MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download ppdel-5.seq
 Deletion ppdel-5
 Length 19137
 Fasta Format

>ppdel-5
GATATTTCTCAACTTCTCGCCTGCCATCAGTTTGCGTTCGATATGTTCCAGCGTGACATT
TTTGGTTTCCGGAATGAGCCAGAAAGTAATGCCCACAAACGCAATGTTCAGCGCAGTGTA
GAGCCAGAACGTACCGGCAGCGCCAATGCTATCAAGCAGTGTCAGGAAGGTCGCGCCGAT
AATCATATTCGACACCCAGTTCGTGGTGGTCGAACAGGTAATACCGAAATCGCGGCATTT
CAGCGGCTGAATTTCAGAGCACAGGATCCACACCACTGGCGCGGCGCTCATCGCATAACC
GGCAATACACATCATCGTCATGCCAACAGAGAGCCAGGACAAGCCACTGGAAGCCGTACC
GTTATCAAACTGCATCAGGCAATAGCCCAGCACCAGAGTGCCTAACGCCATCACGCTGAA
ACCAATTTTCAGAGCCGGTTTACGCCCTGCTTTATCTACCGTAAACACCGCAATAAAGGT
GGCGAACATAAAGGTCAGCCCTACGACCAGAGTCGCAATCATCTGTTGTTCTGTGGTCGT
AAAGCCCGCCATTTTGAAGATACGCGGCGCGTAGTACATGATGATGTTCATACCGGTAAA
CTGCTGCATCGCCTGCAACAACATACCGAGAAACACAGCACGACGGACGTTACGGTTGAT
CTTAAACAGTGCCCAACCGCCCTGTTTTAACTTCAGGCTTTCACGAATTTCGTTGAGTTC
TTCTCGCGCTTTTTCCGACGTATCGCGCAGCATACGCAATACTTCTTCCGCCTCAATATG
ACGCCCCTTTTCCGCCAGCCAGCGCGGGCTATTTGGCAGGAAGACTACCAGAATAATCAG
CAGAACTGCTGGTAAAGCAAGAACCCCCAACATTGCGCGCCAGTTACCGCTATAACTGAA
CGCTGTATCGGATAAAAACGCCAGCACGATGCCGAGTGTGACCATCAACTGGTACATACT
GATCATCTTACCGCGAACGTTTTCACTTGCCATTTCAGAAAGATACAGAGGAGCGGTGTA
AGACGCGATCCCGACAGCAATGCCCAGCACCACACGAGCGGCGATTAACATCTCTACGCT
GGTCGCAAAAGCGGACCCTATAGAACCGAGTACAAACAGGATGGCCCCCGCCATCAGGCT
GTATTTACGCCCCAGGCGGAACGACAGCCAACCATTAAACAGCGCACCAATTGCTGCACC
GAGCATCATGCTACTAACCACCCATTCCTGCAAACGACTGGTCAGCACAAAGTGATCGGT
AATGAACGGCAACGCTCCGGCGATTACGCCGATATCAAGACCAAATAACAATCCTGCGAC
CGCAGCAGCTACCGAAACAAACATATTCATACGCCGCGTATCCCGCAAAGAACGTGGCGT
TAAAGCAGATTCCGTATTGATAGTAACCATTTTTTCCTGCCAGCAGAGAGTAAGACATAG
TGAAAAAATACGTGAACAACTCACGCAGGTGTCAGGTCGGAAACAGCATAAATATGGATT
AAATTGCTGCGACATGTCGTTATGTGATGGATATTCCAATTTTCAAATTAAGTTGAATTA
TTGAGATTATTATTAACCACCTAATTTTACAGCAGATAAAATTCATAAAGTTCATTAATT
GATAATTAATATGGATTATTTCATAACCATGATATGGATTATGATGATCTACAGGTATAA
AAAACCCTGCCATGCGGCAGGGTCATAAAAGTAAGAAGAATGAATTAACGCGCCAGCCAA
CCGCCATCCACGGCAATGGTATAACCATTCACATAATCTGAAGCGCTGGAGGCAAGGAAC
ACTATCGGCCCCATCAGGTCACTCGGCAGTCCCCAACGACCAGCTGGAATGCGGTCGAGA
ATTTCCGCGCTACGTTGTTCATCTGCCCGTAGTTGTTGAGTATTGTTGGTCGCCATGTAA
CCCGGGGCTATCGCATTAACATTAATGTTGTGTTTAGCCCATTCGTTCGCCATCAATCGC
GTCACACCCATCACGCCGCTTTTTGATGCGGTATAAGAAGGCACACGGATCCCGCCCTGG
AAGGAGAGCATTGACGCGATATTGATAATCTTGCCGCCATTGCCTTGCGCGATAAAGTGT
TTCGCCGCTGCCTGAGACATGAAGAATACGCTCTTGATATTCAGGTTCATGACATCGTCC
CAGTCCTTTTCGCTGAACTCGAGAGCATCTTCGCGGCGAATCAATCCGGCGTTATTCACC
AGGATATCAATATGACCAAACTCCGCTACCGCGCGATCCAGCAGTGCTGGAATACCATCA
