MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 17.seq
 Deletion 17
 Length 72554
 Fasta Format

>17
GCTGCGGCTGAGTGACTGCCGGGTCGATAATCCGCACGTTACCAATGGCACTGGATTTCG
AAATACTCAACTCCTGCTGGCGGTTAAGTAATTGCAGATATACCGCACGGCCCGCTTCTA
CGTCACGACTTAAACGCAACACTTCCTGTTGGGTGGAAGGCATTGCCGATACCCGCTTAT
TCAGGCGTTTGCGTTCTTGCTCCAGCGTCTGGCGTTTTTCCAGCAGCGCACGATAAGTTG
GGTGATCTTTCTTATACAGCTGGGAGATCTCTGCCTCGCGGAAGGTCAGCTCATTGAGTT
GATTATCAACGTTCACAATCTGCTCAAGAACGGCTTTGGCTTCCAGGTTAAGGTCAACCG
AATCGCGCTGCTGGCGATAAACGTTGAGTTTTTCTTCCGCTTGGTCCAGCTCGCTGCGCA
CTTCAGGTAACTGGCGCTGTAAGAATTCAAGGCTTTGTGAATCCTGCGCCGCCTGGCGAG
CGATATTCTGTTGCAAATAGTTGTTAGCGATGCTGTTCAGAATACGAGTAATCAACTGGG
GATCATCACCAGTCATGGTAAGTTCCAGCATCCCGCTTTCTTTACTGCGTTCGCTAACGG
TAAAGGTTTCCTGCAATGCGTTAATCGCTTCCAGTTCGGTACGCTGGCTCAGGACAAACT
GTGTTCCTGGTTTGGCCTTAATGTCCGCGATAGTCAGCGCAACGCCATCTTTTTCCAGAC
GCTGGCCGACCATACCATTGACGGTGAACTCTTCACCTTCCAGTGTATAGTGGCCGTTTT
CCCCAACCGTGAGTGTCAGTTGCTGATCCTGACCATTCAGTTGTGGAATATGCATCCAGC
TGATCGCCAGCTCACCTGGTTTTTCTTTGGTTAATCTCGCCCAGCCGCGACCCACAATCG
GAAAATACTTCTGCTCAACTATGTCGCGCAGATTCAGTTCAGCAATGGTTTTACCGAGAA
TCATGCGCGATTGCAGCAGTTGGATCTCCGGTGCAGACTCGGGCGATGAGTTAGGGATCA
TATCGCTCAGGCCGCTGAGAATGGCGTTGCCCTGTTTTTGCTCAACCTGGACCAGAGTAT
CTGCCTGATAAATTGGTGTGCTTAACAGCGAGTAAGCGACAGCGATCAGCGTGAATAACG
CGGTCACGCTGATAATAAACTTACGGTGATCCCATAACTCGCCGACCAGACGAAGCAGAT
CGATCTCATTTTCCTGAGTGCTGCCTGGTGGCGTATTCATATTTTTAGTTGTCATCGTAT
TTTATAAACTCAAATTACCGGCTGAGGCGCTTCGCCCATTCCTGACTGGCGCGCTCCAAC
ATACCGTAGACATGTTCAAATGCGTCCTGACTTTTACGATAGGGATCCGGGATCTCTTTC
TGTTCCAGCCATTGCCCAAACAGCATTGTCTTCCCGCGGACCTCGGGAGCAATTGCGGTA
ACCTGAGCAATATGTTCCGACTCCATTGCCAGAATCAGATCGTAATTTCGTGCCATCTCA
GCAGTGAGCTTACGTCCGGCATGTCCTTCAAGAGATACGCCATGATTAGCGGCAACATCT
GCCGCTGTCGCATCTGCAGGGTGTTTTACCAGACCATGAACACCTGCCGATTTGACTTTT
ACGCCCGGCAGACGTTTACGCAGCAAGCGCTCGCCAATGGGCGAACGGCAAATGTTGCCG
GTACAAACCACCAGGATTGAGTTAAATTTTAGTTGGGCCATGTTTGAATCCACCGTGAAG
TCTCTGTCAGGTCATGCACCCCGGAAATCGTCGGTACCAGCAGAGAAATCACACGGTTCC
AACGAGCCAGCGGCGCGGTAGTGACATAAACAATGTCGTAAGGTTCAAGCTGGAATTCCG
TTCCGAGTATCATTGCCGATGCGTCCTTCGCATTCAGCTGATAAATATTGGCGATTTTGC
CATTCTGCTTGTTTTGCGTTGCACGAATAACAAAAATCCCCGTCGCATCAGCGACATCCT
GATTCATACCCTCAGCGTTACCCAGCGCTTCCGCCAGGGTCATACCGCTGCGGTCCATTT
TCAGCGTGCTCTGTTTACCCACTTCACCCATCACGAAGACTTTCAGATCATCGTTGCGCG
GAATAAATAAAATATCGCCCGGGTGCAGCAGTTTGTTCTGGCGCAAGTCGCCACGCTGCA
TCAGCGCATAGAGGTTCACTTTGGTCTTTACGCCATTCTGGGTGAGCACCACGTTGCGCC
AGTCTGCATCTGCGGTCAGACCGCCCGCGGCGTTAATCGCATCCATGATGGTCAGAGGAA
TATTGGTAATCGGCTGCTGACCCGATTTGCTGACTTCGCCGGTGACGTACGCTTTTTGCG
ATCGGAACGCCGCGACGCTGACATCGACTTGCGGGCTTTCAATGACTGAATCGAGACGCG
CTGTAATCTCGTTGCGTACCTGGGTAAGTGTTTTCCCGGCCACTTTCAGGCGACCAATAT
AGGGGTAGAAAATCGCACCATCGGCGTTAACCCAGTTGCCGGTATCACTGGCGCTACGGT
ATTGCCCTGCGGGGGTGGTTAGTTCCGGGTGATCCCAGACCGTAACCATCAACACATCAC
CAATCCCGATACGATATTCATAGTTTGCGATTTGCTGCTCCAGCTCCGGGTTAGCCTGCG
ACATAATCGGTTTGGCGCGCAACTGATCAATCAATCCTGGCGTGACGGGATAGATATTGA
CCATTTTGTCCAGGTCATACTGATTGTCAGGTAGTTCAATGACATCCTTGTTACTGGTCG
ATAAATTCTGACCAGGAACAAGGGTACATGCTGTCAAAGACAGAACAGCCAATGTCAGTA
CCGAAAACTTAAAAATGTTCTTTTTCATTGGTTTATATTTATCAGTCAATGTAATGTTAT
GAATTACGTCAGGTTATTGTCCAACCGGTACTTCTCGCTCTGCCGTCATTGGATAGAGCT
GGTATTTGCGTGACAGCATTTGTCCACCATCACGCGTCAATGGTGTCCACGAAACCACCG
CGCGGTTGCGGTTAGGTCCAATGGTCATCAAGTCGAATGGAATCGAGATATAAAAACCTT
TACTAAAGCCGCCTTCGCCGTAGTCATCTTTAGATACGTTACTGATTGCCGCCCATACCC
CTACCGCCACGCCGCTGTCAAAGCGTTTGGCGACGTCGATCGTTGCGCCTTTATCTTTTG
CCAGATATTGCCCAACGCTAAGTTTCATCAGTACGCCATTGAGCGTCGGCGGGTTCCAGT
AAGCCGTCACGAAACCTGTTGGCGTGGAATAATCGGTGAAACGCATCATGTTGTCCCAGT
CACGTTGCTTCACGTAGTTAACGTCCACACCCAGCGCCCAGCAGGCATCTAGCGGGCGAT
AAAGCAGCTCGGAACCGACACCGGCGTACATCGTTTCCAGATAACCGCCATACACCTGGC
CATAGAAACCATTGCCTAAGTCAGCAAAATAGTTCGCCTGCAAGTTGTTGAGATAAACGT
CATTGCGAACGTAGTCACGGATATGCGTGCGCACGCGGGGCAGGGTAGAGTCCGCGGGCA
ACAGCGAAGACTTAAACTTGTCGTAGTTGTTGTAAATATTGGTGAAAATACCGCCATCAA
GCAGCAGGTGGTCGGTAAACCAGTAGCGGGCACTGGACATCAGCCCCAGCTGGAACATAT
AGAAATCTTCCGGGCCGCCCAGCGACTGTGAAAGTGTTGGGTTGAAAGAGTAGCTAAAGC
GATCTTCACGAATACGGTAGCCCCGACCAAAGGCAGAAAGATCTTCAGCTTCAACACGTT
GTTGTTGCAGTGGCTCTGATTGACCAGGCGCTGTACCTGCCAGCTGTTTGCGCAGGCTGG
CTACGTCGGTTTCGGTAGTCACCATCGCCATATGCTCGCGCTTTTGCGTCACGCTAATCT
TCTCAACGCCTTGCGGCAGGTTATTCACCAGAATCCGGTTGGCACGATCGACCGCTTCAC
GAGAGTCACGGTATTTGTATTGCTGACCAGACATATACAGTGTCTTATCGCGTAGCTGAA
TTTCTGGCGCGTCAAAGCCCGCGTTATACTTCAGGGCGGTAAGTTGGTTTGCTACCGTGG
TGTACTGCAATCCTTCAGATTCAGGCGCAGGTTGATATGCCGGTTTTGGCGTATCGCGCA
GGGCAGGGCGCAGATCGTTGAAATTGGTCCGTAACGTGAAGCCAAACATCAACGTGTTAC
CGCGTTCATAACTCAGGTTGAGATCTGCCCAGCTGGCAGCGCGATAAACTGCGCCGACGT
TGAAATGGCTTGCCTGAGGCAGTTTGCCAGCGAAATCATTCTGGTAATTGTTTCCATCGT
ATTCGAGTTTCAGACGCAGGGGATTCCACGGCGTTTGATACTCAATGCCGCCAAAGATGG
AAGCCGGGCCACGAAAGATATCGCTAAAGCTGATATCGCCCGCATCGTGAGACTCTGCGC
GATGACAATATTTATCGCTCACCCGGCAAAACGGGTTGGTAATATTGCCCGCATTACCGG
CGTAGCCCCATGCCATCCCGAGGGTGAAATCAAATGGCCCCGCTTGCTTGCTGGCCACCA
GATACTCACCGTCAAACAGACCCGTACCAGCAATATCACGTTTACCAAACGCCACTTGCG
GTAGCCAGTAACCTTCTTCCCACAGGCGAAGTTTAAAATCGAATGATTTGTCTTTGTATG
ACTGATCGCCGCTGAAATCTTCCCACTGGCTATATTTGCGTGTGCGCACATCCGTATAAC
GAATGGTGCCTTCCAGCCATGGGAACAGCGCCACGGAGGTGGAGTAGAACCGGTATTGAT
CGTTATCCCGGTAGTTGACGCTGAATTCACCTTCCGGTGCGATGCGCGCATTTGGCATCT
GCAACAATCCTGTGCCGCCAAAGTCTGATTGCGACGAACCCAGCGGATCCGGGTAGGTTA
ATACTTCAGCATGACAGGCACTGGAGACGGCAATGGCCAGGCAGCTTAAAAGATAAGAAT
TCTTCTTCATCAGTCAGGAACACGTTGCGTTAAAACAGACACAATCTGGTCATTTAAATC
AGCATATTTTTCGGGCAGTACATGCGCAGAAAAGCCCAACCAAAGCTGGCTGCCAGGCGG
TGGTTCCACATGTCTTTTATTCCACAGGGCAACAGGGGCGACGACAGTCTCACCCTCAGG
CGTAATCACCATAACGTTATTCTTGTCCGCGCCTGCAAGGCGGGGGTGATCTTGCAGATA
ATCGGTAACGCTACGGCCTGCCTGCCAGGGCAATTGCCCGGCCCCAGAAACCGCACCCAG
CAGAGTAATAGTCACCGGACGCTGTACGGTATAGAGCGTATAGTCCCCGACCAACGGGGG
ATTGCTGTTCTCATCCACTCGTACAAAATCAGGGTCCAGTTTGACCGGTAAGCGACCAGT
GATATTGAGATTGAGTAACTGCTGGCGCACGGATTTAATCGTTGCCGCCACATCGTCGTC
AGCTTCTGCTTCCCAGGAAGCAAGCTGTGCCATGACATGTTGGTAGTCTTTAAGCGCTTT
AGCTTTCGCCGCAGAGTCGGTCAGCAAGGCACCAGGCCACCAGAGGCGATCGCGCAGTTG
CGGTTGTGTCACCAACTGGACAACATTTTCCACGGGGCCAACGGAAAGTGTCTGTTGTTC
GCCAGGCAGATAAATAGTCACCGTTCCTTGCGCAAAGGCATGGGGTGTCATTACGTAAAG
TACGCTGGCAATGAAATACGACTGTAATTTATTCATGGTGCGGGTTTAAGAAACGTCATT
TCTACGGGAATAACCCCTGCGCCTAACATTTGCCGACTTTGACGAACCTGGCCAGTAGCC
GAATCGACCCAGAATGTGTTTTGCCACTGTTTTTCTGGCCGCGTGGAAGTCACCTCTTCC
TGCCAGACATTACACAGCACATTGCGACCCGCAATATTCAGCGTCTCTAATCCAGCAAAG
GAAAAAGTAGAACTCAGGGTCGCAGAGCGAAAATGGTTGTCTTCACTCCAGAGAATATCG
CGCGTCCAGCGGCTGCCATCTTTTATTGCCAGCGCGTTACGCAGAGGGTCCTGCCCGGAA
TTTGTCACTTCCAGCAGATTATTATTAAGTTTGACGGTTTTTAAAAGACGTCCATTGTGG
GTAACCAGCATGGCGTTATCCTGGGATAACCATTTGCTTTGTTCTTGTTCTATATATCCC
AGTACCACAAAGATTCGTTGCCCTTCATTAAGGCGTAAATACATAGTGGAATAAGGCAAC
GCCTGGATCTGCTGATCCGCTACGGTGATATCCTGATTATCGAAAAGGCTGGCGCGAAAT
GTATCGACCATACTTTGCTGGCTGTGCGTACATCCCGCAAGAAATAGTGCGAAAATCGAT
AAAATAAGAGGGCGCACCTTTAATCCTTGAAAGGTTAATTAAAAAAATGCAAATCTCTAA
AGCCCGGTACGAATATCGCAACCGGGTATCATTTAACTTTAATTTCGACGCGTTAAAGCA
GTATTAGCGTGTAGTGGACGTGGTGGTTGAGGTGTTATGAGAACCGCCATCGCCACTGTC
ATTTGCTGCAACAACTGCCAACGTCGCCACACCAACAGCCGTTGCCACACCGACAACTGT
CGCCGTGCCGACAGCGCCAGCAGCCACGCCACCAGTGGTAGTAGCAGTCGTGGTTGCGCC
GGTAGTGGTCGTTGTGGTGCCAGTAGTACCCGTCGTTGCCTCGGTCCCGTTTGTTGCTTC
AGGGGCAGCAAACGCAGCTGGCGTCGTCAACATGAAGGCCATAAGGATTGCAGAAAGCTT
GTGTTTCATAACTTTTCCTTTATTCATCGCATGGACAATACGGGTGATGCTGCCAACTTA
CTGATTTAGTGTATGATGGTGTTTTTGAGGTTCTCCAGTGGCTTCTGTTTCTATCAGCTG
TCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCA
GCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTC
TCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGC
AACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGG
CCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATG
GACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTAT
GACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTG
GGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGG
CCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAG
CGAATTGAGCGGTATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCG
CTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATA
AAACACTATCAATAAGTTGGAGTCATTACCGACAATACGTACGCTTGAGATCAGGATTGT
CTACTTTGAGTATAACATCCTTGTGAAATCTCCCTTTCCTCATACCGCTTGCACTATATA
CTGCGGGTAGGAAAGGCGCGCAGAGGGAAATATAAGATTGTTAACTATCCCCCTCTGGAA
ATACGACTTGTGAGCATAAGATAAATCTTAGCAAAATACAAATTAAAGATAAGGAAATTG
TTACGAAAGCTATTAATTATTGTTGGTAATATAGTTTCAAGTGGTACTATAACTGGCTGT
TAAATGGCATTTATAACTATTAGGTGCAGAGATATTCGCTTAAATGGATTAGTTTCTTTG
TGGAAAAGTAACTGATGTTATAATGTATGATGTTGACTATTTCACTATTCCAATAAAACC
AGTCAGCTTTAAACAAGCAGCGTCATATTAAGAGAGATAAACATTTGCCGCTGTTGGTCC
TCGCAGGCCATTTACGCGGCAAAATTCCACACGTAATCCTGGTATAAGCACTTCTGCGTC
GCGGGGAGTGAATGCGGAAATATGGACCTGAACTTCTTTACGACCGTCGGAGGGGATAAT
GAATCCTTTGCCGCTTTTGCGATCAAAGGTTTTGACAATTCCTGTCATTTTACGGGACAA
ACAAATTCCTTACTGAAAATACTGCGCTGCACTATACGGGGTTAATAAAATAAAGCCAGC
GATATTTAAGACCGCCGGACGGCTAAAATAAAATTTGCTTAATCTCAATTATCATGCGTT
AATAGCTGCGTCGGTTTGAAAGACAGACAGCATACAAAGTAGTTTACTAAAGCAGTTCTC
ATTATCAGGCATTATCCCCTTCTTTTGAGTCTCTCTCCTGAACACTAAGTAGTTTCTGTA
TTAAAGCCCTGTTTGCCGAAAGGCCCAAAATGAAGGAAGTAAAATATGTCTAATAAAATG
ACTGGTTTAGTAAAATGGTTTAACGCAGATAAAGGTTTTGGCTTTATCACTCCTGATGAT
GGCAGCAAAGACGTTTTCGTCCATTTCACCGCCATCCAGAGCAATGAATTCCGCACGCTG
AACGAAAATCAGAAAGTTGAATTTTCTATTGAGCAGGGGCAACGTGGCCCCGCGGCAGCG
AACGTTGTTACGCTCTAAGGTTGCCATTATTACTCAACATCTCCATTTCCGCTGTCCATG
TTGTCATGGTTCACAGTACCGCACATCGGCATTCGATGTGACGGAGCGAAACCCTTTGGG
CGCTAAGTGTATTTTTTGTAAATCGACGATGATCACCTTTGATAACGTCGCGCTGCAAAT
ACGCACTGACCATGCGCCGCTGGATTTCACAAAATAATATCAGGCTCCCTCGTGGAGCCT
TTTTTATATCTGCCTTATTTTTCTTCAACGCTGTATGTATAGTAAGCGATAACCTGTTGA
