MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 15+dps.seq
 Deletion 15+dps
 Length 134656
 Fasta Format

>15+dps
TATACTTACTCCTCAAATCATCTTTTAATGATAATAATTCTCATTATATTGCCGCGACGA
AGCAACAGCAATGCTTACGCATAACCATAGCGAAAATAGTGGCGCAGTGTAAGGTTGTTG
TGAATATTGAGTTGCAAATATGTCGGTGTTTGCTGGTGATTTGAACAATATGAGATAAAG
CCCTCATGACGAGGGCGTAACATTACTCAGCAATAAACTGATATTCCGTCAGGCTGGAAT
ACTCTTCGCCAGGACGCAGGAAGCAGTCCGGTTGCGGCCATTCAGGGTGGTTCGGGCTGT
CCGGTAGAAACTCGCTTTCCAGAGCCAGCCCTTGCCAGTCGGCGTAAGGTTCGGTTCCCC
GCGACGGTGTGCCGCCGAGGAAGTTGCCGGAGTAGAATTGCAGAGCCGGAGCGGTGGTGT
AGACCTTCAGCTGCAATTTTTCATCTGCTGACCAGACATGCGCCGCCACTTTCTTGCCAT
CGCCTTTGGCCTGTAACAAGAATGCGTGATCGTAACCTTTCACTTTGCGCTGATCGTCGT
CGGCAAGAAACTCACTGGCGATGATTTTGGCGCTGCGGAAATCAAAAGACGTTCCGGCGA
CAGATTTCAGGCCGTCGTGCGGAATGCCGCCTTCATCAACCGGCAGATATTCGTCCGCCA
GAATCTGCAACTTGTGATTGCGCACGTCAGACTGCTCGCCGTCAAGATTGAAATAGACGT
GATTAGTCATATTCACCGGGCAAGGTTTATCAACTGTGGCGCGATAAGTAATGGAGATAC
GGTTATCGTCGGTCAGACGATATTGCACCGTCGCGCCGAGATTACCCGGGAAGCCCTGAT
CACCATCATCTGAACTCAGGGCAAACAGCACCTGACGATCGTTCTGGTTCACAATCTGCC
AGCGACGTTTGTCGAACCCTTCCGGCCCGCCGTGCAGCTGGTTAACGCCCTGACTTGGCG
AAAGCGTCACGGTTTCACCGTCAAAGGTATAACGGCTATTGGCGATACGGTTGGCATAAC
GACCAATAGAGGCCCCCAGAAACGCGGCCTGATCCTGATAGCATTCCGGGCTGGCACAGC
CGAGCAGCGCCTCGCGGACGCTGCCATCGGAAAGCGGAATACGGGCGGAAAGTAAAGTCG
CACCCCAGTCCATCAGCGTGACTACCATCCCTGCGTTGTTACGCAAAGTTAACAGTCGGT
ACGGCTGACCATCGGGTGCCAGTGCGGGAGTTTCGTTCAGCACTGTCCTGCTCCTTGTGA
TGGTTTACAAACGTAAAAAGTCTCTTTAATACCTGTTTTTGCTTCATATTGTTCAGCGAC
AGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGATCAGCGCGACGATACAGCCGCCAAA
TCCGCCGCCGGTCATGCGTACGCCACCTTTGTCGCCAATCACAGCTTTGACGATTTCTAC
CAGAGTGTCAATTTGCGGCACGGTGATTTCGAAATCATCGCGCATAGAGGCATGAGACTC
CGCCATCAACTCGCCCATACGTTTCAGGTCGCCTTGCTCCAGCGCGCTGGCAGCTTCAAC
GGTGCGGGCGTTTTCAGTCAGTATATGACGCACGCGTTTTGCCACGATCGGGTCCAGTTC
ATGCGCAACAGCGTTGAACTCTTCAATGGTGACATCACGCAGGGCTGGCTGCTGGAAGAA
ACGCGCACCGGTTTCGCACTGTTCACGACGGGTGTTGTATTCGCTGCCAACCAGGGTACG
TTTGAAGTTACTGTTGATGATGACGACAGCCACACCTTTGGGCATGGAAACTGCTTTGGT
CCCCAGTGAGCGGCAATCGATCAGCAAGGCATGATCTTTCTTGCCGAGCGCGGAAATTAG
CTGATCCATGATCCCGCAGTTACAGCCTACAAACTGGTTTTCTGCTTCCTGACCGTTAAG
CGCGATTTGTGCGCCGTCCAGCGGCAGATGATAAAGCTGCTGCAATACGGTTCCGACCGC
GACTTCCAGTGAAGCGGAAGAACTTAACCCGGCACCCTGCGGCACATTGCCGCTGATCAC
CATGTCCACGCCGCCGAAGCTGTTGTTACGCAGTTGCAGATGTTTCACCACGCCACGAAC
GTAGTTAGCCCATTGATAGTTTTCATGTGCGACAATGGGCGCATCGAGGGAAAACTCGTC
GAGCTGATTTTCATAATCGGCTGCCATCACGCGAACTTTACGGTCATCGCGTGGTGCACA
ACTGATCACGGTTTGATAATCAATCGCGCAGGGCAGAACGAAACCGTCGTTGTAGTCGGT
GTGTTCACCAATCAAATTCACGCGGCCAGGCGCCTGAATGGTGTGAGTGGCAGGGTAGCC
AAATGCGTTGGCAAACAGAGATTGTGTTTTTTCTTTCAGACTCATTTCTTACACTCCGGA
TTCGCGAAAATGGATATCGCTGACTGCGCGCAAACGCTCTGCTGCCTGTTCTGCGGTCAG
GTCTCGCTGGGTCTCTGCCAGCATTTCATAACCAACCATAAATTTACGTACGGTGGCGGA
GCGCAGCAGAGGCGGATAAAAGTGCGCGTGCAGCTGCCAGTGTTGATTCTCTTCGCCATT
AAATGGCGCGCCGTGCCAGCCCATAGAGTAGGGGAAGGAGCACTGGAAGAGGTTGTCATA
ACGACTGGTCAGCTTTTTCAACGCCAGCGCCAGATCGCTGCGCTGGGCGTCGGTCAAATC
GGTGATCCGTAAAACGTGGGCTTTGGGCAGCAGTAGCGTTTCGAACGGCCAGGCAGCCCA
GTAAGGCACGACGGCTAACCAGTGTTCGGTTTCGACAACGGTACGGCTACCGTCTGCCAG
CTCGCGCTGAACATAATCCACCAGCATTGGTGATTTCTGTTCGGCAAAATATTCTTTTTG
CAGGCGGTCTTCGCGCTCAGCTTCGTTAGGCAGGAAGCTATTTGCCCAAATCTGACCGTG
CGGATGCGGGTTAGAGCAGCCCATCGCCGCGCCTTTGTTTTCAAAAACCTGCACCCATGG
GTACGTTTTCCCCAGTTCTGCGGTTTGCTCCTGCCAGGTTTTGACGATTTCCGTCAATGC
TGCAACGCTGAGCTCTGGCAGCGTTTTACTGTGATCCGGTGAAAAGCAGATCACCCGGCT
GGTGCCGCGCGCGCTCTGGCAACGCATCAGCGGATCGTGACTTTCTGGCGCATCTGGCGT
GTCAGACATCAAAGCCGCAAAGTCATTAGTGAAAACGTAAGTCCCGGTGTAATCGGGGTT
TTTATCGCCTGTCACCCGCACATTACCTGCGCAGAGGAAGCAATCTGGATCGTGCGCAGG
TAACACCTGTTTGGCTGGCGTTTCCTGCGCCCCCTGCCAGGGGCGCTTAGCGCGGTGCGG
TGAAACCAGAATCCATTGCCCGGTGAGCGGGTTGTAGCGGCGATGTGGATGATCAACGGG
ATTAAATTGCGTCATGGTCGTTCCTTAATCGGGATATCCCTGTGGATGGCGTGACTGCCA
GTGCCAGGTGTCCTGCGCCATTTCATCGAGTGTGCGCGTTACGCGCCAGTTCAGTTCACG
GTCGGCTTTGCTGGCGTCCGCCCAGTAGGCCGGAAGGTCGCCCTCGCGACGCGGTGCAAA
ATGATAATTAACCGGTTTGCCGCAGGCTTTGCTGAAGGCATTAACCACGTCCAGCACGCT
GTTGCCTACGCCAGCGCCGAGGTTGTAGATGTGTACGCCTGGCTTGTTCGCCAGTTTTTC
CATCGCCACGACGTGACCGTCCGCCAGATCCATTACGTGGATGTAATCGCGTACGCCAGT
ACCATCTTCGGTCGGATAATCGTTACCAAAAATCGCCAGCGAGTCGCGACGGCCTACAGC
AACCTGGGCGATGTATGGCATCAGGTTATTCGGAATGCCTTGCGGATCTTCGCCCATATC
GCCCGACGGATGCGCGCCAACCGGGTTGAAGTAGCGCAGCAGGGCAATGCTCCAGTCCGG
CTGGGCTTTTTGCAGATCGGTGAGGATCTGTTCCACCATCAGCTTGCTTTTGCCGTAAGG
GCTTTGCGGTGTGCCGGTCGGGAAGCTTTCAACGTATGGAATTTTGGGCTGATCGCCATA
AACGGTGGCGGAGGAGCTAAAAATAAAGTTTTTGACGTTAGCGGCGCGCATGGCGCTAAT
CAGGCGCAGAGTGCCGTTGACATTGTTGTCGTAATATTCCAGCGGTTTTTGTACCGATTC
GCCCACGGCTTTCAGCCCGGCGAAGTGGATCACGGTGTCGATAGCGTGATCGTGCAGGAT
CTCGGTCATCAACGCTTCGTTACGAATATCGCCTTCAACAAACGTTGGATGTTTGCCGCC
TAAACGCTCGATAACAGGCAGTACGCTGCGCTTACTGTTACAGAGGTTATCAAGAATGAT
GACATCATGACCGTTTTGCAGTAATTGCACACAGGTATGACTTCCAATGTAACCGCTACC
ACCGGTAACCAGAACTCTCATAATTCGCTCCATTAGGCTTATGGTATGAAATAACCATAG
CATAACAAAGATGCGAAAAGTGTGACATGGAATAAATTAGTGGAATCGTTTACACAAGAA
TTTAGCCGTTTTTTATGCGCGATTAAGTGATTATAAAACAGAGGGTTTATGAATGATTGC
GCTTTTTATCTGAAAAAAGACGCGGTTTCATGCCTGCATGCGTCGAACCGTTGGCCGGAG
AGGGTGCTAAGGCCGCCTCCGGCAAGGTCAGCACTACCGACTCAATATATTTTTGTCAGC
ACATAGCGATAGAGTCCACCGTCCGGCACGAACTCAAGACGATGGGTAATACAGGCAGGC
GCATCTTCAGCGTGGTGCGAAACAAACAACAATTGCGTTTCACCTTCGCTAATCAGCACA
TCAACAAAACGGCGGATAAGCTGGCGATTCAGCGGATCAAGCCCCTGTAGTGGTTCATCG
AGAATAAGCAACGTCGGATGTTTCACCAGTGCGCGGACAATCAGCGCCAGACGCTGCTGT
CCCCAGGAAAGACTATGGAACGGAGCGTCAGCCGTGCGTTTATCAATGCCGAGAATATCC
AGCCACTGCTGCACCAGTTTTTGCTGGCGATCCGAAACGGCCTGATAAATGCCAATCGAA
TCAAAATAGCCAGAAAGAATCACATTACGCACGGTAGTGCTGACCCGGTAATCCAGATGC
AAACTACTGCTGACGTAACCGATATGCTTTTTGATATCCCAGATGGTTTCGCCGCTGCCG
CGACGTCGTCCGAAAAGCGTCAAATCGTTGCTGTAACCTTGCGGATGATCGCCAGTAACC
AGGCTTAATAACGTCGATTTTCCTGCACCATTTGGCCCGACAATTTGCCAGTGTTCGCCT
GGATTCACCTGCCAGCTAAGGTTATTAAGAATGGGGCGATCGTTATAAGAAACCACGCCA
TTGTTCAGCACAATGCGCGGTTCGTTGGCGGGTAAGGCGTGACGTGCTGAAGGTTCATCC
GGCTCCGGCAGTTGCACACCTTCAAGCTGTTCACTATGCGCCAGTTGCGCGACGAGTGCT
TGTTGGAGCAGTTCCTCTTTAGCGCCAGTTTCCGCTAACGTGCAATCCGCCAGCACGCCA
GCAAACTGGACAAACTCCGGGATCTCATCGAAGCGATTGAGCACCAGTACCAGAGTAATA
CCGGACTGATGTAACGAGGCGAGTCGCTCAGCCAGCTGCTGACGTGAGGCAACATCCAGG
CCATCGAACGGCTCATCAAGAATCAACAAGTCAGGCTCCGACATCAGCGCCTGACACAGC
AGGGTTTTTCGCGTCTCGCCAGTGGAAAGGTATTTAAAGCGTCGGTCGAGGAGGGCGGTA
ATACCGAACTGCTGCGCCAGTTGCATGCAACGCGGTGCATCCTTTACTTCATCCTGAATG
ATCTCAGCCGTAGTGCGTCCGGTGTCATCTTCGCCAGGGCCGAGCATATCGGTGTTATTC
CGCTGCCATTCGTCGCTGACGAGTTTTTGCAATTGCTCGAAGGAGAGACGAGTGATGTGG
GAAAACTGGCTTTGCCGTTCACCTTTCAAAAGCGGAAGTTCCCCCGCCAGCGCGCGGGCC
AGGGCCGATTTCCCGCTTCCATTCGAACCGACAAACGCCCAACTATCACCCGCGTTTAAC
GTTAGCTGAGGCAATTGCAGCGTTTTTGTGTCGCTAAGACGAAACGTGCCTTGCAAAATT
TGCAACGATGACATTTTATATCCCACTTTGTGCAGCGATTACTGACAGGGATACGTGTTT
CATAACAAATTGTCAACACGCTTAGCACAGCGTGGCGATAATCACGCTGTCGGCATTAAA
GTAGGCCGTGACATTCTGTCCTTGCTGAAGAGAAGTCGCTTCATTTACCGGCACTGTGGC
GCACAGTGTTTGCCCGTCGGGTAGCGCCATTAATACTTCGCACTGCTCTGCGCCGCGCTC
AATATGACTAATAATACCCGGTAATTGGTTGTCAGCGTTTTGCGCGACCGCCTCGTCCTG
AGTAATACCTACCCACGGCGCTTTTAGCAATATCAACACTTCTTTGCCTTCATCCAGCCC
CAGACGCGCGCCGCTTTGTGCGGTAATTGCGACTTTCAGGCGTGTTTTTCCGTCAGCCAG
TAAGACATCAACATGCTGTTGAACGTCATCATGATCGCGGGCGGTGATGGTACCGAACCA
CTGGTTACGGGCGCTGGTTTGCAGTGAAAAACGTGAGATCGCGGCCAGCAGGCTGTTCAG
CGGCAGGGCGTCATCGTCACTTAACACATCAAAGGCTTTTTGCTGGATTTGCGCCAGTAA
GTCATAGAGCTGAATCAGTCGCTGACCATAGCGGGTCAGTACTGCGCCGCCGCCACCTTT
ACCGCCTGTTGCGCGCTCGACCAGAATATGCTCACTTAACTGATTCATCTCGTTAATGGC
ATCCCAGGCGCTTTTATAGCTAATACCGGCATCTTTCGCTCCCTGGCTAATGGAACCGGA
AAGCGCAATGTGTTTTAGTAGCGAAATGCGGCGCGGGTCGGCGAATAATTTTTGTTGGAG
CTTAAGGGTGAGAAGGATTTCGGCCTGCATAACAATGTCCTGGCAAAAGTCTTATTGTGA
CGGAAAACGAACGCCACGCAAAGCTGACCGCACAAAAGGGGAGTGCTTTTCTGTGCTTAG
CGGTTAGAATAGTCTCATGACTATATCTGGAGTTGACCATGTTAGAGTTATTAAAAAGTC
TGGTATTCGCCGTAATCATGGTACCTGTCGTGATGGCCATCATCCTGGGTCTGATTTACG
GTCTTGGTGAAGTATTCAACATCTTTTCTGGTGTTGGTAAAAAAGACCAGCCCGGACAAA
ATCATTGATTCCCTGAATGCCCGCTTAGTCGGGCATTTTCTTTTTCTCAACTTCCTGCTT
TTCCTGCCGATATTTTTTCTTATCTACCTCACAAAGGTTAGCAATAACTGCTGGGAAAAT
TCCGAGTTAGTCGTTATATTGTCGCCTACATAACGTTACATTAAGGGGTTACCAATGGCT
CGTAAATGGTTGAACTTGTTTGCCGGGGCGGCACTCTCTTTCGCTGTTGCTGGCAATGCA
CTGGCAGATGAAGGGAAAATCACGGTGTTCGCCGCCGCATCACTGACTAACGCAATGCAG
GACATTGCTACGCAGTTTAAAAAAGAGAAAGGCGTGGATGTGGTTTCTTCTTTCGCTTCG
TCATCTACTCTCGCCCGTCAGATTGAAGCGGGTGCGCCTGCGGATCTGTTTATTTCTGCC
GATCAGAAATGGATGGATTATGCGGTTGATAAAAAAGCGATCGATACAGCTACGCGTCAG
ACACTGCTCGGCAATAGCCTGGTCGTTGTAGCACCGAAAGCCAGCGTGCAGAAAGATTTC
ACCATCGACAGCAAAACCAACTGGACTTCACTGCTGAATGGCGGTCGCCTGGCGGTTGGC
GATCCGGAACATGTTCCCGCTGGCATTTATGCAAAAGAAGCACTGCAAAAACTGGGCGCA
TGGGATACGCTCTCTCCGAAACTGGCCCCAGCGGAAGATGTTCGTGGGGCGCTGGCGCTG
GTCGAACGTAACGAAGCGCCTCTGGGCATTGTCTACGGTTCTGACGCAGTTGCCAGCAAA
GGGGTAAAAGTGGTTGCCACCTTCCCGGAAGATTCACATAAAAAAGTGGAATATCCGGTT
GCTGTTGTGGAAGGGCATAACAATGCGACAGTGAAAGCATTTTATGATTATCTGAAGGGA
CCGCAGGCAGCGGAAATCTTTAAACGTTACGGATTTACAATCAAGTAATGATACTGACCG
ATCCAGAATGGCAGGCAGTTTTATTAAGCCTGAAAGTTTCTTCCCTGGCTGTGCTGTTTA
GCCTGCCGTTTGGGATCTTTTTTGCCTGGTTACTGGTGCGTTGCACGTTTCCGGGCAAAG
CTCTGCTCGACAGCGTACTGCATCTACCGCTGGTGTTACCGCCCGTGGTCGTCGGTTACT
TATTATTAGTTTCGATGGGACGGCGCGGATTTATCGGTGAACGTCTGTATGACTGGTTTG
GTATTACCTTCGCCTTTAGCTGGCGCGGCGCGGTTCTCGCTGCCGCCGTCATGTCGTTTC
CGCTGATGGTGCGGGCAATTCGTCTGGCGCTGGAAGGGGTTGATGTCAAACTGGAACAGG
CCGCAAGAACACTGGGGGCCGGGCGCTGGCGCGTTTTCTTTACTATCACGTTACCGCTGA
CCTTACCGGGAATTATTGTTGGTACGGTACTGGCTTTTGCTCGTTCTCTCGGTGAGTTTG
GTGCAACCATCACCTTTGTGTCGAACATTCCTGGTGAAACGCGAACCATTCCTTCTGCCA
TGTATACCCTGATCCAGACCCCCGGCGGGGAAAGTGGAGCGGCGAGACTGTGCATTATTT
CTATTGCGCTGGCGATGATCTCCCTGTTGATTTCAGAATGGCTGGCCAGAATCAGCCGTG
AACGGGCGGGGCGCTAATCATGCTGGAACTGAATTTTTCCCAGACGTTGGGCAACCATTG
CCTGACTATTAATGAAACGCTGCCCGCCAATGGCATCACTGCTATCTTTGGCGTCTCCGG
TGCCGGAAAAACTTCGCTGATTAACGCCATCAGTGGACTGACGCGCCCGCAAAAAGGGCG
GATTGTCCTCAATGGGCGGGTACTAAATGATGCCGAAAAAGGTATCTGCCTGACGCCGGA
AAAGCGTCGCGTTGGCTATGTTTTTCAGGATGCGCGGCTGTTCCCGCATTACAAAGTGCG
TGGCAATCTGCGCTACGGCATGTCGAAAAGTATGGTCGATCAGTTCGATAAGCTGGTGGC
GCTTTTAGGCATTGAACCGTTGCTTGACCGTTTACCAGGCAGCCTGTCCGGAGGCGAAAA
ACAGCGCGTGGCGATTGGTCGGGCTTTGCTGACAGCACCGGAATTGCTGTTGCTGGATGA
ACCGCTGGCGTCACTGGATATTCCGCGTAAACGCGAACTGTTGCCTTATCTGCAACGGCT
GACACGGGAAATCAACATTCCGATGTTGTATGTCAGCCATTCGCTGGATGAGATCCTCCA
TCTGGCAGACAGAGTGATGGTACTGGAAAACGGTCAGGTGAAAGCCTTTGGCGCGCTGGA
GGAAGTGTGGGGCAGTAGCGTGATGAATCCGTGGCTGCCGAAAGAGCAACAAAGTAGCAT
TCTGAAAGTGACGGTGCTTGAGCATCATCCGCATTACGCGATGACCGCGCTGGCGCTGGG
CGATCAGCATTTGTGGGTCAATAAGCTGGACGAACCGCTGCAAGCTGCGCTACGTATCCG
CATTCAGGCTTCCGATGTTTCTCTGGTTTTACAACCGCCGCAGCAAACCAGCATTCGTAA
CGTATTGCGGGCAAAAGTTGTTAATAGTTATGACGACAACGGCCAGGTGGAAGTGGAACT
GGAAGTCGGCGGTAAAACGCTGTGGGCGCGTATCAGCCCGTGGGCCAGGGATGAACTGGC
GATCAAACCTGGCCTGTGGCTGTACGCGCAAATTAAAAGTGTGTCGATAACCGCCTGATT
AAATCAGGTGGCTATAAATGAACTGGGCAATGCTGTCGGTGGTGTTATCACCAATCACAA
TGTTGGCGCGCGCTTTTACCGCGTCATCGGCGTTGCCCATCGCCACGCCTGTACCAGCGG
CTTCCAGCATACTGATATCATTAAAGTTATCGCCGAATGCCACGACGTTTTCCATCGACC
AACCTTGCGCCTCAACCCATTTCGTCAAACGTTTACCTTTGCTGTTGCCGCCGCGTGCAA
TATCAACCTGATCGTGCCAGGACCATTCACACTCCAGTCCCAGTTCATGTTCGACATGCT
TACCAAAATGCTGCAATTGCGGCAGGTCATCGTGCGTCAGGGCGAACTTCCATACGGCGT
TAACTTGTTGCGCCGTTTCAGCCAGAGAAGCGACTTGTGTGAAAGTCGGACGCTGTTCCG
GCGGCAGGGTTTGCGCCCAGTTAGATGTGCGAATGACATGCCCGGTCGGGTGCTCATAGA
CCATTGCATCATCGACATACATCAGACCGTGAATGTGGTGTTCATTCAGCATCTCAATGA
GTTGCAGGGCTTTAATAACGGGCATTGGGTCCGCTTCCAGCACGGTTTTTGCATGATAAT
CATACAAATAGGTGCCATTACAGCAAATAGCAGGTGTATCCAGCGCCAGCGCCTGATAAA
AAGGATGAATAGCGACGTGATGGCGACCTGTGACGATGATTAATTGATAGCCTGCTTCGC
GAGCGCGGGCCAGGGCTTCTATCGATGAAGGAAGCAGGGTCTTTTTCGGGGTCAATAAGG
TGCCGTCTAAGTCGAGAGCAATCACGCGTGTGGTCATGGCGTATTCCAGATTAAGGTTAA
GAATTTTCGTCTGCGCGAATGGTACACCGATACCACTATCGGACAAAATTCTGCGTTTTA
ATTCAGCATTCACCGCCAAAAGCGACTAATTTTAGCTGTTACAGTCAGTTGCTAAATGCA
AAGGAGCATTCATGAAGCAAACAGTTTATATCGCCAGCCCTGAGAGCCAGCAAATTCACG
TCTGGAATCTGAATCATGAAGGCGCACTGACGCTGACACAGGTTGTCGATGTGCCGGGGC
AGGTGCAGCCGATGGTGGTCAGCCCGGACAAACGTTATCTCTATGTTGGTGTTCGCCCTG
AGTTTCGCGTCCTGGCGTATCGTATCGCCCCGGACGATGGCGCACTGACCTTTGCCGCAG
AGTCTGCGCTGCCGGGTAGTCCGACGCATATTTCCACCGATCACCAGGGGCAGTTTGTCT
TTGTAGGTTCTTACAATGCGGGTAACGTGAGCGTAACGCGTCTGGAAGATGGCCTGCCAG
TGGGCGTCGTCGATGTGGTCGAGGGGCTGGACGGTTGCCATTCCGCCAATATCTCACCGG
ACAACCGTACGCTGTGGGTTCCGGCATTAAAGCAGGATCGCATTTGCCTGTTTACGGTCA
GCGATGATGGTCATCTCGTGGCGCAGGACCCTGCGGAAGTGACCACCGTTGAAGGGGCCG
GCCCGCGTCATATGGTATTCCATCCAAACGAACAATATGCGTATTGCGTCAATGAGTTAA
ACAGCTCAGTGGATGTCTGGGAACTGAAAGATCCGCACGGTAATATCGAATGTGTCCAGA
CGCTGGATATGATGCCGGAAAACTTCTCCGACACCCGTTGGGCGGCTGATATTCATATCA
CCCCGGATGGTCGCCATTTATACGCCTGCGACCGTACCGCCAGCCTGATTACCGTTTTCA
GCGTTTCGGAAGATGGCAGCGTGTTGAGTAAAGAAGGCTTCCAGCCAACGGAAACCCAGC
CGCGCGGCTTCAATGTTGATCACAGCGGCAAGTATCTGATTGCCGCCGGGCAAAAATCTC
ACCACATCTCGGTATACGAAATTGTTGGCGAGCAGGGGCTACTGCATGAAAAAGGCCGCT
ATGCGGTCGGGCAGGGACCAATGTGGGTGGTGGTTAACGCACACTAACCGCTGATTTACC
CGGCGCAGTCTCTCCTGCGCCGGTGTATTAACCTATCTCCTGTAACGCGTGTCTCTGGCG
TTCGACGATATTGGTCCACAAATTGTCTTTATCGTCAGTCCATAAATTAATCAGCAAGGC
AAAAAAGCGTTCTGCTGCTGGAGAAAGTACGGCATCTTTACGGCGAATTATTCCCAATGT
TCGACGTATAACGGGTTCCACCAATGGGATACCAATAATCGAAGAATAGGGCGCATGAGG
CATTGCCAGGCCAGGAAGCGCCGAAATCCCCAGTCCCGCCTCCACCAGTCCTAATGACGT
CGAAAGATGACGCACTTCGTAAAACCAGTCCAGCTTCCAGGGCTTGTCGGCCAGCTGTTG
TTCTATCAACAGTCGGTTGCCGCTGGAGGAGCGTACGCCAATCATTTTGTAACCCACTAA
CTCCTGCCATTCTACAAGCTGCTTTTTGGCCAATGGATGGTCACGCCGACAGGCCAGCAC
GAACGGCTCGTTGACCAGTGGGGTAAAATCAATGGATGAATTTGTGACGTTGTTCATGTT
TATGCCAAAGTCTGATTCGTTACACAGCACCGATTCCATGCAATTATTCGTGCCTTGTTC