ATCTTTCGCAGATCGGCGGTCAGGCTTAAAAAACGACGCCCCAGCGCTGTGACCTGCTCG
ATGGTTTCAGTCGGTTCAACGATGTTAATGCCAACAATGTCACAGCCCGCTTGCGCCAGC
CCCAACGCCATCCCCTGACCCAGTCCAGTATCACAACCAGTGACGACCGCAACTTTACCT
TCGAGAGAAAATGCACTTAAAATCATAACAATACCTTATTCGTTTATGCCCACAACTAGC
GCAAATCTTTAACGGCCACATGGTCCATATCATCAAAGACCTGGTTTTCACCGACCATGC
CCCAGATAAAGGTATAAGCTTTGGTTCCGACACCGGAATGGATCGACCAGCTCGGGGAGA
TCACCGCCTGCTCGTTATGCATCACAATATGACGCGTTTCTTGCGGCTGCCCCATCATGT
GGAAAACGCAGGCGTCATCATCCATATTGAAATAGAAATAAACTTCCATCCGGCGCTCGT
GGGTGTGACACGGCATGGTGTTCCACAAGTTACCCGGAGCCAGCTCCGTCAGCCCCATAC
TCAATTGGCAGGTTTCCAGTACATCCGGGACAAAATATTTGTTAATCGTGCGACGGTTAC
TGGTGAGGTTATCGCCTAACGTGACTGGAGATACTTCGTCCGGTGTGACTTTTTTGGTGG
GATACGTCGTATGCGCGGGTGCGCAATTGTAATAAAACTTCGCCGGAGTGCCGGTATCAA
TACTGGCAAAGACAACTTCTTTTGCACCTTTACCAACATACAGGGCGTCGCGGTGACCGA
TTTCATAGCATTGGCCATCGACAGTAATCGTACCGGCACCGCCAATATTGATAACACCTA
ACTCGCGACGTTCAAGGAAATAGCTTACGCCGAGTTGTTTACCAACTTCCCCGCCAACGG
AAACCGTTTTAGTTATCGGCATAATGCCGCCAACAATAATTCGGTCAATGTGGCTGTAAA
CCATGGTGTACTCATCGGCGACAAATACCTTTTCAACCAAAAATTCATTGCGCAGCCCTT
GGGTATCCAGCGTTTTTGCGTGCGCACTGTGGATGCTCTGTCTTACGTCCACATCAACCT
CCGATAATCAGTGAAGCGTGAAAATAGAAAACGATAGTGAAACACTGTTTCGTTTTCTCT
ATAAAGGGATGATATGCCCATGGGCTAGGGTTTTCAATTAAAAATAAAACAATGTTTCAT
TTTTAAGTTAAGGATTAAAAAAAGTGCAGTGTCGATCACGAATATGTCATGAGAATGGAA
AAATGAGGGAGCCCAGAAAATGTATGTCGACTTGCCAGCCATCATTATTCAACAGATTAA
TGACGGCAGATATTTATCGGTAAGGAGGAAATGCAGAGCTATTCGTCACGTTCAATGGTC
AATGCCACACCCTGGCCCCCGCCGATACAAAGCGTTGCCAGTCCTTTGCGGGCATTACGT
TTCACCATTTCATGAACCAGAGAAACCAGGATTCGGCAACCGGAAGCGCCTATCGGGTGA
CCGAGTGCGATCGCGCCACCATTGACATTGACCCGACGCTCATCCCACTCAAGCATCTTG
CCAACCGAAAGCGCCTGTGCAGCAAACGCTTCATTAGCCTCGATAAGATCGACTTCAGCC
AACTGCCAGCCTACACGCTCCAGGCAACGGCGGGTCGCATACACCGGCGCAATTCCCATC
AATGCCGGATCTACACCAACGCTGGCAAATGCGCGAATGCGGGCCAGCACGGGTAAATTC
AACGCTCGTGCTTTGGCTTCGCTCATCATCATTACCGCAGCTGCGCCATCGTTTATGGAT
GATGCATTACCCGCTGTCACAGAACCGAGACTATCAAATGAAGGATTTAAACGGGCTAAG
CCTTCTGCGCTGGCGTCAGTGCGTGGCTGTTCATCGGTATCAACAACCAACGTCTGCCCG
TTACTTTGGGTCATTACCGGGACGATCTCATCTTTAAATCGTCCGGCGTCAATCGCCGCT
CGCGCTTTTTGTTGCGAGCTAAGTGCGTAAGCATCCTGCAACTGACGGCTGATGCCATAT
TCGCGAGCCAGATTTTCGGCGGTGACACCAATATGATAATCATTGAAGGCATCCCACAAC
CCATCATGCACAAGACTGTCAACCAACTGGCTATTGCCAAGCTGTGCACCGGTGCGGCTA
TCAGTCAGAACATGTGGTGCGCGGCTCATGTTTTCCTGGCCACCGGCGATGACAATATCA
GCCTCGCCACACTGTATCGCCTGAGTAGCCAGATGCAGTGCTTTAAGCCCGGAACCGCAA
ACGTCATTAATAGTGATTGCAGAAACGCTATTAGGCAGACCACCTTTAATAGCCGATTGC
CTTGCCGGATTCTGCCCTGCCCCTGCAGTCAACACCTGACCAAGAATTACTTCATCCACC