TTATTGAATCTTTCGGGGAGATGGCTTATAACATTTCTTACCTGACCAGGGTACCGGGAA
CCAACACCTTACTGGCGTGTTGCTGTCTTTTAAGACCAGAAGAGGTTAACAGTGAATATT
GAAGAGTTAAAAAAACAAGCCGAAACGGAAATCGCCGACTTTATCGCGCAAAAAATCGCC
GAGCTGAACAAGAATACAGGGAAAGAAGTCTCTGAAATTCGCTTCACCGCACGAGAAAAA
ATGACCGGGCTTGAAAGTTATGATGTCAAAATCAAAATAATGTGATTTTGTGAACATCAC
CCCGTGCGAGGTGATGTTCCGCTTGTTGCTAATTTAGTGACCAATCATTGGCGCTTGTGG
AATTAAGCGTCGGTACAATTCCTCCGGCACCGGGCTTTGCCATACTCCCGCATACATTGC
GTAACCAATCACCGCAAACATAATCCCCAGAACCAGTAGCGTCATTAACCAGCCAGACAA
CGCAAAGGCTTTTTTATTTGCCGCAGGTTTTTGCAGTGAAAAGGTCAATGTTGAGGCTAC
CGGACATGACTCTACGCAAGTCATACAGCCGGTACATTCCACTGTTCGTACCTGAATTAA
TTTATCGACCGGGATCCGTGATGGGCAATTTTTTGCGCATTTGCCACAGTCGATACAACT
TTCGGCATTGCGACGAATCTTAAACGGCGACAATAGCGAAACCACGCCCATCAGCGCGCC
ATATGGGCAAAGATAACGACACCAGGCATGGCGAATAAACAGGCTGGCAATCAGCAAAAC
GGTCACGCTGATTAATGTCGCGGTCCCCATATGACGAAAGAAATCGAGCATTTTAACGTC
CATCACCACGCTGTAGGGCGACAACATAAAATAGTGAATCGCCTGAGCGGGCATCAATAA
CGCGATATAGATAAAAAAACTCAACAGCAAATACTTCACGCCGCGCAGAGGAATATCCAG
CCAGCGGGGAAGGACACATTGCCGACCAAACAGTTTGTTACCGAGATCGCCGATTAATTC
AGAAAGCGTACCAACCGGGCATAACCATGAGCAAAAGGCCTTTTTGAGTAATAGACTGAT
GACGATAAAAGCGACCAATAACAGCATCGCGGCGGCGTGGACGGACGGTAACTGACCTGT
TACAAGGCTATATTTCAGATTCATCAGCCCGGCAATCGGTAGCCAGCCTTCGATACCTCC
CGGTCTGGCGACAAATGTCGTGCTACTTGCCGTTTCGTAATAGCGCACCCAATACCAGAA
CGTGATGGCAATATAAATATTCATTGCCAACAGTAATAATTGCGTCGCTTTACGCCAGGT
CGTGGCATTACGCCAGTCATTCCACGGTAATTTGCCGCCCGTCGTGCCTGGCCGCCGCTG
CCAGCGGGTTCTTTTATTCTCTGCCATGATTTTGCCAGTCCGTTAAGTTGTATACCAAAT
GCCACTATTCTAGTTGTTCTTAACTGGCTGATATTGATTCAAATCGCGTTCAGGTCTTTC
TTATGCAACCATGCTTCCAGAGCGGCAACACTGCGTGTAATTTCTTCGTGTGGAAGGGGG
GCAGATAATGGCTGCTGCTCCAGTTGTGCGCATAGCTGGCTGGCGATATGCATTCCCAGA
CTCGAGCAACTGCTTTTTAGCTGATGCGCGGCACGCTTTATTTTCTCGCTATCCTGACTG
GCGCGGGCAATGTCGATTTCATCGAGAAGCGGCAGGGCATGTTGTGTAAATAATACCAGC
CATTCGTGGATCTTCTCCGTCCCCATTAACTGAGCATCTTCATTGAGTTGCGATACATCC
AGCGATTGATCATTATTGACTTGCAGTTGGAGATAGTGCGCCAGTAACTGACCGAGCACT
TCACGCGGCACCGGTTTAGGGATAATCCCGCGGAATAATGAACTGGTACGCTGGCGCAGC
GTTTCGTCAATGACATGGGCGCTAAAGCCAATCAAAACCAGCGACGGATATTGCTGTGCC
AGTTGTCGGGCAAGCGTAATGCCGTCGATATCCGGCAGATCAAAATCCACCAGTGCGGCA
GCAAACGGTTCGCTATTTTGCAGTGTCTCTAAAGCCTGCGCGGCATTGCCAACAGCAACA
ATCTGCGCACCACTGGTTTTCAGCATCTCAATGGTAATTCGCTGGGTTAGCGGGTTATCT
TCAATTAACAGCAAACGTAAACCGTCAAGACGCACCGCCTGATTGACTGTTTTTGGCACG
GGTGCCGTGGCAACACGTAACGGCAAGCGTAAACAAAAACAGCTTCCAACCTCCGGCGTG
CTGGTGGCGCTCAGTTCGCCGCCCATCGCCTGGGCCAGACGGCTACTGATAGTCAGTCCC
AGCCCGGTGCCGCCGCGTTTGCCGCTTACCTGCACAAATGGCTGGAAGATTTCTGCCAGT
TTCGCGGGATCAATACCGCAGCCGCTGTCTTCCACTTCGACCAGCCATTGCTCGCCATCA
GTGCGACTACGCAGGATAATGTACCCTTCGTCAGTAAAACGCAGGGCGTTGCTCAACAGG
TTGGTTATAACCTGACGAATACGTCGTGGATCGCCCATTAACGCGCACGGCATATCATCG
GCAATTGCCGTTGCCAGGCGAATCGGGCGACCTTTCACCCGTCCGCTCATTAATTGCAGG
GTACTTTCCAGCAGCGGGCGCGGTTCAAAGGGCTCATCGCTGACCGAAACATTCTTGCCA
CCTGCTTCGATAGCGGAATAATCGAGAATATCGTTGAGGATGGTCAGCAACGATTCACCA
GAGTCAGTAATTGCCCGCAAATCATCACGCTGGGCGTTAAGTGCGGGGTTATCTGCCAGC
AGTTGAGCAGTGCCGAGAATACCGTACAGCGGTGTGCGGATCTCATGGCTCATCGCCGCC
AGAAACGCCGATTTTGCCTGGCTGGCTTTTTCTGCTTCCGCCCGTGCCTGTCGGTGTTCT
ATCACCAGTTCCTGCAATTCAGCTGTACGCGCTTTGACCTGCGCCGCCAGCTGTTCGCGG
TGGCGATTCAGTGCATGAACATTGCTGCGAAACGCATCCATCAGCCGCCCGATGGTATCC
AGCTCCCGTACGCCAGCGGTTTCCGGGAAAGGGGAGTCAATATCACCGTCCAGCAGCCGT
TGCAGCGCCTGCGTTTGTTCGGCAAGTGGACGCGTGACTGAGCGATAAACCACGCGCCAG
AGGATCAGAATCAGTGCGCAAAGTGAAACCATCCCCAGCAATAACAGGCTGTATTGCCCG
CGTGCACTCGCTTTTTCCAGATGCGCCAGTCCGTGCTGATTACGCAGCTCAATGGTGTCG
ACCAGCTGACTGACTTCGCTACTAAACTGCGCGAACTGGGCGATGTTATTTTGTGCGAGA
GTTTGTAGGTGATTGCTGATTTCACTGTCCTGCTGATACAGCGCCAGCAAATCGCTATAT
TGGCTAACGGTAGTTAACGTTGTTGCGACCTGCGCACGAACACCCGGATCTTCAATGCGT
ATTTGCCGACGTTGCAGAATTTTCACCGCATTATTGAGCTGCTTTTCCAGCGTTGGTGCA
TTTTTCTGGATCTGCTCCAGCCCCAGATTCATCACCATTTGCTGCACCCGCAGAGCGCTA
AGGCGCAGTTCATTCATCTGGTTAACATACTCAAGATCGATATCAATCAGCCGATCGAGT
GCACTTTCAGCAGCCTGACGCTGATCTTGTTCGATCAAATCGTAAATCCCGGCCTGGGTC
GCTCCAGCGGAAGTTGTCGCATTATTCGCCTGACCTTGCGCCAGGCGTGCGATCTCATCG
GCGGCAGCGACTATCTGCTGACTGAGTTGCTGTTGTTGCTGGCGCAGTTGCAAACGCTGC
CCCACCAGTTCCCCTTGCTGACGTAACGAACGGGAGATCTCCTGCTCCTGTTGTTCAATA
GCGGTGGTATCAAAACCTTGTTCCCGTAACGCTTGCAGCAACGCATTAATCTTCAGGCTT
TGTGCGGTGAGCATTCGCCCCTGCGCCTGCCACATCTTTTCGTTATCGGCACTGGTCAGG
TTCTGCGCGGCGAAAAGTTCCCAGGCGCTGGCTTCGCTCAACTGGCGCGCCATATTCATG
GTAGGAATCAATGCCTGAGTGTTGTCTTTTTCCACCTGGCTGATAAAGCGCAGGTTGTAC
CATCCCACCAGGGTACTGGTCAGGGTTAACAGCGCCATCAGGGCAAAGCCCATCCAGAGT
CTTCGGGTCAGGGTTAAATTCACGGTCGGTGCACTTTAGGTGAAAAAGGTTGAGTCGCAA
AGCGGAATGCATCTAGCATAAAGCCTTATTATTGATGAGGCTATCATGCGCGTACTGCTA
TTTTTACTTCTTTCCCTTTTCATGTTGCCGGCATTTTCGGCTGATAACCTGTTGCGCTGG
CATGATGCGCAGCATTTCACGGTGCAAGCCTCTACGCCGCTTAAAGCCAAACGCGCATGG
AAACTGTGCGCGCTTTATCCCAGCCTGAAAGATTCATATTGGTTATCGTTGAACTATGGT
ATGCAGGAGGCTGCTCGCCGCTACGGTGTGGATTTAAAAGTGCTGGAGGCAGGCGGCTAC
AGCCAGTTGGCTACCCAGCAAGCACAAATCGACCAGTGTAAACAGTGGGGCGCAGAGGCC
ATTTTGCTCGGTAGTAGCACGACCTCATTTCCCGACCTGCAAAAGCAGGTAGCAAGTCTG
CCGGTGATCGAACTGGTAAATGCTATTGATGCTCCCCAGGTGAAAAGCCGCGTTGGTGTG
CCCTGGTTTCAGATGGGCTATCAACCGGGGCGATATCTGGTGCAATGGGCGCACGGTAAA
CCACTGAATGTGCTGTTGATGCCCGGACCCGATAACGCCGGGGGCAGTAAGGAGATGGTC
GAGGGTTTTCGCGCAGCCATTGCCGGAAGCCCGGTGCGTATTGTTGATATTGCGCTTGGT
GATAACGATATTGAAATCCAGCGTAACCTGTTGCAGGAGATGCTGGAACGCCATCCAGAA
ATCGACGTCGTTGCCGGAACGGCCATTGCGGCAGAGGCGGCAATGGGGGAAGGGCGTAAC
CTGAAAACGCCGCTTACCGTGGTGTCGTTTTATCTTTCACATCAGGTGTATCGCGGGCTG
AAGCGGGGAAGAGTGATTATGGCTGCCAGCGATCAAATGGTCTGGCAGGGGGAACTGGCG
GTTGAGCAGGCCATCAGGCAATTACAGGGGCAATCGGTTTCTGATAATGTCAGCCCACCG
ATTTTAGTTCTGACGCCGAAAAATGCCGACCGTGAACATATTCGCCGCTCGCTGTCACCA
GGGGGATTTCGTCCGGTCTATTTTTATCAGCACACATCAGCGGCTAAGAAATAACCTTCA
CCATGTTGCGTCACCAGTAAATCCGCGCTGAGTTTATGACGTAAACGACGAATTAACACA
TCGACGGTGCGCAGGTCAGGGTTTTCCACCCGACGCGCAGAAAGCATACGTAGCAGACGT
TCACGGCTGAGAATTTCGCCCGGATTCGTCACAAATGCCACCAACATTTCATACTCTGCG
CGGGTCAGTTTAATCGGCTCGCCATCCCGCTCCAGCGTATGGCGCGACACATTCAGGCAA
TAACCGGCAAAGCGATAGCAGTTGTCCTGAGTGTGCGGTTGAGCTTGTCGCGCGAGGTCG
ATTCGCCAGAGCAGATTTTTCACCCGTACTACCAGTTCGCGCAGTTCCAGCGGTTTGGTG
ACGTAATCGTCTGCGCCCATTTCCAGCCCAACAATACGGTCAATCCGATCGCTGCGTCCG
GTAACCAGAATAATCCCCACCGTTGAGCGTTCTCGCAGGGCGCGGGTTAACATCAGGCCA
TTTTCATCGGGTAAGTTGATATCCAGCAGAATTAAATCTACCGACTGATTCTGCATAATT
TCCCGTAGCCCAGCACCGCTCGCCGTAACGGAAACGGTATACCCCTCCTGAGTGAAGTAG
GATTGTAATCGCGCCTGGGTAACCGGCTCATCTTCAACAATAACAATGTGATGTGGCATC
AGAGGGTTTTACTCATTCTGTTCATATCTGTTCATATTCTGCCGTAAGCCGTTCATCCTG
ACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCACTAAACCATAATTCTACAG
GGGTTATTATGCGGAAACTCTGGAACGCGCTACGCCGACCCAGTGCTCGTTGGTCGGTAC
TGGCGCTGGTCGCAATTGGGATTGTGATTGGCATTGCGCTGATTGTATTGCCACACGTTG
GGATCAAAGTCACCAGCACAACCGAATTTTGTGTCAGTTGCCACAGTATGCAACCGGTGT
ATGAAGAATATAAACAGTCGGTGCATTTCCAGAACGCCTCCGGCGTGCGAGCTGAATGCC
ATGACTGTCATATCCCGCCGGATATTCCAGGCATGGTGAAGCGCAAACTGGAAGCGAGCA
ATGATATCTACCAGACCTTTATTGCTCACTCCATTGATACACCTGAAAAATTCGAAGCCA
AACGCGCGGAACTTGCCGAGCGTGAATGGGCGCGAATGAAAGAAAACAACTCGGCAACCT
GCCGCTCCTGCCATAACTACGATGCGATGGATCATGCGAAGCAGCATCCTGAAGCAGCAC
GTCAGATGAAGGTGGCAGCGAAAGATAATCAATCCTGCATCGACTGTCATAAAGGTATTG
CCCACCAGTTACCGGATATGAGTAGCGGCTTCCGTAAGCAGTTCGATGAGCTGCGCGCCA
GTGCTAATGACAGTGGTGACACGCTGTACTCTATTGATATTAAGCCAATTTATGCGGCGA
AAGGCGATAAAGAAGCCTCTGGTTCTCTGCTGCCTGCTTCGGAAGTGAAAGTCCTTAAAC
GTGACGGCGACTGGCTGCAAATTGAAATTACCGGCTGGACGGAAAGCGCCGGACGTCAGC
GTGTACTCACCCAATTCCCAGGTAAACGCATCTTTGTTGCCTCGATTCGTGGTGATGTGC
AGCAGCAGGTAAAAACGCTGGAGAAAACCACCGTTGCCGACACCAATACCGAGTGGAGCA
AGTTGCAGGCCACTGCGTGGATGAAGAAAGGCGACATGGTGAACGATATCAAACCGATCT
GGGCTTATGCGGATTCGTTGTACAACGGCACCTGTAACCAGTGCCACGGCGCACCGGAAA
TCGCCCACTTTGACGCTAACGGTTGGATCGGCACGCTCAACGGCATGATTGGCTTTACCA
GTCTCGATAAACGTGAAGAACGCACCTTGTTGAAATATCTGCAAATGAATGCGTCTGACA
CCGCAGGTAAGGCTCACGGCGATAAGAAGGAAGAAAAATAATGAACAATAACGATCTCTT
TCAGGCATCACGTCGGCGTTTTCTGGCACAACTCGGCGGCTTAACCGTCGCCGGGATGCT
GGGGCCGTCATTGTTAACGCCGCGACGTGCGACTGCGGCGCAAGCGGCGACTGACGCTGT
CATCTCGAAAGAGGGCATTCTTACCGGGTCGCACTGGGGGGCTATCCGCGCGACGGTGAA
GGATGGTCGCTTTGTGGCGGCAAAACCGTTCGAACTGGATAAATATCCGTCGAAAATGAT
TGCCGGATTGCCGGATCACGTACACAACGCGGCGCGTATTCGTTATCCGATGGTACGCGT
GGACTGGCTGCGTAAGCGCCATCTCAGCGATACCTCCCAGCGCGGTGATAACCGTTTTGT
GCGCGTGAGCTGGGATGAAGCCCTCGACATGTTCTATGAAGAACTGGAACGCGTGCAGAA
AACTCACGGGCCGAGTGCCTTGCTGACCGCCAGTGGTTGGCAATCGACGGGGATGTTCCA
TAACGCTTCGGGGATGCTGGCGAAAGCTATTGCCTTGCATGGTAATAGCGTTGGTACGGG
CGGAGATTACTCTACCGGTGCTGCGCAGGTGATCCTGCCGCGCGTAGTCGGTTCGATGGA
AGTGTATGAACAGCAAACCTCCTGGCCGCTGGTATTGCAGAACAGCAAAACCATTGTGCT
GTGGGGCTCCGATTTGCTGAAAAACCAGCAAGCGAACTGGTGGTGCCCGGATCACGATGT
TTATGAATATTACGCGCAGCTAAAAGCGAAAGTCGCCGCCGGTGAAATTGAGGTCATCAG
CATCGATCCGGTTGTCACATCCACCCATGAGTATCTGGGGCGCGAGCATGTGAAGCACAT
TGCGGTTAACCCGCAAACTGACGTGCCGCTGCAACTGGCGCTGGCACATACGCTGTACAG
TGAAAACCTGTACGACAAAAACTTCCTTGCTAACTACTGTGTGGGTTTTGAGCAGTTCCT
GCCGTATCTGCTGGGTGAGAAAGACGGTCAGCCGAAAGATGCCGCATGGGCTGAAAAACT
GACCGGCATTGATGCCGAAACCATTCGTGGGCTGGCGCGGCAGATGGCGGCGAACAGAAC
GCAAATTATTGCTGGCTGGTGCGTGCAGCGTATGCAGCACGGTGAACAGTGGGCGTGGAT
GATTGTGGTTCTGGCGGCGATGCTGGGGCAAATTGGCCTGCCAGGTGGTGGTTTTGGTTT
TGGCTGGCACTACAACGGCGCAGGCACGCCGGGGCGTAAAGGCGTTATTCTGAGTGGTTT
CTCCGGCTCTACGTCGATTCCGCCTGTTCACGACAACAGTGACTACAAAGGCTACAGCAG
CACTATTCCGATTGCCCGTTTTATCGATGCGATCCTCGAACCGGGGAAAGTGATCAACTG
GAACGGTAAATCGGTAAAACTGCCGCCGCTGAAAATGTGTATTTTTGCCGGAACTAACCC
ATTCCATCGCCATCAGCAGATCAACCGCATTATTGAAGGCTTGCGCAAGCTGGAAACGGT
TATCGCCATAGATAACCAGTGGACCTCAACCTGCCGCTTTGCCGATATCGTACTGCCTGC
GACCACGCAGTTTGAGCGTAACGATCTCGACCAGTACGGCAATCACTCCAACCGTGGCAT
TATCGCCATGAAACAGGTGGTGCCGCCGCAGTTCGAGGCGCGCAACGACTTCGATATTTT
CCGCGAGCTGTGCCGTCGCTTTAATCGCGAAGAAGCCTTTACCGAAGGGCTGGACGAAAT
GGGCTGGCTGAAACGCATCTGGCAGGAAGGTGTACAGCAAGGCAAAGGACGCGGCGTTCA