CAGAATCCGCACTTTAATATTGGGATACAGCTCATTAAATTTACCGATTGCCAGCGGTAA
AAAATAAAATACTGCGGTCGGAATACACGCTAACGTCACCATACCACGATGATAAGCATT
CATATCACGAATATTAAAAAGCGTTTCATCGAATTTCTTTATTAATTCCCGCGCCTCCGG
GAGCAACCTTTTTCCTGCTTTTGTTAACGTAACCTTGCGAGTTGTACGCTCAAATAGTTG
AACATGTAAATCTTCCTCCATCTTTTTTATTCTTCGCGTTAATGCAGGTTGCGTAATATT
GAGTAATTTAGCGGCATTGTTAAACGAACTGGACTCTGCCAGTATGACAAATGCCTTCAT
ACTTGATAATTCATGCTTCATTATTACTCCGGAAAATGGAAGCGACGATTTTGGGTGGCT
GGCCGTTAAAAATTTTAACTGCATTTAGCCAACTTAAATTAATGAAAAAATGTTATTAAT
CGTTGAGCTAAAGTCATTAGAGATGCTTTGCCCTTAATGTAACCATATCGCAATAAGTTA
TGTTTTTAAATTGAGGGCATTATTATGAAAAAAATACCCTGCGTGATGATGCGAGGTGGA
ACCTCGAGGGGCGCGTTCCTGTTAGCGGAACATTTACCCGAAGATCAAACGCAGCGCGAT
AAAATATTGATGGCAATTATGGGTTCCGGTAACGATCTGGAAATTGACGGTATTGGCGGC
GGTAATCCACTGACCAGTAAAGTCGCCATTATTAGCCGTTCCAGCGATCCGCGTGCTGAT
GTCGATTATCTGTTTGCGCAGGTAATCGTTCATGAGCAACGTGTCGATACCACGCCTAAC
TGCGGCAATATGCTGTCTGGTGTTGGGGCATTCGCCATTGAAAATGGTTTGATTGCAGCG
ACTTCGCCAGTTACTCGCGTACGTATCCGCAACGTCAATACGGGTACGTTCATCGAAGCT
GATGTGCAAACGCCAAATGGTGTTGTCGAGTACGAGGGTAGCGCCAGAATTGACGGCGTA
CCGGGTACTGCCGCACCGGTTGCGCTCACTTTCCTGAATGCCGCTGGAACCAAAACCGGA
AAAGTTTTCCCGACTGATAATCAGATTGATTATTTTGACGATGTCCCGGTGACCTGTATC
GATATGGCGATGCCAGTCGTCATTATTCCGGCTGAATATCTGGGAAAAACAGGTTATGAA
TTACCGGCGGAACTGGATGCCGACAAAGCATTATTAGCCCGCATTGAATCTATCCGTCTA
CAAGCGGGTAAAGCAATGGGCTTAGGTGATGTCAGTAATATGGTTATCCCTAAACCTGTG
CTTATTTCTCCAGCGCAGAAAGGCGGGGCAATTAATGTGCGTTATTTTATGCCGCATTCT
TGCCATCGCGCGCTGGCGATAACCGGTGCTATTGCTATTTCCAGTAGTTGTGCATTGGAA
GGCACCGTCACCCGACAAATCGTCCCTTCTGTAGGATACGGCAATATCAATATTGAACAC
CCCAGTGGTGCGCTCGACGTTCATTTAAGTAATGAAGGTCAGGATGCCACGACGTTACGC
GCATCTGTTATTCGGACGACCAGAAAAATATTTTCCGGTGAAGTTTATCTTCCCTGAAAA
AATTCGTTGTCAGGATAAGGACAATCAATAAAGGACTTCTGTATGAGTCATACAGAAAGA
ACAGGATTTTAAATGAATAAGAAATCGTTATGGAAGCTAATTCTGATATTAGCGATCCCA
TGTATTATTGGTTTTATGCCAGCTCCGGCAGGATTAAGCGAACTGGCGTGGGTGCTTTTT
GGTATTTACCTGGCGGCCATTGTGGGGCTGGTTATCAAGCCTTTCCCGGAACCTGTCGTA
CTGTTAATTGCCGTTGCTGCCTCAATGGTGGTGGTCGGTAACTTATCCGACGGTGCGTTT
AAAACCACCGCCGTATTAAGCGGTTACTCTTCAGGTACCACCTGGCTGGTGTTCTCGGCG
TTTACCTTAAGCGCCGCATTTGTGACCACCGGTTTAGGTAAACGTATTGCCTATCTGCTG
ATTGGTAAAATCGGTAACACCACGCTGGGTCTGGGTTACGTTACGGTATTCCTCGATCTG
GTACTGGCTCCGGCAACACCGTCTAACACCGCGCGTGCGGGCGGCATTGTGTTACCGATC
ATCAACAGCGTGGCGGTGGCTTTGGGGTCCGAACCGGAAAAAAGTCCGCGTCGTGTCGGA
CATTACCTGATGATGTCCATTTACATGGTCACCAAAACCACCAGCTATATGTTCTTTACC
GCAATGGCGGGGAACATTCTGGCGCTGAAAATGATCAACGACATTCTGCACCTGCAAATT
AGCTGGGGTGGATGGGCGCTGGCAGCCGGATTGCCGGGCATCATTATGCTGCTGGTCACC
CCGCTGGTGATTTACACCATGTATCCACCAGAAATTAAGAAGGTGGATAACAAAACCATC
GCTAAAGCGGGCCTTGCCGAACTAGGACCGATGAAAATCCGCGAAAAAATGCTGCTCGGT
GTCTTTGTGCTGGCGCTGCTGGGCTGGATTTTCAGTAAGTCTCTGGGGGTTGATGAATCC
ACCGTGGCAATCGTTGTTATGGCAACCATGCTGCTGCTGGGTATCGTTACCTGGGAAGAC
GTGGTTAAAAATAAAGGCGGCTGGAATACCTTAATCTGGTACGGCGGTATTATCGGCTTA
AGCTCCTTATTATCGAAAGTTAAATTCTTCGAATGGTTAGCTGAAGTCTTTAAAAATAAC
CTGGCATTTGATGGTCACGGTAACGTTGCTTTCTTCGTTATTATTTTCCTCAGCATTATC
GTGCGTTATTTCTTCGCTTCCGGTAGTGCCTATATCGTTGCTATGTTACCGGTATTTGCC
ATGCTGGCGAACGTCTCCGGCGCACCGTTAATGTTAACCGCGCTGGCACTGTTGTTCTCC
AACTCCTATGGCGGCATGGTTACTCACTATGGCGGCGCGGCAGGTCCGGTCATCTTTGGC
GTGGGTTATAACGATATTAAATCCTGGTGGTTGGTCGGTGCGGTACTGACGATATTAACC
TTCCTGGTGCATATCACCCTCGGCGTGTGGTGGTGGAATATGCTGATCGGCTGGAACATG
CTGTAAATATTCTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCA
GTCACTTACTTATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAA
TTATTTAGAGTATATCCATTTATTATCTTTCTGCGCACTTCACGGTGCGCAGATATCTGG
AGCATTTGATGATCAAGTTATCTGAAAAAGGCGTGTTTCTCGCCAGTAATAACGAAATAA
TTGCCGAAGAACATTTCACCGGCGAAATTAAAAAAGAAGAAGCCAAAAAAGGCACTATTG
CCTGGTCTATTCTCTCTTCGCATAATACGTCCGGAAATATGGATAAACTTAAAATTAAGT
TTGATTCATTAGCCTCTCACGATATTACCTTTGTTGGTATTGTACAGACCGCTAAAGCGT
CCGGTATGGAACGTTTCCCGCTGCCGTATGTGCTGACCAACTGCCATAACTCACTCTGCG
CCGTCGGCGGCACTATTAACGGTGATGACCATGTTTTTGGTTTATCGGCGGCCCAGCGTT
ATGGCGGTATTTTTGTGCCTCCGCATATTGCGGTCATCCATCAATATATGCGTGAGATGA
TGGCAGGCGGCGGCAAAATGATCCTCGGGTCAGACAGCCACACCCGTTACGGTGCATTAG
GGACAATGGCAGTCGGTGAGGGCGGCGGTGAGTTGGTAAAACAGCTGCTTAATGACACCT
GGGATATCGACTATCCGGGCGTGGTTGCGGTGCATCTGACCGGAAAACCTGCGCCGTATG
TGGGGCCACAGGATGTGGCGCTGGCTATCATTGGCGCGGTGTTCAAAAACGGTTACGTCA
AAAACAAAGTCATGGAGTTCGTTGGACCGGGCGTTAGCGCGCTCTCTACCGATTTCCGTA
ACAGCGTTGACGTGATGACCACTGAAACGACCTGTTTAAGTTCTGTCTGGCAAACCGATG
AAGAAGTCCATAACTGGCTGGCGCTGCACGGTCGCGGCCAGGATTACTGCCAGCTTAACC
CTCAACCGATGGCGTACTACGATGGCTGCATCAGCGTTGATTTAAGCGCCATCAAACCAA
TGATTGCGCTGCCGTTCCACCCGAGCAACGTGTATGAAATCGACACACTGAACCAGAACC
TGACCGACATTCTGCGTGAGATTGAAATTGAGTCCGAACGCGTGGCGCACGGTAAAGCCA
AACTCTCGCTGCTGGATAAAGTGGAAAATGGTCGCCTGAAAGTGCAGCAGGGGATTATCG
CGGGCTGTTCTGGCGGTAACTACGAAAACGTCATCGCGGCGGCGAATGCACTGCGCGGTC
AATCCTGTGGCAATGACACCTTCTCGCTGGCAGTTTACCCGTCATCACAGCCGGTGTTTA
TGGATCTCGCCAAAAAAGGTGTGGTAGCAGATTTGATTGGCGCAGGCGCAATCATCAGAA
CCGCGTTCTGCGGCCCATGCTTTGGCGCGGGCGATACGCCAATCAACAACGGTTTGAGTA
TTCGCCACACCACGCGTAACTTCCCGAACCGCGAAGGCTCTAAGCCAGCTAATGGGCAGA
TGTCAGCGGTGGCGTTGATGGACGCTCGTTCTATCGCTGCGACTGCGGCAAACGGTGGCT
ATTTAACCTCTGCCAGCGAACTTGATTGCTGGGACAACGTGCCGGAGTACGCCTTCGATG
TAACGCCGTATAAAAACCGTGTTTATCAGGGCTTTGTGAAAGGGGCAACTCAGCAACCGC
TGATTTACGGGCCGAACATTAAAGACTGGCCGGAATTGGGTGCGCTGACTGACAATATCG
TCCTGAAAGTGTGCTCGAAGATCCTCGACGAAGTGACCACCACCGACGAACTGATTCCTT
CCGGTGAAACCTCTTCTTATCGTTCAAATCCGATTGGTCTGGCGGAGTTTACCCTGTCTC
GCCGCGATCCCGGTTATGTTAGCAGAAGTAAAGCGACTGCTGAGCTGGAAAATCAGCGTC
TGGCGGGGAATGTCAGCGAGCTGACAGAGGTGTTTGCGCGCATTAAGCAGATTGCTGGTC
AGGAGCATATTGATCCGCTGCAAACTGAAATTGGCAGCATGGTCTATGCGGTGAAACCAG
GCGATGGTTCTGCGCGTGAACAGGCGGCGAGCTGCCAGCGTGTGATTGGCGGTCTGGCGA
ATATTGCCGAGGAGTACGCGACTAAACGCTATCGTTCTAACGTCATCAACTGGGGGATGT
TACCGCTGCAAATGGCGGAAGTACCAACCTTTGAAGTGGGGGATTACATTTACATCCCTG
GCATTAAAGCGGCGCTGGATAATCCGGGTACGACGTTTAAAGGTTATGTGATCCATGAAG
ATGCGCCGGTAACGGAAATTACGCTCTATATGGAAAGTCTGACTGCTGAAGAGCGCGAGA
TTATCAAGGCGGGTAGTTTGATTAACTTCAATAAAAACCGTCAGATGTAAAAAGCGCCAT
GTGAATGTAGGTCGCATTCGGCACTTATTGTCGGATGCGATGCTTGCGCATCTTATCCGA
CCTACGAATCGCATCGAATCTGTAGGCCAGATAAGGCATTTTCGCAGCATCCGGCACTTA
TTGTCGGATGCGATGCTTGCGCATCTTATCCGACCTACAAATCGCATCGAACCGTAGGCC
GGATAAGGCGTTTACGCCGCATCCGGCAAATAGTTAATTGCTCTTACTTCTTCGCCTCTG
CAACCACTTTACTACCCACGCCGCGGTTATTGTATTCCCACATGCGGTTGTAGTTAGTGT
CATTCAGATTGCGCTGTATTTCGTCGTTATCATCTACGCTGCCGGTATTACCCGCAAACG
GACGATTAGAGATCACCGCATCGGCCCACGGTTTAGCCGTGTTAAAACCTTCGTTGATGG
CGCTATCACGGATCACCACCTGACCGTTGGTATTGGCATCAACATCCAGCGAGCGGCCCA
GTTGCGCCACACCATCACCGAAAGCATTGAAACGGCTGTTTACGGCGAGGAAACCGTAGT
AAATGTTGGACAGCGTAGCCGGTGCAAACACATACGCTTCTTGCTGAGTACGTGAGTTCA
CCACGCGGAATTCGGTGTTATCGAACACCACTGCGCCGCGACCAGAAACGATATCCACAT
CCCCTTCAATGTAGCTGTTGGTCACCAGCGTACGCGGCTGACGATTCGTTTCCAGACGGT
TCTGCACACCGCTGTTGGTGACAAAGAAGGTGTTCTGACGACCGAGAATGTTAACGTTGT
TAATCTGTACCTGGTCACCATCAGTACGCAGTGCCACCGCCGGATGGTTACCTGCATCTA
CGCTATCGCCCAGCGTGTTTTCGATGGTCAGATTTTGCAGTTGCAGGCCATTGTTTTGTG
ACCAGAAGACCGCAGAGCAGAGAACACCGATACTGTCGCTGCGTTTGCTCTGGCAGCTAT
CGTACATATACCACGCTGGTTTACCTGGCATATATTTGCCGCGCGGGTTGACGTCGTGAC
GCCAGTCGGCAGGGCTCATGCCACCATCAAGGGAAAGCCCAATCTTCACATCAATCGGTT
TTTCACCTGTACCGTACAGAGTAATTCCACCCGGAGCGGCAGGGACATATACCGTTCCCT
GATACTCACCAGGCATCACGGCAATATACTGGCGCTTGTTGGTACGCTTGATAATTGCCG
CATCTACCGCCGCCTGAATCGTGGTATGCGTTACACCTTGAGTGCCCGCCGGGCCGACAA
CAAAGTCAGGTTGCGCAGGCAGGGTAATCGGGGAAGGATTCCACGCTGCAGCACCTGGTG
TCAGGGATGCAAAATAGTGTTGAGCATCGAAATTCTGCGCTTCTTTTGCCGACAGAATCG
GGCGAGAAGAGGTACCAGGCGCGGTTTGATCAGAAGGACGTTGATCGGGCGGGGTTGAGC
TACAGGCGGTCAGCGTCACGCCAAAAGCCAATGCCAGCGCCAGACGGGAAACTGAAAATG
TGTTCACAGGTTGCTCCGGGCTATGAAATAGAAAAATGAATCCGTTGAAGCCTGCTTTTT
TATACTAACTTGAGCGAAACGGGAAGGTAAAAAGACAAAAAGTTGTTTTTAATACCTTTA
AGTGATACCAGATGGCATTGCGCCATCTGGCAGAGTGATTAACTAAACATCGCAGTAATC
GAGGCGCTTGCCAGAGAGTGGAAATGAACGTTAAACCCGACCATCGCGCCGCTGGCACCT
TCATCGACATCAATACGTTCTATATCCAGCGCGTGAACGGTAAAAATGTAGCGATGAGTT
TCGCCTTTCGGCGGTGCTGCGCCATCGTACCCGGTTTTACCAAAGTCGGTACGCGTCTGC
AAAACGCCGTCTGGCATTGCTACCAGACCAGAGCCAAACCCTTGCGGTAATACGCGGGTA
TCAGCGGGTAAGTTAACAACTACCCAGTGCCACCAGCCGGAGCCGGTTGGCGCATCCGGG
TCGTAGCAGGTGACAACAAAACTTTTCGTTCCCGCAGGAACATCATCCCACGCCAGATGC
GGTGAAATATTATCGCCATCGTAACCCATGCCGTTAAAGACATGACGATGCGGCAATTTA
TCGCCATCGCGCAGATCGTTACTGATGAGTTTCATGAACCCTCCTTTCTTGTTTGCAGAA
AGTGTAGCCAGAAACCCTCACGCGGACTTCTCGTTATTGGCAAAAAAATGTTTCATCCTG
TACCGCGCGGTTAACCGCTGCGGTCAGACGCTGCAACTGTTGCGGGAGAATAATATAGGG
CGGCATCAGGTAAATCAGTTTGCCAAAAGGCCGGATCCAGACACCCTGTTCGACAAAGAA
TTTTTGCAGCGCCGCCATATTCACCGGATGAGTGGTTTCGACCACGCCAATGGCCCCCAG
TACGCGCACATCGGCAACCATTTCGGCATCACGGGCGGGGGCAAGTTGCTCGCGCAGCTG
TACTTCAATATCCGCCACCTGTTGCTGCCAGTCGCCAGATTCGAGAATCGCCAGGCTGGC
GTTTGCTGCCGCGCAGGCCAGCGGATTGCCCATAAAAGTTGGCCCATGCATAAAGCAACC
GGCTTCACCGTTACTGATGGTTTCTGCAACCTCGCGCGTGGTGAGTGTGGCGGAAAGGGT
CATTGTGCCGCCGGTTAAGGCTTTACCGAGGCACAAAATGTCCGGCGCGATTTCTGCATG
TTCACAGGCAAACAGTTTCCCGGTACGACCAAATCCAGTGGCGATCTCGTCGGCAATCAG
CAAGATACCTTCGCGATCGCATATTTTGCGGATTCGTTTTAACCATTCCGGATGGTACAT
GCGCATCCCGCCTGCGCCCTGGACAATCGGCTCAATGATCACCGCCGCGATTTCATGACG
ATGCGCCGCCATCAGGCGGGCAAAGCCCACCATATCGCGCTCATCCCATTCGCCATCCAT
GCGGCTTTGCGGGGCGGGAGCAAACAGGTTTTCTGGCAGGTAGCCTTTCCACAGACTGTG
CATTGAGTTATCCGGATCGCACACCGACATCGCGCCAAAGGTATCGCCATGATAACCATT
GCGGAAGGTCAGAAAACGCTGGCGCGCTTCGCCTTTGGCTTGCCAGTACTGCAACGCCAT
TTTCATCGCCACTTCCACCGCTACGGAACCGGAGTCCGCGAGAAAAACGCACTCCAGCGG
TTGCGGCGTCATCGCCACCAGTTTGCGGCACAGCTCAATGGCTGGCGCATGGGTGATACC
GCCAAACATCACATGCGACATGGCATCAATTTGCGACTTCATCGCCGCATTAAGCTGCGG
GTGATTGTAGCCGTGGATCGCCGCCCACCAGGACGACATACCGTCAACCAGGCGTCTGCC
GTCAGACAAAATCAGCTCGCAACCTTCGGCGCTCACCACCGGATAAACCGGCAGAGGGGA
GGTCATGGATGTGTATGGGTGCCAGATATGGCGTTGGTCAAAGGCAAGATCGTCCGTTGT
CATAATCGACTTGTAAACCAAATTGAAAAGATTTAGGTTTACAAGTCTACACCGAATTAA
CAACAAAAAACACGTTTTGGAGAAGCCCCATGGCTCACCGCCCACGCTGGACATTGTCGC
AAGTCACAGAATTATTTGAAAAACCGTTGCTGGATCTGCTGTTTGAAGCGCAGCAGGTGC
ATCGCCAGCATTTCGATCCTCGTCAGGTGCAGGTCAGCACGTTGCTGTCGATTAAGACCG
GAGCTTGTCCGGAAGATTGCAAATACTGCCCGCAAAGCTCGCGCTACAAAACCGGGCTGG
AAGCCGAGCGGTTGATGGAAGTTGAACAGGTGCTGGAGTCGGCGCGCAAAGCGAAAGCGG
CAGGATCGACGCGCTTCTGTATGGGCGCGGCGTGGAAGAATCCCCACGAACGCGATATGC
CGTACCTGGAACAAATGGTGCAGGGGGTAAAAGCGATGGGGCTGGAGGCGTGTATGACGC
TGGGCACGTTGAGTGAATCTCAGGCGCAGCGCCTCGCGAACGCCGGGCTGGATTACTACA
ACCACAACCTGGACACCTCGCCGGAGTTTTACGGCAATATCATCACCACACGCACTTATC
AGGAACGCCTCGATACGCTGGAAAAAGTGCGCGATGCCGGGATCAAAGTCTGTTCTGGCG
GCATTGTGGGCTTAGGCGAAACGGTAAAAGATCGCGCCGGATTATTGCTGCAACTGGCAA
ACCTGCCGACGCCGCCGGAAAGCGTGCCAATCAACATGCTGGTGAAGGTGAAAGGCACGC
CGCTTGCCGATAACGATGATGTCGATGCCTTTGATTTTATTCGCACCATTGCGGTCGCGC
GGATCATGATGCCAACCTCTTACGTGCGCCTTTCTGCCGGACGCGAGCAGATGAACGAAC
AGACTCAGGCGATGTGCTTTATGGCAGGCGCAAACTCGATTTTCTACGGTTGCAAACTGC
TGACCACGCCGAATCCGGAAGAAGATAAAGACCTGCAACTGTTCCGCAAACTGGGGCTAA
ATCCGCAGCAAACTGCCGTGCTGGCAGGGGATAACGAACAACAGCAACGTCTTGAACAGG
CGCTGATGACCCCGGACACCGACGAATATTACAACGCGGCAGCATTATGAGCTGGCAGGA
GAAAATCAACGCGGCGCTCGATGCGCGGCGTGCTGCCGATGCCCTGCGTCGCCGTTATCC
GGTGGCGCAAGGAGCCGGACGCTGGCTGGTGGCGGATGATCGCCAGTATCTGAACTTTTC
CAGTAACGATTATTTAGGTTTAAGCCATCATCCGCAAATTATCCGTGCCTGGCAGCAGGG
GGCGGAGCAATTTGGCATCGGTAGCGGCGGCTCCGGTCACGTCAGCGGTTATAGCGTGGT
GCATCAGGCACTGGAAGAAGAGCTGGCCGAGTGGCTTGGCTATTCGCGGGCACTGCTGTT
TATCTCTGGTTTCGCCGCTAATCAGGCAGTTATTGCCGCGATGATGGCGAAAGAGGACCG
TATTGCTGCCGACCGGCTTAGCCATGCCTCATTGCTGGAAGCTGCCAGTTTAAGCCCGTC
GCAGCTTCGCCGTTTTGCTCATAACGATGTCACTCATTTGGCGCGATTGCTTGCTTCCCC
CTGTCCGGGGCAGCAAATGGTGGTGACAGAAGGCGTGTTCAGCATGGACGGCGATAGTGC
GCCACTGGCGGAAATCCAGCAGGTAACGCAACAGCACAATGGCTGGTTGATGGTCGATGA
TGCCCACGGCACGGGCGTTATCGGGGAGCAGGGGCGCGGCAGCTGCTGGCTGCAAAAGGT
AAAACCAGAATTGCTGGTAGTGACTTTTGGCAAAGGATTTGGCGTCAGCGGGGCAGCGGT
GCTTTGCTCCAGTACGGTGGCGGATTATCTGCTGCAATTCGCCCGCCACCTTATCTACAG
CACCAGTATGCCGCCCGCTCAGGCGCAGGCATTACGTGCGTCGCTGGCGGTCATTCGCAG
TGATGAGGGTGATGCACGGCGCGAAAAACTGGCGGCACTCATTACGCGTTTTCGTGCCGG
AGTACAGGATTTGCCGTTTACGCTTGCTGATTCATGCAGCGCCATCCAGCCATTGATTGT
CGGTGATAACAGCCGTGCGTTACAACTGGCAGAAAAACTGCGTCAGCAAGGCTGCTGGGT
CACGGCGATTCGCCCGCCAACCGTACCCGCTGGTACTGCGCGACTGCGCTTAACGCTAAC
CGCTGCGCATGAAATGCAGGATATCGACCGTCTGCTGGAGGTGCTGCATGGCAACGGTTA
ATAAACAAGCCATTGCAGCGGCATTTGGTCGGGCAGCCGCACACTATGAGCAACATGCAG
ATCTACAGCGCCAGAGTGCTGACGCCTTACTGGCAATGCTTCCACAGCGTAAATACACCC
ACGTACTGGACGCGGGTTGTGGACCTGGCTGGATGAGCCGCCACTGGCGGGAACGTCACG
CGCAGGTGACGGCCTTAGATCTCTCGCCGCCAATGCTTGTTCAGGCACGCCAGAAGGATG
CCGCAGACCATTATCTGGCGGGAGATATCGAATCCCTGCCGTTAGCGACTGCGACGTTCG
ATCTTGCATGGAGCAATCTCGCAGTGCAGTGGTGCGGTAATTTATCCACGGCACTCCGCG
AGCTGTATCGGGTGGTGCGCCCCAAAGGCGTGGTCGCGTTTACCACGCTGGTGCAGGGAT
CGTTACCCGAACTGCATCAGGCGTGGCAGGCGGTGGACGAGCGTCCGCATGCTAATCGCT
TTTTACCGCCAGATGAAATCGAACAGTCGCTGAACGGCGTGCATTATCAACATCATATTC
AGCCCATCACGCTGTGGTTTGATGATGCGCTCAGTGCCATGCGTTCGCTGAAAGGCATCG
GTGCCACGCATCTTCATGAAGGGCGCGACCCGCGAATATTAACGCGTTCGCAGTTGCAGC
GATTGCAACTGGCCTGGCCGCAACAGCAGGGGCGATATCCTCTGACGTATCATCTTTTTT
TGGGAGTGATTGCTCGTGAGTAAACGTTATTTTGTCACCGGAACGGATACCGAAGTGGGG
AAAACTGTCGCCAGTTGTGCACTTTTACAAGCCGCAAAGGCAGCAGGCTACCGGACGGCA
GGTTATAAACCGGTCGCCTCTGGCAGCGAAAAGACCCCGGAAGGTTTACGCAATAGCGAC
GCGCTGGCGTTACAGCGCAACAGCAGCCTGCAGCTGGATTACGCAACAGTAAATCCTTAC
ACCTTCGCAGAACCCACTTCGCCGCACATCATCAGCGCGCAAGAGGGCAGACCGATAGAA
TCATTGGTAATGAGCGCCGGATTACGCGCGCTTGAACAACAGGCTGACTGGGTGTTAGTG
GAAGGTGCTGGCGGCTGGTTTACGCCGCTTTCTGACACTTTCACTTTTGCAGATTGGGTA
ACACAGGAACAACTGCCGGTGATACTGGTAGTTGGTGTGAAACTCGGCTGTATTAATCAC
GCGATGTTGACTGCACAGGTAATACAACACGCCGGACTGACTCTGGCGGGTTGGGTGGCG
AACGATGTTACGCCTCCGGGAAAACGTCACGCTGAATATATGACCACGCTCACCCGCATG
ATTCCCGCGCCGCTGCTGGGAGAGATCCCCTGGCTTGCAGAAAATCCAGAAAATGCGGCA