GCATATGCAGGAACGCCGGTACGTTCTATTAACGCTTTCACGACCAGACTACCAAGTTCC
ACGGCGGAATGACCCGCTAACGCACCACGAAAGCAGCCGATAGGTGTCCGTAACGCCCCG
ACAATCACAACGTCTTTCATCACAACCTCGCACCAATTAACAGTGCAATAGTAAATGATT
GTTAATTACAGTTATCTTAATTGTTTAAAAAAAGTGATTTTTATCACAAAGGAAATATGC
CTGAGCAGCAGTCAGAGACATAACTGGCACGTAAGGTTTGCAACCACTAACCCACCAATA
GAGGGGTAGATAGGGCGTTAATCTCCCATACTTAACCTGGTTTATGGTAAATTGCCCTCC
ATTTTGTTTAATTTGTAGATGATACGTTCAGATAATGTCTAATATTTGGTCTAAAGAAGA
AACTCTGTGGAGTTTCGCGCTCTACGGCACAGCCGTTGGTGCAGGCACGCTCTTCCTTCC
TATTCAGTTAGGTTCGGCAGGGGCTGTGGTCCTGTTTATTACTGCTCTGGTCGCCTGGCC
TTTAACATATTGGCCACATAAAGCCTTGTGCCAGTTCATCCTCTCATCAAAAACATCAGC
AGGTGAAGGGATAACGGGCGCGGTAACACACTACTATGGCAAGAAGATTGGTAATCTGAT
TACCACGCTGTACTTCATCGCCTTTTTTGTCGTCGTGTTGATATATGCAGTGGCAATTAC
CAACTCACTTACGGAACAGCTGGCAAAGCATATGGTTATTGATCTTCGCATCCGTATGTT
GGTGAGTCTGGGTGTTGTATTAATTCTGAATCTCATTTTTCTGATGGGACGTCATGCCAC
TATTCGGGTAATGGGATTTTTGGTATTCCCATTGATTGCCTATTTCTTATTTCTTTCCAT
TTACCTTGTCGGTAGTTGGCAACCTGATCTATTAACAACCCAGGTAGAGTTCAATCAGAA
TACCCTTCACCAGATATGGATATCGATTCCCGTGATGGTTTTCGCCTTTAGCCATACGCC
CATTATTTCTACGTTTGCCATAGACAGACGTGAAAAATATGGCGAACACGCTATGGATAA
ATGCAAAAAAATTATGAAAGTCGCTTATCTCATCATCTGCATAAGTGTACTGTTCTTTGT
CTTTAGCTGCCTGCTTTCTATTCCACCTTCGTATATTGAAGCTGCTAAAGAAGAAGGGGT
CACCATTTTATCGGCGCTTTCTATGCTGCCGAACGCCCCAGCATGGTTGTCAATTTCCGG
GATTATTGTCGCAGTAGTTGCGATGTCGAAATCATTCCTGGGTACGTACTTTGGCGTTAT
TGAAGGTGCCACAGAGGTCGTCAAAACAACACTACAGCAGGTTGGTGTAAAGAAAAGTCG
TGCATTTAACCGCGCACTATCAATTATGTTGGTATCGCTGATTACCTTCATTGTTTGTTG
CATTAACCCGAACGCGATTTCGATGATTTACGCGATCAGCGGCCCGCTCATTGCCATGAT
ACTTTTCATCATGCCTACGCTGTCAACGTATCTCATCCCGGCGCTTAAACCCTGGCGTTC
CATCGGAAATCTGATTACGCTGATCGTGGGTATCCTGTGCGTATCGGTAATGTTCTTTAG
CTAATATCAGTTGTGGATGGTTCAAAATTGCTACAATTTTGAACCATTCCATTTTTCATA
ATATTCATTTGTTATTATTCCACCCTATCACTTCTCTCGTCATATCCTAGTATTATCAGT
TAGTTAAACACACAAAGAGATCTGAACATCTTAAATAAGACTATTTAAGATGCATAACTT
AGATTCGCAAGATATCTTCTGGTCATTCAAAAACAATTTGCGATATAGATATTCTTATAC
CATGAGATAGTTATCTGGACCGCTCTCAACCATGCAAGATTAAATCAGTGAAACATAATC
ATATTTGATAACGAGAAATGCATTTTTAAATGCCTTACTCAGAATTATAGCAAATACAGA
TTAATCGCAATTTTTCCCGGCAAAATTACAAAATCATGGTGTATTGACATCATCAATAAC
CAATGAAATTATGCAATTATATACGGATAGGGAGGTTCTTAACATGGGGCTTTGTAGTCG
TTATAAAAGTCTTACATGCAATAGTTGCTCAATGCATTGCCAAATAATGCCAGAAGAGTC
ACCGCGTTTGCAGTATTGCGCAAACTCGTGTTTTTGTATGTGGCCCGAAGAAAGTTCATA
TTTTAATCGTGGTGTGGTAGAAGGTATCTTAACAAAAAACCACAATGCGAGATTAAGCGG
ATATATTTTTGTCGATTTTTCAGTAAGTTTTTTACGTCTATTCCTTGAAAAAGACTGGAT
TGACTATCTTGCAAGTACTGACATGGGGATTGTTTTAGTCAGCGACCGCAATATGCAATC
GTTAGCTAATTACTGGCGAAAACACAACTCAGCAATATCTGCTGTCATATATAATGATGA