TCTGCCAGCGTTTGATGACTTCTGGAATAACAAAGAGTACGTCGAGTTTGACCATCCGCA
GATGTTTGTTCGCCACCAGGCATTCCGCGAAGATCCGGATCTCGAACCGCTGGGCACGCC
GAGTGGCCTGATTGAGATCTACTCGAAAACTATCGCCGATATGAACTACGACGATTGTCA
GGGGCATCCGATGTGGTTTGAGAAAATCGAACGCTCCCACGGTGGGCCTGGCTCGCAAAA
GTATCCGTTGCATCTGCAATCTGTGCATCCGGATTTCCGACTTCACTCGCAGTTATGTGA
GTCGGAAACGCTGCGTCAGCAATATACGGTAGCGGGTAAAGAGCCAGTATTCATTAACCC
GCAGGATGCCAGCGCGCGCGGTATTCGTAACGGTGATGTGGTACGCGTCTTTAACGCTCG
CGGTCAGGTGTTGGCAGGGGCAGTGGTTTCTGACCGCTATGCACCCGGCGTGGCACGAAT
TCACGAAGGGGCATGGTACGATCCAGATAAAGGCGGCGAGCCTGGTGCGCTGTGCAAATA
CGGTAACCCCAACGTGTTGACCATCGACATCGGTACATCGCAGCTGGCGCAGGCGACCAG
TGCGCACACTACGCTGGTGGAAATTGAGAAGTACAACGGAACAGTGGAGCAGGTGACGGC
GTTTAACGGCCCCGTGGAGATGGTGGCGCAGTGCGAATATGTTCCCGCGTCGCAGGTGAA
ATCATGACCACGCTGACAGCACAACAGATTGCCTGTGTTTACGCCTGGCTAGCGCAGTTG
TTCTCCCGTGAGCTGGACGATGAACAACTGACGCAAATCGCCAGTGCGCAGATGGCTGAA
TGGTTTTCGTTGCTGAAAAGCGAACCGCCGCTCACTGCGGCGGTGAACGAGCTGGAAAAC
CGTATTGCCACGCTGACAGTACGTGACGATGCCCGTCTGGAACTGGCCGCGGACTTTTGC
GGCCTGTTTCTGATGACCGACAAACAAGCGGCGCTGCCGTATGCATCGGCCTACAAACAG
GACGAGCAAGAGATTAAACGCTTGTTAGTTGAGGCAGGGATGGAAACCAGCGGCAATTTC
AACGAACCGGCAGATCATCTGGCGATCTATCTCGAATTGCTCAGCCATCTGCATTTTTCG
CTGGGAGAGGGGACCGTTCCTGCGCGAAGAATCGACAGTTTGCGGCAAAAAACACTGACG
GCGCTGTGGCAATGGTTACCAGAGTTTGTTGCGCGTTGTCGTCAGTATGACAGCTTTGGT
TTTTACGCGGCACTAAGCCAGTTATTGCTGGTGTTAGTGGAGTGCGACCACCAAAACAGA
TAACGTCGTTTGTGCGCCTGAAAAGACGCGTTTAGCGTCGCATCAGGCATTATGGCGCAG
TTGCCGGATGCGGCGTGAACGTCTTATCCGGCCCACAGGAACTGTAATCTTTGTAGACCG
GTTAAGATGCGTCATCGCATCCGGCAAACACACATCACGGATGAGCTACAAACCGGGAAA
GCCGCTGGCGCAGCAGGCGGTTTTCCTGCTTCAGGTGCGCAATATCATCCATTAACGTCA
GCGCCACCGCGATCCCCGGCCAGTCCAGAGCCAGTTCATGACGCAGGCGTACCGCGCGTT
GCACCACAATGGCGGCATGGTCGTCAAATACCCAGGTTGTTTCCTGGATCTCACGCGGTT
CAACCACCCCCAAACCGACAATTTCATTCAACTCCTCTTCAGAGATGCCGGTATGCAGGC
AAAATTCGGTAATAGTAAAAGTCACCGTAACATTAGCCATTATGCTTTCCCCCAATCTTT
ACGTGGATCAAAAGACGACTGGGCGTCTGCCAGTTGCTGCCACAGCGCGGCAGTGTTTTC
ATCCGGTTTCGGCGGCATCACGATTTTCAGTACCGCATACAGATCGCCGGTCTGTTTTTT
GCTCACCAGACCTTTGCCTTTAACGCGCAATCGTTGCCCGGCCTGGCTGCCTGGCGGGAT
AGTCAGCAAAATGCTTTCTTTCAGTGTTGGAACGGTGACTTTAGCACCCAGCGCCGCTTC
CCACGGGCTAACCGGCACCACAATTTCCAGATCCTGGCCGACAATATCAAACAGCGGATG
TGGCGCAATATGAATCACCAGCCACAAATCGCCATTTGGACCGCCGTTTTCGCCCGGCGT
CCCCTGGCCTTTCAGACGGATGCGTTGACCATTGCCGACGCCCGCCGGGATCTTCACATT
CAGCGTTTTCGGAATTTCCTGTTCGATCATGCCAAAGGCGTTATAAACCGGCAGGTTATA
GCTGATGGTACGCTTATGCTCAGTAAGCGTTTCTTCGAGGAATACCGCCACTTCGATTTC
AATATCGTGGCCGCGTGTGGCGGGGCGTTGACGGCTCTGGCGGGCATGCTGACCGAAAAT
TGACGAGAAGATATCGTCAAAATCTTCGGCGTTAAAACTCTGACCGTCGCCATGGTGGAA
CTGACGGTTAAATTGCGGATCGTTGCGATGTTGCCACATCTGATCATACTCAGCGCGACG
TTGTTCATCACTTAACACTTCCCAGGCTTCAGCGACCTCTTTGAAGCGGGCTTCGGCATC
CGGTTCTTTGCTGACATCAGGATGGTATTTGCGGGCAAGTCGACGATAGGCGGTCTTGAT
TGTCTTGAGATCGTCCGTCGGTTTCACGCCCATGATGGCGTAATAATCCTTTAATTCCAT
AGCGTTATCTCGCGTAAATCAACACAAATTGAAGGAACCCCTGTAAGGTAACTCCTATAA
GTGTAGGGTAATCCTCAAAATTTCATATGCCAACACAGAATATGTTATTGAAATCATCGC
GGAGAGGAGGTCGCCATCAAGATGGGTTGCTGAACATATTTTAAACAGGTGAAAAAGGGT
GAGCGATTTTTGATAGTTGAACCAGGCACTTTAAGTTTAACTAGGGCGTCATTATTTATT
AAATTTTATAGACGCTATATATGGGTAGTAATATACATGGAATTAGTTGCACTGCAAATA
ATTATTTGAAACAGGCCTGGAACGATATAAAAAATGAGTACGAAAAAAATCAAACATATT
CAATCACGCTTTTTGAAAACACACTGGTGTGTTTTATGCGGTTATACAATGAACTCAGAC
GTAAAGTAAATGAAGAGGATACTCCATGTCTGGAATGTGAATCACTAGAAAAAGAATTTG
AGGAAATGCAGAATGATAATGATCTATCATTATTTATGAGAATATTGCGTACTAATGATA
CACAAATTTATTCAGGGGTTTCAGGAGGTATTACATATACTATACAATATGTTCGAGATA
TTGATATTGTTAGAGTGTCCTTGCCGGGCAGAGCTTCAGAGTCTATCACAGATTTTAAAG
GTTATTATTGGTATAACTTTATGGAGTATATTGAAAACATTAATGCGTGTGATGATGTTT
TTTCTGAGTATTGTTTTGATGATGAAAATATAAGTGTCCAGCCAGAGCGGATAAATACGC
CGGGAATATCTGATTTGGATTCTGACATTGATTTGTCTGGTATATCTTTTATTCAGCGTG
AAACTAACCAGGCATTAGGATTAAAATATGCTCCTGTAGATGGCGATGGATATTGTCTGT
TAAGAGCTATACTGGTTTTAAAACAACATGATTATTCATGGGCGCTGGTCAGTTATAAGA
TGCAAAAGGAAGTTTACAACGAATTCATTAAAATGGTTGATAAAAAAACGATCGAGGCTC
TTGTTGATACGGCATTCTATAATCTCAGGGAAGATGTAAAGACGTTATTTGGCGTTGATC
TACAATCTGACAACCAAATTCAGGGGCAGAGTAGTCTTATGTCATGGAGCTTTCTGTTTT
TTAAAAAACAATTCATTGATAGTTGCTTGAATAACGAAAAATGTATCCTGCATTTACCCG
AGTTTATATTTAATGATAACAAGAACTTGCTTGCTTTAGATACCGACACGTCGGATAGGA
TTAAAGCGGTGAAGAATTTTCTTGTTGTTCTTTCAGATAGCATTTGCTCATTATTTATTG
TTAATAGTAATGTGGCATCAATCTCCTTGGGGAATGAATCCTTTTCAACAGATGAAGATC
TTGAGTATGGTTATTTAATGAACACTGGCAATCATTATGACGTTTACCTCCCTCCTGAAC
TTTTTGCTCAGGCTTACAAGTTAAACAATAAGGAAATGAATGCGCAACTCGACTATTTAA
ATCGTTATGCAATTTAATGGCAAAGGCATATGCTAAAAACCATTGTTATTAGTCTCACAC
TTTTTTATTGGTAAATATTGTCTCTGTATTGGTAACGCCGCAGATATTCTGTTTAGCCAC
AGGTGCAATTATCAGCGGCGTACGCGAGGCAGGGGCTAATCAGGCATAGTTTGCGTCAAA
CCTTGCCTGTTTTTGAAGATGTATATAGAAAAACAGGCGTTCAACAAGCCATTTTGCGAA
CCTGTTCCCGGAAAAAAGTCATATTTCTGTCACACTCTTTAGTGATTGATAACAAAAGAG
GTGCCAGGAATGAACAAAACGCTAATCGCCGCAGCTGTGGCAGGGATAGTTTTACTCGCT
TCAAACGCTCAGGCACAAACCGTACCGGAAGGCTATCAGCTACAGCAAGTGCTCATGATG
AGCCGCCATAACTTACGTGCGCCGCTGGCGAACAATGGCAGTGTGCTGGAGCAGTCGACG
CCGAATAAATGGCCAGAATGGGACGTCCCCGGTGGGCAACTCACCACCAAAGGTGGCGTG
CTCGAAGTGTATATGGGCCATTACATGCGTGAATGGCTGGCAGAGCAGGGGATGGTGAAA
TCGGGGGAATGCCCGCCGCCGTACACCGTTTATGCCTATGCCAATAGTCTGCAACGTACC
GTTGCGACCGCACAGTTCTTTATTACCGGCGCATTCCCGGGGTGTGATATTCCTGTGCAT
CACCAGGAAAAAATGGGCACTATGGACCCAACCTTTAACCCGGTGATCACCGATGATTCC
GCCGCATTCAGTGAACAGGCGGTGGCGGCAATGGAGAAAGAGCTCAGCAAACTCCAGCTT
ACCGACAGCTACCAGCTACTGGAAAAAATCGTTAACTATAAAGATTCCCCTGCCTGTAAA
GAGAAACAACAGTGTTCGCTGGTGGATGGCAAAAATACCTTTAGCGCCAAGTATCAACAA
GAACCAGGTGTTTCCGGGCCGCTGAAAGTCGGCAACTCGCTGGTAGATGCGTTTACTTTG
CAATATTACGAAGGTTTTCCGATGGATCAGGTGGCCTGGGGAGAAATCAAATCTGACCAG
CAGTGGAAGGTGTTGTCGAAGCTTAAAAACGGCTACCAGGACAGCCTGTTTACCTCACCG
GAAGTGGCGCGCAATGTTGCGAAACCGCTGGTCAGTTATATCGACAAAGCTCTGGTCACC
GATCGCACCAGCGCACCGAAAATTACAGTGTTGGTTGGGCACGACTCCAACATTGCCTCT
CTGTTAACGGCGCTGGATTTCAAACCGTATCAGTTGCATGACCAGAACGAACGCACGCCG
ATTGGCGGCAAAATCGTTTTCCAGCGTTGGCATGACAGCAAAGCCAATCGCGATTTGATG
AAAATTGAATATGTGTATCAGAGTGCGGAACAGTTACGTAATGCCGATGCGTTAACCCTG
CAGGCACCTGCGCAGCGTGTGACGCTGGAATTAAGCGGTTGCCCGATAGACGCTGATGGT
TTCTGCCCGATGGATAAGTTTGATAGCGTGTTGAATGAAGCGGTGAAATAACAGAAAACT
CCCCCGCGAGAAGCGGGGGAGTCGCTGGTTAAACGTTTTTACGTTCGATGGTCTGTTCGC
CCCAAAAAAGCGAATCTTTATCGGTCTTAGCAAAGGCTTTGACTAACACTTCATCACTAC
CTTCTTCCCAAATCTTTTCCGCCATTTTTTCGTCGTACCCGGCGACTTCGAAAATGGCCT
CGGCTATTTCCGGCGACGTATTGCGCAGAGATGCCCATTCACCGACGTGATGAGCTTTCG
CTTCTTGAGTTGGCATGCGTATCCTCCTGTTGAAGATTAGCCGTTAAGTTTAACTGCCAG
ACCTGCGACATATTCCCCTTGATAACGAGCAATAGACAGTTCTTCCTGGCTGGGCTGGCG
TGAACCGTCACCGCCTGCGATGGTGGTTGCGCCGTACGGCGTACCGCCGCGAACCTGTGA
AACGTCAAATAATTCCTGCGCTGCGTAGCCAATAGGGACAATTACCATGCCGTGATGCGC
AAGGGTCGTCCAGGTGGATGTGATGGTTTGTTCCTGACCGCCGCCAGTACCGGTGGAACT
AAAGACGCTCGCCAGTTTTCCGTATAGTGCGCCGGAAGCCCACAGGCCGCCCGTCTGGTC
GAGGAAGGTACGCATTTGACCGGACATGTTGCCAAAGCGGGTAGGTGTACCAAAAATAAT
GGCGTCGTAATCGGCCAGTTCTTGCGGGGTTGCAACCGGTGCAGTTTGCGTTTTACCGCC
TGCTTTTTCAAATAATTGCGGCGGCATGGTTTCCGGTACACGCTTAACGACAACTTCAGC
GCCATCCACTTTGCTTGCACCCTCAGCGACTGCGCGTGCCATCGTTTCAATATGTCCGTA
CATGGAATAATAAAGCACCAGAACTTTAGCCATTTCTAACCACTCCTCGTGTTATCTCTA
TTCCGTAGCGATTCGCTACCACTTATTTAAAGATAAGACGTCCTTTTCAGAGTGCAAATT
TCACAACCACTTATTTGATTTATAACAACTTTCACAAGCACGTAATTTTGTCGCAAAATG
ACACATTTTTATCTCATCGCGTTTTTTTAATCATAAGAGCGGCTTATGGATAATTATTGG
AGATGATATCTATTCTCGCTAAGAAGCTGTTGCAGGATATTACCAAACGCGGGTCTGCCC
GCGTCAGTTCACTAAGCTTAGTCCCACGTAGCGAAAATATGGCAGCCGCCATACGCCGCG
TTAATTCTATGCAATATGATGTCTATACCCAGACGGAGGTCAGTAATGGCAAACCATCGA
GGCGGTTCCGGCAATTTTGCAGAAGACCGCGAAAGAGCATCAGAAGCAGGTAAAAAAGGT
GGACAGCACAGCGGGGGTAATTTCAAGAATGACCCGCAGCGCGCATCTGAAGCAGGTAAA
AAAGGTGGTAAGAGCAGTCACGGCAAAAGCGACAACTAGCCGGGCTAATCAATGACGAAT
GCATTTTTGTCTGTAGCTCGTCAAAAAGCCATCACCGCCGGTTACCCGGTGGTTGATACT
GATGACAAATGTAAGCTTGCCTGATGCGCGATGCTTATCAGGCCTACCAGAAGATTGCAA
TATATTGAATTTGCACTGTTTTGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCATGA
ACAATGCGTACGTTGTCAACAATCTGCACCGCCGGTAACCCCGGCGGTTTTCTGTTTATG
GCTCCTGATGAACAACTTCTGGCGGTGGAACGTCAACCAACTTTCTGCTTAACAACGCAT
TGAGTAAAATCGCGCCAAAGGTTGCTGTACCAATCCCTCCCAACGTAAAACCGCCCAGCG
TGAGAGCAAAATCACCCGCGCCCAGCACTAAGGTTACTGCGACCATAATCAAATTACCGT
TCTGGCTTAAATCGACACGGTTTTGTACCCATATCCTTGCGCCTGCGACGGCAATCAGCC
CGAACACAACAATTGATGCACCACCAATAACCGCGGCCGGAATGGTATGAATCAGCGCAC
CAAATTTCGGTGAAAAGCCCAACAGCATGGCGATGACGGCAGCAGCAACAAACACCAGCG
TCGAGTAGACTTTGGTCACGGCCATCACACCGATATTTTCAGCATAGGTGGTCACGCCGC
TACCGCCGACAGAGCCGGAAAGCATCGTTGCCAGACCATCGCCTACGAATGCCCGCCCCA
TATACGGGTCCATATTGCGTCCGGTCATCCCGGCGACTGCCTTGAGATGACCTAAGTTTT
CCGCCACCAGAATCACCGCCACGGGCGCAATCAGCATCATTGCCTGACCATTAAAAGCAG
GAGTGGAAAAATGTGGCAGACCGAACCAGGCAGCATGGCTGACGAGAGTAAAATCGACGG
CTTTTCCCAGCCCTAAAACGTTGGTCATCACGCCATACAGCAGACAGGCGACAATTAATC
CTACGAGAATCAATAACCGCTGGATCATGCCACGGGTAAACACCGCCACCAGCCCAATAC
ACAGCACCGTCATTACCGCCATCCAGCTATCAAAGGCCGAAGCCGATACACTTTTCACTG
CGATAGGCGCTAAGTTCAGGCCAATCGCCATCACCACCGCACCCGTCACCACCGGCGGCA
TCAGTCGTTCAATCCAGCGCGTACCGATTTTCATCACCACCAGGCCAATGACGGTATAAA
CCAGCCCACAGGCGATAATCCCGCCCAGCGCAATGCTGATATTCGGGTTAATGCCCTGAC
CGTTAAAGCCCGTCGCGGCGATCACCACGCCGACAAAAGCCGCGCTGGAGCCGAGATAAC
TGGGGACGCGCCCGCCGGTAATAAAGAAAAACAGTAACGTGCCGATCCCCGACATTAAAA
TGGAAAGATTGGGATCCAGCCCCATCAGAATCGGCATTAACACCGTCGCGCCAAACATCG
CCACCGCGTGTTGAACGCCCATTACTGCCGTCTGAGCAAACGGCAATCGTTCATCCGGCG
CGACCACGCCGCTCTCTGTAGAGGTCGATTTTAACTGCCAGTGAGGAAAACCGAACATTG
CCATCAGCTGTCTCCTTAAGGAGGTTAACAAGCAGGGCGCATCAGCGCGTGATAACTGCG
ATCGAACCACACCAGCCCGTAGGGTGTGGTGTGACGATGAATCGCTTCGATGGCGCAAAA
CAGAATGTCGTGGGTGCCGACGCTCACCACCTGGCTGATACGGCAGTCAAACGAAACCAG
AGCCTCTTCCAGTTGCGGGCATCCGGTCACCCCCGTCTGCCAGCGGGCGGCGGCAAAGCG
GTGTTCCATGGGCGTTTTGCCGCCAAAAAGGTTTGAAAGCGGCTCCTGCCCGGCGCTAAG