ACCGGAAAGTACATAAACCTTGCCTTGTTGTAGCCATTCTGTATTTGGTTAAATTGCGAG
CGAGATCGCGTCTTCGATTGACTGCAATTTAACCAATTAAATTCTAAAATAATCACGAAA
AAAATTTTACTTCCGCCTCATGCGGCGAATGTGGGAATTGCCCAGGCGGCGGGGGATAGG
GGCTGGAGACAGTTATCCACTATTCCTGTGGATAACCATGTGTATTAGAGTTAGAAAACA
CGAGGCAAGCGAGAGAATACGCGGCTTGCACGCGAATTGGCGTTAAAGACGGCTCAAAGA
AATATCTTTTATTTTTTAACTGGTTAGATAAATGCAATGGCAGTCACTGAACAGGCATCT
CTTGCCATAAAACTGTCATCACTCATCTTGACAAATGTTAAAAAAGCCGTTGCTTTGGGG
ATAACCCGGTAAGGCCGGAGTTTTATCTCGCCACAGAGTAAATTTTGCTCATGATTGACA
GCGGAGTTTACGCTGTATCAGAAATATTATGGTGATGAACTGTTTTTTTATCCAGTATAA
TTTGTTGGCATAATTAAGTACGACGAGTAAAATTACATACCTGCCCGCCCAACTCCTTCA
GGTAGCGACTCATGAGTAAACCGTTCAAACTGAATTCCGCTTTTAAACCTTCTGGCGATC
AGCCAGAGGCGATTCGACGTCTCGAAGAGGGGCTGGAAGATGGCCTGGCGCACCAGACGT
TACTTGGCGTGACTGGCTCAGGGAAAACCTTCACCATTGCCAATGTCATTGCTGACCTTC
AGCGCCCAACCATGGTACTTGCGCCCAACAAAACGCTGGCGGCCCAGCTGTATGGCGAAA
TGAAAGAGTTCTTCCCGGAAAACGCGGTGGAATATTTCGTTTCCTACTACGACTACTATC
AGCCGGAAGCCTATGTACCGAGTTCCGACACTTTCATTGAGAAAGATGCCTCGGTTAACG
AACATATTGAGCAGATGCGTTTGTCCGCCACCAAAGCGATGCTGGAGCGGCGTGATGTGG
TTGTGGTGGCGTCTGTTTCCGCGATTTATGGTCTGGGCGATCCTGATTTATATCTCAAGA
TGATGCTCCATCTCACGGTCGGTATGATTATCGATCAGCGCGCGATTCTGCGCCGACTGG
CGGAGCTGCAATACGCTCGTAATGATCAAGCATTCCAGCGTGGTACTTTCCGCGTTCGTG
GCGAGGTGATAGATATCTTCCCGGCAGAATCGGATGACATTGCACTTCGCGTGGAACTGT
TTGACGAGGAAGTGGAACGATTGTCGTTATTTGACCCGCTGACCGGGCAGATTGTTTCCA
CTATTCCACGTTTTACCATCTACCCGAAAACGCACTACGTCACACCGCGCGAGCGCATCG
TACAGGCGATGGAGGAGATCAAAGAAGAGCTGGCCGCCAGACGCAAAGTGCTGTTGGAAA
ACAACAAACTGCTGGAAGAGCAGCGGCTGACCCAGCGTACCCAGTTTGATCTGGAGATGA
TGAACGAGCTGGGCTACTGTTCGGGGATTGAAAACTACTCGCGCTTCCTCTCCGGTCGTG
GACCGGGTGAGCCACCGCCGACGCTGTTTGATTACCTGCCTGCCGATGGGCTGCTGGTCG
TCGATGAATCTCACGTCACCATTCCACAAATTGGCGGCATGTATCGCGGTGACCGGGCGC
GTAAAGAGACACTGGTGGAGTACGGCTTCCGCCTGCCATCAGCGCTGGATAACCGTCCGC
TTAAGTTTGAAGAGTTCGAAGCATTAGCGCCGCAAACCATCTATGTTTCGGCGACGCCGG
GTAATTACGAGCTGGAAAAATCCGGCGGCGATGTGGTGGATCAGGTGGTGCGTCCAACCG
GATTGCTTGACCCGATTATCGAAGTGCGGCCGGTGGCGACACAGGTTGATGATCTTCTTT
CGGAGATTCGTCAGCGAGCGGCAATTAACGAACGCGTACTGGTCACCACACTGACCAAGC
GGATGGCGGAAGATCTTACCGAATATCTCGAAGAACATGGCGAGCGCGTGCGTTATCTTC
ACTCAGATATCGACACCGTCGAACGTATGGAGATTATCCGCGACTTGCGTCTGGGTGAGT
TCGACGTGCTGGTAGGGATCAACTTACTGCGCGAAGGTCTGGATATGCCGGAAGTGTCGC
TGGTGGCGATCCTCGACGCTGACAAAGAAGGCTTCCTGCGTTCCGAACGTTCGTTGATCC
AGACCATTGGTCGTGCGGCACGTAACGTTAACGGTAAAGCGATTCTCTACGGCGATAAGA
TCACCCCATCAATGGCGAAAGCGATTGGCGAAACCGAACGTCGCCGTGAGAAACAGCAGA
AGTACAACGAGGAACACGGAATTACGCCGCAAGGCTTGAACAAGAAAGTGGTCGATATCC
TGGCGCTGGGGCAGAACATTGCCAAAACCAAAGCGAAGGGCAGAGGAAAATCGCGCCCGA
TTGTTGAGCCGGATAATGTGCCGATGGATATGTCGCCTAAAGCGTTGCAGCAGAAAATCC
ATGAGCTGGAAGGGTTGATGATGCAACACGCGCAGAATCTGGAGTTCGAAGAAGCGGCGC
AAATTCGTGACCAGTTGCATCAGCTGCGTGAGCTGTTTATCGCGGCATCGTAACAGGATA
GCGAAGAAGACTGATGACAAACGGAAAACAGCCTGATGCGCTACGCTTATCAGGCCTACA
TTTTCTCCGCAATATATTGAATTTGCGCGGTTTGTAGGCCGGATAAGGCGTTCACGCCGC
ATCCGGCATAAACAACGCGCACTTTGTCTTCAATAGGAAGCCGGAATTTTCCTTCGGATT
TCCGTTAACCTAAAGCCTGTAACGCCTTTTCCAGCGCGTTATGTAACAACTGGCGGTCAT
GACGATACGGAATATCGCTGGCCTCCAGTACCTCCTGGATCACAATCCGCTCTTTCACCG
CCGAGACATCCACTTTTGGCCCGACGATGACCGCATCAATGACCTTTTTACCAACATACT
GCTCCATAATTGCCAGCTTGCTTTCCAGCTTCAAATTAGCCGCAGGTAAACTCAACTCAC
GCCCCAGATTGCCGATATAAACCATCGGCGCTGGCGTGCGGCGTAATGCCTGGGCGATTT
CCTTCAGCAGCAGAATTGGCATCAGGCTGGTATAAAAACTGCCAGGCCCAATAATGATGA
GATCCGCTTCATTGATAGCGTGAACCGCCTCACGCGTTGCGGGTACATTAGGCGTTAACA
ATAACTCTTGAATCGGCGTAGTTAACTGGTCGATATTGACCTCGCCGTAAACTTCATGCC
CCTGATCGTCAATCGCCATCAGATCAACAGGATGCTCTGACATTGGAATCAAATGCGTAT
CCACTTTCAGCAGATTACGAATTAAATTGATGGCTTCCAGAGGCCGCACGCTAAGGTGAT
CCAGCGCCTTTAACATCAAGTTTCCGAGATTATGACCGGAAAGTTCGCCATTGCCACCAA
AACGGTATTCAAACATCGCGGAGGCGACGCTCGGTTCCGTTATCAGCTGGTTGAGGCAGT
TGCGCATATCGCCCCAGGCAATGCCGCCTTCTGAACGGCGAATACGCCCCGTCGAGCCAC
CATTATCGGTGGTGGTGACGATACCCGTTAAACGAGAACCCAAAGACGAAAGTGATGAGA
GAACGCGTCCCAGTCCATGCCCTCCGCCGAGAGCAACGACACGATCAAGATCAGCCAGCG
TACGATTGCGCATATAGTTTCCTGGAGTCAGATTATCCGCGCTACAGTAGCGCAAATTGC
GGGGAAACAGCAATTAACCTGCCAATATTGAGGATACAAACTATTTTCTTCTACCTCTAA
AGGACGATGCACGCTATGCCTCCCTGATGATGTATATCAAAGTAAAACCGCCATTTTCCC
TTATTCTGTAGCGAAATAGCACGATCATGACGCTATATACATGATTACATAGCGAAAGTG
TGGATGGTAAAAATCTCATTTACACGCTAGTATCGGCATAACCACTAAACACTCTAGCCT
CTGCACCTGGGTCAACTGATACGGTGCTTTGGCCGTGACAATGCTCGTAAAGATTGCCAC
CAGGGCGAAGGAAGAAATGACTTCGCCTCCCGTATCTGGAAAGGTGTACATGGCTTCACA
ACTGACTGATGCATTTGCGCGTAAGTTTTACTACTTGCGCCTGTCGATTACCGATGTGTG
TAACTTTCGTTGCACCTACTGCCTGCCGGATGGCTACAAACCGAGCGGCGTCACCAATAA
AGGCTTTCTTACCGTCGATGAAATTCGCCGGGTTACGCGCGCCTTCGCCAGACTGGGCAC
CGAAAAAGTGCGCCTGACAGGAGGAGAGCCGTCTTTACGCCGCGACTTTACCGATATCAT
CGCCGCTGTGCGGGAAAACGACGCTATCCGCCAGATTGCGGTCACAACCAATGGTTACCG
TCTGGAACGCGATGTGGCGAGCTGGCGCGATGCGGGACTTACTGGCATTAACGTCAGTGT
CGACAGTCTGGACGCCCGCCAGTTTCACGCTATTACCGGGCAGGATAAATTCAACCAGGT
CATGGCAGGGATTGATGCTGCATTTGAGGCCGGTTTTGAGAAGGTCAAAGTCAATACCGT
GCTGATGCGTGATGTTAATCATCACCAGCTCGACACCTTTCTGAACTGGATCCAGCATCG
CCCTATCCAGCTGCGTTTCATCGAACTGATGGAAACGGGCGAGGGCAGCGAGCTCTTCCG
TAAGCATCACATCTCTGGTCAGGTTCTGCGTGACGAGCTACTGCGTCGCGGCTGGATCCA
CCAATTACGTCAACGCAGCGACGGTCCCGCGCAAGTCTTTTGCCATCCAGATTACGCCGG
AGAGATTGGCCTTATCATGCCGTATGAAAAAGACTTCTGCGCCACTTGCAACCGCCTGCG
CGTTTCCTCCATTGGTAAACTCCATCTCTGCCTGTTTGGTGAAGGCGGCGTTAACCTGCG
CGATCTGCTGGAAGACGATACCCAGCAACAGGCGCTGGAAGCGCGTATTTCAGCGGCGCT
GCGGGAGAAGAAACAGACCCATTTCCTGCATCAAAACAACACCGGTATTACGCAAAACTT
ATCGTACATTGGCGGCTAAAACGTCAAAAGGAGAGATCAGATGAGTCAGGTAAGCACTGA
ATTTATCCCGACCCGTATTGCTATTCTTACGGTTTCTAATCGTCGCGGTGAAGAAGACGA
TACCTCCGGTCACTATCTGCGCGATTCGGCGCAAGAAGCGGGCCATCACGTTGTCGATAA
AGCCATTGTGAAAGAAAACCGCTACGCTATTCGCGCTCAGGTATCTGCGTGGATCGCCAG
CGACGATGTACAAGTGGTATTGATTACGGGTGGTACTGGCCTGACGGAAGGTGATCAGGC
TCCCGAAGCATTGCTGCCGTTGTTCGACCGTGAAGTTGAAGGTTTTGGTGAAGTGTTCCG
GATGTTGTCGTTTGAAGAGATTGGCACTTCCACGTTGCAATCTCGTGCGGTAGCGGGCGT
CGCCAACAAAACGCTGATTTTCGCCATGCCGGGTTCGACCAAAGCGTGCCGTACCGCATG
GGAAAATATCATCGCGCCGCAGCTGGATGCCCGTACGCGTCCGTGTAATTTCCATCCACA
TTTGAAGAAATAAGTATGTCGCAACTGACCCATATCAACGCCGCTGGCGAAGCGCACATG
GTGGATGTCTCCGCCAAAGCGGAAACCGTGCGTGAAGCGCGGGCGGAAGCCTTTGTCACC
ATGCGCAGCGAGACGCTGGCGATGATTATTGATGGTCGCCACCACAAAGGCGACGTATTT
GCCACTGCGCGTATTGCCGGTATTCAGGCGGCAAAACGCACCTGGGATCTGATCCCGCTC
TGTCATCCGCTGATGCTCAGCAAAGTTGAAGTCAATTTACAGGCCGAGCCGGAGCACAAT
CGGGTGCGTATAGAAACCTTATGCCGCCTGACCGGGAAAACCGGTGTCGAAATGGAAGCA
TTAACCGCGGCCTCCGTGGCGGCGCTGACCATTTATGACATGTGCAAAGCGGTGCAAAAA
GATATGGTGATTGGTCCGGTACGTTTGCTGGCGAAGAGCGGCGGCAAGTCGGGTGACTTT
AAGGTGGAAGCGGATGATTAAAGTTCTTTTTTTCGCCCAGGTGCGCGAGTTGGTGGGAAC
AGATGCAACCGAAGTGGCTGCGGATTTCCCAACTGTTGAAGCGTTACGCCAGCACATGGC
TGCGCAGAGCGATCGCTGGGCGCTGGCGCTGGAAGATGGCAAATTACTGGCTGCCGTCAA
CCAGACGCTGGTGAGTTTTGACCATCCGCTGACTGACGGCGACGAAGTAGCTTTCTTCCC
GCCGGTAACCGGAGGTTAAGATGGCAGAAACCAAAATTGTTGTTGGTCCGCAGCCGTTCA
GCGTAGGAGAAGAGTACCCGTGGCTGGCGGAGCGTGACGAAGACGGTGCGGTAGTCACCT
TTACTGGTAAGGTGCGCAACCATAACCTGGGCGACAGCGTCAACGCATTAACCCTCGAAC
ACTATCCGGGGATGACTGAAAAAGCACTGGCAGAAATTGTTGATGAAGCGCGTAACCGCT
GGCCGCTGGGGCGCGTCACTGTGATTCACCGCATCGGGGAATTATGGCCGGGCGATGAAA
TCGTTTTTGTCGGTGTCACCAGTGCGCATCGCAGCAGTGCGTTTGAAGCCGGGCAGTTTA
TTATGGATTATCTCAAAACCCGCGCACCGTTCTGGAAGCGCGAAGCCACGCCGGAAGGCG
ACCGCTGGGTTGAAGCTCGGGAGAGCGATCAGCAGGCGGCAAAACGCTGGTAGTTTTTTG
TTAGCCGGATAAGGCACCGCTGCGTCCGGCAATTTCACCGCTCAGTACATACGTTTACGC
TGCGTCGATGCACAGCCTCATCATTTTGCAGTATCCTTAAGATATTCCTTATATCTTCAG
GAGATCGTCATGGACAGATTCCCACGTTCTGATTCAATCGTACAACCCCGGGCTGGCTTG
CAAACTTATATGGCTCAAGTCTATGGCTGGATGACCGTTGGCTTGTTGCTGACCGCATTT
GTTGCCTGGTATGCGGCTAATTCCGCGGCCGTGATGGAGCTGTTGTTCACTAACCGTGTC
TTTTTAATCGGTCTGATCATCGCGCAATTAGCATTGGTTATTGTGTTATCAGCGATGATT
CAAAAGCTGAGCGCAGGTGTAACGACGATGCTCTTTATGCTTTATTCGGCGCTGACGGGT
CTTACGCTTTCCAGTATATTCATTGTCTATACCGCTGCTTCTATCGCCAGTACTTTCGTC
GTTACTGCCGGGATGTTCGGCGCAATGAGCCTGTACGGTTACACCACGAAGCGCGATTTA
AGTGGCTTTGGCAATATGCTGTTTATGGCGTTAATCGGCATTGTGCTGGCATCGCTGGTC
AACTTCTGGTTGAAAAGCGAAGCATTGATGTGGGCAGTTACCTACATCGGCGTGATTGTC
TTTGTCGGATTGACGGCGTATGACACGCAGAAACTGAAAAATATGGGTGAGCAGATTGAT
ACCCGCGACACGTCGAACCTGCGCAAATATTCCATTCTTGGCGCGTTAACCTTGTATCTG
GACTTCATCAACCTGTTCCTGATGTTGTTGCGGATCTTCGGCAACCGCCGTTAATTCTTT
TTCACCATCACTATCCCGGCCATGTGTCGGGATTTTTTTCTTACTAAAAACGACACTTAA
CAAGTACCAGGTATAAAATATGCCTTATGGACGAGCGGAAGCGTTTTCTGTATCCATAAA
TGCAAAAGTATTTTGTATGCGTGGTTTTAAATTTATTGATGGTGAATATTAATATTTTTT
CTAAGGATAACTAAAAGAATGGAATCATACTCGCAAAACAGCAATAAATTAGATTTTCAG
CACGAGGCCAGGATATTAAACGGTATATGGCTCATTACCGCTTTAGGTTTGGTGGCAACC
GCAGGACTAGCCTGGGGAGCTAAGTATATCGAAATTACGGCAACCAAATATGATTCACCA
CCAATGTATGTCGCCATAGGGTTATTATTACTTTGTATGTATGGCTTAAGTAAGGATATC
AACAAGATAAATGCCGCCATCGCGGGCGTAATATATCTGTTTTTACTCTCTTTGGTGGCG
ATTGTCGTTGCAAGTTTAGTTCCTGTATATGCCATTATCATCGTGTTCAGCACTGCGGGC
GCGATGTTTTTAATCAGTATGCTGGCCGGTTTATTATTTAATGTTGATCCTGGTTCTCAC
CGTTTTATCATTATGATGACGTTGACAGGGTTGGCCCTGGTAATCATCGTGAATGCGGCA
TTAATGAGTGAACGGCCCATTTGGATAATAAGTTGCTTAATGATTGTGTTATGGTCAGGC
ATTATCTCGCATGGACGAAATAAGCTCCTTGAATTGGCGGGGAAATGCCATAGTGAAGAG
TTGTGGAGTCCGGTTCGTTGCGCTTTTACAGGTGCATTAACACTCTATTACTATTTTATC
GGCTTCTTTGGGATACTTGCCGCGATAGCTATAACGCTTGTCTGGCAAAGGCATACGCGT
TTTTTTCATTAGCCGTAAATGCACATACTAAAGAACTTAACTAAACTTCACATCGCCGCT
TCATTTTTCGCCCGTAGCTTCTTCGCCTGGCTTTCCAGCAACAGGTAACAGATCAGCGCC
AGCAGCAGTGGGATAAAGTAATACAGCACACGGTAAGCGAGTAGGGCGGCGATAATTGTA
CCTTTGGAGGTATGCTCCCCAGCCAGTAGTGCGATAAACACCGCTTCCAGCACACCGATC
CCCGCCGGAATATGCACGATGACGCCAGCAATACTACTAACCAGTAACACGCCCAGTACA
AAGAAATAGTTCACGCTTTGACCAAGTAACAGCCAGATAATCGCCCCCATTACCATCCAG
TTAACGCTGGAAATCAGCATCTGAGCGAGGGCGAATTTCCATGAAGGCAGCACCAGCTTT
TGCCCTTTGATGGTCATATGGCGGTGCTTCGCGAAAGCGCAAAACCACAAATAAACCGCG
ATAATCATCAGTAAGCCAATGCCGAGAATACGCAGCGTAGTTTGATCGACATACCAGTGA
TCCGGCAACTCCACCACGCCTGCGGTAAAGATAATCCCTGCCAGTAAAATGTAGCCCAGC
CAGTTGGTGGTAATACTGAGCGAGAAAATCCGCGTAATAGTGCTACCGGGCAACCCCAGA
CGAGAGTACAAACGATAGCGCATACCAATGCCGCCGACCCAGGTACTGAGCGTCAGGTTG
AAGGCGTAGCAGATAAACGACACCAGCATCACCTGGCGCTTCGCCAGTTTGTGACCGCAG
TAAAAGCGGGCGAGCAGGTCATAGCAGCCGTAAATCAGATAGCTGACGACCACCAGCCCG
ACCGCACTAAGCAGCGCAACGCGATTGTAGTCGCGGATGACCTTCCAGACCTCTTCCCAG
TCCACTTTTTTGGCGTAGACCACCAGCAACACAATCACCGCGATAAAAAACAGCCAGGTG
AGGATCTTCTTTGCTAAGCGCCAGCGCGGGTGTGATTTACTCATCAGGGTTTTACCCCCG
TGTTTTCAGTTTCTACCCGATCCTGCGTTTCCATTGTCGGTTGTGCGGGCGGATCAACCT
GCGCCAGACGTGGCGTGTGTGCCGGAAGCCAGCCAACCAGCGCCGGGAAGTGGCGTAAAA
AGTGGAACGCCAGCACGCTTTTGGTCAGGTTCCACCAGGTGCGTTTGGGCAGCATGGTTT
CATCCACCTGCTGACAATCTGCGGCAATAATGCCGTTCAGATTATCGCGCAGCGTCTGGT
TAAAATGACGATCGTGGATGATGACATTTGCTTCGAGATTCAGTGACAAACTGAGCGGAT
CGAGATTACTGGACCCTACTGTCGCCCAGTGATCGTCCATCAATGCCACTTTGCCGTGGA
GCGGGCGGCGGCGGTACTCAAAAACCTGAACGCCGCCTTTAACCAGATAGTTATACAGCA
AGCGCGCACCGACTCTGACAATCGGCATATCCGGTTCGCCCTGAATGATCAGTTTGATCC
GCACCCCGCGCCGTGCCGCTTTACGCAAGGCGTGTAAAAATCGATAGCCGGGGAAGAAGT
AGGCGTTGGCGATAATCACTTCCCGCCGCGCCTGAGTGAGCATTTTCAAATAATGGCGTT
CAATATCATCGCGATGTTCTTCGTTATCGCGCCAGACCAGCAATACCTGCGCTTCTCCCG
GCTGGCGGTTCTCTTCCGCTTTGTGATGACGTCGCCACCAGCGTCGTGCCGCGCTCTGTC
CAGGCAGGTTTTCCAGCTCAAACTGGAGAATATCTTCGACAATCGGCCCTTCAAGGCGTA
CCGCGTAATCCTGTTTAGCCTCTGGACCGTAGCTGGACATATGCTCGGCGGAGTAATTCA
GCCCGCCAATAAAGGCTATACGCGCGTCGATCACCACAATTTTGCGATGCATCCGGCGAA
ACACATTGGTGCGCATACCAAAAAGGCGAGGGCGGGGATCGTAGTAGCGGAACACTACGC
CAGCTGCCGTCAGTTCATTGACAAACTCATCGCTGAGATCCGGCGAACCGTAGCCATCCA
GCAAGACTTCCGCTTTAACCCCGCGTTGCGCTGCTGCCAGTAGTGCCGCATGCAGTTGTT
TGCCGACGTCATCCTCAAACCAGATAAACGTTTCAAGAATGATGCGTTCTTGTGCCTCGC
CAATCGCCTTAAACACCGCGGGATAATATTGCTCGCCGTTTTCCAGCAACTGGATCTTAT
TGCCTTCGCGCCAGCTACATTTCATAAATGAATCTCCGCACTTAAAGGGGCATGATCAGA
AAGGTGTCGCCATGTCCGCAGCGGCAACGCGGTTGGCGCGCTGGCGCTGGCATTTTTGAC
GTAGATCCTGTCCAGTCGTAGTAGAGGAAATTGCACCGGAAACGTGCGCGCCGGGCGTCC
GTGGGCGCGGGTAAAAATCTCATCCAGTCCGGCCTGCACTTTTAACGGATGATTAGCTTT
TTGCCGCCAGTCATTGAAATCACCCGCCACCAATACCGGTTCGCCGTCCGGTAGCTCATT
CACCCATTCGGCGAGCATCGCAAGCTGCGCCTGACGGTGCGCCTCACGCAGGCCCAGATG
TACGCACATCACATGAATCGCTTTTCCGGTCATCGGCGGCACAATGCGGCAGTAGAGCAC
GCCGCGCTTTTCCGCACCATCGACCGAAACATCGCGATTCTCATAATGTTCAATGGGATA
ACGCGACAGTACGGCGTTGCCGTGATGCCCTTCCGGGTATACGGCATTGCGACCGTAGGC
AAAATCGCTCCACATAGTGTCGGCGAGAAACTCGTAGTGCGAGGTATCGGGCCAGTTTTC
CACATGCAGCGGATGAACTTCGTGCGCGCCCATCACTTCCTGCAGGCAAACAATATCGGC
GCTGACGGTACGCACGGCGTCGCGAAGTTCCGGCAAAATGAAGCGTCGGTTAAACGCGGT
AAAGCCTTTGTGAATATTGATGGTGAGCACCTTGAACGAAAATTGTTGTGTTTGATCGGG
CATAATTTTCCTGTCTTTGCCTCTTATCTCATTGAAATAGTGTAGTCGGCGTCACAAAAA
GGTGCGGTCTTACGGAATTTTCCGTAAAGTTCGGTACTCTGAGTAAGTAGAGATAAATTC
TTCAGGAGAGAAGCCATGAAGTGGCAACAACGTGTTCGTGTCGCAACGGGTCTAAGTTGC
TGGCAGATTATGTTGCATTTACTGGTAGTGGCGCTGCTGGTGGTGGGCTGGATGAGTAAG
ACTCTGGTTCACGTCGGCGTGGGATTATGCGCACTGTATTGTGTCACGGTAGTGATGATG
CTGGTGTTTCAGCGCCACCCCGAGCAACGCTGGCGTGAGGTGGCAGACGTGCTGGAAGAG
CTGACCACGACCTGGTATTTTGGCGCAGCGCTGATTGTGCTGTGGCTGTTGTCCCGCGTT
CTGGAAAACAACTTTTTGCTGGCAATTGCAGGGCTGGCAATCCTTGCCGGCCCGGCGGTA
GTGTCTTTGCTGGCGAAAGATAAGAAGTTACATCACCTTACGTCTAAACATCGCGTACGC
CGCTGACCCTGTCGTGGCCGTTATCACCAGTAGCGGCCACAAACTATTCCACACAATATC
CAGACTCGCATCCTTCAAATAAATCTGCTTGGTAATGTCCGTAAAGTGGCGAATAGGGTT
AATCCACGTCAGGTTTTGCAGCCATACCGGCATGTTTTCCACCGGAGAAACGTAACCGGA
AAGGAGAATGGCGGGCATCATAAAGACAAACACGCCGATAAACGCCTGCTGTTGTGTTGA
ACAGAGTGATGAAATCAACAGACCGAATCCCACCAGCGATAAACCATAAATCACCATCGT
AAAGTAGAACAGCGCCAGCGATCCGGCGAAGGGGATTTGATACGCCCAGATACCAATCGC
CAGCACAATGGTGGCCTGGAAGGTGGCGACAATTAACGCCGGTACGGCTTTGCCGATGAA
GATCTGCCAGGTGGTGAGCGGCGAAACCAGTAGCTGATCGAGCGTACCTTGTTCACGTTC
GCGGGCGACGGAAAGTGAAGTGACGATCATTACGCCGATAGTGGTGATCATGGCGATCAG
TGACGGCACCACAAACCATTTGTAGTCGAGATTCGGGTTATACCAGTTGCGTACCACCAG