TGGTCTTGATGTTGCCAATGAAAAGATCAGACAACTATTTATTGGTCGTTATTTATCATT
TACCGGAGGTAACACATTAACTCAGATGGAATTCACCATAATGGGGTATATGGTTTCTGG
TTATAATCCATATCAGATTGCTGAAGTTCTGGATATGGATATCCGTAGCATCTACGCGTA
CAAGCAACGAATCGAAAAGAGAATGGGTGGTAAAATAAACGAATTATTTATTCGTTCACA
TTCGGTCCAACATTGATACTCAACGACCAGCCAGAATCATACTCTGTTTATACGGGCATT
TATTGAAATGTCCGTATTTTATAAATAGGCCGTCCCCTCAAGAGTAAACACCATAGTATT
TAAAACCATCACACGAAAAATTCAGAAGCATTACGAAATATGAATTTACAAACAATAGTG
GCATAAATGTTAACCATGTTAATTTACGTAAAGTTTTACGTTGCAACATTAAAGCCTCAT
TTCAATCATCATGATAAATATAAAATTAATATATATTTATGCCGTAAATACCAATATACT
TAGCAAACTATGTGATCTCCATTTCGATTGATTTAGTGTTTATTGACGTATGTACTGGAT
TATTAACGATAATATCGAGTTCTGGCCTGAGCACCGAAAATTAATATCGGTACATAACGC
CGATCTTAACGTCGTTCTGACAACGCCAGCCAGTCGATGTTTATCACTTCTACTTGAAGC
TTTTCCTGATGTGGTTGCACAACAAGATTTTTTCACCAGAGTCTGGGAAGAAGAAGGTAT
GCGTGTGCCTACTAACACGTTATATCAGAACATATCCATTATCAGACGCGGATTTCGCGC
TGTTGGTGATACTACCCACTCGCTAATTGCAACCGTGCCGAGAAGAGGATTCAAGATCCA
TAATGACATTAACATACAAAATCATGTAATAAACTCGTCAACAGACGCACATACACACAA
TGCCCCACCTGCCATAAAAGTTAATGCGGGATACAAAGAGAGCATTGGTGGCGCAAAGAA
TTTCAATAACAAAATCCTCAAACATATAAAAAGTCATCTAATTATGTTGAGCGCATTTGT
CATAGGCGCATATTCTGCATATTGGCTATGGAATAATAATCAACCGAAGCCATTTTTCAA
GGATTACAAGACTGTTGCGGAAATTAATGGCTGCCATTTTAATGTAACAGAAGATACAAT
TGATGGGTTGAAAGAGTTCGATAAATATAAAACACGGATACTGGATTCGGGGATTAACTG
TAAAAAACATCCGTGGTTATACTTCCCTCTTGCAAAATCCTCACCGGGGATGATTGTTAT
GGCATGCAATAAAAACTATAACCAACATGAAGTGGCAAACTGTTTAACCCTGTCTTACCG
TGAGGTTAATCGTGATTGATTATAAAAAAAACTTATTATTTATTTTAGTTTTTATCAGTG
GGTTTATTCTCTTCACTGTCTATTCTTACACTGCAGAAAAAATGATATATAACGAAACAT
GCACTGCAAATTGGGTAATTTTTAATGACCAGGGACGAGCAAATCTTACCATCGACTTTA
TGTATAACAAAAAAAATAAAACAGGAACTGTTGCGTTGAGTGGAACCTGGCAACAAGGTA
ACAGAGAAAGTAAATCAATACGGCGAAATATTGAATACACATGGATTGAAAACTATGACA
CAGCCCATTTAACATCAAAGAAAGTTAATAAGTTTGAGATTATGGATCAAGTTGATGATG
ATAGACTTGCACAACTTATTCCTGATTTTTATGTCTTTCCAGAAAAAAGTGTAAGCTATA
ATATACTAAAGCAAGGTAAGCATGCTTTTATTTTGAGCATTGGTAACAGAGCAATAATGC
ATTGTGCAAGGTAAACTAAAATAGATAACAAAAAGATGGAACCTCGTTAATCATAAAACA
ATAAAATTAAATATTCTCGCAGTATATGGCAGTCTAAAGCATCAAAGATTTGATCAACAT
CTTTCATTTTAGACATCTCCTTGCAATGTAAAATATCATGTATCAACAACATCTGGTGCA
AATCCATGAGTCGAACTCGACATTCATCTTAGCTCGATTATTATTCCTTCGTACAGTCGA
TGTAAACAATACAGAAAGAGGATTATTAAGAACCAGTTTACTCAGTGAATCAATAGAGGA
AAGGACTAACGTTTCTTTAAAAGAATTGATTTCATCATCTGTTAAACTAAACTCATCATT
GACAGATCGTGAGATATAACTGTTTTTAACTTTACTCTTTACGTTGACTTTATTGACAGA
ATTAACATTCACATATCTTGAATTTAATGTCCATGATGTTGTTTGCGTGAGAACATTCTC
AGCATTAAGGAATTTTTTTAACGGAATCCTTGGTTTCTTTTTCGAGTCCGAATTTACAAT