TGTATTTACACACAGCGTTCGATTTTCATTGAATGCCGGCCAGACGGACGCCCCACGATT
CAGGCACACCAGTAATGTGGGCGGCGTATCGGTCACACTGCAGACGGCGCTGGCGGTGAA
CCCGGCGCGCCCGGCTGGACCGTCCGTGGTGATAATATTGACCGCCGCGCCCATGCAGGA
CATCGCATCGCGAAAAGTTTGTTGATCGACAATGTTCATAGTTTGCTCCTTACAACAGCC
CGCAGGCTTCTTCAAAGGACAGACGTGGCAGGCGCGCATAAAGCTTGCTGCTATCGCCAT
AGCCGATATTAATCAGCAGATTGCTCTTCAGCGTGCTGCCCGTAAAAAAGGCGTCGTCCA
CGTGTTGACGGTCAAAGCCCGACATCGGGCCGGTATCCAGTCCCAGCGCCCGGCAGGCGA
CGATCAGATAGGCCGCCTGCATGGAACTGTTGCGAAACGCTGTTTCTTCGGCAAGTTGTG
GGCTGGAGGTAAACCAACTGCGGGCATCACCGTGGGGAAACAGTAGTGGTAACCGTTCAT
AAAATTCACTGTCCCAGGCGACGATAGCGGTGACGGGCGCGGTCAGGGTTTTTTGCAGAT
TGCCGCTGGAAAGTGCCGGGCGCAGACGTTCTTTTCCTTCTGCCGTGCGGGTAAACACGA
TCCGTGCCGGAGAACAGTTAGCTGATGTCGGCCCCCATTTCATCAGGGCATAAATCTCCC
GTAACGTCTCATCGCTGACGGGTGTCTCCCGCCAGCCGTTGTGAGTGCGGGCATCGGTGA
ACAGGGTGCTAAGCGCACCTGGGCTAACGGCTTCGTTCATAGCAATTCCTTACAGGGCGG
CTTCACGGTGATGTAACAGGCTGGCAAGCCCGTTGAGTAACAGAGCATTAAACGTTTCGG
GATCGGTCACGTTGCAGGCGTGTCCGCCATAGGGCATCACCATTTTCTGGCTATCGGGCA
GGGCGGCATGAAGTTCACTGGAACATGCTGTTGGCACCAGCAGATCATCACTGGCGCAGA
TGATTTGCACCGGGCAGCGGATGCGATCCGCATGGTGACTAAAGTCAGCGCGTTTGAGGG
CGTTAAGTCGACGCAGTAAATTATTTTTGCCCTGAAAATGCGCCAGTGCCAGCGCGTCTT
CTGCCTCCAGGCGAGGTGCGCGGGCCGCCATCCAGTCGGCGGGATAGAGGAACAACGGCT
GCGCTTCCACCCATGCCTGCGCGCCGCCGCTATACAGTAATCGTTCGCGAACCTGAAAAC
AGCGGCGCGTATGGGCGTTTATTCGTAGCCAGCCGTTAACGCTGATCAGCACAGTTACCG
ACGCGGGATAATCCAGCGCCAGCTGCATTCCCACCAGCGCACCGAGCGCATGGCCGACCA
CTGCGTAATGCTCAATCCCTGCGGCTACCAGCGCCTGATGCAGTTCCGCTGCCATCTGGG
CGATACTGTAATCTTCTGCCAGCGTGTCGGGATTATTGCCGGTGCCGCGCTGGTCGTAAC
AGACTACCTGATACTCCTGCTCCAGCACCGCCAGTTGCGGTAACCAGTAACTGCCGCTAC
CCCCAAGACCCGAAATCAACACCACTACGGGCGCATCAGCATAAGGGGGAGGTGAGAGTG
AAAGTTTCATCGCGGCCTCACTTGGCGATATGCGCAATTGTGGCGATTTCCACCAGCGCG
TCAGGTTTTACCAGTCCGCACTGAATGCAGAATCGCGCCGGTTTATCACCCGGAAAAAAC
TCGGCGTAGATTTCGTTAATCGCGGCGTAATTTTTCCAGTCGGTAATAAAGATGCTGTTG
AAGGTCACATCCGCCATCGTGCCACCCGCCGTCTCGATCACCTTGCGGATAGTTTCCAGA
ACGTGGCGGGTTTGCGCCTTTGGGTCATCGGCAAACAGCACGTTATTATGTTGATCAAAA
GCCAGCGTACCGGAGACATACACCACGCCATCAGCCAGCGTGCCGGGAACGAAGGGGGCC
AGCGGTGCGCTGCTGCCAGCGGGAATAATTACGGATTTTGGCATCGTTAAACTCCTTAAG
CGATATGAGCAAAGGACGTGGGAGAAAGCGCGTCGCAGAATGTTTCGACGTCGCTGACCC
AGCCAAAAAAGGTTTCGATATTGAACAACGCGGCTTTCTGCGCAAATTTCGGCCCCGCCT
GGTGAGTTGCGTCTTCAAGCACCACGCCGAAATACTCCAGAAAAAAGCCGTCGCGTAGCG
TCGATTCGACGCAGACGTTGGTAGCGATGCCGGTGAAAACCAGATGGCGTATTCCGCGGC
TGCGCAAAATGCTGTCCAGCGGCGTATTGAAGAAACCGCTGTAGCGCGGCTTCGGCAGCA
CAATATCGCCAGGCTGCGGCACCAGTTCATCCACCAGTTGATAATCCCAGGAGCCTTTCG
CCAGCAATTTCCCCTGCAGCTGCGGCTGCTTACGCATGGTTTTCAGGGCGTTCGATTTAT
GAAAATTCGGTGAGCCGGGTCCGCCAGCCTCGACATACTGTTCATCCCAGCCATTTTGAA
ACCAGATGATCAGCATCCCTGCCGCTCGCGCTGCGGTCACGGCGGTTTGAATGTTGGCAA
TGACCGGGCGAGTGGTTGAGACATCAAACCCGGCGAGATCTAAGTAGCCGCCTGGCGTGG
CATAAGCGTTTTGCATATCCACCACGATCAGCGCACTTTGCTGCGGATCGAAGGTAATGG
CTTCCGGTCGAGCGGTTAAGGTCGTCATCATGCCACCTCCTGAGTCAGCGCAGGTAGATG
GGCGCGGCATTGCATCAGTGGTTGAATGCGCTCGCCGAAGGTTTCGATTCCCGACAGAAA
ATCGTCGAAGGTTAACAGCACGCCTTCGGCACCAGGCACGCTTGCGACTTCATCTAACAT
GCGCGCGACACTGGCGTAAGAACCGACTAACGTCCCCATATTGATGTTTACCGCCGAAGT
GGGATCGGCCATCTGACGAACGTTGGTGTCAGTACCGGAGCGGGTATCTTTCTGACTTTG
TTCGGTTAGCCAGCTTAACGCCTCTTCATCCGCGCCCGCTTTGTAGTGTTCCCATTTGGC
GCGAGCGGCATCGTCGGTTTCATCGGCAATCACCATAAACAACACATAAGAGCCAACGTC
GCGTCCGGTTTGCTCTGCGGCCTGTTTCATCCGCGCAGCGGTCGGGGCGAAAGCCGTGGG
TGTATTTACGCCTTTGCCGAAACAGAAGTTGAAATCGGCATACCGGGCGGAGAACGCCAT
GCCAGCGTCGCTTTGCCCGGCGCAGATCACTTTCATGGGGACACTCGGTTGCGGACTCAC
GCGACAATCATTCATGGTGAAAAAATCGCCTTTAAAATCGCTTTTCCCCGTGCCCCACAG
GTCGCGCAGCACCTGAACATATTCGGTGAGATAGTCGTAACGACGGGAGAAATAGTCATC
GCCAGGCCAGATACCCATCTGCTCATACTCGGGCTTTTGCCAGCCAGTCACGAGGTTGAC
GCCAAAACGCCCGCCAGAGATGGAGTCGATGGTTGCGGCCATACGGGCGACGATTGCCGG
AGGTAACGTTAAGGTGGCAGCAGTGGCGTAAATCTGAATGCGCGAGGTCACGGCCGCCAG
CCCCGCCATCAAGGTGAACGACTCAAGGTTGTGATCCCAGAACTCAGTTTTGCCGCCAAA
GCCACGCAGTTTGATCATCGACAGGGCGAAATCGAAATGGTAGTGCTCCGCTTTTTGCAC
AATGGCTTTATTCAGTTCAAAGGTCGGCATGTACTGCGGCGCGTGGGTCGAAATGAGCCA
GCCGTTGTTGCCAATAGGTACGAATACGCCAATTTTCATCATCAACCTCTCTTCGTCTCG
TAAAGTGAAAGTCAGACGGGGCGCTGCATCCTGCATATCCTTTTCAGCCGCGTATTGGCT
TGTTTGCAAAGCGGATGCCAGTTTTTAAAAAGTTAATGTTATTAATCTGTTAACATTACG
TTATCTAAAATATCTGGTAAAAAGTGGACTAAACGGTCAAAACAGTTGCACATAAAACAT
GCATCTGTGCGCGATGAGAGTGCAGAAGGTCGAGGCCGGGCGGGGGTTTTGCTATCCTGT
TGCCAATCTACAAGAGGGGAGAGCGCATGACGCAAGGCGCAGTGAAAACAACGGGTAAAC
GTTCGCGCGCAGTAAGCGCGAAGAAAAAAGCGATTCTTAGCGCAGCACTGGACACTTTTT
CACAATTCGGTTTTCACGGCACAAGGCTGGAGCAGATCGCAGAGTTGGCGGGTGTTTCAA
AAACCAATCTGCTGTATTACTTTCCGTCAAAAGAGGCGCTGTATATTGCCGTGCTGCGGC
AGATTCTCGATATCTGGCTGGCACCGTTAAAAGCGTTTCGTGAAGATTTCGCCCCGCTGG
CGGCGATCAAAGAGTACATCCGTCTGAAGCTGGAAGTCTCACGCGATTATCCGCAGGCTT
CGCGCCTGTTCTGTATGGAGATGCTGGCAGGCGCGCCGCTGTTAATGGATGAACTGACGG
GCGATTTGAAGGCATTAATTGATGAGAAATCGGCGCTGATTGCCGGTTGGGTCAAAAGCG
GCAAACTCGCGCCGATTGATCCGCAGCATTTGATTTTTATGATTTGGGCTTCCACTCAAC
ATTACGCCGATTTCGCCCCTCAGGTGGAGGCGGTGACAGGCGCGACGTTGCGCGATGAGG
TATTTTTCAATCAAACGGTTGAAAACGTGCAGCGGATTATTATTGAGGGGATTCGACCAC
GTTAAAGATGCCGGAGGAGGTTGTAACATCCTCCGGCTACCTGTTTAACCTATAGTCATT
AAGCTGGCGTTACCGCCAGCGGCAGCGGTATTCACACTCAGCGAACGCTCGATATACAGC
CGTTCCAGAAGGATATTGCTTTCGCCACGGGCAAAACCCTGCACCGAAACAATTGTGCCA
TCCCGCGCGGCAACTGCTTCACACAATGCGCGAAGCTGATCCGAATCACCGTGGAAGATC
ACCGCATCAAACGGTTGAGCGGTTATATTTTCCGCTTTCGCCAGTTGAATACGTTCGCTG
ACTGCCGATGGCAATGCCTTCACTAACTGACGATGCAGCGCGTCATCCGGCCACAGTACC
TGGCTGCCCACCGCCAGCACGGCGGCGAGCTGAGTCAGCGCATCCTGCTCATCATCGGCA
ATACACAACACGCGCTCACGCGGCAGCAGCGTCCAGGTGTTGCGTTCACCCGTCGGCCCC
GGCAGCAATCGTTGTGTTCCTGCCTGCGCCAGCTCGCCATATTGCGTACATAACGCCTGC
AATTCTGGACGATTTGCTGCCCATTCCCGCAGTGCATTTAGCGGCTGAGTCAATGCGGCT
TTCAACTGCGCATCGACCGGATACTTTGCATCCTGACGCGCGAGCGTCACTGCCAGCGCA
CTTTCCGGGCGATTCGCCAGCAGACGGTAGAGATAGAGCGGACCGCCTGCTTTCGGCCCG
GTACCGGACAACCCTTCGCCGCCGAACGGCTGCACACCAACCACTGCGCCCACCATATTA
CGGTTAACATACAGGTTACCAACATGGGCCGAGCCAGTGACCTGGGCGATGGTTTCATCA
ATGCGCGTATGGACGCCAAGCGTCAGACCATAACCGGAAGCGTTAATCTGCTCGATCAGC
TCTGGTAGCTGGTTACGGTTGTAACGCACCACATGCAGCACCGGACCAAAGACCTCTTTT
TGCAATTCGGCAAAGTCATCCAGTTCGATCAGCGTCGGGGCGACAAAGGTGCCGCTTTGC
CATTCACGGGCATCTTCGCTGTTTTCCCGCACCGCCTGGAACACCGGACGGCCTTTGCTA
CGCATGGTCTGAATATGGCGCTCAATATTGGCTTTCGCTTCGCTATCAATCACTGGACCG
ATATCGGTGGTCAGGCGACCCGGATTACCCATCCGGCATTCGGCCATTGCGCCGCGCAGC
ATTTTCAACGTGTGGTCGGCAATCTCATCTTGCAGGCACAGCACGCGCAGCGCCGAACAA
CGCTGACCCGCACTGTCGAACGCCGAGGCCAGTACATCCACGACGACCTGTTCGGTCAGT
GCTGAAGAATCGACAATCATCGCGTTCATGCCGCCGGTTTCAGCGATGAGCGGAATAGGG
CGACCCTGAGCGTCCAGGCGGCTGGCGATATTGCGCTGCAGTAACGTAGCGACTTCGGTT
GAACCGGTAAACATCACCCCGCGCACGCGATCATCACCCGTCAGTTGCGCGCCCACGGTT
TCACCCCGACCTGGCAGCAATTGCACCACGCCTGGCGGTACACCCGCTTCCAGCAAAATG
GCGATCCCTTGCGCGGCAATCAGCGGCGTTTGTTCTGCCGGTTTTGCCAGCACGCTGTTA
CCTGCCGCCAGTGCGGCGGCGATCTGCCCGGTGAAAATAGCCAGCGGGAAGTTCCACGGA
CTGATACACACCACAGGCCCTAATGGACGGTGGGTTTCGTTAGCGAAATCATCCCGCACC
TGTCCGGCGTAGTAGTGGAGAAAATCGACCGCTTCGCGCACTTCGGCAATGGCGTTACTG
AAGGTTTTTCCGGCCTCACGCACCAGAATACCAATCAGTTGCTGCATCTGGCTTTCCATC
AGCACGGCAGCGCGGTGCAAAATCGCTGCGCGTTCAGCCGGAGGCGTGGCAAACCAGATT
GGCGCGTTATTAACCGCACTTTCCAGCGCCTGTTCTACTTCACGCGGCGTGGCTTCACGC
ACATAGCCCACAATATCTTTCGGTTCCGCAGGGTTAATAACGGGCGACATCTCACCTGCC
GCTACCGGTTGTTCCAGCATTGGCAAGGCCTGCCATTTTTGCAGTGCACTATTGAGCAGG
GCAGAGGAGAGCGAGGCCAGGCGGTGTTCGTTAGCGAGATCCAGCCCTGCCGAGTTGTCG
CGCCCGTGACCGTAAAGATCGCGCGGCAGGGGAATTTTCGGATGCGGTAATCCAGTTTGC
CCTTCCTGTTGCGCCAGTTTTTCTACAGCAGTGACCGGATCGGCGACCAGTTCATCCAGT
GGCAAAGAGGTGTCGGCAATACGGTTAACAAACGAGGTGTTAGCACCGTTTTCCAGCAGG
CGACGCACCAGATACGCCAACAGCGTTTCATGTGTGCCAACCGGAGCATAAATACGACAC
GGACGGTTAAGTTTGCCGTCGGCAACTTTCCCGGTGACCTGCTCATACAGTGGCTCGCCC
ATACCATGCAGGCACTGGAACTCGTACTGACCCGGGTAGTAGTTCTGCCCCGCCAGTTGA
TAAATCGCCGCCAGCGTATGGGCGTTGTGCGTCGCGAACTGCGGGTAGATTAGATTCGGC
ACCGCCAGCAGCTTTTTCGCACAGGCGAGATAAGAAACGTCGGTATACACCTTGCGGGTA
TAAACCGGATAACCTTCAAGGCCGTCCATCTGCGCACGCTTAATTTCACTATCCCAGTAC
GCGCCTTTCACCAGGCGAATCATCAGACGGCGACGGCTGCGGGTGGCGAGATCAATCAGG
TAATCGATCACCAACGGGCAGCGTTTTTGATAAGCCTGAATAACAAAACCGATGCCGTTC
CAGCCTGCCAGTTCCGGCTCGAAACAGAGTTTTTCCAGCAGATCGAGGGAGATCTCCAGG
CGATCGGACTCTTCGGCGTCAATGTTGATACCAATATCGTACTGACGCGCCAGCAGGGTG
AGTGATTTCAGACGCGGGTAAAGCTCTTCCATTACCCGGTCATACTGGGCGCGGCTATAA
CGCGGATGCAGCGCCGACAGTTTGATTGAAATGCCCGGCCCTTCATAGATGCCACGACCG
TTAGACGCTTTACCGATGGCGTGAATCGCCTGCTGATAGGAAACCATATACGCCTGTGCA
TCTGCGGCGGTCAGCGCGGCTTCGCCCAGCATATCGTAAGAGTAACGGAAACCTTTCTCT
TCCAGCTTGCGGGCATTGGCTAACGCTTCCGCGATGGTTTCGCCAGTGACGAACTGCTCA
CCCATCAGGCGCATCGCCATATCCACACCTTTGCGGATCAGCGGTTCACCGCTTTTACCG
ATAATGCGGTTCAGCGAGCGGGAGAGGCTGGCTTCGTTATGGGTGGAAACCAGTTTGCCA
GTAAACAGCAGCCCCCAGGTGGCGGCATTAACAAACAGTGACGGGCTACGACCAATGTGT
GACTGCCAGTTACCGTTGCTGATTTTGTCGCGAATTAACGCGTCGCGGGTGGCTTTGTCG
GGAATACGCAACAACGCTTCCGCCAGACACATCAGCGCCACGCCTTCCTGCGATGACAGC
GAAAACTCCTGCAATAACCCCTGGACCATACCTGCGCGACCACTGGCATTTTTTTGATTA
CGCAGTTTATCGGCCAGCTGATACGCCAGTTTGTGCGCCTGTTCAGCAACTGGCTGCGGC
AGGCGGGCTTGTTCCAGCAGCATAGAAACCGCTTCGGTTTCCGGGCGGCGATAGGCCGCG
GTGATCGCGGCGCGGGAAACCGACTGGGGCAATATTTGCTCGGCAAAGTCGAGGAATGGC
TGGTGTGGTTCCTCTGCCGGAGTCGGTGCTTCATCGCTCTCATTGGCCGCGCCAGAAAGC
AGCGCAGGTAGCTCCGGCAGAGTATCGCTGTTTTCCAGTTGTTCGAGATAAGAAAAAATC
GCCTGCTTAATTAACCAGTGTGGTGTGCGATCGATACGTGTCGCGGCAGACTTAATACGC
TCACGCGTCGCGTCGTCCAGCTTAACCCCCATGGTGGTGGTTCCCATGCCATTACTCCTG
TTGTTCAGAAAGGTGCAACTTAACGTTATCGTGAAATATCCATGATGTTGCAACTTTGTG
CAACCATGTTAAATGTGACATGCGTAGCAAGCTTAAAAATGAATGAAATGTTAATAAAAG
AAATCGATATGACAGGGATTAAAAAAATAACTCAGACTTTTTCTCTGCGGCAGTTAACAT
TTTTGAAAGGTGCAACCGCAAAAAATGTGAGAGAGTGCAACCTGATGAAAAATAGTGTCG
CTGAGCACTAAAATTTAATGTAAATGGTGTGTTAAATCGATTGTGAATAACCAGCGCTTC
CGGCAGGATACGGTCGCCCTGGTAAAACATAAACTCTGTTACCCCGTTCCGGTGGCAGAT