CTCGCTGTTGTTAGGTTTCGGTTTTCCTTCCAGCAGCTCCTGCTGATAATTTTTGACGAT
CTGTTGCAGGTAGTTGGCGGCAATTTGCGCACTGTTGGAGTTACGCCCGTCGAGGATCAA
CTGCAAAGGCGCGGTCTGGAAGGTATCCAGTTTGCGCGAGAAGTCAGCCGGGAAACGCAC
CAGTAGTAACGCCTTTTGTGTGTCGATGGTTGGGCGGATCTCCTGTGGGCTTTTCAGCAG
CAGCACATGAGTAAAGGCGCTGGCGCGGGCAAAACGTTGGGTCAGCTCCACCGAATGCTC
GCCGTTATCTTCATCGTAGATGGCGATGGTGGCGTTAGTCACTTCCAGCGTGGCGGCGAA
CGGGAACAGGATCACCTGAATTAGCACGGGTAAAATCAGAATCGCGCGGGTTTGCGGTTC
GCGCAGCAACGACTGCAACTCTTTGCGGATTAACGTCCATAAGCGATGAAACATGCTCTT
CTCCCTAATCCAGCCGACGTTTGGTTTTCAGCCACGTCAGGCCGATAAACATCACCGCCG
AAGCGATCAAAAACAGCACGTTTACCACCAGCACCACTGGAATATTCCCGGCGAGGAACA
GGCTTTGCAGGGTGCTGACGAAATAACGAGCGGGAATAATGTACGTCACCGCGCGGATCA
CCGCGGGCATACTGTCGATCTGAAAAATAAAGCCGGAAAGCATAATCGACGGCAGAAAAG
CGGCGTTCAGGGCGACCTGAGCGGCATTGAACTGGTTGCGGGTAATCGTGGAAATCAGCA
GCCCCATCCCCAGGGTACTGAGTAAAAACAGGCTGGAGATAAAAAACAGAATCAGCAGCG
ACCCGCGATACGGCACGCCGAGAATAAACACTGACACCAGCATACACAGCAACATCGCCA
GCATCCCGAGAAAGTAATAAGGGATCAGCTTACACAGCAGCAGTTCCGTGCGGGTAATCT
CCGTAGAGAGCAGAGCCTCCATGGTGCCGCGTTCCCATTCTCGCGCCACCACCAGCGAGG
TGAGAATCGCGCCGATGACCGTCATGATAATGGTCACCGCACCGGGGATAATGAAGTGCT
GGCTAATCGCCGCCGGGTTAAACCAGTAGCGGGTTTGTACATCAATAAGCGGTTCAAAAG
TCTGCCCGTTGTCCTCCGCTCGCTGCATTTGCCAGATCTGCCAGATCCCTTCGACATACC
CCTGTACAAAGTTAGCGGTATTCGGCTCACTGCCGTCGGTGATCACCTGAATCGGTGCGG
TGGCGTTGGCGCGCTCCATCTGTTCCGCAAAATCCACCGGAATAACCACCAGACCGCGAA
TTTTCCCCGCCTGCATTTTGGCGATCAGTTCCTGACGGTTATCGCTGATGGTGGCGTCGA
TGTAGGGCGAACCGGTCATGGTGTGGGTGAAATCCAGCGCCGCTTCGCTACGCTGTTCCA
GTAAAATCCCGACCCGCAGCTTGCTGGAGTCGAGGTTAATGCCGTAACCAAAAATAAACA
GCAGTAGCAGCGGGATCACTACCGCAATCAGCCAGCTACTCGGATCGCGAACGATCTGCC
GCGTCTCTTTAACGCACAGCGCCCGTACGCGACGCCAGGACAGGATCGGGTTACTCATTG
CTATGCTCCTTATCCCAGTCGTGGATCAACTGAATAAAGGCTTGCTCCATGGTGGGATCG
GGTTGCTCATCGTTAGCCGACTGTGCTTTCAAATCGTCCGGCGTGCCGCTGGCGATTAAT
TTCCCGCGGTACACCAGGCCGATGCGGTCGCAATATTCCGCTTCATCCATAAAGTGGGTG
GTGACCATCACCGTGACGCCTTTCTCTACCATGCTGTTGATGTGCAGCCAAAATTCACGG
CGGGTGAGGGGGTCAACGCCGGAAGTCGGTTCGTCGAGAAACAGAATGTCCGGTTCATGC
ATCAGCGAACAGGCCAGCGCCAGCCGCTGTTTAAAACCTAATGGCAGTTCATCGGTGGCG
TGGGAGGCGATACTTTTCAGGCCGAACGCCTCGCTCATGCGGGAGATTTTTTCGTTCTGC
GCCCGACCGCGTAAGCCATACACACCAGAGAAAAAGCGTAAATTCTGTTCGACCGTCAGG
TTACCGTAGAGCGAAAATTTTTGCGCCATATAGCCGAGATGCTGGCGCGCTTTACCGGAA
CTCTCTTTCAGATCCATCCCCAGCACCAGCGCCTGGCCGGAAGTCGGCACCAGCAAACCG
CACATCATCTTAAAGGTGGTCGATTTACCCGCGCCGTTTGGCCCCAGCAAACCAAAAATC
TCCCCACGTTTAACGGCAAAGTTGACGTGATCGGTGGCGGCAAAATCCCCAAATTTCTTG
GTCAGTTCTTTCGCTTCGATCACCGTCTCGCCGGGTGTGCCTTCTACCGTATGTAATATT
GCGCCCAGCGGCGATTCCGAGGTTCCGGCACCGCCCAGCAAATCAATAAACGCATCTTCA
AAACGCGGCGTAGTTTCGTTGATGTTGATTTCCGGCATCCCGTCGGCATGGCGAATATCG
TCTGGTGTGGCCTCTTTTTTGAGGATCAGACGTACCGATTTCCCCTGAATCATGCCGTCG
CTGACCTGCGGCAGTTTCAAGGCGCGTTGCAACAGTTTGCGGTTGCCCTCGTGTGGACTG
GTCATCAGAAAGCTGCGTCCGGCCATGGTTTGTGTCAGGGCTTTTGGTTCTCCCTGATAC
AGCAACTCGCCTTCGTTCATCAGTAACACGTCACGGCACTGCTCGGCTTCGTCGAGATAC
GAGGTACTCCAGAGGATTAACATCCCTTCGCCCGCCAGCTCATGCACCATCTGCCACAGT
TCGCGCCGTGAGATAGGGTCAACGCCGACGCCGGGTTCATCGAGCAGCAACACTTTCGGT
TCGCCCACCAGGGTACAGGCCAGACCGAGTTTTTGTTTCATCCCACCGGAGAGCTTGCCC
GCCAGGCGTCCGGTAAACGGCCCAAGAGACGTAAACTCCAGCAGGCGAGCAAAAGTTTGC
TTACGTGCCTCGCCGGTGACGCTGCGCAAATCCGCGTACAGATTGAGGTTCTCCATCACC
GTGAGATCTTCATACAGACCAAATTTCTGCGGCATATAACCGAGCACGGCGTGCAGCGCG
CCGTCGTTTTTGATCGGATCAAAGCCAATCACCGTGGCACTGCCGCTGTCGGGTTTCAGT
AATCCCGCCAACATCCGCATCAGCGTGGTTTTACCTGCACCGTCCGGCCCCACCAACCCC
GTCACATAACCGGCGTGAATGGTACAATCGAGCGGCGCGACGGCGGGCTTGTCCATGCCC
GGAAAGCGTTTTTCCAGGCCGTTCAGCGTGATAACGGCATCATTCATGTCCTGCCTCGTC
ACCGAATTGTACCGTCACTGGCATTCCCTGGCGTAACGCATCATCGGCGTCGGTCACCAC
AATACGCAGGCGATAGACGAGGTCGGTACGCAGATCCGGCGTTTCGACGGTTTTCGGGGT
AAATTCAGCAGTCGGCGAAACGAAACCAATCTGCCCGTGATACGGCTTGTCCGGGCGACC
ATCGGTATAAAGCAGCACTTTGCGCCCCGGCTGGGCCTGGTCAAGATTACGTTCATCAAC
ATAAGCGCGCACCCACACCGGACGCGTTAGTGAAACGGTAAACACCGTGCCACCTTCATT
GAGGACCGTGCCTGGCTCCACCGCGCGCGTTAACAGCGTGCCATCAGACGGGGCTATCAA
CGTTGAGTCCTGTAAATTCAACTCCGCCTGCGCCAGTTGCGCCTGCGCCTGTTCGAGGCT
GGCTTTCGCCTGAGCGATGTCCTGTTCACGGTTACCGGAACGGTACTGACGCAATTTATC
CTGTGCTGATTTCAGCGTTGCCTGCGCCTGGTCGCGCGAGGAGCGGGCATTTTCCAGGTC
ATTTGCCGAAATAGTGCGGCTTTTCCACAACCCTTGCTGGCGGTTATAGAAGTTCTGCGC
ATAGTCATAGGCGGCTTGCGCCTGTTTCACCGCTGCGGCGGCCTGAGCGATTTCTTCATT
GCGATACCCGGCAAGCATCAGGTCATACTGCGCCTGTGCCACCGAAACACCCGCTTTCGC
CTGCATCAGGGCAATCTCATACGGCTTGTGATCCAGTTCGCCCAGCACCTGGCCCGCTTT
GATAGCATCACCTTCGTCCACCGCCAGCGATTCAACGCGCCCCCCAACACGGAAACTAAG
ATTTACCGTACGAATATCCACGTTGCCATACAGCGTCAGGCCGTTATCCTGGCGGCTTTG
ATACCACCAGTAGCCTCCGGCAACCACGGCGGCAAGTACCACTACCGCCAATCCGATCAC
GACAGGTTTTTTCATCACTACAAACTCCTTTGCGATAATCCTTGCAAAATCAGGTCGATA
TGACAGGTCACCGTCTGGTTGATCAGTTCGGTCTTTTCTTCATCGAACGCGGTCCAGCCG
GTACGTAACAGAATTGTTTCTTTGCCAAGACGGAACGCCAGAATCTCACCAATCAACGCA
TGGGTATGAAGGATCATGCGGGTGTCATTGGCGTCGCAGCCGGTCCAGGCGGCAATCAGG
CGTGTCAGGTGGCTGTGTAGCGGACTAATCACCTGTTCGTGCACCAGGTGGTAGGCTGCC
GTGGGAGAGAGCTGCTCACGGGAGATAAACTTGCTGAGGTTGACGGTGTCATCCTGGGTG
AGCAGCTTAATCATGTTCCTGCAGGCGCGAAGGATCAGTTCACGGATGGCAGCCCGATCA
GGCTGTGGTTGCGCGAACAAGCGTTCGGCTTCCTCGGCATGCGGACGGAACTGCTCGCCA
ATAAAATCGGCAATCCACTGGGCGCAGGCGAGGTACAAATCTTCTTTCGAACCGAAGTAG
TAGGTGATGGCAGCGATATTCTGCCCGGCCTGGGCGGCTATCTCGCGAGTGGTGGCGTTC
ATTCCATATTCACCAAACTGCGCCAGTGCGGCAGCAATCAGCTGTTTTTTCGCCTGTTCA
CCCTTGATTGTCATGGCAGGATTATTCATCGCACAGTCCATTCTTAATCAAATGATTGAT
TAAGATTATGACTCCATAGGGGAGTTGTCCAGTATGGCTAAGAATTTTAGCAACGCCAGT
CACAGGGATAATTTATGCGCTGCGTCACAAAAACTGCTACACTCCGCTCCCTCATGACAT
TGTGGTTTTTGTCATTTTCCTTTTCAGTATCTCCCTGAAAACTACACCGGTAACGGTCGG
GGCGGTTCGGAGTAGTTATGTCTTTCGATTCTTTGGGTTTAAGCCCTGATATCCTGCGCG
CCGTTGCCGAGCAGGGTTACCGTGAACCCACCCCTATTCAGCAGCAGGCGATCCCTGCGG
TGCTGGAAGGCCGCGACCTGATGGCTAGCGCCCAGACCGGCACCGGCAAAACAGCGGGCT
TTACGCTGCCGCTGTTGCAACACCTGATCACTCGCCAGCCGCACGCCAAAGGGCGTCGTC
CGGTACGTGCGCTCATTCTTACCCCGACCCGTGAACTGGCGGCGCAGATTGGCGAAAACG
TCCGTGATTACAGCAAATACCTGAACATTCGTTCGCTGGTGGTGTTTGGTGGTGTGAGTA
TTAACCCGCAGATGATGAAACTGCGTGGCGGCGTTGATGTGCTGGTGGCAACCCCGGGAC
GTTTGCTGGACCTGGAACATCAGAATGCAGTGAAGCTGGATCAGGTTGAAATCCTCGTCC
TCGATGAAGCTGACCGCATGCTCGACATGGGCTTTATCCACGATATCCGTCGCGTGTTAA
CAAAACTACCTGCGAAGCGCCAGAACCTGTTATTCTCCGCGACCTTCTCTGACGATATTA
AAGCCCTGGCGGAAAAACTGTTGCACAACCCGCTGGAAATCGAAGTGGCACGCCGCAATA
CCGCGTCTGATCAGGTGACCCAGCACGTTCACTTTGTCGATAAGAAACGCAAACGCGAAT
TGCTGTCGCACATGATTGGGAAAGGGAACTGGCAGCAGGTGCTGGTGTTTACCCGTACCA
AACACGGCGCTAACCATCTGGCTGAACAGCTCAATAAAGATGGCATCCGTAGTGCGGCGA
TCCACGGCAATAAATCGCAAGGTGCGCGTACTCGTGCGCTGGCTGATTTTAAATCGGGCG
ATATTCGTGTACTGGTGGCAACTGACATCGCTGCGCGCGGCCTGGATATTGAAGAGCTGC
CGCACGTCGTCAACTATGAACTGCCAAACGTACCTGAAGATTATGTCCACCGTATCGGGC
GTACCGGTCGTGCGGCTGCTACCGGTGAAGCGTTGTCGCTGGTGTGTGTTGATGAACACA
AACTGCTGCGTGATATCGAAAAACTGCTGAAAAAAGAGATCCCGCGCATTGCGATTCCGG
GCTATGAGCCGGACCCGTCAATCAAAGCCGAACCGATCCAGAACGGTCGCCAGCAACGTG
GCGGCGGCGGTCGTGGGCAAGGTGGTGGTCGCGGTCAACAGCAACCACGCCGTGGGGAAG
GTGGCGCAAAATCTGCAAGCGCGAAACCTGCAGAAAAACCGTCTCGCCGCCTCGGCGATG
CCAAACCGGCAGGCGAACAACAACGTCGCCGCCGTCCGCGTAAACCTGCCGCTGCGCAGT
AATCTTTTATGCCGGGCTATGCCCGGCATCAGGCTGATGAACAAACGCAAAACTGCCTGA
TGCGCTACGCTTATCAGGCCTACGTGAACTCTGCAATATATTGAATTTGCATGCTTTTGT
AGGCCGGATAAGGCGTTTACGCCGCATCCGGCATTTCACAACAAGCACTTGTCAGCAATT
TGAGAACACGGGAAAAAATTTATCTGTTTTACCGCCCATAAGCCACCGAGACGTTACTTC
TCTATAGCCAATTGTTCGCGCAACTCCATTAAAAGGTAGCCCAGTCGATTCTTGCCCTTA
CCATGACCACCGTCTCCCCAGTAAGCATCGTTTTCCGTATGCTCAACCAGTTTTGCGGGC
GCGGTTGCCAGCAAGAGCGCACGCAGTTCTGCATGCTGTTCGAATTTAGCGCGAAGTGCT
TTTCGCATCACCTGTTCTTTGACCGACTCCCAGTTTTTACGCAGAGGCTTAGAACGATCG
CGCCCCATGCGTGCGGCGACCATAGGGGAAGAAACCCGACGGATCTCTTCGCGGTATTTT
TCATCAAGGAATTTTTGTGCCTGAAAATAGTGTTCTGAGGTAGGCCAGGTTTTCCCGTCA
ACCTTGATGGGCCAGGCGGCAAAGTTAGAAAAATCACCGTAGTCATCGCTGGTGCTGTAG
AAATTTATGATGGTGTCTTGCATGACGTGTTGGATCCTTTGTGCTCGAACGGGCATTAAA
CCGCATTATGTTGGTGGTTATTGCGAGCCGCTTTCCAGAAACAGAAAAACCATTACCCCT
GAAAACCGAAAAATGCCACAATATTGGCTGTTTATACAGTATTTCAGGTTTTCTCATGGC
ATTAACCGCCGCGCTTAAAGCGCAAATTGCCGCCTGGTATAAGGCGCTTCAGGAACAGAT
CCCCGACTTTATTCCCCGTGCGCCGCAGCGGCAGATGATTGCGGACGTCGCCAAAACGCT
GGCCGGAGAAGAAGGGCGACATCTGGCGATTGAAGCCCCCACCGGCGTTGGGAAAACGCT
CTCTTATTTGATTCCCGGCATCGCCATTGCCCGCGAAGAGCAAAAAACGCTGGTGGTGAG
TACCGCCAACGTGGCATTGCAGGATCAGATTTACAGCAAAGATTTACCGCTGCTGAAAAA
GATCATTCCCGATCTTAAATTCACTGCCGCTTTTGGGCGTGGGCGCTACGTTTGTCCGCG
TAATCTGACGGCGCTCGCCAGTACTGAACCCACGCAACAGGATCTGCTGGCGTTTCTTGA
CGACGAACTGACGCCGAACAATCAGGAAGAGCAAAAACGTTGTGCGAAGCTGAAGGGCGA
TCTCGATACTTATAAATGGGATGGTCTGCGCGATCATACTGATATCGCTATAGATGACGA
TCTCTGGCGTCGTTTAAGTACCGACAAAGCCAGCTGCCTCAACCGCAATTGTTACTACTA
TCGTGAATGCCCGTTTTTTGTCGCTCGTCGGGAGATTCAGGAAGCGGAAGTGGTGGTGGC
AAACCATGCGCTGGTGATGGCGGCGATGGAAAGCGAAGCGGTATTGCCTGACCCGAAAAA
TTTACTGCTGGTGCTGGACGAAGGCCATCACCTGCCGGATGTGGCGCGGGATGCGCTTGA
GATGAGCGCCGAAATCACCGCGCCGTGGTATCGGCTACAGCTGGACTTGTTCACGAAACT
GGTCGCTACCTGCATGGAGCAGTTTCGCCCGAAGACCATCCCACCGCTGGCGATCCCTGA
ACGTTTGAATGCGCATTGTGAAGAGTTGTATGAGCTTATCGCCTCGTTAAACAACATTCT
CAATCTCTACATGCCTGCCGGGCAGGAGGCAGAGCACCGTTTTGCGATGGGCGAACTGCC
AGATGAAGTGCTGGAGATCTGCCAGCGGCTGGCAAAACTCACCGAGATGCTGCGTGGCCT
GGCGGAGTTATTTCTTAACGATTTAAGTGAGAAAACCGGCAGCCATGACATTGTACGTCT
GCATCGGTTGATTTTGCAGATGAACCGCGCGTTGGGGATGTTCGAGGCGCAAAGCAAACT
CTGGCGGCTGGCTTCGCTGGCGCAATCTTCCGGTGCACCGGTGACCAAATGGGCGACGCG
GGAAGAGCGCGAAGGGCAGCTACACCTCTGGTTTCACTGCGTGGGAATACGTGTCAGCGA
TCAGCTGGAAAGGCTGCTGTGGCGCAGTATTCCGCACATTATTGTCACCTCCGCAACCTT
GCGTTCGCTGAACAGTTTTTCGCGTTTGCAGGAGATGAGTGGTCTGAAAGAGAAAGCGGG
CGACCGTTTTGTGGCGCTGGATTCCCCCTTTAACCACTGCGAACAGGGCAAAATTGTTAT
TCCCCGGATGCGCGTTGAGCCTTCCATCGACAACGAAGAGCAGCATATTGCCGAAATGGC
GGCCTTTTTCCGTAAGCAGGTGGAGAGCAAAAAACATCTCGGTATGTTGGTACTGTTTGC
CAGCGGACGGGCGATGCAGCGCTTTCTCGACTATGTGACGGATTTACGTCTGATGTTGCT
GGTTCAGGGCGATCAGCCGCGTTACCGTTTAGTTGAACTGCACCGCAAACGCGTCGCCAA
CGGTGAGCGCAGCGTGCTGGTGGGCTTACAGTCATTTGCCGAAGGGCTTGATTTGAAAGG
TGATCTGCTCAGCCAGGTGCATATCCACAAAATCGCTTTTCCGCCCATCGACAGCCCGGT
GGTGATCACCGAAGGGGAATGGCTGAAAAGCCTCAACCGCTATCCGTTTGAGGTGCAAAG
CCTGCCGAGCGCCTCGTTTAACCTGATTCAGCAGGTTGGGCGACTGATTCGAAGCCACGG
TTGCTGGGGCGAAGTGGTTATCTACGACAAACGCTTGCTGACCAAAAATTATGGCAAGCG
ACTACTGGATGCATTACCGGTATTTCCGATAGAGCAACCGGAAGTCCCTGAAGGTATAGT
TAAAAAGAAAGAAAAAACGAAATCCCCACGCCGTCGGCGGCGTTAATGATGTGAGTCAGG
TAAGGAGTCGTAAATGGACTATCGCAAAATCATTAAAGAGATCGGGCGCGGGAAAAACCA
CGCGCGCGATTTAGACCGGGATACTGCGCGCGGTCTGTATGCTCATATGCTCAATGGTGA
AGTCCCTGACCTTGAGTTGGGCGGCGTATTGATTGCGCTGCGTATCAAAGGAGAAGGGGA
AGCAGAGATGCTCGGCTTTTACGAAGCCATGCAAAATCACACCATCAAGCTGACGCCGCC
AGCAGGCAAGCCGATGCCGATTGTCATCCCCAGTTACAACGGCGCGCGTAAACAGGCCAA
CCTGACGCCGTTGTTGGCGATTCTCCTGCACAAACTCGGTTTTCCTGTGGTGGTTCACGG
GGTTAGCGAAGATCCAACCCGCGTGCTGACTGAAACCATTTTTGAATTGATGGGTATTAC
GCCAACGTTGCACGGCGGGCAGGCGCAGGCGAAGCTCGACGAACATCAACCGGTGTTTAT
GCCAGTCGGCGCGTTTTGCCCGCCGCTGGAAAAACAACTGGCGATGCGCTGGCGGATGGG
CGTGCGTAACAGTGCACATACCCTGGCGAAACTGGCGACGCCATTTGCCGAAGGTGAGGC
GCTGCGTCTTTCCAGCGTTTCGCATCCGGAATACATTGGACGCGTCGCGAAGTTCTTTAG
CGATATCGGCGGGCGGGCGCTACTAATGCATGGTACTGAAGGTGAAGTGTATGCTAATCC
GCAGCGCTGCCCGCAGATCAATCTCATTGACCGTGAAGGGATGCGGGTGCTGTATGAAAA
ACAGGACACTGCTGGTAGCGAGTTACTGCCACAAGCAAAAGATCCGGAAACCACGGCGCA
GTGGATTGAGCGTTGCCTTGCTGGCAGCGAACCGATTCCCGAATCGCTGAAAATCCAGAT
GGCTTGCTGCCTGGTGGCTACGGGTGAAGCGGCAACTATCAGCGACGGCCTGGCGCGCGT
TAATCAGGCATTTTAATTCTTTTCTCAGCCGGATGAGCCATGTCATCCGGCTTTTACCCC
ACCGCAATATGAAATTCCTGCATCTTTATTGACCTTCCCACGCCCGGCGTGCAGCATAAA
AATACAACAAACACATAACATAAACAGGAGTTAACCATGGAAAGTGGTCATCGCTTTGAT
GCTCAGACGCTGCACAGTTTTATTCAGGCTGTATTTCGTCAGATGGGTAGCGAGGAACAA
GAAGCGAAATTAGTTGCCGATCATTTAATCGCGGCAAACCTGGCAGGGCATGATTCACAT
GGTATTGGCATGATCCCAAGCTATGTACGCTCCTGGAGTCAGGGGCACCTGCAAATTAAC
CATCATGCCAAAACCGTTAAAGAGGCGGGGGCGGCGGTCACGCTCGATGGCGATCGCGCA
TTTGGTCAGGTCGCGGCACATGAAGCGATGGCGCTGGGGATTGAGAAAGCGCATCAGCAC
GGTATTGCCGCCGTGGCGCTACATAACTCGCATCATATCGGCCGTATCGGTTACTGGGCG
GAGCAGTGTGCAGCGGCGGGGTTTGTCTCTATCCACTTTGTTAGCGTGGTCGGTATTCCA
ATGGTCGCGCCGTTCCACGGTCGCGACAGCCGCTTTGGCACCAATCCGTTCTGTGTGGTT
TTCCCTCGTAAAGATAATTTCCCGCTGTTGCTTGATTACGCCACCAGCGCCATTGCATTT
GGCAAAACCCGCGTCGCCTGGCATAAAGGCGTCCCCGTGCCGCCAGGTTGCCTGATTGAC
GTTAACGGCGTGCCGACGACCAATCCGGCGGTAATGCAGGAGTCGCCGTTGGGTTCGCTG
TTGACCTTTGCCGAACATAAAGGCTACGCCCTTGCAGCGATGTGTGAAATTCTTGGCGGG
GCGCTTTCCGGCGGTAAAACGACGCATCAGGAAACGTTACAAACCAGTCCCGATGCCATT
CTTAACTGCATGACCACTATCATCATCAACCCGGAACTCTTCGGCGCGCCGGATTGTAAC
GCGCAGACCGAAGCCTTTGCCGAGTGGGTGAAAGCCTCGCCGCATGATGATGATAAGCCG
ATTTTGCTACCGGGCGAGTGGGAAGTGAACACGCGTCGCGAACGGCAGAAGCAGGGGATT
CCACTGGATGCGGGAAGCTGGCAGGCCATTTGTGATGCAGCGCGGCAGATTGGTATGCCG
GAAGAGACGTTGCAGGCTTTCTGTCAGCAGTTAGCCAGCTAAAAAAAAGCCCGTCCAGTG
GCGGACGGGCAAACAAGGGTAACATAGGATCAATGAGGGTTAGAGCATATGCGTCTGTCG
GCAAACAGACAGGGAAATACTTGTGCTGGACGTAGCGTAAACGCCTGATCCGTCCAACGG
TTCGGATTTTGTAGGCCTGATAAGACGCGGTAGCGTCGCATCAGGCATCTGTTGCCGGAT
GCGGCGTAAACGCCTTATCCGTCCTACGAATTACTTATAAATTACCGCAGTACCGCTTAA
TTTATTGTTGTTGGTGGCGGAAGTGATGCTGTATCCACTGGCACCGGCTGCCGCGGCTTT
CTCAGCCAGTTTCGCTTCCAGGGCATCGAGGGTGGATGCGCCATCGGCAGAAACCACGCC
GATTTTATTCATGTTCTGTGCCTGGGATGCCGTTACCGGTTCCGCCGCGAACACGCCAAA
TGACAGAGTTGAAAGAGCCATAGCAGCAACAACAGTATTGATAGTTTTCATAATTAATCT
CTCGCAGGTGATTTTTGTATAAGTGACGTTGTTTCGTCGATGTGATGAGTATCACGTTTT
TTTACGAGAGATAAAATCGAAGAGAATTGACCGCCTTGTTCAAATAAATTGATTGATATC
TAACCTACTGATAAACCATTTATTTGTTGTACTTATGAACTTGTTTTATACCGCGTGGCA
GTCACAGCAGCGTTAAAGGCACGGAATGACACGCAAAATACAAATTATACTCGCTATGCA
TCTCGCCAGTTGTAGTTAACGTAACTGGCTGTCTTTCGAACCTCTGCGATTATATCCTGT
ATAAGCTGGTTTTTGTAAATCTTTCTCCTGCTGACAATGAATACATAAGCGCACGCCAGG
AATGGCTTCCCGACGGGCCTGCGGGATGGGGGCACCGCACTCTTCACATTCATCCAGGCT