ATCATGCATATAGACCATTTCATGAATCTGCGAAAATTCAATGTCCATTGTATACCTCAC
ATTTTTACCGTGACTCGATGTTACTGTTCAATAATCACCTTCCATCAATACTAAAATTAA
TACCCCTAATGTGCCGATAACAAATATAGTCATTCTACGTAACGTCTCCATAAGGTGATA
TTTGACATTATCAGAAGCTGCGAATTCGGATTTTGCTCTAATCAAATGAGAGAAATGTAA
AATGAAGCCACGAAATATTAATAATAGCCTACCACTGCAACCATTAGTTCCTGATCAGGA
GAACAAAAATAAGAAAAATGAAGAGAAATCCGTTAATCCAGTTAAAATCACAATGGGGTC
TGGTTTAAATTATATTGAACAAGAATCTCTTGGAGGAAAATATCTAACACATGATTTGTC
AATAAAGATAGCGGATATTTCTGAAGAGATAATTCAGCAAGCAATATTATCTGCTATGAG
CATATATAAATTTTCGATAACAGATGATTTAATGAGTATGGCTGTAAATGAACTCATAAA
ACTGACCAAAATAGAGAATAATGTAGACCTGAATAAATTCACTACTATATGCACAGACGT
TCTATCCCCCCGCGTCACCAGACATAATAAAGAAAAAAACAAACGACATTCTACCCTTCT
CAAAAATCCCCTTTTTAATTTTCATTGAAAAAATGGCAATTGATACTATGAATCCAGGTC
ATACACATTAAGGCATTTATGTAATGTCGTAATTAAGATAACTAATAAGGTGAATATTAG
TAAAACAACTAATGATGTTATTAGTTTGTAGTGAACAGTACTTTTACCAATAATGAAAAA
TATACCATAAGCAATGCAAGCTTAAAACTCATAATTTAAAAAAGATAAATATAAAAATAT
CAATGAGTCAATCAATAATAATTTGGCATCACGAGACACATCACAGAGGAATATTATGAG
CACAGAAACAATTGAAATATTCAATAATAGTGATGAATGGGCAAATCAACTAAAACACGC
ATTATCGAAAGGAGAAAATCTGGCATTACTACATGGTTTAACTCCTGATATCCTTGATAG
AATATATGCATATGCATTCGACTACCATGAAAAGGGTAATATAACGGACGCAGAAATTTA
TTATAAATTCTTGTGCATTTATGCGTTCGAAAATCATGAGTATCTAAAAGATTTTGCATC
AGTATGTCAGCCCAAAAAGAAATATCAACAAGCATATGACCTTTACAAACTAAGTTACAA
TTACTTCCCGTATGATGACTATTCAGTTATTTATCGTATGGGTCAATGTCAGATTGGGGC
TAAAAATATCGATAACGCAATGCAATGTTTCTATCACATTATTAACAATTGTGAGGATGA
TAGTGTTAAGAGTAAAGCGCAGGCATATATTGAACTCTTAAACGATAATTCAGAAGATAA
TGGCTAAGCATTACAATCATTTGGTTAAATTTGCTGGTTATAGTGCAGTTAACCACTATA
ACCAGCACCTCTTATGTTTTCTTAAATCAGCATCTTAAAACAGTTAAGAGCATACTATAA
ATCATTATTTTTCAATGCGTTAGAGAACAATCTACTTTATCAAAATTGAATAAGGCTATT
TCAGATTACATCACTGAATTCCTAAGATAAATTAGTGAACACAACCATAGATATGTCAAA
TGTAATTTCCTGTAGCGTTAATGACACATAAATATGAATAGCCATAATTTCTATTGCTTA
AGCAGGATGCAAGAAACCAATTTTTTCATAGAGGTTAACTAATGGACTTAGAAAATAAAT
TCTCATATCATTTTCTTGAGGGATTAACGCTCACGGAAGATGGAATTCTTACTCAAGGAA
ATGAGCAAGTTTATATTCCACAGAAAGAGTTAGGTGTATTAATAGTATTACTTGAATCCG
CTGGTCATGTTGTACTGAAAGATATGATCATCGAATCAGTATGGAAAAATATTATTGTTA
GTGACGAGTCCCTGACAAGATGTATCTATTCTTTGCGCTGCATTTTTGAAAAAATTGGCT
ATGATCGTTGCATAGAAACAATCTACCGGAAAGGTTATCGTTTCAGCGGGCAGGTTTTCA
AAACTAAAATTAATGAAGATAATACTTCAGACTATTCCATAGCTATATTCCCTTTCACTA
CTTCATTGAATACACTGGATCCATTAATACTTAATCAGGAATTAGTGCAAATCATTTCAA
ATAAAAAAATCGATGGTCTCTATACCTATCCGATGGCTGCGACAAATTTTTGTAATGATC
ACATATCTCAAAATTCATTCTTGAGCAGATTCAAGCCAGATTATTTCGTTACAGGAAGAA
TAAACCAGAATAATGCAGTGAACACTTTATACATTGAGTTGATCGACGCTAAAAACCTTT