ATAACGGCAAGTTTCGACATTGCCGATAATAATTTTTTGGAGACTTTAGATGGCTATTAG
CACACCGATGTTGGTGACATTTTGTGTCTATATCTTTGGCATGATATTGATTGGGTTTAT
CGCCTGGCGATCAACGAAAAACTTTGACGACTATATTCTGGGCGGTCGTAGTCTTGGGCC
ATTCGTGACGGCATTATCGGCGGGTGCGTCGGATATGAGCGGCTGGCTGTTAATGGGGTT
GCCGGGCGCTGTTTTTCTTTCCGGGATTTCCGAAAGCTGGATCGCCATTGGCCTGACATT
AGGCGCGTGGATTAACTGGAAGCTGGTGGCCGGGCGGTTGCGTGTGCATACCGAATACAA
CAATAACGCCTTAACACTGCCGGATTATTTCACCGGGCGCTTTGAAGATAAAAGCCGCAT
TTTGCGCATTATCTCTGCGCTGGTTATTTTGCTGTTCTTCACCATTTATTGCGCTTCGGG
CATTGTGGCAGGCGCGCGTCTGTTTGAAAGTACCTTTGGCATGAGCTACGAAACGGCTCT
GTGGGCGGGCGCTGCGGCGACGATCCTTTACACCTTTATTGGCGGTTTCCTCGCGGTGAG
CTGGACTGACACTGTACAGGCCAGCCTGATGATTTTTGCCCTGATCCTGACGCCGGTTAT
CGTCATTATCAGTGTCGGTGGCTTTGGTGACTCGCTGGAAGTGATCAAACAAAAGAGCAT
CGAAAACGTTGATATGCTCAAAGGTCTGAACTTTGTTGCCATTATCTCACTGATGGGTTG
GGGGCTGGGTTACTTCGGGCAGCCGCACATTCTGGCGCGTTTTATGGCGGCGGATTCTCA
CCACAGCATTGTCCATGCGCGTCGTATTAGTATGACCTGGATGATCCTCTGCCTGGCAGG
GGCGGTGGCTGTCGGCTTCTTTGGGATTGCTTACTTTAACGATCATCCGGCGTTGGCTGG
TGCGGTAAATCAGAACGCCGAGCGTGTGTTTATCGAACTGGCGCAAATTCTGTTTAACCC
GTGGATTGCCGGGATTCTGCTGTCGGCAATTCTGGCGGCGGTAATGTCAACCTTAAGTTG
CCAGCTGCTGGTGTGCTCCAGTGCGATTACCGAAGATTTGTACAAAGCGTTTCTGCGTAA
ACATGCCAGCCAGAAAGAGCTGGTGTGGGTAGGGCGTGTGATGGTGCTGGTGGTGGCGCT
GGTGGCGATTGCGCTGGCGGCAAACCCGGAAAACCGCGTGCTGGGCTTAGTGAGCTACGC
GTGGGCAGGCTTTGGCGCGGCGTTTGGTCCAGTGGTGCTGTTCTCGGTGATGTGGTCACG
CATGACGCGTAACGGTGCGCTGGCGGGGATGATCATCGGTGCGCTGACGGTTATCGTCTG
GAAACAGTTCGGCTGGCTGGGACTGTACGAAATTATTCCGGGCTTTATCTTCGGCAGTAT
TGGGATTGTAGTGTTTAGTTTGCTGGGTAAAGCGCCGTCAGCGGCGATGCAAAAACGCTT
TGCCGAGGCCGATGCGCACTATCATTCGGCTCCGCCGTCACGGTTGCAGGAAAGCTAAGG
GACTTAGCCTGCGGCGGTTTTGTTTGGCTTCAGCAGCGGGTTGCGCTCCCTTAATGTGCC
TCGCCATATAAATTGAATGGTGCAGGGAGCGCGCAGGGGGCGGCCAATCGCCGCCGCCCC
CTGCTGTCCCGGCCTTCGGGGAACGCTTCAGCGATTTTGACGCCACCAACACCCGAGCTG
TTATTATGTTCCGGGCAAAAAGTTAGATTTGATAATCGCGGATGGACGAAATTGCTTGAT
ACACCCGCTTATCAGTTTTACATGGAAGCTCTGATGCATTGAGTCTGGACAGTTTTGTCG
GCTGGATACGGCGTTTACGCGGCATCCGGCAAGAACACATGGTTCTTTGCAAACAATCCC
ATCTTTCTACCCTGGAATAATCGTTTATATCCCTTGGCATTACCTCTCTTTGTTTACATT
CCAACATCATTTTATAAACATTCCGCTTGTGTTTTTCTTTGCCGTAATGATAATCGCTAT
CACTGCGATTTACTTTTCTTTGCATAGATTGACTCAGAAAAACGTTTAAGGGTGGGTGGC
ATGTTTGTTCCGTTTCTCATTATGTTGCGCGAAGGACTTGAAGCCGCGCTGATTGTCAGT
TTGATTGCCAGCTATCTTAAGCGTACCCAGCGAGGCCGATGGATTGTGTGATGTGGATTG
GCGTGTTGCTTGCCGCTGCGTTGTGCCTGGGCTTGGGTATCTTCATTAACGAAACCACCG
GCGAATTTCCGCAAAAAGAACAGGAACTGTTTGAAGGTATCGTGGCGGTGATCGCCGTGG
TGATCCTTACCTGGATGGTTTTCTGGATGCGCAAAGTGTCGCGCAACGTCAAAGTGCAAC
TGGAACAGGCAGTCGATAGCGCATTGCAGCGTGGAAATCATCATGGCTGGGCGCTGGTGA
TGATGGTCTTTTTTGCCGTTGCAAGGGAAGGGCTGGAGTCGGTCTTTTTCCTGCTGGCGG
CATTTCAACAAGATGTCGGGATCTGGCCGCCGCTGGGTGCAATGCTCGGTCTTGCTACTG
CCGTGGTGCTAGGCTTCCTGCTCTACTGGGGCGGTATTCGCCTCAATCTTGGTGCATTTT
TTAAATGGACCAGCCTGTTTATTCTCTTCGTCGCCGCAGGGCTGGCAGCTGGTGCCATTC
GCGCATTTCATGAAGCCGGATTGTGGAACCACTTTCAGGAAATCGCCTTCGATATGAGTG
CGGTGCTCTCAACTCACTCGCTGTTTGGCACGCTGATGGAAGGGATTTTTGGCTATCAGG
AAGCGCCGAGCGTCAGCGAAGTCGCCGTCTGGTTTATTTATCTCATCCCGGCGCTGGTGG
CATTTGCTCTGCCACCACGCGCAGGGGCGACAGCGTCTCGCTCCGCGTAACAAATACGAC
GCAAACTCTTGCTTAGTTACAACATACTTTAAAGGGATAGTCTCGTCATGACCATTAACT
TCCGCCGTAACGCATTGCAGTTGAGCGTGGCTGCGCTGTTTTCTTCTGCTTTTATGGCTA
ACGCCGCTGATGTGCCGCAGGTCAAAGTGACCGTGACGGATAAGCAGTGCGAACCGATGA
CCATTACGGTTAACGCCGGGAAAACACAGTTCATTATTCAGAACCACAGCCAGAAGGCGC
TGGAGTGGGAGATCCTCAAAGGCGTGATGGTGGTGGAAGAGCGGGAAAATATCGCCCCTG
GCTTTAGCCAGAAAATGACGGCGAATTTACAGCCTGGCGAATACGATATGACCTGCGGTC
TGCTGACTAACCCGAAAGGGAAGTTGATCGTCAAAGGTGAGGCAACGGCGGATGCGGCGC
AAAGTGATGCGCTGTTAAGTCTTGGTGGTGCAATTACTGCATATAAAGCGTATGTCATGG
CGGAAACCACGCAGCTGGTGACCGACACCAAAGCCTTTACCGACGCGATTAAAGCAGGCG
ATATCGAAAAAGCGAAAGCACTGTATGCACCGACGCGCCAGCACTATGAGCGTATTGAAC
CGATTGCTGAACTGTTCTCCGATCTGGATGGCAGCATTGACGCCCGTGAAGATGATTACG
AGCAAAAAGCCGCCGACCCAAAATTCACTGGTTTCCACCGTCTGGAAAAAGCATTGTTTG
GCGACAACACCACCAAAGGGATGGATCAGTACGCTGAGCAGCTTTATACCGATGTGGTCG
ATTTGCAAAAACGCATCAGTGAACTGGCTTTCCCACCTTCAAAAGTGGTCGGCGGCGCAG
CCGGACTGATTGAGGAAGTGGCAGCCAGCAAAATTAGCGGTGAAGAAGATCGCTACAGCC
ACACCGATCTGTGGGATTTCCAGGCTAACGTTGAAGGCTCGCAGAAAATTGTCGATTTGC
TGCGTCCACAACTGCAAAAAGCCAACCCGGAACTGCTGGCAAAAGTCGATGCCAACTTTA
AAAAGGTCGATACCATTCTGGCGAAATACCGTACTAAAGACGGTTTTGAAACCTACGACA
AATTGACCGATGCCGACCGGAATGCACTGAAAGGACCGATTACTGCGCTGGCGGAAGATC
TGGCGCAACTTCGCGGTGTGCTGGGACTGGATTAAGCGTTATGCAGTATAAAGATGAAAA
CGGCGTGAATGAACCGTCACGCCGACGTTTACTGAAAGTGATAGGTGCACTGGCGCTGGC
GGGAAGTTGTCCGGTCGCTCATGCACAAAAAACGCAAAGTGCGCCGGGTACGCTTTCACC
GGATGCTCGCAATGAGAAACAGCCGTTTTATGGTGAGCATCAGGCAGGGATCCTGACGCC
ACAACAGGCCGCAATGATGCTGGTGGCGTTTGATGTGCTTGCCAGCGATAAAGCCGATCT
TGAGCGGTTGTTTCGCTTGTTGACTCAGCGTTTTGCTTTTCTGACTCAGGGCGGAGCAGC
ACCAGAAACGCCAAATCCGCGCCTGCCACCACTCGATTCCGGCATTCTTGGCGGCTACAT
TGCGCCCGATAATCTCACCATCACGTTATCGGTGGGTCACTCATTGTTTGATGAGCGCTT
TGGCCTTGCGCCACAGATGCCAAAAAAGCTGCAGAAGATGACGCGTTTCCCCAACGACTC
GCTGGATGCGGCGTTATGTCATGGTGATGTGTTGCTACAGATTTGCGCCAACACCCAGGA
CACGGTTATCCATGCGCTGCGCGATATCATCAAACACACGCCGGATTTGCTCAGTGTGCG
CTGGAAGCGGGAAGGGTTTATTTCCGATCACGCGGCGCGTAGTAAAGGCAAAGAGACGCC
GATTAATTTGCTGGGTTTCAAAGACGGCACTGCCAATCCCGATAGCCAGAATGATAAGTT
GATGCAAAAAGTGGTGTGGGTAACGGCAGATCAGCAGGAGCCTGCGTGGACAATCGGTGG
CAGCTATCAGGCAGTACGCTTGATTCAGTTTCGAGTGGAATTTTGGGACAGAACGCCGCT
GAAAGAACAGCAGACGATTTTTGGCCGTGATAAGCAAACCGGTGCGCCGCTGGGAATGCA
GCATGAGCATGATGTGCCTGATTACGCCAGCGACCCGGAAGGGAAGGTGATCGCGCTGGA
CAGCCATATCCGGCTGGCGAATCCCCGCACGGCGGAGAGTGAGTCCAGCCTGATGCTGCG
TCGTGGCTACAGTTATTCACTGGGCGTCACCAACTCCGGGCAACTGGATATGGGGTTGCT
GTTTGTCTGCTACCAACACGATCTGGAAAAAGGCTTCCTGACAGTACAAAAAAGGCTCAA
TGGCGAAGCGCTGGAGGAATACGTTAAACCTATCGGCGGCGGTTATTTTTTTGCGCTGCC
GGGGGTGAAGGACGCGAACGATTATTTCGGAAGCGCGTTATTGCGGGTTTAATGTTTTTA
GGCGGATAAGGCATTTGTGCGCAGATGCCTGATGCGACGCTTGCGCGTCTTATCATGCCT
ACAATCAGTGCGGGTTTGGTAGGCTGGATAAGGCGTTCACGCCGCATCCGGCGATCGTGC
ACTGATGCCTGATGCAAATCCTGCTGAAAGCACACAGCTTTTTTCATCACTGTCATCACT
CTGTCATCTTTCCAGTAGAAACTAATGTCACTGAAATGGTGTTTTATAGTTAAATATAAG
TAAATATATTGTTGCAATAAATGCGAGATCTGTTGTACTTATTAAGTAGCAGCGGAAGTT
CCCGGCAGTGATAGTCAGTCACTATGGAGATCGCGGATGGTAACGTCCTGTACTGGACAT
GTTTTAGATAATCAACGCGCCACCACTCGCGGAGTTTTCTCCTCCGGTAGTCATCTCGTC
ACTTTGCATTTTCAACCTCATCCTTTCTTTTCATGTGTTACCGACGCCGTAAACGGTGCG
CGTAGCCGTTTTTCGGCATTTTATCCAAAAGCAAACTATGGCTTACAAGGAAGCCAACCC
TCTGATGTTCGTGCGCATAATCGCGCTGCCAACGGCGCGTGTGATGAATACAAACAACTC
AAGGTGCTCTCCATGGGAAGACAAAAAGCAGTGATCAAAGCTCGTCGCGAGGCAAAACGT
GTGCTGAGACGGGATTCGCGCAGCCATAAGCAGCGTGAAGAAGAATCGGTCACCTCGCTT
GTGCAGATGGGCGGCGTAGAAGCCATTGGTATGGCCCGCGACAGTCGCGATACTTCGCCC
ATCCTCGCGCGAAATGAAGCGCAATTGCACTATCTGAAGGCTATTGAGAGTAAGCAGCTG
ATATTCGCCACGGGCGAAGCCGGGTGCGGAAAAACCTGGATCAGCGCAGCAAAAGCGGCA
GAGGCCCTGATACATAAGGATGTCGACAGGATTATCGTCACCCGTCCAGTTCTGCAAGCC
GATGAAGATCTTGGCTTCTTACCTGGAGATATCGCAGAAAAGTTTGCTCCCTATTTTCGC
CCGGTCTACGACGTGCTGGTCCGGCGCTTAGGGGCTTCCTTTATGCAGTACTGCCTGCGA
CCGGAAATAGGGAAGGTGGAAATTGCGCCGTTCGCCTATATGCGTGGACGTACCTTTGAA
AATGCAGTCGTCATTCTTGACGAGGCGCAGAATGTGACTGCCGCGCAAATGAAAATGTTT
TTAACCCGCCTCGGGGAGAACGTGACGGTTATCGTCAACGGTGATATCACGCAATGCGAT
TTGCCTCGCGGCGTGTGCTCCGGATTAAGTGACGCGCTGGAACGTTTCGAAGAAGATGAA
ATGGTTGGGATCGTCCGGTTCGGTAAAGAGGACTGCGTACGTTCGGCACTTTGCCAACGT
ACGCTGCATGCCTACAGTTAAGTGTGTTATCGGTGCAGAGCCCGGGCGAACCGGGCTTTG
TTTTGGGTGTTTATGCCCGGACTAGCGCTTTTTCTGAAACAACCATTTTTATTTGCCCCT
GGCTGGTGAAGTGTACGCTCATCCTGTGGCTTTTTTGTAGTTGCTGATAGAGCTCATCAG
GTATTGCTAAGCTCTCTGCATATTCTTGCGGCGTATATTGGTAGGCTGCATGATGCTGCT
GTTTTTGAAAACGCAGCTTATTGTACAGCGCCCAGACAATTAACACGACGGCATTCGCCA
CTGCCAGCAAAAAATAGAACTGAAGTCGGCTTCTGGCCTCGCTTTGCCAGTAATAACCCG
TCAGCAGATCCATGGCGAATAAGAATATGAACAACGCAAATAATGTCCACAAGATGGTTG
TGGCAACATAATCAACCAGTAAACGTACTGGTGATTGTCGGGTCGTAATAATTAAATTGT
TCATATTAACCTCTCAGAATCCCGCGATCGGGACTTACCCAACGGGCGCGTTGCTTTTTA
GGCATCAACATGACTCGTGTAAATGATACCAATGTCGTTGCCAGGCTCAGCATCCAGAAA
ATAACCGGGAACCAAATAATCCAGAAAAGCGATGAAGTCAGATTATGCTCATAGCGATTC
TCGATCATCAGGCTGACAATAAATTGCAGTAAACATAACGTACACAATAATATTCCGGCA
GTATGTGTCGCAGCGATATGTGTCAATTCAATATTTAACGGTACACCGGCAAGTTGGACT
GCGTAAATAATGAAACCGACCAGGCAGGTGAAGGCCCATATTGTCGTCAGGCAGTATTCA
AAAAACAGCGGCCACATTCGAAAGTTTTCTTTGCGCCACAACCTTGTCATATTTTTGAGG
AATACTTCTGCACCGCCCTGAGCCCAGCGCAGGCGCTGTTTCCACAGCCCTTTTAACGTT
TCAGGCATTAATATCCAGCACAGTGCCCGTGGCTCGTAAAAAATCGTCCACTGATTCAAC
TGCAGCTTCCAGCTAATATCAATATCTTCGGTGATCATATCGTCACTCCAGTAACCCACT
TCTGCCAGGGCGCTGCGACGAAATGCGGCAATAACACCGGAAACGGTAAATACGTTTCCA
TAGATACGCTGGGTTCGCTTGATCAAACCAATAATTGAGGAATACTCGCCAACCTGAATT
TTACCCACCAGGGTAGAACGTGTTCGAATACGAGGATTACCGGTTACGGCACCCACACGC
GGGTTGTACAACATCGGTTCCACAATATATGCCGCCGCATCGCGGTCTAATAACGCATCG
CCATCAATGCACACCAGATATTCACTTTTCGCCGCGGCAGCTCCGGTTTTAAGCGCAATG
GCTTTCCCCTGGTTTTGCGCCAGATGAATGACCCGCAAATGGGGAATTTGTGCAGCCATG
CGATCCAGGATGGCACGGGTTTTATCTGTTGAACCGTCATTTACGGCAATAACTTCAATG
TTCTCATAACGCTGTGCTAAAGCGGCGTGTATGGTTTCCTCAACGTTTTTCTCCTCATTA
AAACAGGGAATGATAATGGAGATAGACGGATTATCTTTCAACTGGGGAGCTGGTGCGTTT
TCTCCCCACGGCCAGTGGCGTTCACGATAGACCCAGAAATAGACGCCGCCAACAATCCAC
ATAATGGACATAAAAAACGGCCAGAAGAAAACGAACCTCATCATCAGTTCACCAGAGTGA
AAGTACGCTACGCATAGGGGTATGCATAACACCAGACATAATATAAAAAACGATACGATG
CGATTAATCATTTTTCGGATACCAGGCTGTTGAAAACTCAGGACGAATAAGGTCTATTTC
AGGTTGGTTATGCAGAAAATTGTCGGGATAATAACCATAGTTTTTCACTCCATTCAGTTG
TAATAGGCTCATCCAGTGAGCGAGTTGTTGCGAAGAAATAGCCTGATGCTGACCATTTTT
CTGCCAGTTTTGTGCCTGTAATTCTAAAATAGATTTGTCTTTAGCCTGAGGGATGTTTTT
AATTTGATTGGTCAATTGTATTAACCATTGGTCAGCCGATTTTTCTGCGACACCTTCCAG
ATAAGGCATAGCCATAATAGCGGTCCAGTCATAGCTTTTTAGGAAATCAGCATAATTCTG
TGCAAACCAGGCTTCACTTTCAGGTTGTATTACCGGAAGTGCAAAAATATTTCGTGCAGT
TTTAATATGTGGACCGCGAATGGCTTTTACGCGCGCACTAAGTTCTAAAGTGAAGTCAGT
TAACGCACGACTTTTAAAGCGGGCCCACTGTTTAAATTGCTCCGGGTTTTGTCGAATTTC