TTCGCCGCGCGGAATTTCACCCCGAGCGCGGGCAATCGCATCTTCAATTGTACTGTTGAT
CTGTTCGTTGACGGCGTCATCGTTAGCCCAACCGGATGCCATATCGACCTCCCCATATCA
ATACTTGTACAGTTAAGTGTAGCTAATCCAGGGACGAACTCGGGCAGTTCAAGCATCAGA
TCTCCGACCATTCCCGCAGCAGATTATGATAAAGATTAAGCAGCGACAGGATCTCTTCAC
TTTCGCCGTAGCGGCTTTTCAGCGACTGAATATTGTTGTCCAGTTCAAACAGCATGGCGC
GCTTTTTATCATCGCGGATCATCGACTGGATCCACATAAATGATGCCACTCGTACGCCGC
GGGTTACGGGTGTCACGCAATGCAGGCTGCTGGAGGGATACAACACGAGATCGCCTGCCG
GGAGTTTTACCCGATGTTGTCCGAAGGTGTCATTAACGACCAGTTCGCCGCCGTCGTAGC
TTTGTGGATCGCTTAAAAACAGCGTGGCAGAAAGGTCAGTACGCATCCAGCCGTTTTGTG
GATGGCTGCGTACTGCGCCATCCACATGGAAACCATAGGTTTCATTGTTCTGATAGCGAT
TAAACAGCGGCGTGGAAAGGGTACGCGGCAAGGCCGCGGCAAAGAATAAAGCATGTTGGT
TAACCGCGTTCAGCACCTCATTTTGCAGGGCGGCGTATAACGTGCTGCGGGTGTCGACCT
GTTGATTGTTCTTAACTTGCGCACCTTGTGCGCCGGTGGTGACGCGTCCATCCACCCATT
CGGCTTGTTCCAGTTGTTCGCGAAAACGAGCGACGTCCTGTGGCGATAACACGCCGGGAA
TGTGGTACATCATACAATTTCTCCAAAAAGTGGGGCCTGCGCCCCACATCTGAATCAGAA
ATGCATATTGGCTGTGAGCAAGAAGGTTCTTGGCTCGCCCGGGTGATAACGGTAGCCGCT
CTTGTTGATTGAGGCGACGTAATCGGTATCAAACAGGTTGTAAACGTTTAGCTGGAAGTC
GAGATTGCGATTAACTCGATACCCCAGTTTGGCATCGGCGACCCAGTAACCTTCGGTAAA
CGCTGGCGTTCCCACCGCGCCGTCTGAACCTTTATGCATACTGCCGATATAGCGTGCGCC
CGCGCCAACAGAGATATCGTCGGTTGCCTGATATTGGCTCCATAAGGTGAAGGCGTGCTC
CGGGGTATACGGCAGCGATGAGGAACCATCCTGGGCAACATCTTTGCCGTTTTTGATGGT
TGCTTTTTGCTGGGTATAGCCGCCAATCACCTGCCACGCGGGAGTGATATTCCCGGCCAC
GGATATCTCATAGCCTTCGACGCGTTTCTTACCGTATTGCGAGTAAGTTCCGTCATCATT
TTGCTCAACTTCATTTTCGATATCAGTGCGGAACAGCGCGGCGGTGAGCAACAGACGTTT
ATCCAGAACCTGCCATTTGGTGCCAATCTCGCTGGTGTTGGCTTTTTGCGGTTTAAAATC
GGTGCGGTTGGCACTGTTACCGCTGCCAGACTGCGCAAGGGCGAAGTTGTTGCCGCCCGG
AGGCTGCTGGGAAACGGCATAGTTAATATAGACATTGCCGTTTTCCGTCAGGTGATACAG
CGCCCCGGCTTTCCAGTTCATCAGATTGCCCGACTTGGCGGTGTCGACGGTGGTGACCGG
AGAACCTTTTGCCACACCAGTTGGGCAGGTGATGGCACCGCGTCCGCTGCCGCCGCAGGC
GGTGGCACTGTCATATTCAGTATGATAATTATCCAGACGGATCCCGCCGTTCAGCTCAAA
ATCACGGGTGATTTGCAGCGTATCAAAGGCGTAAATTGCGAAGGTATCCGTCTGACCATT
GGCGTTTGCGCCGTTGCGCGTCAGGCCGCCGGGATGAATGCTGCTGTCAGGATGATAAAT
ATTTACCGCGGGTAACGTCACCGGATTAACGCCGTAGTTAGTCTGCGTTTCACGGGTAAA
TTCCACGCCGGTACTGACATCATGACCGATAGAACCGGTATAGAACGTCGAGGTCAGGTT
GGTCTGGTTGGTGAGAATTTTATTACTCACATCTTTGGTATTCGCCGTGCGTGACCAGGT
CCAGCTATTCACATCGCTGGTGGGCTGAGTAATATTCGACGCCCCGCCCATAATCGCCGT
CATCAGGTAATCCTGCTTTACGCGCGACCAACGGGTAGTATTGCGAATGGTGGTGTTATC
GTTGATGTCGTGCTCAAAACGCATGGTGGCGGTGTCGGTGGTCGAATCGTCGTAATCGGA
ATCCGTGCCGTAAAAGTTATGAGTATCAACTTTTCCGGAATGATTCAGGGCCGCCGTTCC
CGCAGATGGGGCAGAATAGCCCGGCAAACCGATGGTCGGAATGCCGCCGTCTGGCGTGTT
GTGCTGGGTGACATGCAGATAATTAAGATACAAACGATTCGCTGTACCAAGGCCAAAAGC
GACAGAAGGGGCGACGCCGTAACGCTCATTTTTGACTTTGTCGCGTCCGGCATCGTGCGT
TTTTTCGCCCATTACATTCAGGCGCACCGCGGTGGTATCACCAATGACCTGATTGACGTC
CAGCGTGCCGCGGCGGAACCAGGCGCTGCCAATACTGGCGGAGGCGTCAATGCCGGAATC
ATTGCGCGGCTGCTTGCTGATCATATTGATCGAGCCTGTCGGTGCGCTGCGCCCGTAGTC
GGTGCCGGACGGCCCTTTAATCACTTCGACCTGCTCGGTATTGAAGGTGTCGCGCGAGAC
GCTGCCGATATCGCGAATGCCATCAATATAAATACTGTTAGAGGTATCGGCACCACGCAT
ATAAATGGCGTCGCCAGTGGTGGAGTTACCGTTCTCACCCGCAAAAAACGCACCCACGCC
GGGGACGTTTTTGAGCGCGTCGGTAAGGTTGGTTGCGCCCTGATCTTTAATCACTTGTTC
AGAAATTACCGTCATCGTGCGGGTAGTATCCGCTACCGGACGCGAGAATTTCGGATCGGC
AGATTGTTGTGGCGCATAAAGCGAAGGCGTTGATGCTTCGACAACCAGCGTGTCATCCGC
GTTAGTTTGCCCTTCGGCGGCGAGTGCCTGAGCCACAGGCGTGATGCCAATACAAAGACC
GGCAAAGAACGTGAGCGAATGAAATTGTCTGGCAGGGAAATTGCGATTGTTTTCCATTTT
GCAGGTGACTTTTTCTTATATGTTGAAATTTTCACTGCCACGAGAAAGCCTCTCTGCGGA
TGCGATGCCACTGTTAATCCCGTGATAGTGCTCGTGAAAGTGATAATAATTTTGATAAGC
ATTATCACTTGGAGCGATTTTCTATCACCCATTGCGCGAAAAAGAAATACATTTATTTAC
ATTGAGTTCATATTTGATGTTTTTTGATTACAAAACAGACGAAAACTGCATCCAGAGGCG
AATGCAGTTACGTTGGTGGGGTTATTTGTAGATGGTTGCAGTACCGAACATCTGGTCATT
TCCGCCTGCGGAATTAATGACATAACCTTTCGCGCCTTGTTCGCGCGCTTTTTCTGCCAG
TTTATCCTCCAGATCGCTTAGGTTTGATGCGCCAGTTGCCGAAACGGTACCGGCGGGCCG
TAGCTGACCGCTGTCCAGGTTACTCATCGGTTGCGCGGCATAAGCCGTGAGAGAGATTCC
GCTCAGGACGGTGGCAATCAGTAGTGTGAGGCACTTTTTCATAATGACATCCTCATAAAT
ACAACGGGTAGTGCCTGATAAGTGTAGGTCGCCTGCGCGATGCAAATGACGCAAAAAATT
GACAGAGATGTGCTTATTTTTTGAACGATATATTTTTACAAAATAAGACAAATCAATGAC
ATGCATAATGCTGATTTTTATGATGAATTGCCATAAACCATAGCCATGTTAAGGTTTTGG
GGAATGATAAACGCAGCCAGATATTTACCCTGTCGCGTTATGCGGGTATCTTACGCCGCT
GCTTAAAGGAGAATGCTATGTCCGCCCAGAAACCGGGGTTGCATCCGCGCAACCGTCATC
ACAGCCGCTACGATCTCGCCACGCTTTGTCAGGTCAATCCTGAACTCAGGCAATTCCTCA
CGCTTACACCCGCCGGGGAGCAAAGCGTAGACTTTGCCAATCCGCTGGCGGTGAAGGCGC
TCAATAAGGCGTTGCTGGCCCATTTTTACGCCGTAGCGAACTGGGATATCCCCGACGGTT
TTCTCTGCCCACCAGTACCGGGCCGGGCGGATTATATTCATCACCTTGCCGATTTACTGG
CAGAAGCAAGCGGAACAATTCCAGCGAATGCCAGCATTCTGGATATCGGCGTTGGTGCGA
ACTGTATTTATCCGCTGATTGGCGTACATGAATATGGCTGGCGTTTTACCGGTAGTGAAA
CCAGCAGCCAGGCGTTAAGCAGTGCGCAGGCGATTATCAGTTCTAATCCGGGGCTTAACC
GCGCCATTCGTCTGCGTCGGCAAAAAGAGAGTGGGGCGATTTTTAACGGCATCATCCATA
AAAACGAGCAATACGACGCGACCTTGTGTAACCCGCCATTCCACGATTCCGCCGCTGCGG
CACGGGCAGGTAGTGAGCGTAAACGCCGTAACCTGGGGCTGAACAAAGACGATGCACTGA
ACTTTGGCGGCCAGCAACAGGAGTTGTGGTGTGAAGGCGGTGAAGTCACCTTTATCAAAA
AGATGATTGAAGAGAGCAAAGGCTTCGCGAAGCAGGTGATGTGGTTTACATCACTGGTAT
CTCGTGGTGAAAACTTACCGCCGTTGTATCGTGCCCTGACGGACGTGGGCGCGGTGAAGG
TGGTTAAAAAAGAGATGGCCCAGGGGCAAAAGCAGAGTCGCTTTATTGCCTGGACCTTTA
TGAACGACGAGCAGCGCCGCCGTTTTGTCAATCGCCAGCGTTAAAGCGTTGGTTCCCCCG
GCGGTAACGGTTCAGCCGGGGTCGCGCCCGGAGCAGGCAGCACCTGATAAGTCTGCACTG
GCGCGCGAACGCCCGCCAGGTCGAAATGTTTTTTCACCTGGCTGTCGAGGGCAAAGCGTA
CCGTCCACTGTTTGAGTGGCAGCGTGGTGAACGAAACACGCAGTGTAAACGCGGTATTGC
TTAAGCCGACAATCCCGGCAAAATTCGGTTCACCAATAATCAGCCCGCGAATTTCTTCGT
TTTCCATTAATTCCGCTACCGCATCTTTCAGTGCCTGATTGGCTTTATCAGCATCTTCAT
GGCGATCAACATCATAATTTGCCACCACCGAACCAATGCCGCGGACAAAGTTAGCAAAGG
TGGTTATCGAAGACCACGGAATGATGTGATACGCCCCGGTATCCTGTCGTACGCCCACGG
AGCGAATCGACATCCGTTCCACTGTGCCGGTCAACGGCCCGATAGTCACCAAATCTCCAG
TGTTCATGCCGTTTTCAAACTGAATAAATACCCCGGTGATAATATCTTTCACCAGCGTTT
GCGAACCAAACGAGATAGCCAGACCTAATGCCCCGGCACCTGCCAGCAATGGCGCGATAT
TGACGCCGATTTCCGACAACACAATCATGATGGTGATGGTACTGATAATCACCGCCAGCG
CGTTACGAAACAGCGTAAGCAGGGTACGCGTGCGGGCGCTGGGTAGCGGGCGGCCATGAA
TATCCGAAGCCAGCCGGTTTTCGATCAAACTGGCGAGCACCGTCCAGCCAACCGCCGAGA
AGAAAAGAATGAGTGCGATACGGATCAGGATATCTACGGTTTTCTGCCCCGCGCCGTTTT
GCAGCCAGTTCCAGAAATCGAACAATCCCCATGCGCTCAACAGCAACATTACCGCCACGC
AGACTGTCAGAATACGCGCCGTTTTCAGCGCCGCCGACAGCCAGCCATTCAACCGTTTTT
GCAGCTCCGGATAGTTACGCTGAGTATGTGGCGAGAGAGTGATGGTTTTCGCCAGCCAGC
GGGAAAACATACCGGAAACAAACGCTGCGATACCAATAATCGCCAGGCTGCGCACCGTTG
CACCCATCATAAATTTCAGGCTGTTGCCCGGATCGAACAACGAAAAGAAAAACAGCACGA
TAAAATAGGCGCTTGCCAGCCAGTGCCACACCAGCGCAAAGGCGCGGATAAACAGGCTGA
AAAAGGCCAGCGAATGCTCCGCGAAGTTGAGCAAATGCTGGGTAATCTCTTTTTTATTAC
GAAAGATCAGGTACAACGCCCAGACGGTCATGCACAGCATAATGATGACGTTCGCCAGCG
CACCTATCTGTACATTCACCTGATTAGAGATAATCGGCACGGCCACAATCAGGCCATAAC
CTATCAAACTGCTTAACCAGCTCAGGCGACGACTCCAGTAACGGGCGCTCTCGTCCTGAA
TCGTGAACGGGCGCAGCTCCGCCACGTTTGGGCAAAAAATCAGGCGTAGTACGGCTTTGA
AAAATTCAATGAGGGCAAAGGCGTTGAGAAACAAACTTTGTTGGAAAGCGATGGTGCGAC
TGCCTGCATTCAGGTTGTCGCTTAATACCTGGCCGACAAATAATGTCAGGGCCAGTAACA
GCAGGTCGATAATAAACGCCCCGATAATCATCGCCGGAAGCTGCAACCAGTTGCTGCGCT
CACGATTTTTTTGCCGCGCCCACTGACCCATTTTGCGATACAGCGGCAGTGCGCACAGGC
GAATCAGCCAGTAAAAACCAAACACTAATACCGCTAACATTGAAAAATGGGTCAGCGCAT
TGCTGAAGGTTTGTGGATTAAACGGCTTATGCGGGGAGCCGGTGATATTGCGATAAAGTT
GCCCGAAGCGGGCGGAAAGGGCTTCACCATAATGGCGGCTGACTTCGGTGACCTTTTGCA
GCACGGTTTGCTCTTCGACCAGCGTCGGCGGCACTATTTTTGGTACCGGTTCAGCAGGGG
GCGTAGCGGCAACGGTGCGCAACTGGTCGATCAACTCTTTACGCGAGGTGTCATTATCCA
GCACATCCGCCAGTGCGCCATAGGCCGCTTTTTTTTGTTCGATATCCGGTTCCGGGGCCG
GTTCAGTCGTTGAGTCCGTTGTCGTTGTGGTTGTAACGCCGGGTATGGATACCGCGTGGG
CAGGTGCGCCCAGCAGGCAGAAGAGGATGAACAGGATCCACCGCATGACTCCTCCAGTGA
GAAAATAGAGCAAAAAGATAAGTATAGATGCTGGAGGAGGGGCGATTTTAAATGAGAGGA
ATCTGGTGTGCCTCCCTTTCGGGTGAAAGGGAGGAAGGGATATTAAGCAGGTTGCTGACA
ACGTGCGGGCTTTTTTGCCGGATGCGGCGTGAACGCCTTATCCGTCCTACAAGTTCATGC
AATTTTAATAAGTTGCCAGATATCCTGTAGGCCTGATAAGCGTAGCGCATCAGGCAATGT
GTCTTATTAAGAGACGTGCTGCAAAAATTCCTGCAAGCGCTGGCTCGGCGGGTTCTTGAT
CAACACCTGCGGATTGCCATCTTCCGCAATCCGGCCTTTGTCGATAAAGATCAGCCGCGA
AGCTACTTTCTCGGCAAAACCGATTTCGTGGGTCACGATCACCATCGTCATCCCTTCTTC
AGCCAGATCCTGCATAACCTTCAGCACTTCATGGCGCAGTTCCGGGTCAAGAGCGGAAGT
CGGTTCATCAAACAGCATCATTTTCGGCTTCACCGCCAGCGCGCGGGCAATCGCCACACG
CTGCTGTTGACCACCAGAAAGTTCGGAAGGGTAGTGATGTGCACGTTCTGCCAGACCGAC
TTTCGCCAGCAGCTCACGTGCCAGTTTTTCCGCCTCTTCTTTGTTCGCGCCACGCACGCG
TAGCGGGCCAAACATGACGTTTTCCAGCGCTGTCAGATGCGGGAAGAGGTAAAACTGCTG
GAACACCATACCTGCTTCCTGGCGAATCAGGCGCTCGTCAACTTTCGGATCGTTAACCTT
CAGGCCATCGACAATCAGATCGCCGGAGGTGATTTCTTCCAGTTTGTTGATGCAGCGCAG
CAGGGTCGATTTACCGGAACCGGACGGCCCGATAATCACCACGACTTCGCCCTGGGCAAT
GTTCAAATCGATATTGTGCAGCACCTGGGTTGGGCCAAAGTGCTTGGAGACGTTTTTAAA
TTCAATCACAGGATTTTCATCCTTCTTTCCAGACGACGCAGAATAAAGCTCAGCACCAGG
GTAATAATCAGATAGAACACCGCCACGGCGCTCCAGATCTCAAGGGCGCGGAAGTTACCG
GCAATAATTTCTTGCCCCTGACGGGTCAGTTCCGCCACGCCGATCACAATAAACAGCGAG
GTGTCTTTAATGCTGATGATCCACTGGTTACCCAGCGGCGGCAGCATACGACGCAGTGCC
AGCGGTAAAATGACGTAGCGAATGGTTTCCCAACGTGAAAGACCGAGCGCCAGTCCTGCT
TCACGAAAACCTTTGTGGATAGACAGCACCGCACCACGCGTGATTTCCGCAATATACGCG
CCGGAGTTGATCATGATGGTGACCACCGCCGCAGTAAATGGGTCGATGCGTAAGTCGTTA
AACGCCATCGGCAGGGCGAAATAAATAAACATCACCTGGACGACGATAGGTGTGCCGCGG
ATCACTTCAATAAAGACCAGCGCGACGTGGTTGGCTATCCAACCTCCGAAGGTGCGTGCA
AAACCTGCCAGCAATCCGATTACCAGACCGCCTGCCAGACCGAGGACCGAAATCCACAGG
GTCATTTTGGCACCTTCAATCAGAAGCGGAATGGCAGGCCAGATGGCACTCCAGTCAAAC
TGCATATGTTGTTCCTGTTACCGTGGTGTAAATAATCAAATTCAGGGTAATTAATGGCCC
CGGAGCGGGTTTGCGCCCCTCACCCTAATCCTCTCCCCATAGGGGAGAGGGAACTGCCAG
TGCGTTTTACAGGTGTAGCGTTATTATTTCGGTTCAGTACCGAACCATTTTTTGTAGATT
TCGTTGTAAGTTCCGTTCTCGCGCAGGGTTTTCAACGCGCCGTTGACTTTGTCACGCAGC
TCGTCGCTACCTTTCGGGAACGCAATACCGTATTGCTGCGCTTCCAGAGAGTCACCTACC
GCTTTGAACTGACCGTTACCGGCGGTTTTGATGAAGTACAGAATGTTTGGCGTATCGTGC
AGAACGGCGTCTGCGCGGTTGGTGCCCAGTTCCATATAGGCGTTATCGATGTTCGGGAAC
TGACGCAGATCTTTAGTTTTGATGTTTGCTTTCGCGTAATCAACGGAGCCAGTACCGCTC
TTCACAGCAACCACTTTCCCGTCGAGATCTTTCACGCTTTTCACATCGTTATTGTTAGCT
TTCACCATCACTAACAGGCCGCTTTTGTAGTAGCCGTCAGAGAAATCGATCGCTTTTTTA
CGCTCGTCGGTGATGGTAATGCCCGCCAGCGCCAGATCGACGTTTTTGGTTTGCAGTGCC
GGAATGATCCCACTGAAATCCATCGGCTTCAGTTCGTAATCCAGCTTCAGCTCTTTAGCG
ATGGCAGCCCACAGATCAACGTCAAAGCCCACATATTTATCGCCCTGTTTAAATTCAAAC
GGAACGAAGGCGGTATCCGTCGCGACAACTAATTTTTTATCCGCGGCATGAGAAGAAACC
GCAAAAGCCAGGGTCAGTGCAGCCAGTGAAACTTTTAATACAGACTTCATAGCATTTCCT
TTTTTCTATCCACGGGACGATCCCCTGCGTGACATTCACATATATGAAAAAATCGTGCCA
GTTTTGCAACTCCTTGATTTTTCGAGATGCGGCAAAAACGTGATGCACGATTTATAGGGC
AATACCCTGAAGATGCACCATTCTGGGGCACCAATCTGGTGCGCTAAAATTGTGCACTCA
ACACAGTGATTATTTAGCGTAAAACCTGATGAAAAAACAATCTTTATGTAACGATTGTGT
GATGATGTGGATACAAAAAATTTACTTAATCAGCTGGAGATAGCAGATGGATGCACTAAA
TAAGTGCGTTGAGGTGGGCTGCAAAACAAAACGGCCTCCTGTCAGGAAGCCGCTTTTATC
GGGTACTAAAGTTCTGCACCATCAGCGATGGATTTATTCGATGTTAGACTCGATAAACCA
CAGGAATTTATCCAGGTCGCGAGACGCGGCGGTCAGGATATCTGCGGTGTCGTCATCTTT
CGCTTCGCCAATCGCTTTGCGTACGTCATTAGCGACGATTGCGTAACGGTCAGCCAGTTC
TTTCAGGTGATCCTGAACGTTGTGGATGTCCAGCGGGTAACTTTTCAGCGGGGTTTTGCT
GTTGATAACTTGAGTGGTCCCCAGAGCTACACCGCCCAGCTGCACTGCACGTTCTGCCAT
GGTATCCAGATGATCGATCAGTGCGGTGCGGAAGCCATCCAGCATTTCATGTACGGCAAT
GAAGTTAGCGCCGCGCATGTTCCAGTGCGCTTGTTTGGTAATCAAAGAAAGATCAATAAA
CTGGATAACCTGGCGATTCAGCAACTCTACTGTTGCTTTTTTCTCGCTGTCGGAGACATC
GTTGCGGGTATAAAGCAGATTGGTCGCTTTTGATTTAACTAATTTAGCGGTACTCATAAT
TTCATATCCTCTTGATGTTATGTCCCAGTAATTAACGAGATTAAGTATAGCACCGGCTAT
GTGTTCCGCTATTCTGGCTGTTCCTATCACACTAATAGTGGTAACAAGCGTGAAAAACAA
AACTAATAAAGATTCAATGAGTTAGATATATTGATAAGAACAATTCTTATTTATCTGCTC
GCCAGGAATTTTCGGAATAAATATGCTTTTGCATAATTCGATATATAAAGACGGTGTAGA
GGAAAAGTAGCGAGAAATTCTGCATGGTTATGCATAACCATGCAGAAATGTAAATTTAAT
TAATGTCTAATTCTTTTATTTTGCTCTCTTTGCGTACTGTCAGCGTAGACCCCATTGAAG
CGGCGATGATAGCGCCGAGCGCCAGTAGCTGTATGGGTGTCAGTGTTTCTCCGAGGAAAA
TCATCCCGGAAACGGCAGCCAGCGCCGGTTCCATGCTCATCAGCGTACCAAATGTCCGTG
TTGGCAAACGGGTGAGGGCAATCATTTCCAGCGAATAAGGCAGAGCGGTCGAGAGAATAG
CGACAGCCAGACCCAATGGAATAACCGACCAGTGCCAGAGTGCTTCACCAGCCTGAAGCG
CTCCAATTGGCACGAAAATTAACGCTGCAATCAACGAACCAATTGCCACCGTCGCAGGGC
CATGTTCCGCTCCTGCGCGTTGCCCACTTAAAATGTAAATAGCCCAACAAGCCCCGGCCC
CCAGTGCCAGCGCACAGCCGGTTAAATCGACATGGGAAACGTCTTGCCCCAGCGGTAGCA
GGAACCACAGACCAAGAACCGCCAGCACAACCCAGACGAAATCTACCGGGCGACGAGAAG
AGAACAGCGCCACCGCCAGTGGTCCGGTGAACTCCAGCGCCACCGCAATACCCAGCGGTA
CTGTCTGAATAGAAAGATAAAAAAGATAATTCATCCCACCCAGCGAAACGCCGTAAAACA
ACAGCGGTAACCGTTGCTCTTTGGCAAAGCGCAGTCGCCATGGCTTAAAGAACGCGATGA
GGATCAGCGTTCCTAATGCCAGACGCAGCGCAGTGACACCCGGTGCGCCCACCAGAGGAA
AAAGTGACTTAGCTAACGAGGCTCCACCCTGAATAGACGCCATGGCAACGAGCAATATGA
CTATTGGTAACCAGACCGGCATTTTACGTAATGAACCAGGCATCCTTTCTCCCACAAATA
TCTAGACTTAAGTAAAGCGTGGAGTGTACTGGATATACCCAATGCTGGTTGAGCATTTGT
TGAAAAAATTTTCCCCCGTTTTGACTAAAATGCGCCAGGATTGATGGAATCATTAGTCTG
GTGATTAGGAATAATCTGGATGAATGACAGGGAAAACATGCGTAATACTTACGCAGTTCT
CTGAAAAAGTGATTTAAATTTAGATGGATAGCGGTGTATGGAAACGTTCTGTTACATGAA
ATGGCCCGTTAGACATCACAAATCGCGAAGAGTTTCCCATTAATTTTTGATATATTTAAA
ACTTAGGACTTATTTGAATCACATTTGAGGTGGTTATGAAAAAAATTGCATGTCTTTCAG
CACTGGCCGCAGTTCTGGCTTTCACCGCAGGTACTTCCGTAGCTGCGACTTCTACTGTAA
CTGGCGGTTACGCACAGAGCGACGCTCAGGGCCAAATGAACAAAATGGGCGGTTTCAACC
TGAAATACCGCTATGAAGAAGACAACAGCCCGCTGGGTGTGATCGGTTCTTTCACTTACA
CCGAGAAAAGCCGTACTGCAAGCTCTGGTGACTACAACAAAAACCAGTACTACGGCATCA
CTGCTGGTCCGGCTTACCGCATTAACGACTGGGCAAGCATCTACGGTGTAGTGGGTGTGG
GTTATGGTAAATTCCAGACCACTGAATACCCGACCTACAAACACGACACCAGCGACTACG
GTTTCTCCTACGGTGCGGGTCTGCAGTTCAACCCGATGGAAAACGTTGCTCTGGACTTCT
CTTACGAGCAGAGCCGTATTCGTAGCGTTGACGTAGGCACCTGGATTGCCGGTGTTGGTT
ACCGCTTCTAATCACTTTGGTGATATAAAAAATCCGCCTCTCGGGGCGGATTTTTGTTTT
TAAGGTTTCGGGTCGAAAATATCGGTTCCGAGATGGTTGTAATCCACCTTCTGTAACTGG
AAGTTGGTGATGTATATCGGCCCGGCTTTCTTCTCAGATATAAACGGGTATTTGATGTTA