TCCTCATCGCCAGTAATCATCTCCCTGTTGATGAACTACATAATACATCACAATTTATTA
TAGATAATATCCTTCAAACGGTACATAAACCAGAACGATCTGTAAGATTAGCTAAGCAGG
ACCAAGGATATAAGAATCATTATTTATCAGATGAAATGTTAGCCGGAAAGAAAGAACTTT
ACGACTTCACCCCTGAAAGCATTTACAGGGCCATGACTATATTTGATAGATTACAAAATA
AAAGTGATATACAGACGCTAAAAACAGAATGTTATTGCCTTCTAGCGGAATGCCATATGT
CTTTGGCACTTCATGGAAAAAGTGAACTTGAACTTGCTGCTCAAAAAGCATTAGAGCTTT
TAGATTATGTATCAGACATAACCACTGTCGATGGAAAAATTTTAGCTATTATGGGACTGA
TAACTGGTCTGTCTGGACAAGCAAAAGTATCTCATATCTTATTTGAACAGGCTAAGATAC
ACTCAACTGATATAGCCTCTCTCTACTACTATAGGGCACTAGTCCACTTTCATAATGAAA
AAATTGAAGAGGCAAGGATTTGTATAGACAAATCACTACAACTCGAACCCAGAAGACGAA
AAGCAGTTGTGATAAAAGAATGTGTAGATATGTATGTGCCTAACCCGCTCAAAAACAACA
TTAAACTCTACTATAAAGAAACTGAGAGTGAAAGCCATCGAGTTATAATTGACAACATTT
TGAAATTAAAGCAGCTGACGAGAATTTGTATGCGATAAATTTTTATTGACGCAATTTTAT
TATTTAGATGTATGCAACTTGTTATTTAAACAACAGAGATAAAAATATCTAAGATATTCA
CCTTATTGCAAGATATTTAAAATGCTCTAGAGTTAAAAGTATGATGTAAAGACCATTGGC
CTGGACAATTAAAAAAGGGAGCTTTATGACTAATCCAATCGGTATCAATAATTTATCTCA
AAGTTCAAATATAGCGAATGCAACGGGTGATGAAGTCGTATCATTAGATAAACACATCAA
CACCAGTGCTACTGATACAGATCAAATACAAGCATTTATAGTTTCAACATGGATGGCGCC
TTTTCAAAATGATATGTATTCAGAAGATAATCCTATCTCACCTTACTATAAAATTGAGTG
GTAGACGATTGACCAAATAAATCATAACGAGATACTTTTATAATAGTATCTCGTTCCTTT
CATTCAATCCTCACACATGAAAAAATATGCGCTCACCAAAAGTTAAATTCTTAACCATCT
TCACGTTTTGTATATTTATTACAAAAATGTCTTTCGCCAGCAACTCTTGCTCTAATGAAG
CAGGAACAATGTTCAGAATCGAACCAAATTTAATTAAAGCTATCGCTCTTGTTGAAAGCA
ATCTAAAAAAGGATAGCATAGGCAAGAACAGAGATAAGAATAACAATATAAAGAGTTTAG
ATTATTGGTTAATGCAGATAAACCAGATGCATATTCCCCTGTTAAAAAAACGTGGAATAA
TAAAAGATGAACGAGATTTGTTAGATAACCCTTGTCTGAACATTAAAATAGGAACCGAGA
TTTTATATAACCATTTTTCACGTTGTGGAGTAACGTGGCAATGCCTGGGGACTTATAATG
CGGGTTTTGCAATGGATAACCAAAAAAAGAGACAGCAATATGCCCCAAAATATATATTGT
ATATACCAGGCTTAATGAACTAGACAATCGTAAGGCTTCAGCAAAATGAGCCTAAAGCCT
CTTTTTTTTATATAGTGCAAACACCCATACGTAAAGCTGTTTTGATCAACTCGATACCAC
TGTGAACATCTAATTTCTTCATGATATTGAGTCTATGAGTTTCGACTGTTTTCCTGCTTA
ACTGCAAGAAATTAGCGATTTCTTTGTTTGTTTTACCATCAGCTATGAGTTGTAATATTT
CTGACTCACGATTTGTAAGTTGATTATCAGAGGAATACCTGGAAGATATTTTTTCACAAT
CCATATGTACACTATCAAAATAAGTGTAACCATTACTAATCGAATCAATAGCACGATTTA
GTTTCGCCGGGTGACTGGTTTTCCATACGCATCCTTTCGCACCTGCTTCAAGCAATTTTA
TTGAATCAATATACGGCATCTTTGCTACAAATGTAATAATATGAGCATCTATCTTATGCG
ATTTAACCCATTTTACGAGTTCGGCCCCCATCATTCCACCTGCAAATTCTCCTAAAATAA
ATATTTAGGCTGTAGATTTGTTACACTCCGCTATAGCTTTCTTCAGATCTTTATAGCCCC
CAACAACCTCATATAAATCAGGATAATGTCCGAGAAATCCAATTATCCCATCAATCATAA
ACGGCTGCTGATCTGAAACTACAATTTTAATTTTTCCCATATATTCATCCTGAGTGTAAA