GCTCAGACTCCCGCTAAAGCCTGCTTGCTGATAAGCCGTGATAGCCGGTGCACTGGCATC
TTCATAATCTGAAAGCAAAGCATCATCGTGGAACAATATGCCATCAAAAGCAGCATGTCC
GGCAAGATCTTCATATAACATGCCAACTTGTGCTCTGACTCTGTCATCGAAAGGAGAGAG
ACGGTGATATTGTTCAGGATGAATTTGTGCTTTTTTCTCCCCTGTTGGTAAGTATTTTAC
TCGCGTTAATGTGGGATCTAAATCCCAGCTTAATACCGGCATCCACGCATAGATGTTTAC
ACCTGAGCGGGTACGTAATTGCCAGGCAACCCGACTAAAAATATCTGCTTTCATTGGTAG
CAAACGATTTGGAAACCAGACCTCTTTGACCAGCCCATCACCATCGGGATCAGCAAATGC
CTGCAAATACACGGTTGATATTTGCATATCTTTCACCCGCTGAATTAGCACATCAATATT
GCGATCCATTTGCTGGAGGTTTTCGTCATAAACGTAATCAAGATCGATATGCATTATCCG
TTGTGGTGATTTTTCCTGTACGGTAATAATTTGCTGGGCAAACTCTTTTAATGAGGGATT
ATTGGCGATTAATACCCGCGGAATGGAATCCAATTGCGACGCATTTGCCAAACCTGATTC
AAGGGTGAAGAACATGTCATAACCGAGTTTTTTTAATTCCTCTATCGCTATGCCATTCGC
TTCGCCATAAGGCCAAACAAAAACGTGTGGATTTACCTCAACCTTTGTACGCAGGTATTC
CGTCATTTTTACAGCATCCAGACGAATTCTTTCCCGGTATTCTGCTGCGGTTTCATACCG
TGCGTGGTCAGTAAAATATGCACGATTTACATATACAGGCAATAAGCTGCCGGTGGCATT
AGCCTGAATACCGTAGTGAGAATTCCATGTATGAGAAGCGAGCTCAACGAGCCGGGAACG
CGCAACTTCTCGCACTTGTTGCCACGTGGCAAAATATTCTCGATCGACCAACTCATCGCC
AAATTTTACTTGTTTATCCGCTGGCGTATCGACCCAACTGCCGACGGGGGCCCATACAGC
AGGCCACTGGAAGGCCTGAAGAATTGGGAAGACGCGGGTATAAAAACTCTGGTAGCCGTC
ATCAAAAGTCAGCACTACAGCTTTTTCCGGTAGCGGTTTTCCTCCTCGATGTGCTTCACG
AATTTGAGCAATACTGACCGGTTGATAACCGTTCTCGCGCAGCCAGGCAAATTGTTCACG
CAGTGCTGATGTCCGCACTGACATAAAACGCTGGTCGGCAGCTTCGTCTTCAACGTTATG
CCATGAAATCGCTACAAAACCATTATGCGGCCACGGTTGCTCGGCGAGTAAAGATTCGCG
ATCCTGTGGCGGTATAAATGATGTTCTTGACTGGCTAATGCACGCGGTGAGCATAATTAT
ACTCACCAGCATCAGGAGATATTTATTTCCATTACGTAACATATTTATCCTTAAAATCTG
AATGTCATATCGAATTCAACGTATAAGTTGTGTTCTCTGTCACCGTCATAAGGTCGTTTT
TCCCAGCGTAGCGTTGCGCCAGCATCAATCACGTCATTCCAACTAATGCGTTGCCCGTAG
CCGAGTTGGGTGACGACATCCGTGCCATAATGTTTTTGCCAGGAGGCACCAACACCTGCG
CTGAATATTTGCTCCCAGCTATTTTCATAGCTTCGCCATAACAAATGGCTTGCCTCAAAT
GCCGGAACAATATCGAACGTTTTTATAGGGTTGTAGTATGGGGTATCGTGTTCTGTATTT
TGTTCGTAATACAGACTGGGTAGGAAATCGACAATCAAATATGGTGAAGACCAGATGCGT
TCCTGACCCTCAAGTGAGACTTCATGACGCTGGTTACTGTCGGAAAAATCAGTGAAAGCC
CAGGAGACACCGTACTTACGCCGCTCATTTTGATACCAGCGAACATAAGCCTGAGCACTG
TTGCCTGTAACACCATTTTTCATTGCCCGTAATGGAACGCGGTGAGAGAGGCGTTCCAGT
TGCGAACCAATACGCCAGTTATCATTAAAATCATACCAGCCAGACAGGCGCGCGCCGGGT
TTATGCTCATGATTGAAAACGCGTTCAGCGTACTCTGCCTCGAGCCAGATATTACGTGAC
CGCCACTCAACACCCGCAAGCCAGTCGCGAACAATCCCTTTTCCTTCGCTAAATTGTCCA
TCGGCATAACCGAATCCAGCAAAACCGCGCCAGTTATCCTTCAGCGGTGGTGAATAAACG
ATGGTGGTTAAGTCGACATCATGTTTACCACTATCCGGGCCTTCGGCATCAATTCCTGTT
GAGCCAGCGATACGAAGCTCTGCAAGATTATGTACATCAACCGCACGTTTTAATCGTACA
ACGCCGGGATCTTGCGGTTCACGTTCGACAACATCGTGCGTTAAGACAGCTGCCTGCTGC
CATTCTTGTAACGTTAATGCTGTCCAGGCTTGTTCAACCTCCAGATTAATATTACGTGGC
TCGATCACTTCTGCTTTTTTTAATTCATTTTCTGCTGCACGAGGCCAACCGCGGGCTTGT
AACACACTCGCGTAATCAATGCGCAGTCCCTGATTTCCTGGTGCGTTATAAGCAAGCTCT
CTGGCTGTCATTTCAGCCTGAGGAAGATCATTACTATATTTTGCTACGGTTGAGAGAAAC
GAATGCCCCTGTAACCAGGTATCATTCGGGATGCTCGTAGGCGTGCCCATTAACCGAAGG
AAAGGCGGCGAAGTATTAATGGTATGTTGGGTGACAGTTAGCGCGCCCGGATAATTTTCA
CTCTCCAGGTGGCTGTAAAAGAGATCCGCAAGTTCTTCATCGGATAAATCCGGGGCAATG
GTCTCCTTGTGATAAAAGAGCTCGGTCATTATTGACTGTGCTTTTTTCGGCTGATGATCT
TTGAGATAAGCCGATGCAACCCAATATTGCCCCCAGGGCGGAATAATTTGCCCCGTCTTT
TTTAATCGCTGATAGTGAGAAATAACGTCTTTATAACGATCGCGAGTTAATAACGCGCCA
AGATGATCAACCTGAATACGCTGGTACTGGGCAGTGCGGTCTGGGTTATCGTGCCACAGA
ATTTCTAATGCAGCGTATTGGGCGAGGGCGCGATCGGCAATGGCATAACGTTCACTTTCA
CTGCGCGTAGGCATAAACGACAGTCTGACCAGTTCGGCATGAATATCAGCGCGAATATCT
GGCGTTAAATTGGCATCGTCAATCGCGGCAGCAAGTTGATTATTACGTAATGCCTGCACG
TATTCTGTGGGATATTGTTGCGTAGATGCATTTTCAGGTAATGACTCTGTCATCGCCCGT
AATTCATCCTGATGACGCCCCGCCAGTTTATAGATATAGGCTTCTGCGAGTAAATTGGCT
TTGTCCGGTGCTCCAGAGTTAAGCTGCTTAAGTTTAACCAGCGCAGTATCATAGTGACCA
GCATCTGCCAGGGTTAAAATTTGTCCCCGTTGATAATCCTTATTTTGCGGCTCCAGAGAG
AGCGCCTTTTGCCACAGTGTAAGCGAGTTTTGCCATTGTTGCAGGTTACGATAAGCGACG
GCGACAGCTGCATAACCACGCGCTGGTAATTGCTGATGACGGTAGCGGTTGTAAACGGTA
ATAACCTGTTTATCTTGCCCGGCCCATAAGGCAATCTGTAACCAGTCAGCAATTTGGTTA
TTGCTGAGTGCTGATTTTAGTGCAAACCATGACAAAGCTGGCTGAGTATTACCCTTGCGA
GCTTCAATAATCAATGCATCATAGGCGTTATTAACAGCACTCTTCGCCGCGGGACTCGCT
GCTAAAAATGCGGCAGTAAGAAGTTTCAAAGCCCATTTGGTTTTCGGGCACCTTTTTCTG
CTACTTGAATACATCCTGTATTACTCCATGTATTGCCAAAATCTCTCTCTGTATCTAATT
ACAGGTAACTGAAAAGAAAGATATTTTTGCACCTCATAATCCGTTATTAAACGCGGAAGA
GAGACGTGAATTGTTGATGATGAGAAGAAGAAATGATGAGCAGAGTGTCCATATAAAATC
CTTTTCTCGCCCGAAAATCCATTCCAATGATGAGGATCTTCAGGAATACGGCATAAATCC
CAATGCCTTTTTCAAAATAAATTAGGATTAAAATAATTAAATCAGTAAATTCCGATGCAT
GATTTCGGATTTTTCGAAAGTCCTGATGAAAGGCTGCGCTACGGCACTCACGGATTTAAT
TGTTATTCCTAATGTATCTATGAATTAATGTTTTATAAGGATTTTCTATAACCATTTATA
AGTATTTTCAAGCCTGGCTTGTTGCAAACAATGTATAAAGCACTTAGGCAATAATAATTA
CATTCAGCAACTATCATCATCGGTATTGTTTGTGGGCGGAATTTCATATTGACAACAGTA
CAGTTCTTATATCTATTAATAATAGAAAGGGATCTACAACCTACAGATTGGTGTAGCTTT
ATGGAAAAAGACTATTTGAGAATTAGTAGTACTGTATTAGTGAGCTTATTGTTTGGGCTT
GCTTTGGTTTTGGTGAATAGTTGGTTTAATCAGCCAGGCGTTGAGGAAGTTGTTCCACGA
TCAACCTATCTGATGGTAATGATTGCTTTATTTTTTATCGATACTGTTGCATTTATTTTT
ATGCAGTTGTATTTCATTTATGACCGTAGGCAATTTTCAAACTGTGTACTTAGTTTGGCT
TTTCTGAGTTGTTTGATTTACTTTGTTATAACCGTCATTATCATTCAGCAAATTATTGAG
GAGCGTTTGACAAGCAGTGTTGTCCAAAATGACATTGCAATCTATTATTTGTTTCGTCAG
ATGAGTTTGTGCATATTAATATTTCTGGCATTGGTGAATAAAGTTAGTGAAAACACAAAA
CAGCGCAATTTATTTTCCAAAAAAATGACTTTGTGCATAAGTTTGTTTTTTGTTTTTGGG
GGGCCGATAGTTGCTCACATACTTTCTAGTCATTATGAGAGCTACAATTTACACATTGCC
GAGTTAACCAATGAAAATGGTCAGGTGGTTTGGAAAGCCTCATATGTTACCATAATGATT
TTCATGTGGTTAACCTTGCTTTCGGTTAATCTATACTTTAATGGTTTACGCTATGATATC
TGGAATGGAGTGACGGTGATTGCTTTTTGTGCCGTACTGTACAATATCTCTCTGTTATTT
ATGAGCAGGTATAGCGTGTCCACTTGGTATATTAGTCGCACTATTGAAGTAGTCAGTAAG
TTAACCGTTATGGTAATATTTATGTGCCATATATTCAGTGCGCTACGAGTAACAAAGAAC
ATTGCACATCGCGATCCCTTAACCAATATATTTAACAGAAATTATTTTTTTAATGAACTG
ACAGTTCAATCAGCATCAGCCCAAAAAACGCCTTATTGCGTCATGATTATGGATATCGAC
CACTTCAAAAAAGTCAACGACACCTGGGGGCATCCGGTTGGCGATCAGGTGATAAAAACA
GTGGTGAATATCATTGGGAAAAGCATACGACCAGATGACCTTTTAGCGCGCGTCGGCGGC
GAAGAGTTTGGCGTCTTGCTGACGGACATCGATACTGAACGTGCGAAAGCTTTAGCGGAA
AGGATTCGGGAAAATGTTGAGCGTTTAACTGGCGATAATCCTGAATACGCTATACCACAA
AAAGTGACGATTAGTATTGGCGCTGTTGTGACTCAGGAAAATGCGTTAAACCCAAATGAG
ATCTATCGACTGGCTGATAACGCACTTTACGAGGCGAAAGAGACCGGGCGTAATAAGGTG
GTTGTGAGGGATGTGGTGAATTTTTGTGAGTCACCATAAAGCGGCATTTTGATCCTACCC
ACGTAATATGGACACAGGCCTAAGCGAGGTTCTTGTTTTCAAATTGTTCCGGACTGAGGC
CGCCACACCAACTGTGCCGCCGCCACCGATTGTAATCACATTCGATATAATTAAACACCG
TTGCCCGCATTATTTCCCGGCTGATAAAGTGTTCTCCATGGATACATTCCACTTTCAGCG
AATGAAAGAAGCTTTCCACGCAGGCATTATCGTAGCAGCAACCTTTTGCGCTCATACTTC
CACGCAGATTATGCCGCTTCAGTTGCGCCTGATAATCTGCTGAACAGTACTGGCCTCCAC
GGTCCGTGTGAACGATAACGTTCCGGGGCCTCTTACGCCGCCACAGCGCCATCTGCAGGG
CATCGCAGGCCAGTTGCGCCGTCATGCGTGGCGACATTGACCAGCCAATAACGGCACGTG
ACCACAGGTCAATGACCACTGCCAGATACAGCCAGCCTTCATCTGTACGTAAGTACGTGA
TGTCTCCTGCCCACTTCTGGTTCGGGCCACTGGCGTAAAAATCCTGCTCCAACAGATTTT
CTGACACAGGCAGGCCGTGTGCGCGGTAGCTGACCGGGCTGAACTTCCGGGAGGCCTTTG
CCCTCAGTCCCTGACGGCGCAGGCTTGCCGCCACGGTTTTTACGTTAAAGGGGTAACCCT
GAGCACGCAGTTCATCCGTCAGGCGTGGGGCACCGTAACGCTGTTTTGACCGGGTAAAAG
CCGCGAGGACAACGCTGTCGCAGTGTTGGCGGAACTGCTGACGCGTGCTTATCCTTGTCC
GCCGCTGACACCACGTATACCAGCCGCTGCGGGCCACCCGGAGCACGCGGCACATTGCTT
TGATGCTGAACTCAGCCTGATGTTTTTCAATAAAGACATACTTCATTTCAGGCGCTTCGC
GAAGTATGTCGCGGCCTTTTGGAGGATAGCCAGCTCTTCATCCCGTTCTGCCAGCTGGCG
TTTGAGACGTGCAATCTCGGTAGACATCTCCAGTTCACGTTCAGAAGACGTCTGCTGATT
TTGCTGTTTACTGCGCCAGTTGTAGAGTTGTGATTCATACAGGCTGAGTTCACGGGCTGC
GGCAGTAACACCGATGCGTTCAGCAAGCTTCAGGGCTTCACTGCGAAATTCAGGCGAATG
CTGTTTACGGGGTTTTTTACTGGTTGATACTGTTTTTGTCATGTGAGTCACCTCTGACTG
AGAGTTTACTCACTTAGCCGCGTGTCCACTATTGCTGGGTAAGATCAGTGCCTGGCACAC
GCGTTTGATGGAAGACGGCGTTCAGGCAATGCGCGATTATCTTGCCGGACTGGATATCGC
TTCGCCAGAGCATCAGGTTCTGATGAACGTAACAGCAAAAAGCGAGGTCGCTCCGTCAAT
TATCAAAGAAAATCTCTCATTACACTTAACTCATACGGTGAAATGGACTGAATCTCTCGA
TACATTTCTGAATATGCCAACCCCGGTAGCTTTCCTTGAAATAAGTAATAAGCCCTATTT
GGGGAATATGTTAAATGATTTTGCTGGCGTGGATCAGCAACGAGTTATGCATTGTCGTAA
AGCATTTAGTGATGCAAAGGTATTCAAATGATTCCTGATTATTTAACTTTTATTCGCTTT
CAGGATAAACGAAATCTGATATACATTTATGCTATTGGACTTATTCTGATAGGCTTTTAT
TGGAAGAATGCAGGGTTTACTTTTCCATCAGAGGATATTGGTGTAGTTAGTGGGATTCTG
GCTCTGGTGCTGTATAATTTTATTTTTGATCTCAAGGCGTACTGGGCTTATAAATGCGTC
ACGAAGAATATCGATTTTTCGTGGTTTAAGAAAAAGCAGAACCACAAAATAGAATTATTT
CTTACACAACCTCTGGTGGCAGGATTTCTGTCGTTAATCATGTTGAGTGCAATGAGTTGG
GGGCTATACCAGCTTCTACCCTCGTTATATGCGCTGTTCCTGATTTCGTTACTTGGGCCG
TTGGTCATCTTTCTGCTGTTTCGGATGATCCGCACCAGTTATGTCAAGCAGGTCGCTATT
TCAGTAGCGAAAAAAGTAAAATATAAAAGTCTGACTCGCTATGTGCTGCTTTCGGTGTGC
ATCTCAACGGTTGTTAACCTGCTTACTATCAGCCCGTTGCGTAACAGTGATTCTTTTGTG
ACAGAGGGGCAGTGGTTAACGTTTAAATCGATAATTGCATTGCTCATTCTTTGTGGCGTA
GTGTTGGCGATTAATCTGTTTTTTCTGCGCTTCTCCAAGCGGTACGCTTTTCTGGGCAGG
CTTTTTTTGCAGGAAATCGATCTGTTTTTCTCCAGTGAAAATGCGTTGTCGACCTTTTTT
GCCAAGCCGCTTTGGCTTCGGTTATTCATATTGCTGGTTATTGAAGTGATGTGGATTACG
CTGGTGTCGGTATTGGCAACGCTTGTAGAATGGCGGATTTGGTTTGAAGCCTATTTTTTA
CTCTGCTATGTACCGTGCTTAATTTACTATTTTTTCTATTGTCGATTCCTCTGGCATAAC
GATTTTATGATGGCATGTGACATGTATTTCCGTTGGGGGCATTTTAATAAGTGAGGAAGT
GATAGGAAGTGACCAGATAATACATATATGTTCTGTACTCTCTTGCGCATTTTGATTGTT
GACTGAGTAACCAGACAGTTGATGTGCACGATTTCCCCTCGCCCTAACAGACGTGGGCGG
GGGCACCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCTT
TAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTCA
CTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGACCCCCGGTCGGGGCTTCT
CATCCCCCCGGTGTGTGCAATACACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCT
TTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTC
ACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGAACCCCGGTCGGGGCTTC
TCATCCCCCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTC
TTTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCT
CACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGAACCCCGGTCGGGGCTT
CTCATCCCCCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTT
CTTTAAATATGGCGGTGAGGGGGGGATTCGAACCCCCGATACGTTGCCGTATACACACTT
TCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTGTCGTTCCTGTCTTGCTG
GAACGGGCGCTAATTTAGGGAAATCATGACCTGAGGTCAACAAACTTTTTGAAAAAATCG
CGCGTTTATTCAAACTTCAATCAATGTGTGGTTTTAATAAGCGAAATCTGCTTTTTTTGC
CACCGACCACGGATTTGTTATGCTGGTGGCCTTTGTAGATCATAACGATAAGTGCGAATA
AATTTCGCACAACGCTTTTCGGGAGTCAGTATGGATATCATCTTTTATCACCCAACGTTC
GATACCCAATGGTGGATTGAGGCACTGCGCAAAGCTATTCCTCAGGCAAGAGTCAGAGCA
TGGAAAAGCGGAGATAATGACTCTGCTGATTATGCTTTAGTCTGGCATCCTCCTGTTGAA
ATGCTGGCAGGGCGCGATCTTAAAGCGGTGTTCGCACTCGGGGCCGGTGTTGATTCTATT
TTGAGCAAGCTACAGGCACACCCTGAAATGCTGAACCCTTCTGTTCCACTTTTTCGCCTG
GAAGATACCGGTATGGGCGAGCAAATGCAGGAATATGCTGTCAGTCAGGTGCTGCATTGG
TTTCGACGTTTTGACGATTATCGCATCCAGCAAAATAGTTCGCATTGGCAACCGCTGCCT
GAATATCATCGGGAAGATTTTACCATCGGCATTTTGGGCGCAGGCGTACTGGGCAGTAAA
GTTGCTCAGAGTCTGCAAACCTGGCGCTTTCCGCTGCGTTGCTGGAGTCGAACCCGTAAA
TCGTGGCCTGGCGTGCAAAGCTTTGCCGGACGGGAAGAACTGTCTGCATTTCTGAGCCAA
TGTCGGGTATTGATTAATTTGTTACCGAATACCCCTGAAACCGTCGGCATTATTAATCAA
CAATTACTCGAAAAATTACCGGATGGCGCGTATCTCCTCAACCTGGCGCGTGGTGTTCAT
GTTGTGGAAGATGACCTGCTCGCGGCGCTGGATAGCGGCAAAGTTAAAGGCGCAATGTTG
GATGTTTTTAATCGTGAACCCTTACCGCCTGAAAGTCCGCTCTGGCAACATCCACGCGTG
ACGATAACACCACATGTCGCCGCGATTACCCGTCCCGCTGAAGCTGTGGAGTACATTTCT
CGCACCATTGCCCAGCTCGAAAAAGGGGAGAGGGTCTGCGGGCAAGTCGACCGCGCACGC
GGCTACTAATAAAGCATCAGGATTCCTGCTATCCTTGGCGGGAATTGAATACAGGAGAGA
GTTATGTATCCCGTCGACCTTCATATGCATACCGTTGCCAGCACACATGCATATAGCACA
TTAAGTGATTACATTGCCCAGGCCAAACAAAAGGGCATTAAACTTTTTGCGATCACCGAT
CATGGCCCGGATATGGAAGATGCGCCGCATCACTGGCACTTCATTAACATGCGTATCTGG
CCGCGAGTGGTTGATGGGGTAGGGATCCTGCGCGGCATCGAAGCTAACATTAAAAATGTT
GATGGTGAAATTGACTGCAGCGGTAAAATGTTTGACTCGCTGGATCTAATTATTGCCGGT
TTTCATGAGCCGGTTTTTGCGCCACATGACAAAGCGACCAATACACAAGCGATGATCGCC
ACTATCGCCAGCGGCAATGTGCATATAATAAGCCATCCCGGAAATCCCAAATATGAAATA
GATGTGAAAGCCGTTGCTGAAGCAGCCGCGAAACATCAGGTGGCGCTGGAAATCAATAAT
TCCTCATTTTTACACTCACGTAAGGGCAGTGAAGACAACTGTCGTGAGGTAGCCGCAGCG
GTACGTGATGCTGGAGGTTGGGTGGCATTAGGCTCGGATTCTCACACCGCGTTTACCATG
GGGGAATTTGAAGAGTGTCTTAAAATCCTCGACGCGGTAGATTTTCCGCCAGAGCGCATT
TTGAATGTTTCTCCGCGCCGCTTACTGAACTTCCTTGAATCTCGCGGTATGGCACCGATT
GCGGAATTTGCAGACCTTTAATTACTAGTAATGGAAATATATTAATGAACGAGTTTTCTA
TCCTCTGTCGTGTGCTGGGTTCGCTCTATTACCGCCAACCACAAGATCCTTTACTGGTGC
CGCTGTTTACCCTGATTCGTGAGGGGAAACTGGCTGCGAACTGGCCACTGGAGCAGGATG
AGTTGCTGACACGTTTGCAGAAAAGCTGTGATATGACGCAAGTCTCTGCCGATTACAATG
CGTTGTTTATCGGCGATGAATGTGCTGTGCCGCCATATCGTAGCGCATGGGTTGAGGGCG
CGACGGAAGCGGAAGTGCGCGCTTTTCTTTCTGAGCGAGGGATGCCATTAGCGGATACGC
CAGCCGATCACATCGGCACATTGCTGCTCGCAGCTTCCTGGCTGGAAGATCAGTCAACGG
AAGATGAGAGCGAAGCACTGGAAACACTGTTCAGTGAGTATCTGTTACCCTGGTGTGGTG
CGTTCCTTGGCAAAGTGGAGGCCCATGCAACCACGCCTTTCTGGCGCACCATGGCACCGC
TAACCCGCGATGCCATTAGTGCAATGTGGGACGAGCTGGAAGAAGATTCTGAAGAATAAG
TGTGATCTACGTCACTCATAACTGCAACGGATAATTTGTTGTTGCATAAAATGTGTGCTC
GATCTCATTCATGGCCGCGTTTTCTGCTATCATGCGCGGCATGAACATACTTCTCTCTAT
TGCAATCACAACAGGCATTCTCTCCGGTATCTGGGGATGGGTGGCTGTTTCCCTGGGCTT
ACTAAGCTGGGCGGGCTTCCTGGGCTGTACGGCCTACTTTGCCTGCCCGCAAGGTGGGCT
GAAAGGGCTGGCGATCTCCGCTGCAACCCTGCTTAGTGGCGTGGTGTGGGCGATGGTCAT
TATTTACGGTAGTGCACTGGCACCACATCTGGAAATTCTCGGTTATGTCATAACCGGTAT
TGTCGCGTTTCTGATGTGTATTCAGGCCAAACAGCTGCTGCTTTCATTTGTTCCGGGGAC
GTTTATAGGCGCATGCGCGACGTTTGCCGGGCAGGGTGACTGGAAACTGGTGTTACCTTC
GCTGGCGCTTGGGCTGATATTTGGTTACGCAATGAAAAACAGTGGCCTGTGGCTGGCGGC
GCGTAGTGCAAAGACGGCGCACCGTGAGCAGGAAATCAAAAATAAAGCGTGAGGGGCACT
CACGCTTTCGCTTAAACAGTAAAATGCCGGATGATAATTCCGGCTTTTTTATCTGTCAGG
ATTCCGGTGGAACCGACATATGGCGGTATTTCACCAGAATGTCATTCTGCCGTTCTGCTT
TATTTTGCAAATCCCACAGACCACGGTCGATACCATCATTAATCAGGAAAATGACCCCTG
TTTCGATAGCCGACATCAGGCACAGCATAACAGGTTCGTTCGAGGTGTAACCCACTTCCC
CTTCAAGCAAGCGCTGGTAGTCAATAAAGCGGAAAACCCCGGCCTGAACTTCATAGGAAA
GTATCGTCTTACTGGTGTTCACCGAAGAAAGGATCTCGCCGGTACTCACATTGACGACGC
GCAGGTTCACGGCAATCTGATCGAGCTGGTATTGCGTGTCGGCACCGATGCCAAAATATC
TTGCCCCAACCCCGCCAGATTTGACGTTGCTTTCATAACCGATAATCGAACCTTCAACCA
TGATATTTGCCGCCGTTAAAGATTGCAGCGGGATTCGGTTATTAATGGCAACCGTGCCGT
TTTCTTGTGCCGCACGAATAATCTTGCGCTCGTTAAGCAGGTTTTGTAAGCCCTGGCGCT
CCAGCGGTATAAACCAGCGAGAATCTTTCAGTGCCGTGACCAGCATTGCCGTGGCGCTTT
GCGGAACAGCAGTGGAGAAGTTACTTGCCGGGTAGGGTTTAAATTGCCCGGTTTCGTCCT
GAATGTTGTATACCGAAACAAAGATTTTACCCGTCGGCGCTGGCAGATGGGTCAAATCTT
TGTAGCTCTGAGCACGAGGCATTAATGTCGGTCTGGCGGCTTCTTTAGGCGGGGCGGTTA
AGCATCCGCTCAGTAACATGACGGCAACCAAAAGAAATAAGCGCTGCATGATTATTTTCC
TTATGAAGCTGGGGCTTAAAAATCGGTTGAGTTATTTTGTAAACCCGAAACCTGGATGGT
CGAGGTTTGTCCGGTTTTACGATCTGTCACGTTCAACTGCAATTGACCATCGCGGTTGGC
AATATCGACAATATAATCGTTGGTCACCATGCGGCCCGGTTTACCGGTATTAATATTCGA
CAGTAGCCCACCTAAAATTTGTGACTGGATGGCCTGAGTAAAGTTATCTAACGCTGAGGG
TGTTTCAATACCAAAGTCATCGTTATAGCTCGGATCTTTATAAGAGTTTTGGGCCTGAGC
GCTATTTAATAAAAAAGCGCCATTATTTGGGTTACCACCAAAGTTTGGATTACGGAACTG
GAAAGTCATGGTTCCAGCCCAACTTAATGGCGAAATAAGCATGAGTAGAACTACTGCATG
TTTGACACGCATTGCAGCCTCCGAACAATTTTTTATTTAGAATTCATCATGCGCCAAATC
GCCCGTACTTAATAACGCCTGATTTATCTGGCGACGATTTAGTGCTTCTTCAGTTTGAAT
CAGTGCAAAGACGACAGTTTTCTCGAAGTCTCTTTTCAACGGAAATAAAAAAGTCTGGAA
AATAACGTCCTGATTGACCGTTATAGTGATCCAGCTTCCCCATCGTGCACTGGGCCTTTC
ATTAATCGTTAAGTTACCCGTATAGTCACTTTCCCATTTATCACTAAAGGCTCGGTAAAA
ATCATGGCCAATAGATGAAACAGTATGGTCAGTTAGCAATCCCGGGACTTCTACCTCAAC
GGCGTGAAGATTCCCTGCGGCGAACAGAAATTCTGCCGCCACAATCCAGCGTAAATAACG
TTTCATGGCTTTATCGCCTGAGGTTATCGTTTGCCCAGGAAACCGCTTGTGTCCGGTTTT
TTACGGCTATCTTCTTGAAAAGATTATAAAGATGCGTTTTAACCGTATTTTCGCTGATGA
ACAACGAACGAGCGATCTCGTTATTAGACGCGCCGATACGCAGCTTATTCAGGATCTCTT
TTTCCCGATGAGTAAGGAGGGCTGATTCCGTGCTGTTATAACGATAGTTACCTGAATGCG
TAATCAGGTAGCTGGCAAGCTTTTGCGTAAAGTAGCATTCGCCGCGCAGGACGCCTTGCA
ACCCATTGACAACACGTTCTTGATCCTCCATGGAATAAAAAACGCCGTTGATATGAGGCC
AGTTTTCAATGTCGCGGTACGGGTAATCTTCAGGCGTATTTAGCAACAATATTTTGATAT
TGTTGTTTTTCCTGCTCAAAGTATCCTGCCAATAATGGATAAGCTTTTTATCCGCTTCCA
TCATATCCAGAAGAATAATAGAGCCTGAAGAGATATCGTCCAGAGAACGTTGAATATTAT
GTAATTTTCCTGTAATTGCCAGCGATTGTTTAAGGTGCTGCAAGAGAGCTGTCGCCTGCA
AAGAAGATTTAGTGATCAACAATAATGTATGACCATGAATACTATGGACTTCATTAAACA
TGATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGC
ACCAGAAGTACTGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGG
TAAAATATAAAACTAATGGATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATC
AAGTGTTAAACATGTAACTAAATGTAACTCGTTATATTAAAATGTTAACCTTAAGGTTTT
ATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGGTTTTTATTGCACAATTTTAAAAA
ATCATACAAATGGTGATAACTTACTAATAATGCATATAAAAAATATTTCGGTGTAGTCCT
TTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTACTGCA
AAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCA
AGAAGAATGACTGTCTGGTGCTTTTTGATAGCGGAAAACGGAGATTTAAAAGAAAACAAA
ATATTTTTTTGCGTAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTA
AAAAAGAAAAATACAACGCGCGGGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCC
ATCGTAACGCAGCGTTAACAAAATACAGGTTGCGTTAACAACCAAGTTGAAATGATTTAA
TTTCTTAAATGTACGACCAGGTCCAGGGTGACAACATGAAAAACAAATTGTTATTTATGA
TGTTAACAATACTGGGTGCGCCTGGGATTGCAGCCGCAGCAGGTTATGATTTAGCTAATT
CAGAATATAACTTCGCGGTAAATGAATTGAGTAAGTCTTCATTTAATCAGGCAGCCATAA
TTGGTCAAGCTGGGACTAATAATAGTGCTCAGTTACGGCAGGGAGGCTCAAAACTTTTGG
CGGTTGTTGCGCAAGAAGGTAGTAGCAACCGGGCAAAGATTGACCAGACAGGAGATTATA
ACCTTGCATATATTGATCAGGCGGGCAGTGCCAACGATGCCAGTATTTCGCAAGGTGCTT
ATGGTAATACTGCGATGATTATCCAGAAAGGTTCTGGTAATAAAGCAAATATTACACAGT
ATGGTACTCAAAAAACGGCAATTGTAGTGCAGAGACAGTCGCAAATGGCTATTCGCGTGA
CACAACGTTAATTTCCATTCGACTTTTAAATCAATCCGATGGGGGTTTTACATGAAACTT
TTAAAAGTAGCAGCAATTGCAGCAATCGTATTCTCCGGTAGCGCTCTGGCAGGTGTTGTT
CCTCAGTACGGCGGCGGCGGTAACCACGGTGGTGGCGGTAATAATAGCGGCCCAAATTCT
GAGCTGAACATTTACCAGTACGGTGGCGGTAACTCTGCACTTGCTCTGCAAACTGATGCC
CGTAACTCTGACTTGACTATTACCCAGCATGGCGGCGGTAATGGTGCAGATGTTGGTCAG
GGCTCAGATGACAGCTCAATCGATCTGACCCAACGTGGCTTCGGTAACAGCGCTACTCTT
GATCAGTGGAACGGCAAAAATTCTGAAATGACGGTTAAACAGTTCGGTGGTGGCAACGGT
GCTGCAGTTGACCAGACTGCATCTAACTCCTCCGTCAACGTGACTCAGGTTGGCTTTGGT
AACAACGCGACCGCTCATCAGTACTAATACATCATTTGTATTACAGAAACAGGGCGCAAG
CCCTGTTTTTTTTCGGGAGAAGAATATGAATACGTTATTACTCCTTGCGGCACTTTCCAG
TCAGATAACCTTTAATACGACCCAGCAAGGGGATGTGTATACCATTATTCCTGAAGTCAC
TCTTACTCAATCTTGTCTGTGCAGAGTACAAATATTGTCCCTGCGCGAAGGCAGTTCAGG
GCAAAGTCAGACGAAGCAAGAAAAGACCCTTTCATTGCCTGCTAATCAACCCATTGCTTT
GACGAAGTTGAGTTTAAATATTTCCCCGGACGATCGGGTGAAAATAGTTGTTACTGTTTC
TGATGGACAGTCACTTCATTTATCACAACAATGGCCGCCCTCTTCAGAAAAGTCTTAATT
TGTTGAAATATCGAGCATAAGATGAATCTGGAGAGAATGGTCTGCTGCGAATCAGCCAAC
CTGAAAGTATGGATAACACAACCCTCAAGGATGACTAATCATTGAGGAAATAGAATAAAT
GTTCAGACCTTTTTTAAACTCTCTTATGCTCGGCAGTTTGTTTTTTCCTTTTATTGCCAT
TGCTGGAAGCACCGTGCAAGGGGGCGTGATCCATTTTTATGGCCAAATTGTGGAACCGGC
ATGTGACGTCAGCACCCAGTCATCACCCGTAGAAATGAACTGCCCACAGAATGGTTCTAT
TCCGGGCAAAACCTACTCCAGCAAAGCGTTAATGAGCGGCAATGTCAAAAACGCGCAAAT
AGCCTCAGTAAAAGTGCAGTATCTTGATAAACAGAAAAAGCTGGCTGTAATGAACATCGA
ATATAACTAAGTTTCTGAACAACTCACGTTGCTGAGCAGAAAAATGCGATTTAACCAAAA
AGCCTGCTGTACACTTAAGAAACAAGAAGGTGTAAGGAGGCGTTATGAAAACGCGTATTC
ATGTTGTGCAGGGTGATATTACCAAACTGGCCGTTGATGTGATTGTGAATGCGGCTAATC
CGTCATTAATGGGAGGCGGCGGCGTCGATGGGGCCATTCATCGCGCAGCGGGTCCGGCCC
TGCTGGATGCTTGTTTAAAAGTCAGGCAACAGCAGGGCGATTGCCCTACGGGGCATGCCG
TTATTACGCTTGCAGGCGATCTTCCCGCTAAAGCCGTAGTGCACACCGTCGGGCCAGTCT
GGCGTGGTGGTGAACAAAACGAAGACCAGCTTTTGCAGGATGCCTATCTCAATAGCCTAC
GACTGGTGGCGGCAAACAGCTATACGTCAGTGGCTTTTCCTGCAATCAGTACTGGGGTTT
ATGGTTACCCTCGTGCGGCAGCGGCTGAAATCGCAGTAAAAACCGTTTCAGAATTTATTA
CCCGTCACGCTTTACCCGAACAGGTATACTTTGTCTGTTATGATGAAGAAAACGCCCACC
TCTACGAAAGACTCCTTACCCAACAAGGAGATGAATGATTTGCCCCGGCTGGCGAGCGCG