ATTTCCTTCGCTTTAATCCCCGTCCACTGGGAGAAAAAGCCTAAGAAGTCATTGGCTGAG
CGGCGGGCTTTAATCACACGATGCGCTTTATCGTCGCTGGAAATGACCATAAAAGGCACC
TGGAAATTTTGCTGATATTTATCATCATGGGCAAGGTATTGCACGTCTTTACCGCGCTCT
TTAAAGGCCAGACCGTGGTCAGAAAAGTAAACCAGCGAGAAGCTGCTGCCGCTGTTGCGT
AACTGATCGTACAGCTTGCGCAGTAAATCGTCCGTTTGCGTCATGGTATAGAGATAGCAC
GACGTTTCTTTCGATTGCACAAAGGTTTCGTATTTTCCTTGTGTCCTGTCGCAGGCCTGC
GGATGTGAGCCCATCAGATGTAGAACAATCAGCTGCGGTTGCGAGTGCTCTTGCGCCAGC
ACTTGAGCGGTCATATCCAGTAACGCTTCGTCTTTGGTGTTTTTATCTGCTTCAAAATTA
CCTTCTTTCAGGAAGTACACTTCATCTGCTCGTTTGGCGATGCTGGCGATAGCGGTATCG
TATTCGCCGATTTGACCCTGGTTGGAAAACCACCAGGTCTGGAAGCCCGCGCGATTTGCC
AGGGTGACAAAGTTATCCTGAAACTGTGGTTTGCCATCGACAACGCGATTGAGCGTTAAG
CCAAGCGATTTCTGCGTGGAGCCACTGGCGGCAATGTAGTCAGCAAATATCAAACCGTTA
ACGCTGCTGGCAAACGGGGTATTGTCCCAGTGACCGCCAAAGGCACCGAGGGCATCGCGA
CGCGCGCTTTCACCGATCACCACCACATAGGTCTGATACTTCGGCTTAACGGCAGTGACC
GTCCAGGTATCTTTCATTCCGGAAAGTTTTGCCATCCGTTCTTGCTCTTCAATCACCTCG
TTATTATTGACGATGACATCCTTAGCAAAACGAAATACCGGATAGCCAGTATCTTTCAGT
TTAAATACGCCACCCCAGGCCAGGTTTTGCACGGGAGCAACAAAAAATGTCGCCACACTG
AATACCAGACACAGGCTGTCGAAGGTATTCCAGCGCGCTTTTTCATTCTCTTTTTTTCGC
CTGATTGCTATTACGCCGAGCGCAAAAATAAATAAGCCGACCAGGTAGCTGTACCACGGA
AAAATCGTCAGGATTTCGGTCGACTCTTCCATATTGGTGGAGTGCAATGCCAGCAATGTA
TTGAAATTAGGCGCGCCGTAGGCCTGAGCAAAAGGGAAATAACAAGCCGCCACCAGCGAA
CTGACACCGACCAGAACTTTTTGTACGCGAGGCAATGTTCGCCATAGCAAAAGCAAAATA
GCCGTAAACGCAGCGGTGTAGAGCAAACTGAAGGGGTAACCTAAGCCGAGGTTAATTAAT
AGCGACTGTAAAAAGTAGAACGCAGTCCACGGGCTAAATACCCGGCTACGGGTAACAAGC
GATTCTTTGAGGGTTAAATTCATATGCCACTATCGTAACAAACGCCATGTGCTTACCCTG
GCGTCAAGGGTCAATACCTGCAAGAGTGCGTGAAGAGTGGAAAGGGGTCCGCATCCGCGA
GCCGCAATATACGCAGGGCTGCAAGAAGATAGAGCGAGCCGCCGTTCAGGTCAACTACTG
ACGAACAAATCTTTTGCGAAGGGGATTGCAAATCCGACAAAAAGTGGGGTTTTTCAGACC
AAAACGCGTTATGCCTGCATGAAAGCAGGAGTGAAGCGGCGTACCGCGACGCCGCTATTT
ATCGGAAGGTTTATCTTGCTGCGGTTTGTTGTTGACCATATCGCACAACATAGAGAGCAG
CATTAACCGTACTTTAAAGGGAGAATGACTAAACACGCGCATACACCTCTTGAACTCATT
CATAAGACCTCCTGACTTGCTAATCCCGTCGATCCTTGAGGGATGATTGCATTACATACA
GATATAGCACAGGCTATATTATATAGCTATTGCTAAAACGTTAATTTTTTGTACCTTCGC
AACTCTGGTTTACAATGTGCGCACGAAATGAGAACGCTATGTATGCGTCACCATAATGAG
GAAGCACAATGAGTCGTCGCGCAGGTACGCCAACAGCAAAAAAAGTGACGCAGTTAGTGA
ACGTGGAAGAGCACGTTGAAGGGTTCCGCCAGGTCAGAGAGGCGCATCGGCGCGAGCTTA
TTGATGATTACGTTGAGCTGATTTCTGACTTGATCAGGGAAGTGGGGGAAGCTCGTCAGG
TGGACATGGCTGCTCGTCTGGGAGTTTCGCAACCGACGGTGGCTAAAATGCTTAAGCGGC
TGGCAACCATGGGGCTGATTGAAATGATCCCCTGGCGTGGCGTGTTTTTAACGGCAGAAG
GAGAGAAGCTGGCGCAGGAAAGCCGCGAGCGACATCAGATAGTCGAAAATTTCTTGTTGG
TGTTGGGCGTCAGTCCGGAAATCGCCCGTCGCGACGCGGAAGGCATGGAGCACCATGTTA
GTGAAGAGACGCTCGACGCTTTTCGTTTGTTTACCCAGAAACACGGTGCCAAATGAGCCT
GCCTTTTTTACGCACGCTGCAAGGCGATCGTTTTTTTCAGTTATTAATTCTTGTTGGTAT
CGGATTAAGCTTTTTCGTGCCCTTTGCACCGAAATCCTGGCCTGCTGCTATCGACTGGCA
CACCATCATCACCTTAAGCGGCCTGATGCTGCTGACCAAAGGTGTGGAGTTAAGCGGTTA
TTTTGATGTGCTGGGGCGCAAAATGGTGCGCCGCTTTGCTACGGAGCGTCGGCTGGCGAT
GTTTATGGTGCTGGCGGCGGCGCTGCTTTCTACCTTTCTGACCAACGATGTCGCGCTGTT
TATTGTTGTTCCGCTGACTATCACGCTAAAAAGACTGTGTGAGATCCCGGTTAATCGGCT
GATTATTTTTGAGGCGCTGGCAGTCAACGCTGGTTCGCTACTGACGCCAATTGGCAACCC
GCAAAATATTCTTATCTGGGGACGTTCTGGTCTTTCGTTTGCCGGATTTATTGCCCAAAT
GGCACCGCTGGCTGGCGCAATGATGCTGACGCTCCTGCTCCTGTGCTGGTGTTGTTTCCC
TGGAAAGGCGATGCAATACCATACGGGGGTGCAAACACCGGAGTGGAAACCGCGGCTGGT
GTGGAGTTGTCTGGGGCTGTATATCGTCTTTCTGACGGCGCTGGAGTTCAAACAAGAGCT
GTGGGGACTGGTGATTGTGGCGGCAGGCTTTGCGCTGCTGGCACGTCGCGTGGTGCTCAG
TGTGGACTGGACGCTGCTGCTGGTGTTTATGGCGATGTTTATCGACGTCCATTTACTGAC
CCAGCTTCCAGCGTTGCAAGGCGTGTTGGGTAACGTGAGTCATCTATCTGAACCCGGGTT
ATGGTTAACGGCAATCGGTTTATCGCAGGTGATCAGTAACGTGCCGAGTACCATATTGTT
GCTGAACTATGTGCCGCCGTCTTTATTACTGGTATGGGCGGTAAACGTAGGTGGCTTTGG
GTTATTACCCGGATCGCTGGCAAATTTGATTGCGCTACGTATGGCGAACGATCGCCGCAT
CTGGTGGCGTTTCCATCTCTATTCAATACCGATGCTGTTGTGGGCGGCGTTGGTGGGATA
TGTTTTGTTAGTTATACTCCCGGCCAACTAGGGTCTGGCAAATAAAAAAGGCGGATTATG
AGTCCGCCTTTTGCTTTAAGTTTTGAAGATTAATTCAGACGAACCGGCATCCCGGAGCGG
TTTTTAATCGCTTCATCAAGAACAACCTGGTCAACATCTGGCTGACCGGTCACTGTCTGC
ACGCTCTTCGTCAGGGTAATTGGCACAATTTCCTGACCTTCAAACTGGGCTTCGGTGGTA
GACAGCGGGTTATGGACTTCAATATAACGGCTGCCGTCTGGCTCGGTGGTCGCTTTTACC
GGCTCATCAATAAACTGTACGCGGGTACCGACCGGTACTTTCTCGAACAGGAATTTGATG
TCTTCGTTACGCAGACGCACACAACCATGACTTACACGCAGGCCGATACCGAAGTTGGCG
TTGGTGCCATGGATAGCATACAGGCGACCGATATAGAGTGCATACAGCCCCATCGGGTTA
TCCGGACCTGCCGGAACGACAGCCGGAAGCGGTTCGCCCGCAGCGCGGTACTCTGCGTGC
ATTTTGGCGGTCGGCGTCCAGGTCGGGCCTGCTTTTTTACGCTCAACTTTGGTGGTCCAG
TTGATAGGCGTATCTTTGCCTAACTGACCAATGCCGATCGGCAGCACGATAACGGTGTTG
GTCCCTTTCGGATAGTAATAAAGACGCATCTCAGCACTGTTAATGACGATGCCTTCATGA
ACGGTATCCGGCAGGATCAGCTGCTGCGGAATGTTCAGTACAGTACCGCCTTTCGGCAGG
AAGGTATCCACACCCGGGTTCGCTTCCATCATATTGGAAAGCCCCATCTGGTACTCGGCG
GCAAAATACTCCAGCGGCTGAGTGTTACCTTCAGGAATGGTGATCACCTGATTCTGACCA
ACCAGGCGACTCCCGTCGGTTGGCAGAGGATAAGTTACCGCAGAGGCGGTACTGCAAAAG
CCGACAACAGCGAAGGCCGCTGCGAATAATGTTTTCAATTTCATATTCATGTTAAGCGAG
ATTTTGTGCCTGGCAGGCCATTGGGTTGAGAATATTAGAGTATTGGAAGCGCATTATAAG
TTCATTCCAGCTCACAGTGAAATCAGATGTGTACGAAATCACATTTTTTGCCTTTGGCTT
GAGTGTAGACCTTAAGCGAGGAGCAGGATCTTCTTTCAGACTTATGGCATAATGCGCGGT
TTGTCATATCTCTTTTCAGGATACGCCTGTGTTAGTTTCCAGTAACGTCACCATGCAGTT
CGGCAGTAAGCCGTTGTTTGAAAACATTTCCGTCAAATTTGGCGGCGGCAACCGTTACGG
CCTGATTGGCGCGAACGGTAGTGGTAAATCCACCTTTATGAAGATCCTCGGCGGCGACCT
TGAGCCGACGCTGGGTAACGTTTCCCTCGATCCCAACGAGCGCATTGGTAAACTGCGTCA
GGATCAGTTTGCCTTTGAAGAGTTCACTGTGCTGGATACGGTGATCATGGGGCATAAAGA
GTTGTGGGAAGTGAAGCAGGAGCGCGACCGCATCTATGCTTTGCCGGAAATGAGTGAAGA
AGACGGCTATAAAGTGGCCGATCTGGAAGTTAAATACGGCGAAATGGACGGTTACTCTGC
GGAAGCTCGCGCCGGTGAACTGTTGCTTGGCGTGGGAATTCCAGTGGAACAGCACTACGG
CCCGATGAGTGAAGTTGCTCCTGGCTGGAAGCTGCGTGTGCTTCTGGCGCAGGCGCTGTT
TGCTGATCCGGATATTCTCCTGCTCGACGAACCGACCAACAACCTCGACATCGACACCAT
TCGCTGGCTGGAACAGGTGCTGAACGAGCGTGACAGCACCATGATCATCATCTCGCACGA
CCGTCACTTCCTTAACATGGTCTGTACCCACATGGCGGATCTGGATTACGGCGAGCTGCG
CGTTTATCCGGGTAACTACGATGAGTACATGACGGCGGCGACCCAGGCGCGTGAACGTCT
GCTGGCCGATAACGCCAAGAAGAAAGCGCAGATTGCTGAGTTGCAATCTTTCGTTAGCCG
CTTTAGCGCCAACGCCTCGAAATCTCGCCAGGCAACTTCGCGCGCGCGCCAGATTGATAA
AATCAAACTGGAAGAGGTGAAAGCCTCCAGCCGTCAGAACCCGTTCATCCGTTTTGAACA
GGATAAGAAACTGTTCCGTAACGCGCTGGAAGTGGAAGGTCTGACCAAAGGGTTTGATAA
CGGTCCGCTGTTTAAAAATCTCAACCTGCTGCTGGAAGTGGGTGAAAAACTGGCGGTACT
GGGTACCAACGGCGTCGGTAAATCAACGCTGCTGAAAACGCTGGTGGGCGATCTGCAACC
GGACAGCGGCACCGTAAAATGGTCTGAGAACGCGCGCATTGGTTACTATGCTCAGGACCA
CGAATATGAGTTTGAAAATGATCTGACCGTGTTCGAATGGATGAGCCAGTGGAAGCAGGA
AGGCGATGACGAGCAGGCGGTACGCAGTATTCTCGGTCGTTTGCTGTTCAGCCAGGACGA
CATCAAAAAGCCAGCTAAAGTGCTTTCCGGTGGGGAAAAAGGGCGGATGCTGTTTGGTAA
GTTAATGATGCAGAAGCCGAACATTCTGATCATGGACGAACCGACCAACCACCTGGATAT
GGAATCCATTGAGTCGCTGAACATGGCACTGGAACTGTATCAGGGCACGCTGATCTTTGT
TTCACACGACCGTGAGTTCGTAAGCTCCCTGGCGACCCGCATTCTGGAAATCACCCCGGA
ACGCGTGATCGACTTTAGCGGTAATTACGAAGATTACCTGCGTAGTAAAGGGATCGAGTA
AGTGATTATCCGTCACCCCGATACTGTCGGGGTGACGGCGGCTGATGACAAATGCAAAAT
AGCCTGATGCGCTACGCTTATCAGGCCTACGCAGTACCTGCAATATATTGAATCTGCAGG
ACTTTGTAGGCCGGATAAGGCGTTAACGCCGCATCAGGCATTAACAAAGCGCATTTGTCA
GCAATCTGAGTAACGTCGAATCGATTTTCTTAATCCCACATCAATTCACTTCCATTAATT
CTCAAACATCCATGCCCAACGCTCGCTTACCGTGAATGTTGAGGTCGGCAAGCGTAAAGC
GTCCTTCCCAGTTTGTTTCATAGTCCTCGCGCGGGAAGTCGCCCGGCGATGCGCCTTTTT
CCAGTGCGGCCTTCACCTTGTGCGCGTAGGCAAGATTTTTCTCGCACATCGGTGCCGCAG
GAATGTACATCACGTTGCCCCAACCTTGTTGATTTTCAACGGGGGCAACGGAATGGATGA
CGTCGCAGTGCCACCAGACGGAGTCTCCGGCTTCGAGTTTTGGAATGCTGGTTAACGCCT
CAATCAACAGTGGATGCCATTGCTCTGATACCGGCAATACTCTTCCGGGCGCTACGCCGC
ACAGTTCATCCTCCGGCACATCATCAAGCAGCGGACGTAACAGTACGTACGCCATAGCTT
CAGGAATGGGCACGACGTGCAGCAGCCCCTGACCAGGCAGCATATCAGAGAGCGCTGTCC
AGCCCTGGAATGTCCGAAACACGGAACATTTGGTGGTGTTGTCCACCGTGTACTCTTCAA
CTTCCGTACGATGTGCCGCATGCCAGGGATCATATTGCGCCAGATTGCCATTAAAGACGT
TGGCGAAAACGCGCTGATACGCTGGAAGCAGCCAGCGTTCCAGTGCCCCGGAGTCGGTAT
GCGCTCCAAGACCTTTGGAGGTCGTTCCGGGCGGACGGCGGCGGATACGGTCAGGGTAGA
TGACGCTCACATCCGGGTTAAACCATTGCTTTCCATCACTTTCAAATGTCCACAGACGAT
TGAGAAACGACTGCGCATTCGCCATTTCTTCACTCTGGCGGGCCTGCATTTGCGCCTGCG
ACCAGTAGATGGGGTAAATCTCGGGACGTGAAGCGCTGAGCGTCCCGAAGAAATTATCGC
CGGGGCCTTTGTAGACCTCGTCAAAGCGGTTGCGGTCCAGATAGTCCAGCATCGACTGAT
CCCAGCCTAGCGCTTGTTCGCGGGGGAAATGGCCTTTTATCACCGCACAACCGCGACGTT
TAATCTGTTCGCGCTGCTCTGCAGTAACATGACCTGCTTTGATATCGGCATAAGACAGCA
CCGGCCAGACGGCATCGCCCTGTGCTTTGAGTGCGTTGATTTCAGCCACTCGCGTGGCAA
TGTCATCGCTTAGCTGATTAAAGATCTGCTGGACGTCGCCAAGCTGCGCCCGCAGCGCGT
GCTTCATCTGACGGATAGCTGCTTTGTGATCGGCAGGCAATGTGTCGCTGGTAAAAGTAG
AAGCCATAACCACCTCTCATTAACTTTCATTCGAAACCATTCTGATTTGCATGTGACAAT
ATAAGTTATAAATAAGTTAATGCAAGTTTAATGATTTGATGTGATGTACAGGATGTAAAA
AGAAGGGAAAACCGGAGCGCACGGCTCCGGTAGAGAGGTCAGCTGTTAAAAGGGGATGTG
TTATCCAGCACCGCCTGAATCACATTCAGCGCGCCTTCATGATTATTATCATCGGTAGCG
TAACGGGCGATTTGTTTAATGTTTTCCGCAGCATTGCCCATCGCAAAGGAATAACGCGCC
ATTTTCAGCATCTCCGCATCGTTACCGCTGTCGCCAATCGCTACCACATTTTGCGGTGAC
AGATCCCAGCGTTTCAGTAACCGCGAAATACCGTTTGCTTTATGTAGACCGGGAATAATC
AGGTCGATAAAGCCAAAACCACTGGTAACGGGTTTCATAATGCCATCGAGCGCTACGTGC
AGTTTGTCGATCACTAACGGGATTTGTTCATCCGGCAGGTTGAGCGAAAACTTGAACAGT
ACGTCGTCAATCTCCTGATAATCTTTTACAGGTTTCAGGCGATGGTAGTGTTTTGCCATC
AGTGCGACAAATGCTTCGGGGGCATTTTCGCTGACATATGCACTTTGCAGACCGCAGGCG
ACAAAATTGAGTTGCTTATCTTTTAGCAACTCGCCAATAACAATCCGCGATTCATGTCGG
GTCAGTTCGCCGTGGAACAACTGCTTGCCATGTTCGTAAACCAGTGCGCCGTTTTCCGCG
ACAAAAGAGATCTCATCCTTTAGCTCAGGAAAGAATGAAATAAGCTGGTAATACTGATTA
CCGCTGGCAACAACGAACTTAATGCCGCGCTTTTTCAGTTCCTGATATTGCGCCATAAAA
CGTGGTTGGTTGTACGTTTTGGCGTCGTTAAGAAAAGTACCGTCCATGTCTGTGACGATA
ACTTTTACGCTCATAGGTGTGCTCCTGGCTCGAAAATGAAACCGTAACAGTGTAATAACA
ATGTGACGCAGAGCACAAATTATATTTCGAATGAAAGTAAGGATGAAATTGATGATGTGA
ATGATTTAGCCCGGCGACGACGCCGCCGGGCCGAGGAGATTACAGCATATGTTCAGTACG
GGCGATGATATCGTCCTGAGCGTCTGGAGAGAGCGCGGTGAAGAACGCGGAATAGCCCGC
GACACGCACTACCAGATCGCGATACTGATCGGGATGTTTTTTCGCATCCAGCAGCGTTTC
GCGGGAAACGATGTTGTACTGAATATGCCAGCCTTTATGCACTTCAAAGAAGGTACGCAG
CAGGATCATCAGTTTCTGCTTGTCAGATTCGTTCTCCAGCGTTGCCGGATTCAGTTTCTG
GTTGAGCAACACGCCGCCGAGAATCGCTGCCGTAGGCAGTTTACCCACTGAGCCAATGAC
CGCAGTAGGGCCAAGATGGTCAGTACCGGAGGCCGGGCTTGCGCCTTCTGCCAGCGGGGT
GTGGGCTTTACGCCCGTCCGGTGTTGCCATAGTCTGCGCGCCAAACGGTACGTTAGCGGA
GATTGATGACGTACCCGCGTAATAGTTGCCGCCAACCGGACCACGACCGTAGCGCGGATT
ATGGTACTGTTTCAGTTCGTCGATATAGGTCTGATAAGCGCGAGCCAGCAGCGTATCGAC
AGTATCATCGTCGTTGCCGTACTTCGGCGCACCGTTAATCAGCCGCTGACGCAGCTGCTC
GTGAGTCAGGCCGTCGAAGTCATCTGCCAGTGCGGCAGCAAGCTGTTGCTGACCAATCGC
ACCTTGTTCAAACACCAGTTTCTTCACTGCCGCCAGGCTGTTGCCGAGGTTGGCAATGCC
GACCTGCAGGCCAGAAACCCAGTCATATTTCGCGCCGCCTTGCTTGATACTTTTCGCTCG
CTCAATACAGTCATCCACCAGCGCCGAGCAGAGAATATCGTGCACGTTCTCTTCCAGCAT
GGTGTCGACGACATATTCGATTTCGATTGATTTGCGGGTGTAGTAACGGATTTGCGTATC
CCACGCGTCCATCACTTCATCGAAGTTGTTGAAGTTACCTGCCGACAACGCTTTTTCTTG
TGGCAGGAACACTTTGCCGCTGGTGGCATCATGCCCGCCTTCCAGCGCCGCCAGCATCAC
GCGGGCGAAGTTGATAAAGCTCATGCCGGTACAGCGATAGCCCCATTTGCCACCGACGGC
GGTTTCTATACAACCAATCGCTGCGTAGTCATAAGCGTCCTGCGGTTCAATACCGAGTTT
AATAAATTCCGGGATCACGATTTCGTCGTTGTTGAACGCCGGCATCCCGAAGCCGCAACG
GATCACCTGTACGCAGGCGTCGAGGAAATCGTTGCTCATTCCTGCATGGTAACGCACGCT
GAGGTTAGGCTGAGTGGAACGCAGGCGACCGCAGGATTCGAGGATCGCGTAAGAGAGTGG
ATTCACCGCGTCCATTGGTTGACCATCAACCAGATTTTGCCCGCCAATAGTGACGTTCTG
ATACAGCGGACTTCCCGCAGAGGCTTTTGAGTGTGAGCCGGAGCGGATCTTGTTCACTTC
CAGCAGTTTCAGCCAGCAGCTATGCAGCATCTCGATGGCGTGTTCGCGATCCAGCGTCTG
GTTGAGTTCAACGTCGCGGCGATAGTACGGGTAGAGATACTGGTCCATACGACCAAACGA
TACTGAGTGACCGTTAGATTCGATCTGCAAAATCAACTGGATGAAGTAACACAGTTGCAG
CGCCTGCCAGAAAGTCTGCGGCGGCTGGTGGGCGATAAGATCGCAGTTTTCTGCCATCGC
CAGCAGTTCATCGCGACGGCTTTCGCGGGTTTCGGTCGCGGCCATTTCACGCGCCAGGGC
AGCGAAACGTTCAATGTGTTCACTGACTGCCACCAGCACGATATCAATCGCTTTCAGGAA
TTGCTCACCGTGTAAATCTTCCAGCACCGTCAGGTTGATGCGCGAGCGACGTTCCGCTAC
TTCCTCGCGCAGACCATCAAGCCCTTTTTCCAGCAGCAGCGGGAAATTCACCGCCAGGTG
CGCATCGCCGGAGGTCATATTGCCTTCCGCTTTAATGATTCCGGTCGCCAGCAGACCTTT
TTGCTCATCGGTAAACATGCCGTAGCAGCGATCCTGTACGGTCTGACCGCGCCACCACGG
GCACACTTCATGCAGAACGCGTTTGTTCTCTTCGCTCACCGCAAAGCCAGCACCGGGACG
ATCTGCCAGATCATCAATCTCTTTTTCGATCCACGAGACAGTATATTCCGGGAAGATCGG
CGCGGCGCGAACTTCGCTTGCCTGGTTGCCAATGATCAACTCATCGTGTTTGATCCAGAT
GGTGCGATTCGCCAGGTGATGCGCCAGTGCCAGCGCGCGACGTACCGGGATCGGCTTATC
GAGATGTTGTTGATACATCTCGGTATAGTGCTGCGCGCGCTCGGTACAGACTGGCGGTTT
CACAATATGCACCAGCGCATTTTTGTGCGCTTTAATGCGGTCGCTGAGCGTGTCCAGTTT
CAGTGTGGTCATGGTTGTTATCCTCGTAAGGTCGCGGTTAACCCTTTCTGGCAGGCATAC
TGCTGGGCAAAGTCGAGCAGTTCTGGCGCATCAAGCGGTTTTTCCGGGGCGTCATAGGGC
AGATTAAGTAAGTGATATTTGTTGATGCCCAGCGTGTGGTAGGGCAGAAAATGAATTTCG
CCAACGTGCAGCTCGTCGGCGGCAAAATCGGTAATGGCTTTTACAGAGGTTTCGTCGGCA
TTAAAGCCCTGAATCAGCGGCACGCGGATAATGATTTTTTTGCCCGCTGCGGCGAGTTTT
TTCAGGTTATCCAGCACTCTGGCGGCGTTACCGTCGGTCCACTGTTTAAACGGCGCGTCG
GCAACGTGTTTTAAATCGGCAAGAAACAGATCGATATAGGGCAGAGAAGGGGCGATATAT
TTCCACGGCACATGCAGACAGGTTTCTACCGCAGTATGAATGCCTGCCTCGTGGCTGGCT
TGCAGTAGCGCCATCGCCATTTCCGGCTGCATAAAGGGCTCACCACCCGAAAGCGTTAAA
CCGCCGCCGCTGCGATCGTAAAACGGTTTATCGCGCAGAACGGTCGTCATGATCTCCTCA
ACGCTTTTCACTTCACCACACACGGTTAATGCCTGTGTCGGACAGCAGTCGGTTAACGCC
GTCAGATGCTCCGGGGTTAACTTTTCCCGATGAATAAGCAAACCATTCAGCGCGCGCTCA
ATCACTTCCGGCGCGGCCTTAGCGCACAGCTCGCAGCCTTCCAGACACAGTCGTGCGTCA
TACAGCAGATCCTGCGTGCGGGCGCGGCTTTCCGGGTTCTGACACCAGCGGCAGCCCAGC
GAACAGCCTTTAAGAAATACGACCGTGCGGATACCGGGGCCATCATGGGTCGAGTAGCGC
TGAATATTGAAAATCATAGTTGCCTCTCTATTTCGTTCAAGCATTAAAATACTTTCGAAT
GAAAGTTAGATTGATGTGCGTCAACTGTTCAGAGAGTTTTCCCGTGATAGTCTACATTCA
GACAAAAAGTACATTTTGAGGATGGTTATGGAACTGTATCTGGATACTTCAGACGTTGTT
GCGGTGAAGGCGCTGTCACGTATTTTTCCGCTGGCGGGTGTGACCACTAACCCAAGCATT
ATCGCCGCGGGTAAAAAACCGCTGGATGTTGTGCTTCCGCAACTTCATGAAGCGATGGGC
GGTCAGGGGCGTCTGTTTGCCCAGGTAATGGCTACCACTGCCGAAGGGATGGTTAATGAC
