTTTGTTTTGCATCGCCAGCGACACACGGAAAAAATAATCCGACATTAAT
TGATCGGGTTGCGCCGCCTGCGCTTTCGGATACTGGCCGTATCGGGAACTCACTTCGCGA
CGCCAGATTTGCGCTTCGCCCTGCTGAGTCTGGCTTACCGGCAAAACACCTTCTGGCGCT
TTGCTTTCGTGCGCACCAATATTTTGCGTAAACAGTTTCCCTGGCAATTGCGCCTGTTCG
GCAGTGCCATCAAACTGACCGACAAACAGCGGGGTTTGCAATTTTGAGTCTTCATACCAG
CACAGCCCCGCGGCACCGTCTAACGCCCCATTCAGCTTGTCGTTTTCCTGGCTGATGTGC
GAAAGCATCTCTTCGGCAATACCGTGTGAATACGGCACCGCCACACAGAAGCTGGCTCCG
GCAGGCATACTGTTCCATACCGGCGTAAAATCGAAACTGGCATCTACGCTGGCGGATTCA
TCATTTAACGCCACAAAACTGTGCCAGCCGTCGTTACCCATTTCGAAGCGTACGCCAGCA
AAAGAAGGCATTAACCGCTGGTAGCCAAACCCCAGCCACCTGGCGCTGACTACGATGCGC
TGGCGTACTGGCGTTTTTTCGGCAGTACGCTCTTCCAGGCCAAAGCTTGCTTGCCAGCGT
TTTTTGCCGCTCAACAAATCACCTGCGATCGCCGTGGCTTCGGTATCCTGCTGATCATCT
TTAAACAACATATCCGTGCTGGAAAACACCAGCATCTTGTCCTGATAAGTCGCGAACATC
AGGGCGTTATTGCCGTTATAGCGCAACTGATAAACAGGAACAGTTTCACTATTTATCTTG
ATGCTACTGATTTCCGTTTTGCTTAACTGGCTGTCGCTGGTAGCGGCAAACAACAATGGC
TCCAGCAGTTTGCTTAAACCACTGCGCTGGATCAGCACCATATAATGTGAAAGATGGCCT
TGTTTATCGTGCCACAGCGCTGCCTGCGCGGGCTGATCTAAGAGTGACGAAAAGAGCTTA
TCTTTCAGCGTGAGATCGTGTTCATAGACAATACGACGAATGCTGCCTTCAATGCCCAGA
CGATCGGCATGATTCTGATAATAGAAAACGAAATCTTCGCTCAGAACATCGTGGAGAAAC
GGAATGGTGAGGAGATCTTTGGGAAGCTGGCTCAGAGAGTCGCTGTCGAGAAAGAGGTCC
GGCTCATTGAGATCGATTTGCAGATTGTTGTGCACCACCAGCGGCGACAACGTTTTTTCT
GGCCCACTGCCAGCATATTGCAACGCCCAGACGCCAGCGGAAAGCAGTGCTATTGCGCCA
AAACCTACAAGACCATAGAACCGCCAGCCTTTCGCCTTTTTTTCACCACTCATTGCCACA
TTCCTTGTGTATAGCCAGCCATTTTTTACGGGCACAGCCAAACTTTACCGTGCCCTAATA
CGACAAAAGCCCAGACTTTGCAGCCTGGACTTTTCAATTCAAACAAGGGAGATAGCTCCC
TTTTGGCATGAAGAAGTAAAATTATTCTTCTTCT