GTGCTGCCACTGTGTTCGCAACATCCCGGTCAGTGTGGCCTTTTTCCTCTGGAGAAAAGT
CTGGATGCGTTTGCCGCCCGGTATCGTCTGGCCGAAATGGCAGAGCATACGCTCGATGTT
CAGTATTACATCTGGCAGGACGATATGTCGGGTCGGTTACTGTTTTCCGCCCTGTTAGCC
GCAGCAAAGCGTGGCGTTCGCGTCCGTTTGTTGCTGGACGACAACAATACGCCCGGACTT
GACGACATTTTACGCTTGCTTGACAGTCATCCACGCATTGAAGTCCGGCTTTTTAATCCT
TTCTCGTTTCGCTTGCTGCGTCCGCTTGGTTATATCACCGACTTTTCCCGTCTTAATCGC
CGTATGCACAATAAAAGTTTCACTGTCGATGGCGTGGTGACCCTGGTGGGAGGACGAAAT
ATTGGTGATGCCTATTTTGGAGCAGGGGAGGAGCCACTTTTTTCGGATTTAGATGTCATG
GCAATAGGACCCGTGGTAGAGGACGTTGCCGATGATTTCGCCCGCTACTGGTATTGCAAA
TCGGTTTCACCCTTACAGCAGGTGCTGGATGTCCCGGAGGGTGAAATGGCGGATCGCATC
GAGTTACCCGCCTCCTGGCATAACGATGCCATGACGCATCGTTATTTACGCAAAATGGAA
TCCAGTCCATTTATAAATCATCTGGTTGATGGAACATTGCCGCTTATCTGGGCGAAGACA
CGTTTATTAAGTGATGATCCGGCGAAAGGGGAGGGCAAGGCAAAACGGCATTCACTGTTA
CCGCAGCGCCTGTTCGATATCATGGGCTCACCCAGTGAACGCATCGATATTATCTCTTCC
TATTTTGTACCGACACGCGCAGGTGTGGCGCAACTCTTACGGATGGTGAGAAAAGGGGTA
AAGATTGCGATCCTAACCAATTCTCTTGCCGCTAACGATGTTGCTGTCGTCCATGCCGGA
TACGCGCGCTGGCGCAAAAAATTGCTCCGCTATGGCGTGGAATTATATGAACTCAAGCCG
ACGCGTGAACAAAGTAGTACGTTACACGATCGCGGCATAACCGGTAATTCCGGAGCCAGC
CTGCATGCTAAAACCTTTAGCATCGATGGTAAAACGGTGTTTATCGGCTCTTTCAATTTC
GATCCGCGTTCAACATTGCTCAATACTGAAATGGGCTTCGTGATAGAGAGCGAAACGCTG
GCACAGTTAATTGATAAACGCTTTATTCAGAGCCAGTATGATGCGGCCTGGCAGCTCCGT
CTGGACAGGTGGGGACGGATCAACTGGGTTGATCGTCATGCAAAGAAAGAGATTATTCTC
AAAAAAGAACCCGCCACCAGTTTCTGGAAGCGGGTTATGGTCAGACTGGCGTCGATATTG
CCCGTGGAATGGTTATTGTAAATGTGGCTTAACGGGCTGGTGCTTTATCGTTCTCACGCT
TAACAACCGGTTTACCAGAGAACAAAAACTTCAGTAACGGGATGCGCAAATGAATTTCAT
ACAGAATTATCGCAATCCCTACTACAAATATCAGGCCACAGAGAAAACCAAGCCAGTTGG
AGGTGATGTGCGGTGTAATGTATGCGCCGAAAAACAGCGTTAACGGGTGGTGAACCAGAT
AGATAAACAGCGATGCGTTAACAAAATAAGTCACCCGCGCTGACTGGAAGTTAAGCAAAC
GGTGGCCAAAGGAGAAGACCACATTCACCATCCACAGACCGAGGACCATGGTGATCACCG
ACTCGGTTTCGTACATCCAGGCATCGCCACTGCCATAGCGCTGGTTGAGTAAATAAGCGA
CAAACGCCAATGCTGCTGCAAGGGTACAGCCACGAGACGGCGTGGTAAACAAGGCTTTAA
GATGAGGGAAAATGAAAGCCAGTGCGCCGAGGATAAAGAACGGCAAATAAAACAGCGTTT
GCATGACAATAAAATTGAACATGCCATTACTCAGAATGGGCGGATACACAATAAAAATCG
TTCTTCTTATTACCGCATAACCGATGCCGAGGCATAAAAAAATCACCGATAGTTTTACCA
TCGAGAATTTTTTATTCGTTTTATCAGAATTTTCTAAATTATTTCTGATGCGCTTAAATA
TCCATACGCACAGCGTCGTCATGACCACTAACACCAGTAAAAACCACAGGTGTGATATTA
ATTCCCAGGCCAACGTATTATATTTGTCATACAATGACAGCCCAGGCCAACTTTCCGCTT
TTCCTTTGACATATTGCAGCATAATAAATTGCGGTAATGTCAGTAGGGGGATGGCTGTTA
ACATCGGGATACCTACACGTTCGACACGTACTTTCCACCATTTTTTCAAGGGATAGCGTA
AAAAAAGCATGTAGGAAAAGTAGCCGGATATAACGAAAAATACCTGCATGCGGAACGAGT
GGATGAAGTCATTAAAAAGGGTCAGCCACAATGATGATTCGGCGCTATTCACATGCCATG
TATGGCTCGAATAGATTAAAGAAATATGAAAAGGTATCCCTAACAACATCAGCCAGGCGC
GGATGGAGTCGAGGAAATATTCACGTTGCGCGGGTACTGGGTTCATATATGGTTAACTAA
TCTCGGATTTTTCGTCTTATCCCTGTCGGGTTATGCCTTTAGGCTTGTTGCCATAGTGAC
ACCGACCTGACCGCGCCAGGCGCAGGCTTCAAGGTTTTTATGCATAGCATCATCGCTACC
ACTAACCAGAATGGAAGCGTCTGTAAGACGGTTGATAAATAAATTTGCTGGCAAACCCTA
CACGAAGTCGATGCTTCTGTCTTTAGGAGAAGCACGGAAAGTGAAAACGGTTGCAATCAG
GTGCTTAATCCATGAGCCAGCGTGCTGAACGATACCGGGATTCTGTTGTCGGAATGGCTG
GTTATCCATTAAAATAGATCGGATCGATATAAGCACACAAAGGGGGAAGTGCTTACTAAT
TATGAAACATAAACTACAAATGATGAAAATGCGTTGGTTGAGTGCTGCAGTAATGTTAAC
CCTGTATACATCTTCAAGCTGGGCTTTCAGTATTGATGATGTCGCAAAGCAAGCTCAATC
TTTAGCCGGGAAAGGCTACGAGACGCCCAAAAGCAACTTGCCCTCCGTTTTCCGCGATAT
GAAATACGCGGACTATCAGCAGATCCAGTTTAATCATGACAAAGCGTACTGGAACAATCT
GAAGACCCCATTCAAACTCGAGTTCTACCATCAGGGTATGTACTTCGATACCCCGGTCAA
AATAAATGAAGTGACTGCCACCGCAGTCAAACGAATCAAATACAGCCCGGATTATTTCAC
TTTCGGCGATGTTCAGCATGACAAAGATACGGTAAAAGACCTTGGCTTTGCCGGTTTTAA
AGTGCTTTACCCGATCAACAGCAAAGATAAAAACGATGAAATCGTCAGCATGCTCGGGGC
CAGCTATTTCCGCGTGATTGGTGCAGGTCAGGTTTATGGCCTTTCTGCCCGCGGCCTGGC
AATTGATACCGCCTTGCCATCGGGTGAAGAATTTCCGCGCTTCAAAGAGTTCTGGATCGA
GCGTCCAAAACCGACTGATAAACGTTTAACCATCTATGCATTGCTTGACTCGCCGCGTGC
GACAGGTGCTTACAAATTCGTGGTTATGCCAGGGCGTGACACGGTTGTGGATGTGCAGTC
GAAAATCTATCTGCGCGATAAAGTCGGCAAACTGGGGGTTGCACCGTTAACCAGTATGTT
CCTGTTTGGGCCGAACCAACCGTCGCCTGCAAATAACTATCGTCCGGAGTTGCACGACTC
TAACGGTCTCTCTATCCATGCCGGTAATGGCGAATGGATCTGGCGTCCGTTGAATAACCC
GAAACATTTAGCGGTCAGCAGCTTCTCCATGGAAAACCCGCAAGGCTTTGGTCTGTTGCA
GCGCGGTCGTGATTTCTCCCGCTTTGAAGATCTCGATGATCGTTACGATCTCCGTCCAAG
CGCATGGGTGACTCCGAAAGGGGAGTGGGGTAAAGGCAGCGTTGAGCTGGTGGAAATTCC
AACCAACGATGAAACCAACGATAACATCGTCGCTTACTGGACGCCGGATCAGCTGCCGGA
GCCGGGTAAAGAGATGAACTTTAAATACACCATCACCTTCAGCCGTGATGAAGACAAACT
GCATGCGCCAGATAACGCATGGGTGCAACAAACGCGTCGTTCAACGGGGGATGTGAAGCA
GTCGAACCTGATTCGCCAGCCTGACGGTACTATCGCCTTTGTGGTCGATTTTACCGGCGC
AGAGATGAAAAAACTGCCAGAGGATACCCCGGTCACAGCGCAAACCAGCATTGGTGATAA
TGGTGAGATAGTTGAAAGCACGGTGCGCTATAACCCGGTTACCAAAGGCTGGCGTCTGGT
GATGCGTGTGAAAGTGAAAGATGCCAAGAAAACCACTGAAATGCGTGCTGCGCTGGTGAA
TGCCGATCAGACGTTGAGTGAAACCTGGAGCTACCAGTTACCTGCCAATGAATAAGACAA
CTGAGTACATTGACGCAATGCCCATCGCCGCAAGCGAGAAAGCGGCATTGCCGAAGACTG
ATATCCGCGCCGTTCATCAGGCGCTGGATGCCGAACACCGCACCTGGGCGCGGGAGGATG
ATTCCCCGCAAGGCTCGGTAAAGGCGCGTCTGGAACAAGCCTGGCCAGATTCACTTGCTG
ATGGACAGTTAATTAAAGACGACGAAGGGCGCGATCAGCTGAAGGCGATGCCAGAAGCAA
AACGCTCCTCGATGTTTCCCGACCCGTGGCGTACCAACCCGGTAGGCCGTTTCTGGGATC
GCCTGCGTGGACGCGATGTCACGCCGCGCTATCTGGCTCGTTTGACCAAAGAAGAGCAGG
AGAGCGAGCAAAAGTGGCGTACCGTCGGTACCATCCGCCGTTACATTCTGTTGATCCTGA
CGCTCGCGCAAACTGTCGTCGCGACCTGGTATATGAAGACCATTCTTCCTTATCAGGGTT
GGGCGCTGATTAATCCTATGGATATGGTTGGTCAGGATTTGTGGGTTTCCTTTATGCAGC
TTCTGCCTTATATGCTGCAAACCGGTATCCTGATCCTCTTTGCGGTACTGTTCTGTTGGG
TGTCCGCCGGATTCTGGACGGCGTTAATGGGCTTCCTGCAACTGCTTATTGGTCGCGATA
AATACAGTATATCTGCGTCAACAGTTGGCGATGAACCATTAAACCCGGAGCATCGCACGG
CGTTGATCATGCCTATCTGTAACGAAGACGTGAACCGTGTTTTTGCTGGCCTGCGTGCAA
CGTGGGAATCAGTAAAAGCCACCGGGAATGCCAAACACTTTGATGTCTACATTCTTAGTG
ACAGTTATAACCCGGATATCTGCGTCGCAGAGCAAAAAGCCTGGATGGAGCTTATCGCTG
AAGTCGGTGGCGAAGGTCAGATTTTCTATCGCCGCCGCCGTCGCCGCGTGAAGCGTAAAA
GCGGTAATATCGATGACTTCTGCCGTCGCTGGGGCAGCCAGTACAGCTACATGGTGGTGC
TGGATGCTGACTCGGTAATGACCGGTGATTGTTTGTGCGGGCTGGTGCGCCTGATGGAAG
CCAACCCGAACGCCGGGATCATTCAGTCGTCGCCGAAAGCGTCCGGTATGGATACGCTGT
ATGCGCGCTGTCAGCAGTTCGCGACCCGCGTGTATGGGCCACTGTTTACAGCCGGTTTGC
ACTTCTGGCAACTTGGCGAGTCGCACTACTGGGGACATAACGCGATTATCCGCGTGAAAC
CGTTTATCGAGCACTGCGCACTGGCTCCGCTGCCGGGCGAAGGTTCCTTTGCCGGTTCAA
TCCTGTCACATGACTTCGTGGAAGCGGCGTTGATGCGCCGTGCAGGTTGGGGGGTCTGGA
TTGCTTACGATCTCCCGGGTTCTTATGAAGAATTGCCGCCTAACTTGCTTGATGAGCTAA
AACGTGACCGCCGATGGTGCCACGGTAACCTGATGAACTTCCGTCTGTTCCTGGTGAAGG
GTATGCACCCGGTTCACCGTGCGGTGTTCCTGACGGGCGTGATGTCTTATCTCTCCGCTC
CGCTGTGGTTTATGTTCCTCGCGCTCTCTACTGCATTGCAGGTAGTGCATGCGTTGACCG
AACCGCAATACTTCCTGCAACCACGGCAGTTGTTCCCAGTGTGGCCGCAGTGGCGTCCTG
AGCTGGCGATTGCACTTTTTGCTTCGACCATGGTGCTGTTGTTCCTGCCGAAGTTATTGA
GCATTTTGCTTATCTGGTGCAAAGGAACGAAAGAATACGGCGGCTTCTGGCGCGTTACAT
TATCGTTGCTGCTGGAAGTGCTTTTTTCCGTGCTGCTGGCTCCGGTACGCATGCTGTTCC
ATACGGTCTTCGTTGTCAGCGCGTTCCTTGGCTGGGAAGTGGTGTGGAATTCACCGCAGC
GTGATGATGACTCCACTTCCTGGGGTGAAGCGTTCAAACGCCACGGCTCACAGCTGCTGT
TAGGGTTAGTGTGGGCTGTTGGGATGGCGTGGCTGGATCTGCGTTTCCTGTTCTGGCTGG
CACCGATTGTCTTCTCGTTGATCCTGTCACCGTTTGTTTCGGTGATTTCCAGCCGTGCCA
CCGTTGGTCTGCGCACCAAACGCTGGAAACTGTTCCTGATCCCGGAAGAGTATTCGCCGC
CGCAGGTGCTGGTTGATACCGATCGGTTCCTTGAGATGAATCGTCAACGCTCCCTTGATG
ATGGCTTTATGCACGCAGTGTTTAACCCGTCATTTAACGCTCTGGCAACCGCAATGGCGA
CCGCGCGTCACCGCGCCAGTAAGGTGCTGGAAATCGCCCGTGACCGCCACGTTGAACAGG
CGCTGAACGAGACGCCAGAGAAGCTGAATCGCGATCGTCGCCTGGTGCTGCTAAGCGATC
CGGTGACGATGGCCCGTCTGCATTTCCGTGTCTGGAATTCCCCGGAGAGATATTCTTCAT
GGGTGAGTTATTACGAAGGGATAAAGCTCAATCCACTGGCATTGCGTAAACCGGATGCGG
CTTCGCAATAAAAACGTAGTTGCCTGATGCGCTACGCTTATCAGGCCTACATCGTTCCTG
CAATTTATTGATTTTGCAAGACTTTGTGGGTCGGATAAGGCGTTCACGCCGCATCCGGCA
AAAACAACGAGCCAATAAAAATACCGGCGTTATGCCGGTATTTTTTTACGAAAGAGGTAT
CAAATGCGTTTAATTGTGGTGAGCATCATGGTGACCTTGCTGAGTGGCTGTGGCAGCATT
ATTAGTCGCACTATACCGGGGCAGGGGCATGGCAACCAATATTATCCCGGTGTGCAATGG
GATGTGCGTGACTCCGCCTGGCGTTATGTCACGATCCTTGATCTGCCATTCTCTCTGGTT
TTTGATACTTTACTGCTGCCGATCGACATTCATCATGGCCCGTATGAGTGATTAACGTTC
ATCCCACTCATCAGCTGCTGCGCGTCCTTCCTCGGTATCCAGCGGTGGCTCAAGCTGAAA
TTCCCCCTCGTCCCATTCATGTAATGTATTCTCTTCCTGCCACTCCTGGCGTATCTCTAT
CTCATCATAGTCGCCATCAAAAACACTTTGCGCGGCTTCACCGCTAAGCATAGGTAAACA
TTCACCTTCTTCCCCTTCGTCGGCAAAAAACTCAACTTGCCACATGATGTCGCCGTCCTG
CAAAACGTATTTTTGGGCATTGAACTGTTGCACATTCGCATCTTCGGCGTCGATGCCGGG
GTTGTCTGCAAGAAATTCTTCGCGTGCAGCGTCAATGGCTTCTTCAAGCGTTGCGTACAT
GGTCATCACGATTCTCCCTTTGAGTTGATGAGGTTTCAGGGAAAAGGATAGCTGATTCTC
CGCTTTTGCAAGTATGAAAGGCGAAAAATCAGTTCGATACCTGGGGTATTCGACGACGAC
GTAGACTGTTCCATGAATAGACTGCGTTGAATAACACTACGCCAGCGGTGACGAGAAATA
CCGCTCTGAAACCGTAGTTCGCTGAAATCGCTGCTCCCATCAATGGTCCGGTAACGTTGC
CAATATCACGAAACGATTGGTTATAGCTGAAGATACGCCCGGCGATCTGGTTGCTCGAGT
TGTAAACCAACAGTGTCTGTACGGCGGGGAGTAGTGCACCATCGGCGGCACCGAGCAAAA
AACGTAAAATCCCAAGTTGCAATGGCGTCTGAACGTAAGACATTGGGATCAACAGCAGTA
CAGAAAAGATCAGCGCTGTAATCAGGATCTTTTCGGGTCCGATTCGATCGCCAAGTTTGC
CGAGTCGTGGTGCACTTAGCAGAGCCGCCACGCCTGGCACCGAGGCGATCATGCCACTGA
TAAAGGCGACGTTACTGACGTTACCCGCCAGTTCGCGGACATACAGCGTCAGAATGGGGG
CAATTGAGCCCGTCGCCACCTGGATGATTAACGTAGTGACAAACAGGCTGAGTACCAGTT
TCGGGTTTTTAAGTGATGTCACCACTTCCCGCATGTGCAGCATCTCTTTTTTGCTGACCG
GCTGGAATTTTTCTCTGATGCAAAACAGGGTGACGAAAAAGCAGAGTATGAGCACACTGG
CGGTAATAAAGAATACCGGACGTAAGCCGTAGCTATCGGCGAGCAGGCCGCCAGCCATTG
GGCCGAGCAACGCACCACTAACGCCGCCTGTGGAGAGCGTACCCAGCGCCCAGCCGCTTT
TATTACGCGGTACTTGTGTGGCGATAAGAGCATTAGCGTTGGGGACAAATCCGCCAAGTA
ACCCAAGAAGCGCCCGCAGGATCAAAAACTGCCAGATATTTTGTGCCAGCCCCATCAACA
CCATCACGATGCCCATGCCGAGGGCAGAGCGTAATAGCATGAGTTTTCGGCCTTTACGGT
CGGCGAGTCCACCCCAAAACGGTGAGGCGATGGCCGAAAATAAAAATGTAATGCTGAAGA
CAATACCGGACCACATATTCAGGGCGGAGTGACCGGTAACGCCAAGCTGCTCAACGTAGA
GGGGTAAGAAGGGCATTACCAGACTGAAGGCGGCACCGGTAAGAAAACAGCCTAGCCAGG
CGACGATCAGGTTTCGTTTCCAGTTTATAGGGGTGTCATTTTCACAGGGTGACATAGCAA
TCCGCTGTTGGTGC