GCGCTTAAGCTGCGTTCTATTATTGCGGATATCGTGGTGAAAGTTCCGGTGACCGCCGAG
GGGCTGGCAGCTATTAAGATGTTAAAAGCGGAAGGGATTCCGACGCTGGGAACCGCGGTA
TATGGCGCAGCACAAGGGCTGCTGTCGGCGCTGGCAGGTGCGGAATATGTTGCGCCTTAC
GTTAATCGTATTGATGCTCAGGGCGGTAGCGGCATTCAGACTGTGACCGACTTACACCAG
TTATTGAAAATGCATGCGCCGCAGGCGAAAGTGCTGGCAGCGAGTTTCAAAACCCCGCGT
CAGGCGCTGGACTGCTTACTGGCAGGATGTGAATCAATTACTCTGCCACTGGATGTGGCA
CAACAGATGATTAGCTATCCGGCGGTTGATGCCGCTGTGGCGAAGTTTGAGCAGGACTGG
CAGGGAGCGTTTGGCAGAACGTCGATTTAACCGGACGTTCTGCATCCTCATAAATTGCTG
ATGACGTGGCGGAGTGCCGCGTCTTATCAGGCCTGGAGGTGGCAATTACTGCCCACACAC
CTCACACCCCGGATTACGCATCAGTTTCATTTCGCGAAACTGACAGGTCATCGCATCGTA
CATGACGATTTTCCCGCTGGCCGGTTTGCCATAACCTGCCAGCATTTTGATCGCTTCCAT
TGCCTGCAACGAACCAATTACGCCGATCAACGGTGCCATTACGCCTGCTTCCACGCAGGT
TAATGCATTTTCACCAAACAAACGGCTAAGGCAGCGATAGCACGGTTCACCGTCCTGATA
AGTAAAGACGGTGATTTGACCTTCCATACGAATTGCCGCGCCGGAAACCAGCGGTACCTT
CGCGGCAAAACAGCCTGCGTTCAGTTGATTACGTACCGCAACGTTATCCGTACAGTCGAG
CACCAGATCGTGTTCAGCAATCAATGCTGCAAGTTCTGCGTCATCCAGCAGTGCATTGAC
TGGCGTAATCGCGATATGTGGGTTGATCCGCGTCAGGGCGTCACGGGCGGATTCCACCTT
CGGTTGCCCGACCGTGGCATCACTGTGCAGTGTCTGGCGTTGCAGATTCGAGAGCGAAAC
CGTGTCGAAGTCGAGCAGCGTCAGGTTACCGACACCGGCGCTTGCCAGATACTGCGAGGC
TGCACAGCCGAGGCCGCCCAGGCCCACTATCAGCACGCGAGAATCTTTCAGCGCCTCCTG
GCCGTCAAAATCAAAGCCGCGCAGAATGATTTGCCGGTTGTAGCGCAGCATCTCCTGATC
GCTGAGTTCCGCCATTACAGGCCTCCGAACAACGCGTTAAACGGTTCTACTTCCACCCAT
TCGCCCACTTCCACATTGCCGCGATCGCGTTCCAGCACGATAAAGCAGTTGCCGAGGCTA
AAGGAGCTAAATATATGTGAACCCTGATGTCCGGTGGTCGTCACTTCCAGTTCGCCATCG
GCGTTGCGTTGCAGCACGCCGCGCTGGAAATCAAGACGTCCTGGCGTTTTTTTCAGGCGG
GACGCTGTGCGTACGCGCTGGCGCGCGGGCAGGCCGCTGGCGGTGTTACCGCTTAGTTTT
GCCAGCAAAGGCTGTACCAGTTGATAGAAGGTCAGCGTCGCTGAAACCGGGTTGCCCGGC
AGGCCGCAGAACCAGCTATTGCTGAGTTTACCGAACGCGAACGGTTTACCTGGTTTAATC
GCCAGCTTCCAGAAGGCGATCTCCCCCAGCTCTTCAAGAATCGTTTTGGTGTAATCCGCC
TCACCCACTGAAACACCGCCGGAACTGATCACCACATCCGCCTGGCTGTCGGCTTCAATA
AATGCGGCGCGCAGGGCATGGGGATCGTCGCGGATAATCCCTAAGTTAATTACCTCGCAT
CCCAACTGTTCTAACATCAGGTGTACGGCGAGACGGTTGGTATCGTAGATTTGGCCGTCG
CCCAGCGGCTGACCGGGCAACTGGAGTTCATCACCGGTAGAAAAAAGCGCTACACGCACT
TTACGAATCACCGGAACTTCGGCAATCCCCAGTGAAGCAATTACTGGCAGCTCTGCGGTA
GTCAGGCGAGTTCCCGCCGGGAAAACAACCGCACCTGCAGAGATATCTTCACCGCGACGG
CGAATATTTTGCCCGCTACGCACTTCAGCAGTAAAACGCACGCCATTGTCCATTTGTTCA
GTCTGCTCCTGCATCACCACCGCTTCGCAGCCTTCCGGCACCGGCGCACCGGTCATAATA
CGAATGCAGGTACCCGCAGGCCATTCACCATGGTATGGCTGACCGGCAAAGGATTTACCG
GCAACGGGCAGCGGTTGCCCGGAGGCAATATCGGCTAAACGCACCGCGTAGCCGTCCATT
GCGGAGTTATCAAACCCCGGAACATCAAGCGGCGAAACGACATCGCTCGCCAGAATACGA
CCAAAACACTGTACCAGTGGCAGCGTTTCCTGGGCGGTCAGTGGGGTGACGCGAGAAAGC
ATCTCATTAAGCGCGGTGTCGAGCGACATCAATCCGGTGGTAAATTCCATGAAAACACTC
CTGCGGAGGCAAAATCGAATTTGCCTATTATGTCAGAAAAACGCCACAGACTGTATGCCA
CCTCGGGCGTAGCGCTGGGTCCTGCCTTTACATGCCATATCCATCTTTCTATATTCAAAA
ATTGAATGAGTAATTCATAAAAATTCTGATATTTATAGCAAAAGTGGCGAACCACCCTTA
ATGGACGAATACTATGGGCAAAGCAGTCATTGCAATTCATGGTGGCGCAGGTGCAATTAG
CCGCGCGCAGATGAGTCTGCAACAGGAATTACGCTACATCGAGGCGTTGTCTGCCATTGT
TGAAACCGGGCAGAAAATGCTGGAAGCGGGCGAAAGTGCGCTGGATGTGGTGACGGAAGC
GGTGCGTCTGCTGGAAGAGTGTCCACTGTTTAACGCCGGAATTGGCGCTGTCTTTACGCG
TGATGAAACCCATGAACTGGACGCCTGTGTGATGGATGGTAACACCCTGAAAGCCGGTGC
GGTGGCGGGCGTTAGTCATCTGCGTAATCCGGTTCTTGCCGCCCGGCTGGTGATGGAGCA
AAGCCCGCATGTGATGATGATTGGCGAAGGGGCAGAAAATTTTGCGTTTGCTCGTGGCAT
GGAGCGCGTCTCGCCGGAGATTTTCTCCACGTCTTTGCGTTATGAACAACTACTGGCAGC
GCGCAAGGAAGGGGCAACCGTCCTCGACCATAGCGGTGCGCCACTGGATGAAAAACAGAA
AATGGGCACCGTGGGGGCCGTGGCGTTGGATTTAGACGGCAATTTGGCGGCAGCCACGTC
CACAGGCGGAATGACCAATAAATTACCCGGACGAGTTGGCGATAGTCCCTTAGTGGGTGC
CGGATGCTACGCCAATAACGCCAGTGTGGCGGTTTCTTGTACCGGCACGGGCGAAGTCTT
CATCCGCGCGCTGGCGGCATATGACATCGCCGCGTTAATGGATTACGGCGGATTAAGTCT
CGCGGAAGCCTGCGAGCGGGTAGTAATGGAAAAACTCCCTGCGCTTGGCGGTAGCGGTGG
CTTAATCGCTATCGACCATGAAGGGAATGTCGCGCTACCGTTTAACACCGAAGGAATGTA
TCGCGCCTGGGGCTACGCAGGCGATACGCCAACCACCGGTATCTACCGTGAAAAAGGGGA
CACCGTTGCCACACAGTGATGAACTTGATGCCGGTAATGTGCTGGCGGTTGAAAATCTGA
ATATTGCCTTTATGCAGGACCAGCAGAAAATAGCTGCGGTCCGCAATCTCTCTTTTAGTC
TGCAACGCGGTGAGACGCTGGCAATTGTTGGCGAATCCGGCTCCGGTAAGTCAGTGACTG
CGTTGGCATTGATGCGCCTGTTGGAACAGGCGGGCGGTTTAGTACAGTGCGATAAAATGC
TGTTGCAGCGGCGCAGTCGCGAAGTGATTGAACTTAGCGAGCAGAACGCTGCACAAATGC
GCCATGTTCGCGGTGCGGATATGGCGATGATATTTCAGGAGCCGATGACATCGCTGAACC
CGGTATTTACTGTGGGTGAACAGATTGCCGAATCAATTCGTCTGCATCAGAACGCCAGTC
GTGAAGAAGCGATGGTCGAGGCGAAGCGGATGCTGGATCAGGTACGCATTCCTGAGGCAC
AAACCATTCTTTCACGTTATCCGCATCAACTCTCTGGCGGGATGCGCCAGCGAGTGATGA
TTGCGATGGCGCTGTCATGCCGCCCGGCGGTGCTGATTGCCGATGAGCCAACCACCGCGC
TGGATGTCACTATTCAGGCGCAGATCCTGCAATTAATCAAAGTATTGCAAAAAGAGATGT
CGATGGGCGTTATCTTTATCACTCACGATATGGGCGTGGTGGCAGAGATTGCCGATCGGG
TACTGGTGATGTATCAGGGCGAGGCGGTGGAAACGGGTACCGTCGAACAGATTTTTCATG
CACCGCAACATCCTTACACCCGTGCGCTGTTAGCTGCTGTTCCGCAACTTGGTGCGATGA
AAGGGTTAGATTATCCCCGACGTTTCCCGTTGATATCGCTTGAACATCCAGCGAAACAGG
CCCCCCCCATCGAGCAGAAAACGGTGGTGGATGGCGAACCTGTTTTACGAGTGCGTAATC
TTGTCACCCGTTTCCCTTTGCGCAGCGGTTTGTTGAATCGCGTAACGCGGGAAGTGCATG
CCGTTGAGAAAGTCAGTTTTGATCTCTGGCCTGGCGAAACGCTATCGCTGGTGGGCGAGT
CTGGCAGCGGTAAATCCACTACCGGGCGGGCGTTGCTGCGCCTGGTCGAATCGCAGGGCG
GCGAAATTATCTTTAACGGTCAGCGAATCGATACCTTGTCACCCGGCAAACTTCAGGCAT
TACGCCGGGATATTCAGTTTATTTTTCAGGACCCTTACGCTTCGCTGGACCCACGTCAGA
CCATCGGTGATTCGATTATCGAACCGCTGCGTGTACACGGTTTATTGCCAGGTAAAGACG
CGGCTGCACGCGTTGCGTGGTTGCTGGAGCGCGTGGGCCTGTTACCTGAACATGCCTGGC
GTTACCCGCATGAGTTTTCCGGCGGTCAGCGCCAGCGCATCTGCATTGCTCGCGCGTTGG
CATTGAATCCAAAAGTGATCATTGCCGACGAAGCCGTTTCGGCGCTGGATGTTTCTATTC
GCGGGCAGATTATCAACTTGTTGCTCGATCTCCAGCGTGATTTCGGCATTGCGTATCTGT
TTATCTCCCACGATATGGCGGTGGTAGAGCGGATTAGTCATCGTGTGGCGGTGATGTATC
TCGGGCAAATTGTTGAAATTGGTCCACGGCGCGCGGTCTTCGAAAACCCGCAGCATCCTT
ATACGCGTAAATTACTGGCGGCAGTTCCGGTCGCTGAACCGTCCCGACAACGACCGCAGC
GTGTACTGCTGTCGGACGATCTTCCCAGCAATATTCATCTGCGTGGCGAAGAGGTGGCAG
CCGTCTCGTTGCAATGCGTCGGGCCGGGGCATTACGTCGCACAACCACAATCAGAATACG
CATTCATGCGTAGATAACATTCAGGCGGAGAATAAAATGGCAAGAGCTGTACACCGTAGT
GGGTTAGTGGCGCTGGGCATTGCGACAGCGTTGATGGCATCTTGTGCATTCGCTGCCAAA
GATGTGGTGGTGGCGGTAGGATCGAATTTCACCACGCTCGATCCGTATGACGCAAATGAC
ACGTTATCTCAGGCCGTAGCGAAATCGTTTTACCAGGGGCTGTTCGGTCTGGATAAAGAG
ATGAAACTGAAAAACGTGCTGGCGGAGAGTTATACCGTTTCCGATGACGGCATTACTTAC
ACCGTGAAATTGCGGGAAGGCATTAAATTCCAGGATGGCACCGATTTCAACGCCGCGGCG
GTGAAAGCGAATCTGGACCGGGCCAGCGATCCGGCGAATCATCTTAAACGCTATAACCTG
TATAAGAATATTGCTAAAACGGAAGCGATCGATCCGACAACGGTAAAGATTACCCTCAAA
CAGCCGTTCTCAGCGTTTATTAATATTCTTGCCCATCCGGCGACCGCGATGATTTCACCG
GCAGCGCTGGAAAAATATGGCAAGGAGATTGGTTTTTATCCGGTGGGAACCGGACCGTAT
GAACTGGATACCTGGAATCAGACCGATTTTGTGAAGGTGAAAAAATTCGCGGGTTACTGG
CAGCCAGGATTGCCCAAACTGGACAGCATAACCTGGCGTCCGGTGGCGGATAACAACACC
CGCGCGGCAATGCTGCAAACCGGTGAAGCGCAGTTTGCTTTCCCCATTCCTTACGAGCAG
GCCACACTGCTGGAGAAAAACAAAAATATCGAGTTGATGGCCAGTCCGTCAATTATGCAG
CGTTATATCAGTATGAACGTGACGCAAAAGCCGTTCGATAACCCGAAGGTCCGTGAGGCG
CTGAATTACGCCATTAACCGTCCGGCGCTGGTGAAAGTTGCCTTTGCGGGCTATGCAACG
CCAGCTACTGGTGTGGTACCGCCAAGTATCGCCTACGCGCAAAGTTATAAACCGTGGCCT
TACGATCCAGTGAAAGCGCGCGAATTACTGAAAGAGGCGGGATATCCCAACGGTTTCAGT
ACCACGCTGTGGTCGTCACATAACCACAGCACCGCGCAGAAAGTGCTGCAATTTACCCAG
CAGCAGTTAGCGCAGGTCGGGATTAAAGCCCAGGTGACTGCGATGGATGCCGGACAGCGG
GCGGCAGAAGTTGAAGGTAAAGGGCAAAAAGAGAGCGGCGTGCGGATGTTCTACACTGGC
TGGTCGGCTTCAACCGGCGAAGCGGACTGGGCACTATCGCCGCTGTTTGCCTCGCAGAAC
TGGCCACCGACGCTGTTTAATACCGCGTTTTACAGCAATAAACAGGTGGATGACTTCCTG
GCTCAGGCACTGAAAACTAATGATCCGGCGGAAAAGACCCGCTTATATAAGGCGGCGCAG
GATATCATCTGGCAAGAATCGCCGTGGATCCCGCTGGTGGTAGAAAAACTGGTGTCGGCA
CACAGTAAAAACCTGACCGGTTTTTGGATCATGCCAGACACCGGCTTCAGCTTTGAAGAC
GCGGATTTGCAATAAGCAACGCAGGGAGTGGAATGCTTAATTACGTTATCAAACGCTTAC
TGGGGTTGATTCCGACGCTGTTTATCGTCTCGGTGCTGGTGTTTTTATTTGTCCATATGC
TGCCCGGCGATCCGGCGCGATTGATTGCCGGGCCCGAAGCTGATGCGCAGGTTATAGAAC
TGGTGCGTCAGCAGCTGGGGTTGGATCAGCCGCTGTATCACCAGTTCTGGCACTATATCA
GCAATGCTGTGCAGGGGGATTTTGGCCTGTCGATGGTGTCGCGTCGTCCGGTTGCCGATG
AGATTGCCAGCCGCTTTATGCCAACGCTGTGGCTGACCATAACCAGTATGGTCTGGGCGG
TTATATTTGGTATGGCGGCGGGAATTATCGCCGCCGTCTGGCGTAACCGTTGGCCGGATC
GATTGAGTATGACCATTGCGGTGTCGGGGATCTCGTTTCCGGCATTTGCTCTGGGGATGC
TTTTAATTCAGGTATTCTCCGTTGAACTGGGCTGGCTGCCTACCGTGGGAGCAGACAGTT
GGCAGCACTACATTTTACCCTCCCTGACGCTCGGCGCGGCAGTGGCCGCCGTGATGGCGC
GCTTTACCCGCGCGTCGTTTGTCGATGTTTTAAGCGAAGATTATATGCGTACCGCGAGGG
CGAAAGGGGTGAGCGAAACCTGGGTTGTCCTCAAACACGGGCTACGTAACGCGATGATCC
CGGTAGTGACCATGATGGGCTTACAGTTTGGCTTTTTGCTCGGTGGTTCCATCGTTGTGG
AGAAAGTTTTCAACTGGCCGGGACTTGGACGCTTACTCGTTGACTCCGTAGAAATGCGTG
ATTACCCGGTGATTCAGGCGGAAATTCTGCTTTTCTCGCTGGAATTTATTCTTATCAACT
TAGTGGTGGATGTGCTTTACGCCGCCATTAACCCGGCTATCAGGTACAAGTAAGGATGCG
ACTATTTAACTGGCGACGTCAGGCGGTGTTAAACGCCATGCCACTGGTCAAACCTGACCA
GGTACGTACACCGTGGCATGAATTCTGGCGACGATTTCGCCGTCAGCATATGGCGATGAC
CGCCGCATTATTCGTTATTTTATTGATTGTGGTGGCCATTTTTGCACGCTGGATCGCTCC
CTATGACGCCGAAAATTATTTTGATTATGACAATCTGAATAACGGACCTTCTTTGCAGCA
CTGGTTTGGCGTCGATTCACTGGGGCGTGACATTTTCAGCCGTGTCCTGGTTGGTGCGCA
AATCTCGCTGGCGGCGGGCGTGTTTGCCGTGTTTATCGGTGCGGCGATCGGGACGTTGCT
GGGCTTGCTCGCTGGATATTATGAAGGCTGGTGGGATCGGCTGATCATGCGCATTTGCGA
TGTGCTGTTTGCCTTCCCGGGTATTTTACTGGCGATCGCTGTTGTTGCGGTGTTGGGAAG
CGGCATTGCTAACGTGATTATTGCAGTCGCCATTTTTTCCATCCCCGCGTTTGCCCGCCT
GGTGCGCGGCAACACGCTGGTGTTGAAACAGCAAACCTTTATTGAGTCAGCACGCAGTAT
TGGTGCCAGCGATATGACCGTTTTGTTGCGTCATATCCTGCCTGGGACCGTCTCTTCTAT
CGTGGTGTTTTTCACCATGCGCATTGGTACCTCGATTATCTCTGCCGCCAGCCTCTCATT
TCTCGGCCTCGGTGCGCAGCCGCCGACACCAGAGTGGGGAGCAATGCTCAATGAGGCTCG
AGCGGATATGGTTATCGCGCCGCATGTCGCTGTTTTTCCGGCCCTGGCTATTTTTCTGAC
CGTACTGGCGTTCAATTTGTTGGGCGATGGTTTACGCGATGCGCTGGATCCGAAAATTAA
AGGATAGTTACGTTTGAATATTGCTTGAAAGGGTAATCACCTCACAGGAAATTATTGCCC
TAAGCAAGTGTTGTAACTTTCTGCTGATTTTGTAGAATCGGGTAATTTGGTTAAAAAGCC
GCAGCAAGGGACAATTTTTGCAGCGGCACAGCGTTCAGATAGTTATTTTGTTAAATGTAT
TAACATGCTGAGTTTATACGAAAAGATAAAGATAAGGCTGATAATTTTATTTTTATTGGC
AGCACTGTCATTTATTGGTCTTTTTTTCATCATTAACTATCAACTGGTATCGGAGCGCGC
GGTAAAACGTGCCGATAGCCGCTTTGAACTTATTCAGAAAAACGTTGGCTATTTCTTTAA
AGATATTGAACGTTCGGCCCTGACATTAAAGGACTCACTGTATTTATTAAAAAATACAGA
GGAGATTCAACGCGCCGTGATTCTTAAAATGGAAATGATGCCATTTTTAGACTCGGTGGG
ACTGGTACTTGATGATAATAAATATTATCTTTTTTCGCGGAGGGCGAATGATAAAATCGT
TGTTTATCATCAGGAACAAGTAAATGGACCGCTTGTCGACGAGTCAGGGCGGGTTATTTT
TGCCGATTTTAACCCATCGAAACGACCGTGGTCGGTGGCTTCAGATGACTCTAACAACAG
CTGGAATCCGGCATACAATTGCTTTGATCGTCCGGGTAAAAAATGTATCTCTTTTACGCT
ACACATCAACGGCAAAGATCACGATTTGTTAGCGGTGGATAAAATTCATGTCGATTTAAA
CTGGCGATATCTGAACGAGTATCTTGATCAAATCAGCGCTAATGATGAAGTTCTATTTTT
GAAACAAGGCCATGAGATCATTGCCAAGAATCAACTCGCTCGTGAAAAACTGATTATTTA
TAATAGCGAAGGTAATTATAATATTATTGATTCTGTCGATACTGAATATATCGAAAAAAC
ATCAGCGGTGCCAAACAACGCATTATTCGAAATCTATTTTTATTATCCTGGCGGTAATTT
ATTGAACGCATCAGATAAACTTTTTTATCTGCCGTTTGCGTTCATTATTATCGTATTGCT
GGTGGTTTATTTAATGACCACTCGTGTGTTCCGTCGGCAATTTTCTGAAATGACAGAGCT
GGTTAATACGCTGGCGTTTTTGCCTGACTCAACGGATCAAATCGAGGCTCTGAAAATTCG
TGAAGGCGATGCGAAAGAGATTATCAGCATCAAAAATTCGATCGCGGAAATGAAAGATGC
CGAAATTGAACGGTCAAATAAATTGCTCTCACTGATCTCTTACGATCAGGAAAGTGGTTT
TATTAAAAATATGGCGATTATTGAGTCTAACAATAATCAGTATCTGGCTGTGGGGATCAT
CAAACTGTGTGGTCTGGAAGCCGTGGAAGCGGTGTTTGGTGTTGATGAGCGCAATAAAAT
CGTCAGGAAATTGTGTCAGCGAATTGCCGAGAAATATGCGCAATGCTGCGATATCGTGAC
ATTCAATGCCGATCTCTATTTACTTCTGTGTCGGGAAAATGTACAGACATTTACCCGTAA
AATAGCGATGGTAAACGATTTTGACAGCAGCTTTGGCTACCGCAATCTGCGCATCCATAA
GTCTGCCATTTGTGAACCTTTGCAGGGGGAAAACGCCTGGAGTTACGCAGAAAAACTGAA
ACTGGCGATTTCCAGTATCCGTGACCATATGTTCTCAGAGTTTATTTTCTGTGATGACGC
GAAACTCAACGAAATAGAAGAGAATATCTGGATTGCGCGTAATATTCGCCATGCAATGGA
AATTGGCGAACTATTCCTCGTCTATCAACCGATCGTTGATATTAACACCCGCGCCATTCT
GGGCGCGGAGGCGTTGTGCCGTTGGGTGTCTGCGGAGCGGGGGATCATTTCACCGCTGAA
GTTCATTACCATTGCTGAAGATATCGGGTTTATCAATGAGCTGGGTTATCAGATTATTAA
AACGGCAATGGGTGAATTCAGACATTTTAGTCAGCGTGCGTCGCTGAAGGATGATTTCTT
ACTGCATATTAATGTTTCGCCCTGGCAGTTAAACGAACCACACTTTCATGAGCGTTTTAC
CACCATCATGAAAGAAAATGGCCTGAAGGCGAACAGCCTCTGTGTTGAGATCACTGAAAC
CGTGATCGAGCGAATTAATGAACATTTTTATCTCAATATTGAACAACTGCGTAAACAAGG
GGTACGGATATCGATTGATGACTTTGGCACCGGTTTGTCAAACCTGAAACGTTTTTATGA
AATTAATCCAGACAGCATAAAGGTGGACTCGCAATTCACCGGCGATATTTTCGGTACTGC
GGGAAAAATTGTGCGCATTATTTTCGACCTGGCACGCTATAACCGGATCCCGGTGATTGC
GGAAGGCGTAGAGAGCGAAGACGTTGCGCGCGAATTAATCAAATTAGGATGTGTTCAGGC
TCAGGGGTATCTGTACCAGAAACCCATGCCATTCTCCGCCTGGGATAAAAGTGGAAAATT
AGTAAAAGAGTAGTTTACGTATGTCCAGAATCAATAAGTTCGTACTTACAGTCAGTCTGC
TGATTTTTATCATGATTTCAGCAGTTGCCTGCGGGATCTACACTCAAATGGTAAAGGAAC
GGGTGTATAGCCTGAAACAGTCCGTTATTGATACTGCTTTTGCGGTGGCAAATATTGCTG
AATATCGGCGTAGCGTGGCAATTGATCTTATCAACACGCTAAATCCCACGGAGGAACAGC
TGTTGGTTGGTTTGCGCACAGCTTACGCCGACTCGGTTTCCCCCTCTTATTTGTACGATG
TCGGTCCTTATCTGATTTCCAGTGACGAATGTATTCAGGTAAAGGAGTTCGAGAAAAATT
ATTGTGCAGATATTATGCAGGTTGTGAAGTATCGACATGTCAAAAATACAGGGTTTATCT
CTTTTGACGGTAAAACCTTCGTCTATTACCTCTATCCGGTAACTCACAATCGTAGTCTGA
TATTTTTGCTTGGTCTGGAGCGTTTTTCTTTACTGTCAAAATCGCTGGCGATGGACAGCG
AGAACCTGATGTTCTCTCTATTTAAGAACGGTAAACCGGTGACCGGTGATGAATATAATG
CTAAAAACGCCATCTTCACCGTTTCGGAAGCGATGGAGCACTTCGCCTATTTGCCGACCG
GATTGTATGTATTTGCGTATAAAAAAGATGTTTATTTGCGGGTTTGTACATTGATTATTT
TCTTTGCCGCATTGGTGGCAGTGATATCGGGTGCCAGTTGCCTCTATCTGGTACGCAGAG
TGATTAATCGTGGTATTGTGGAGAAAGAAGCCATCATTAATAACCATTTTGAACGCGTAC
TGGATGGCGGGCTTTTCTTTTCGGCTGCCGATGTCAAAAAACTCTACAGTATGTATAACT
CGGCGTTCCTGGACGACCTGACCAAAGCAATGGGCAGAAAATCCTTTGACGAAGATTTAA
AAGCGCTGCCGGAAAAAGGCGGTTATTTGTGCCTGTTTGACGTCGATAAATTCAAAAACA
TTAACGACACCTTCGGTCATTTGCTGGGCGATGAAGTGTTGATGAAAGTGGTGAAAATCC
TTAAATCACAGATCCCGGTAGATAAAGGTAAAGTCTACCGCTTCGGCGGTGACGAATTTG
CGGTGATTTATACGGGTGGAACGCTGGAAGAGTTGCTATCGATTCTAAAAGAAATCGTTC
ATTTCCAGGTGGGAAGCATTAATTTAAGTACCAGTATCGGTGTAGCACATTCAAATGAAT