TGCTTTAACGCATTCATTTATAATCATCCCTTCCATTATTATTATAAGCAAAATCCAAAG
AATACATTGATGAAATAATAATGAAATATAATTAAAAATAAAATTTTTGCGTAAAAAAAT
ACCACAGGCATTAAAAAATCATGAGATGATTAAAATATTACAATTAGATTATATTCAAAT
CATTAAACTTGAGCCAGGGAGCTATAAGTCCTCAGGGCTTGCCAAAACAGAATTATTCAT
ATCCAAAGAATGTGTTTCAAACATTTTTTCAACTAAATAATGTCTGGCTTGTTCGCAGAT
TTCGTTAACCTTGTCAGGGGAGAAACAATGATTATTAATTAAATATTGCTCACAATTATC
CACAAATTCCTGCGGACTAAATTCAGCAATAAATTGATCGGTAAAAAACACAAAACGCTT
ATCATCATGAAATGTAATATGGACATTCCATATTGATTTGTCGACAAAATATGACTCTAC
TTCAAGAGACTTATCTTTGAAACTGGTAGGTATATGGAGATTTACAGGACCTGATATTGA
TGGTAATTTTGTTACCCAACTTTCAAAAATTTTGATAAAAACATCAACTTCTTCTGAAGG
TTTTAACAATATACTCTTCAGATCGTTTATCATGTTTATTCTTTTTTTTCAAGTTCTGAG
CATAGCAAGCTTATCAAGGGTATAAAATTATCCATCTCATCAATAATGCCTTTTGTATAG
CCATCATAATAACCTTGAATAAATTTTTCTTCTCTCTTTTCCTCAATACTCTGAATTTTT
GCGGTGGTTTCAAGAAGGATTTTTTCTTTAAGAGAAACTATTTCTTTCAATCCATCAGAA
ATTTTTCTTTTAATCACAACACCATTTGCAGGAGATTTTATCAAGCTCATCTCTATTTTT
TTTCGCATAAAATGTAATTCTCTCTAAAAGTGTTGATGCAAGTGGTAACGGCGATTGTAT
GTGGTCAACAAAATCAGGAAATAATAAATTAAATCGTTGCTGCATTGCCAATGGTTGTTG
CCTTATATAGGGTAACAACGTTGAAAAACCACATGTGATGATATTGTGATAGTTAGCGAT
GCCGGGTTTGTATCGTGCCTTTTCATTTATTTCCAGCGGTATAGCTGATAAATAATCCCT
TAGTACATCAGGAACCTTATAAAAAAACCCGCGTTCTGCAAACCTTTCTCGATAAAAGTG
ACAACCACTGAGTAAACAGATCAATGGAAGTAAATTCCAATTGTTTATTGGATTTGCCCC
TATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCC
CGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCC
TCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCA
CGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCC
GTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAG
CATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGG
CGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTG
ACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTC
TCTCCGTTATCACAGCAGAACTCGAACCCGTCAGAGCACCATCGCTGATTGCTTTCTTTC
ACGGCCACTCTGCCTGTATGTGCCCGTTTCGATGGCGGTACAGCAGGTTTTCGCTCAAGC
AACAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCA
TCAAGTTCTGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTTGGCAGC
TCTCCGATAACATGGTGTATACGGAGAAGCACATCCGTATCATCAGTGTGACGACTGCGG
CGGCCATCCATCCAGTCATCGGTTCGTCTGAGAATGACGTGCAACTGCGCACGCGACACC
CGGAGACAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTA
TCCACTTTTTTGCCCGTCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTT
TCTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCGGCAGCAAGTTCAGAGG
CAGGAACAACCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGCTTAC
GCCAGAGAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCA
TCCCCGGTTCAAAGCTCTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGC
GTTTCTCCGGCCCTAAGACATCAATCATCTGTTCTCCAATGACTAGTCTAAAAACTAGTA
TTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTAA
ACTTGCTCTTTTCTTCTGGTGTTTATCTTTGAAAGATTTGTAGGATAAATAACATTAAGT
AAAGCCGCATCGGCTTCTCTGTAATGTTTATCTTTTTCCAGATAACCTGGGGATTCTCCC
CCTAAATCAAGCTGTAACGTTATTCTTTCATAACCTTTATCTATGAGGTGGTTCAACCTC
GTTGTTGAAAGAGTTTCATCCAGTTCATTGACTTTAGCTTCGCGTAGTAAATCAGAGACA
AAAACAGAGTCTTTCTTCGAGAGTAGGTTTGACAAACGTTCCAGTCCAGAGGTCACCAGT
GCAACGGAAGATGTGTTTAATCGGGCATCTTCTTCCCATGCTCAGGAATCTTCCATAACA
TAGAAATTGGCTTTATCCAGATAAGCAATCAGCAGCGCAACCGACTTTAATCGGTCACCT
TTTTGCCAATCTTCAGCGTTAATAGTACCAGTGTTGATTGCTTGTATAAGGAGATCAAGG
TAAAGACCTAAAGCATCATTTTGTTTATGGTTCCACAGCTGCGGCTTGCCTTCTTCCTGC
ACATCTGCCATCACGGGGGAGTTGCTGTCAAATCGGATATGCACAGCATTCATTTGCACG
GGAATTCCATCCAGTCGTTTTGGGTTGCTAATGACGTCCTGCATCCGCTTAATCTGGTCG
GGCGTAGACATATAATCCCACAGGGTGAGCAGAACCTTTTTTGCGGCTACACTATTTCCC
TGATCTGATACTAATGCCATATAGCCCCATAAACTATCCCTCAACCAGACAGCATCATAG
TGGGTTTCTGCCGCTGTTTTGTCATCTTCGAAAGTAGAAGCAAGAATAAACGTTCCCCAG
GGTTTCTCCGTCAACGTTAACTTTCGTGTGTTTTCTGTTAATGTTAGCAATCCTTGAATT
TCGTCTTTGGTATAGTGGCTCTTTATTTCATTTTGTAATTTGGCTGAGTGAATCAGAAGA
CGATAATTAGGATACTTATCTGGATTTAACGATAAATAACTTTTATCTGTTGCTGCCCCC
GTGGAATTAAGAATGTTAAATACAGATTCACTCGTCACTTCTGCCCCTGTCGCCTGGCAT
GTGCCGCACGAAAATATACCAGCGAGCAGAAGAGTTAATGCAGATTTCCCTTTCATAAAA
TATTCCATCAATCGTTTGTTAAAAGCGTAGATAACCACTTATTTAACAACTTGAAAATAA
GGTGTTTTACCTGGGTTGTTACAAAAGGATTGCATTGCGTAAACGCTTTTTATTTACAAC
AAAATGGGGAAGTATTACGGCGAAGATAAATTGGAGCGGGCGAAGGGAATCGAACCCTCG
TATAGAGCTTGGGAAGCTCTCGTTCTACCATTGAACTACGCCCGCTTCGAGATGCGTAAG
GCATTATAAACCTTACGCTCTCCTTAGCAAGTGCCACGCTGCTGACTGCTGATTAATTCG
CCATCAGCATTTTGGCTTGCTGCCCTGAGGCGGCAAGTAACGTAGCGGATCAATTGCCGT
TGCACGGTAACGAATCTGGAAATGCAGGCGAACAGATGCCGCATCCGTGCTCCCCATAGT
GGCGATTTTTTGCCCAGCCTTCACGCTTTGCCCATTATTTACCAGCATCGTGTCATTATG
GGCGTAAGCCGTAATGTAATCTTCACTGTGTTTAATCATGATGAGATTACCGTAGCCACG
CAGCTGGTTGCCCACATACACCACCTTTCCTGCACCCGCGGCGTAAATAGGTGTACCCCG
TGGAGCTGAGATATCAATCCCTTTATTGCCGCCATCTGCTGTCGAATACGGCATGATAAC
TTTCCCTGTCGTTGGCCATAACCAACAACGTTGCCCTACTGGCGGCCAGGATGATTTCGG
TACCGCTGATGACGGTGTAACCGATGCGGTTTTGGTCGTTGATTTGGCGGTTGATTTACG
TGTAATACTGCTACTTTTCGCCCCACCCAGTTTTAGTTTCTGACCAACTTCAATGGTGTA
AGGGGGGGAAATGCCGTTCAGTCGCGCCAGTTCTTTTACGCTGGTTCCCGTGGTGCGCGA
AATACGATATAGCGTATCCCCCCGTTTCACGGTGTAAACGGAGCCGGAATACGTTCCTGT
ATCGGATGATTTGCTACCCGAACAGCCCGCCAAAAGCAGTCCAACCGATAACAACATCAC
GATACCCAGAGATTTTTTATTCAGGCGTCCCGCACTCAAAATCTTTCCTCGCTTAAA