GTCCTACCGTCGAACGCTTGAAAATGCTGGCGGATGAGCGGCTGTATAAGAGTAAGAAAA
ACGGCAGGGCACAGATTAGCTGGCAGTAATCATTATTCGCAGGCCGGACAAATGATTTTG
CCCGGCCTGAATTAATTAAACCCGGCTACCCCACAAATCGTACTCATCGGCGTGCTCGAC
TTTCACACGCAGGATATCACCCGGCTTAACGTTGGTTTCACCATTGAGATAAACCGCGCC
GTCGATTTCCGGTGCATCTGCCATGCTGCGACCAATCGCGCCTTCTTCGTCCACTTCGTC
GATAATCACCAGAATTTCACGGCCCACTTTCTCTTGCAGGCGCTCGGCGGAAATCTGCTG
CTGCAGCTGCATGAAACGGTTCCAGCGTTCTTCTTTAACTTCTTCCGGAACCTGGTCAGG
CAGGGCATTGGCGTCTGCACCTTCAACCGGGCTGTATTTAAAGCAGCCAACGCGATCCAG
ACGCGCTTCTTTCAGGAAGTCGAGTAGCATCTGGAAATCTTCTTCTGTCTCGCCAGGGAA
GCCGACAATAAAGGTTGAGCGTAGGGTCAGTTCCGGGCAGATTTCGCGCCACTGTTTGAT
GCGCGCCAGTTGGCGATCTACAGAACCCGGACGCTTCATCAGTTTGAGAATGCGCGGGCT
GGCGTGCTGCAACGGAATGTCCAGATACGGCAGGATTTTGCCTTCTGCCATCAGTGGGAT
GACGTCGTCCACATGCGGATAAGGGTAAACGTAGTGCAGACGTGTCCAGATCCCCAGTTT
CGATAACTGTTCGCACAGGCTGACCATGCTGGTTTTTACCGGCTCGCCGTTGTGGAAGCC
AGTACGATGTTTAACATCAACGCCATAGGCGGAAGTATCCTGCGAGATCACCAGAATCTC
TTTAACGCCCGCATCTACCAGACGTTTCGCTTCACTTAACACTTCGCCAATCGGACGGCT
CACCAGGTCGCCGCGCATAGACGGAATAATGCAGAAGGTGCAGCGGTGATTACAGCCTTC
AGAAATTTTCAGATAGGCATAATGACGCGGCGTCAGTTTCACACCTTGTTCTGGCACCAG
GCTCAGGAATGGGTTGTGTTTCGGTTTTGGCACGTAGTGATGAACGTGCTCCAGAACCTG
CTCATAGCTATGAGGCCCGGTGATTTCCAGCACTTTCGGGTGGACTTCGCGGATCTGATC
TTCTTTTGCCCCCAGACAACCGGTCACAATAACCTTGCCGTTTTCATTCAACGCTTCACC
AATGGCTTCCAGTGATTCTTGTACCGCGCTGTCAATAAAGCCGCAGGTGTTGACGATCAC
CATGTCCGCATCGTCATAGCTCGGTACCACGTCATAACCTTCAGTGCGGAGTTCGGTGAG
AATACGCTCTGAATCAACAAGGTTTTTCGGACAGCCAAGGGAAACAAAGCCGATTTTCGG
CTGGGGAGTTACTTTGCTCATAGCTTAAAAAATATTCAGTTACAGGAAAGGTCAGGGCAG
GGATTCTACAGAGTTCTGGATAAAATTTGTATCGCAATCTCATTCGCTGGCGGAGGCGAA
GGAAATGTAAATTTTGTTAATTCGGCGTGAAGAATTGATCCTGGACAGCATTTTGCTCAA
AAAATAGCCATACTATTTAATTGCAACAAGGCTGGGAAGAGGAGGATCGAAGTATGTTCG
TTGACAGACAGCGAATCGATCTGCTGAACCGGTTGATCGACGCACGCGTTGACCTCGCCG
CATACGTGCAACTGAGGAAGGCAAAAGGATACATGTCCGTCAGCGAAAGCAATCATCTAC
GAGATAACTTTTTTAAACTGAATCGCGAACTGCACGATAAATCGCTGCGGTTGAATCTTC
ATCTGGATCAGGAAGAGTGGAGTGCTCTTCATCATGCTGAAGAAGCATTAGCGACAGCCG
CAGTATGTTTGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAACGCCGATA
AGCTTGAAAATTGTCTGATGAGCTTAACGCTGAGTATCCAGAGCCTGCAGAAGCACGCCA
TGCTTGAGAAGGCCTGAAAACTAAGGGGGAGAAAGCGTCTCCCCCTTCATGTTTAAGTTT
TTGTAAAAATGAATTTGTTATCTCCTCCACTGACTACGCTTTAAGCCAGAGTCAATCCGG
AGGCGTTATGCATCGACAATCCTTTTTCCTTGTGCCCCTTATTTGTCTTTCTTCCGCTCT
CTGGGCGGCTCCTGCAACGGTAAATGTCGAAGTACTGCAAGACAAACTCGACCATCCCTG
GGCACTGGCCTTTTTACCCGATAATCACGGTATGTTAATCACTCTGCGCGGCGGCGAGTT
GCGTCACTGGCAAGCAGGAAAAGGATTATCTGCGCCGCTTTCCGGAGTTCCGGACGTTTG
GGCGCACGGGCAGGGCGGCCTGCTGGACGTGGTTTTAGCGCCTGATTTTGCTCAGTCTCG
CCGCATCTGGTTAAGTTATTCCGAAGTTGGCGATGATGGCAAAGCCGGAACTGCTGTGGG
TTATGGCCGCTTAAGTGATGATCTCTCAAAAGTGACCGACTTCCGCACCGTCTTTCGCCA
GATGCCAAAACTGTCTACCGGCAACCATTTTGGCGGGCGGCTGGTATTCGACGGTAAAGG
TTATCTTTTTATTGCTCTGGGCGAAAACAATCAGCGCCCGACGGCGCAGGATCTGGATAA
ATTACAGGGCAAACTGGTGCGTCTGACCGACCAGGGCGAAATCCCGGATGATAATCCTTT
TATAAAGGAATCCGGTGCGCGCGCCGAGATCTGGTCTTATGGCATTCGTAATCCGCAAGG
AATGGCGATGAATCCGTGGAGTAATGCACTGTGGCTGAATGAACATGGCCCGCGCGGTGG
TGATGAAATTAATATCCCGCAAAAAGGCAAAAACTACGGCTGGCCGCTGGCAACCTGGGG
AATCAACTATTCAGGCTTTAAGATACCGGAAGCGAAAGGGGAGATCGTCGCCGGGACCGA
GCAACCTGTTTTTTACTGGAAAGATTCGCCCGCTGTGAGCGGCATGGCCTTCTATAACAG
CGATAAATTCCCCCAGTGGCAGCAAAAATTATTTATTGGCGCGCTGAAAGATAAAGATGT
CATTGTGATGAGCGTCAACGGCGACAAAGTGACAGAAGATGGCCGTATTTTAACGGACAG
AGGGCAGCGAATTCGTGATGTTCGCACTGGACCCGACGGTTATTTATACGTTCTCACCGA
CGAGTCCAGTGGGGAATTACTTAAAGTTAGCCCACGCAATTAGCTAACGGGAATCATCAC
CACTTTGCGCACTGCGGGGCGTTCAGTGAGTTGCTGATACCAGCGTTGCAGATTTGGACG
CGGTGTCCAGGTCAGGCCAACGTTAAACAAATTGTAGATGAACGGTGCGATAGCGATATC
GCCCACACCAAACTCGTCGCCAGAGAACCATTTTACTTTTGCCAGTTCCGCATCGAGCAG
GGCAAACAGGGCGTCGCACTCTTTGCAACTGGCATCAATGGCGGCCTGATCGCGCTCTTC
CGGTGGTGTTCTGACTAATCCCATCAGGATCCCGCGATGAGCATTACTGAGCGTCTGGTT
TGCCCAGTCCATCCATTTTTCCGCTTCCGCACGACGTGCCGGTGAGTCGATCCACAGGCG
TTTTTGCCCGTACTGTGCCGCCAGATAGCGGACAATGGCGTTTGATTCCCAAAGAATGAG
ATCACTTTCGTCGTCACGCAACAACGGCACCAGCCCGTTAGGGTTCATCGCCAGAAAATC
AGCATCGTGATTTATCCCAAACTCACGGCCCGCGAGAATTTGCTCATAAGGTAGTTCCAG
TTCTTCGAGCGTCAGCAATACTTTTTTTACGTTAGTTGAATTATTCCGACCCCACAGCGT
AATCATACTCACCCCTTTTCCGACAGGCAGCCACAGGCTGAACAGGACTCCGATGGTGAA
GTAAAGTTAACTTTTAAGCAACAGCTGGCAAAAAAATGACACCAGAAGCAGCGAAGCGGC
AGGATATTGCATAAACTTTAAAAACTTTACCAACTTACGGTTTCTTTAAGTTTGTGTGTG
CGTTATTAATCACCAAACTTATCATACGGCGATATAACGTATTTTTTTTGAATGGATACT
CGGGTGGCATTTATGACGCAATACTCCTCTCTCCTTCGTGGTCTTGCAGCGGGTTCTGCA
TTTTTATTCCTTTTTGCCCCAACGGCATTCGCGGCGGAACAAACCGTTGAAGCGCCGAGC
GTGGATGCGCGTGCATGGATTTTAATGGATTACGCCAGCGGTAAAGTGCTGGCAGAAGGC
AATGCGGATGAGAAACTGGATCCCGCGAGCCTGACTAAAATCATGACCAGCTATGTGGTT
GGGCAGGCGCTTAAGGCCGATAAGATTAAACTCACCGATATGGTGACGGTCGGTAAAGAT
GCCTGGGCGACGGGAAATCCGGCACTGCGTGGTTCATCGGTAATGTTCCTCAAACCGGGC
GATCAGGTTTCGGTGGCAGACTTGAACAAAGGTGTGATTATCCAGTCCGGTAATGACGCC
TGTATTGCGCTGGCTGATTACGTTGCCGGGAGCCAGGAGTCATTTATTGGTCTGATGAAT
GGTTATGCCAAAAAACTGGGTCTGACCAACACTACCTTCCAGACGGTGCACGGCCTGGAT
GCGCCGGGGCAGTTCAGCACCGCGCGCGATATGGCATTGCTGGGTAAAGCATTGATCCAC
GATGTGCCGGAAGAGTACGCCATTCATAAAGAGAAAGAGTTCACCTTCAACAAAATTCGT
CAGCCTAACCGTAACCGTCTGCTGTGGAGCAGCAATCTGAATGTTGATGGCATGAAGACA
GGAACCACGGCAGGCGCGGGATATAATCTGGTTGCTTCGGCTACCCAGGGCGATATGCGT
TTAATCTCCGTAGTGTTGGGGGCGAAAACCGACCGTATCCGTTTTAATGAGTCTGAGAAA
TTATTGACCTGGGGTTTCCGCTTCTTTGAAACCGTGACGCCAATTAAACCTGATGCCACC
TTTGTGACTCAGCGCGTCTGGTTTGGTGATAAGAGCGAAGTGAATCTCGGGGCAGGTGAA
GCGGGCTCAGTGACCATACCGCGTGGGCAGCTGAAAAACCTGAAAGCGAGTTATACGTTA
ACGGAACCGCAGCTTACCGCACCGCTGAAAAAAGGTCAGGTTGTCGGGACCATTGATTTC
CAGCTTAACGGTAAATCCATTGAGCAGCGTCCGCTGATCGTGATGGAAAATGTGGAAGAG
GGCGGATTCTTTGGTCGGGTGTGGGATTTCGTGATGATGAAATTCCATCAGTGGTTCGGC
AGCTGGTTCTCTTAATCTTCTGATAACCGGATGGCGCGAAACGTCATCCGGTTATACGTC
ATTAATACATCAACTTAATGCGCTGCGTCTGCGCGTACTTCACATACTCATCTTCCGGGC
AACAATCGCTCACCACAATATCAAAGCGTTTCAGGTCACCCATGCGCGCCGGACGCACCT
TGCCAAATTTACTGTGGTCGACAACCAGCACATGCTTTTGCGCCATCGACATGGCCCAGT
GTTTTACCGGCAACTCTTCAAGATTAAAACAGGTAGCGCCTTTACTGACATGCACGCCCG
CCGCAGAATAAAAAGCGATATCCGGGCAAAAATTATTCAGCGTTTGCTGAAAATCGATGG
GTTTGAAAATGGCGTTGCTGGCGTGAAATTCACCACCGCAAAGAAACGCGCGGCAATGGG
GTTTCTCTTTCAGCGCCAGAAAGGTATTTAGCGAATAACAAACGGCGGTAAAAGGGATTT
CATTATCAATCGCTTCAATAATCCACGGCGTGGTGGTGCCACAGTCAAAAAAGAGGGTCT
GATCGGGTTCTACCAGCGTCGCAGCCAGTTTTGCCGCCCGGCGTTTTTCTTCCACCAGGC
GGGATTTTTGATCGCTTAACAGGTAATGGCTGGCACTGCGCGGTTCCAGAACAATATAGC
CGCCGAGCAAAACGACGGGCGCACTGTGGTTGTTCAGATCGCGACGAATCGTCATCTCCG
AAACCCCAAGCAGGGCGGCGGCGTCTTTAAGATGTAACTTATCGCTGCGTTTTAATTCTT
GCAGCAGCTGCCCGATACGCTCTTCGCGACGTGTTTCCATAATCCCTCTGAATAGTTATT
GAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGTCACGCACCCAGCCTTTGC
GGATCGGTAATGCAAAACAGACGCGATACCACGATTGCAGACGTTGATAGAGTTTATGCC
CCATCGCTTGCCAGATAATCTGGGCACTAAGGCAGCCAATCATACCTGCCAGCAATCCAC
CGAGCATATCCAGCGGCCAGTGGACGCCAAGATAAACGCGCGACCAGGCAATGACGACGG
CCAGCACCATTAAAAGTGAGCCGGACCACAGGCGATGCCAGCATAAAAATGCCAGTGCAA
AGGTGAAAATCACCGTACCGTGATCGCTTGGGAATGAGTCATCCGCCGCATGATGCAGGA
AGTTATAGCCGATATTTTCGACAAAGGGTCGGTCGTGCGGAAAAAGATGTCCCATCGTCC
AGGACACAAACAGGCTGACCGCCAGCGCGATAGCGATTTTTATCACCAGTTGCCGTTGTG
CTGTAAGCCCCCACAACCAAAGTACCACGGCCAGCAACGGCACCACGGTAATCAAATCTT
TAGCAATAAAAATCGCCAACGAGATCATCCACGGAGCCGAGTCTGGCGTCGCGTTAATAA
GAGAGAATAGAGAGAGATTCAAATTTTCCAGCATAACTTCCCGACGCAAAGTGATTAAAA
GGGAGCCAATACAGGCAAGTCGTTGAGAATAAAGTGCAGGTTAAACTGGGTAAAGCGGCA
TCGTCTTATTTCCCTCAAGCGGCCTGTTTACGGTGGGTGATTGTAACGGGCATAGGTTAA
ATAAAACTTAAAGAAAGCGTAGCTATACTCGTAATAATGTAAGAATGTGCTTAACCGTGG
TTTCAGCTACAAAATTCGCTTTCTCGTTAGCTGCGCTTTTATTAAACTCTGCGCGATTAT
TATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAG
GCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGAT
ATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTT
CCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCG
CTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTC
ACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTG
CAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTC
GAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCG
CTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTT
GTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACGAGCCATGCCTGAA
ACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTG
GTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCG
TTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGC
TATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTG
TTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCG
ATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTA
TGGATGACTGCCGGGTTAAGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTG
GTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCCGCGATGGGA
ATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAAC
GGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTG
ATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCC
TGACTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGATGGTCGTCAATCTGGTGTT
CGATAACCATCCCTTCACCTACGCTGGCAAGATGGCGAACATAAGGATGCGGGCGGTAAG
CCGGAGCTGGCGCAGGAGCCACATAGACGGTTTGCGGCACAGTCGCGACGCTGACCGCTT
GTGGAACGCTGACTGAATCAGGAACCACAACCACTTTGTATCCACTCGGCACATCGACGG
TGACACTTTGCGCCATCGCCACACCAGTAAAGCCCATTAAAAGCGCGCCCAACAGTAGAC
AATTTTTCATAATCATTTCGCCTGAAATAATGCAGCGGGTTAATTTCCGCGAATTATGCA
GCCTTCATTCAGGCATTGTGTTGCCGGGCGTGCTGCCGGTTTTATTGGTCAAATGGCGCT
TCGTGTTTAAGAACTTTATCGATCACATCCAGTACGCCTTCACGGTTATTGGAGCCTGCG
CGGTATTTTGCCGCTGCGACGACCGCGCTACCGGCATTTTCCATTGCAAAACTAAAGCCT
GCCTGACGCAGCATCTCAATATCGTTACCGCCATCGCCAAAGACCACCACTTCGCTGTCG
TCTATTCCCCATAATTTCTGCAGTTGGCGAAGGCCATTGGCTTTATGTACGCCGGGGATA
ATCAGATCGATGCTGCCGTTGCCGGTGTGGACCGACACCATAATATCGCCGATGGCCTCA
TGTAATGCTTTTTGTACTTGTGGAATCAGTTCATCGGAAAGATTCAGGCCAAACTTAAAG
AAGATATCCTCTAAGTTGTCAAAGTTATCGACGTATTCCAGACGGTGATAATACATTTCC
GCCACCGTTTTCATGGCATCGTCATATTTTTTGAGTGTATAGGCACTATTTTTTCCGCAG
GCAATAATTTCCACTTCCGGGCGCGTCAGCAAATGTTCCACGACAGTAGCAAACGCATCC
TTCGATAGCTCGCCATTAAAAACATCTTTGCCTTCGCTCACTACCCAGCCGCCGTTTTCA
GCCACAAAGGCAATTTCATTAGCAATTTCAGGGAAGAAAGAGATCAACTGATAATATTGA
TTCCCGCTGGCGACTACAAAGCGAATTCCTTGTGCTTTCATTTGCTGATACTGAGCCATA
AACCGCTCACGGTTATAGGTTTTTTGATCGCTTAAGAAAGTACCATCCATGTCTACCGCA
ATTAATTTAATGCTCATCAACTATTCTCCATCGCCGTCTGCGTTTTGGTATCGGGTTTGG
CGACGGCTTTCGCGACAATAGCCGCGAGAATAACCAGCGCCAGTACAACCAGCATTGCAC
TACGTAATCCATAATGTTCGCCGAGATAGCCCAGCAGCGGCGGCCCGACGAGGAAAGCCA
GATAACCGGTCGTTGCTACCACACTGACGCGGGTTGGTGCATCGGGGCCGGTATCGCTGG
CGGCAGAAATGGTCAGCGGGAAGCCCAGCGAGGCACCCAGTCCCCAGAGTACAACAGACA
CCCCAGCGACCCAGGCGCTATCGACAAAAATAATCAGCCCAATACCCAACGCCCCCATTA
GTGCACTGGCCCGAACCACGGCAACGCGACTGTAACGGTCGATGAACCAACCGCCGGTGA
AGCGTCCAACGGTCATCCCCAGGGTAAAACCGGCATAAATCAGCGAGCCGGAAGTAGGGC
TAAAACCGTGACCGTCAACCATTAATAAGGGTAACCAGTCGTTGGCAGAACCTTCGGCAA
AGGCCATCGCCAGCACCACAACACCTATCAGCAGCAACTGGATATCGCGATAAAAAGGTA
CGCCTTTTTCGCCATGCTGGGTGCCATCGGCAGCATTTTTGCCCGTACCGTCAGGGATTG
CCTGAATGGCGATATAAATAGGTGCGATACCTACCAGCGCCGCCAATAAAATGTGCACCG
TTGCCGGAACGCCAAAGGCCGTCAGTGCCATCCCGACACCTGCGCCTGCCAGCGTGCCCA
GGCTATAAAAACCGTGCATCATCGGCAAAACCGTCTTATTCATTTCTCGCTCAACGGCAG
CACCTTCAACGTTTATCGCCACTTCCGCAGAACCAAAACTTGCCCCAAAGACGCCGAGAC
CAACGGCAAAGAGCAGGGGCGATGTCAGCCAGAGTGCCAGACTTAATATCATCATCCCGA
TCAATGCGCAGGACATCGTGACCAGGATGACATTACGTGTCCCAAAGCGTTTCACTAACC
ACGCCGAGCAGAGAATACCGCTCATCGAACCGATCGACAGACCAAAGAGAACACCGCCCA
TTTCAGCGATCGAGACAGAGAGAATATCGCGGATAGCAGGCGTACGGGTTGCCCAGGACG
CCATTAACAGGCCTGGCAAAAAGAAGAACATAAACAGCGCCCAGGTTCGGCGTTTCAATG
CATTACGTGAAGAATTTACGGTCATAGATCACGTCAAAATAAGAAGAGGGAAGACAACAT
TAGCAAGGTTGTGTACATTTGTACACAATTGCAGAGAGAGGAAATGACATGCGTCGCGCT
AACGATCCGCAACGGCGAGAAAAAATTATCCAGGCCACGCTGGAGGCGGTGAAACTTTAC
GGAATACATGCTGTTACGCACCGCAAAATTGCTACCCTTGCCGGGGTACCGTTGGGATCG
ATGACCTACTATTTTTCAGGAATTGATGAGTTGTTACTGGAGGCGTTCAGCAGTTTTACT
GAGATCATGTCCCGGCAATATCAGGCATTTTTTAGCGATGTTAGTGATGCTCCGGGCGCA
TGCCAGGCTATCACCGATATGATCTACAGCTCACAGGTTGCAACGCCGGATAACATGGAG
CTGATGTACCAGCTCTACGCGCTGGCTAGCCGAAAACCGCTATTAAAAACGGTAATGCAA
AACTGGATGCAGCGCAGTCAGCAAACGCTCGAACAATGGTTTGAACCCGGAACCGCCCGC
GCGCTTGATGCGTTTATTGAGGGGATGACGCTGCATTTTGTCACCGACCGTAAGCCGCTA
TCGCGCGAGGAGATTTTGAGGATGGTTGAGAGGGTTGCAGGGTAGTAGATAAGTTTTAGA
TAACAAAAAACCCATCAACCTTGAACCGAAATGGCGGGGTTGATGGGCTCCACAAAATGG
GGACATCAAAGAAAAGCAGTGGCACTAATTAAGACTGATGCCCTGCGGAAAAGTTCTGCG
GTTGTGCAAAAAAATTTCATTTTCAGGGCAACTTCAGTTTTATCCTAATCCTGGCCATAC
CATGACGATGATTGTCCCTGCCAGCGTCAGCAGGACGTTGGCGATTGCATAGGTGCCCGC
ATAGCCCAGCGCCGGGATGTTACTGCGAGCTGTATCACTGATGATCTCCATTGCCGGCGC
GCAGGTACGTGCGCCCATCATTGCGCCGAACAACAGCGCGCGGTTCATTCGCAATACATA
AGCACCGAACAAGAAACAGATAACCACGGGCACCAGACTGACAATCAATCCGGCAATCAA
CATCTGACCGCCAATCGCGCCCAGGCCGTTATTAATACCGCTACCGGCGCTCAGACCAAC
GCCTGCCATAAACACCATCAAGCCGAACTCTTTCACCATGCTTAATGCACCCTGCGGAAT
GTAACCGAAGGTCGGGTGGTTAGCACGCATAAAGCCCAGCATAATTCCGGCGAATAACAA
CCCGGCAGCGTTCCCCATGCCGAAACTGAATGTGCTGAACTGGAAGGTGATCATCCCGAT
CATCAGCCCAATAACAAAGAAGGCGCAGAATGCCAGCAGGTCAGTGACCTGGCTGTGAAT
CGAGATAAAGCCGATGCGATCGGCGATGGTTTTTACGCGGCGGGCATCGCCGCTGACTTG
TAAAACGTCACCTTTGTTAAGCACGACGTTGTCATCTATCGGCATCTCAATCTGGCTACG
AATGACGCGGTTAAGGAAGCAACCGTGATCGGTCAACTTCAGTTGTGCGAGACGTTTACC
TACAGCGTTATGGTTTTTAACGACCACTTCTTCAGTGACGATACGCATGTCGAGAAGGTC
ACGATCGAAAACTTCTTTACCGTTACGGAAGCTGGGATCGAGTCGGGCATGGGCGTCGGG
ATAGCCTACCAACGCTATTTCATCGCCCATTTGTAGCACGGCATCACCGTCTGGATTTGC
CAGAATCCCGTTACGTCGAATACGTTCAATGTAGCAGCCGGTTTGTCGATAAATACCCAG
TTCACGCAGATTTTTGCCGTCGGTCCAGGCCACCAGTTCCGGGCCGACGCGATAGGCGCG
GATCACCGGTAAATAAACCTTACGGTTGGCATCAGTGTCCAGGCCACGTTCGCGGGCGAT
TTGCTGGGCGCTGGTCTGTAAGTCCTGATGCTGCAATTTCGGCAAGTAACGCGCACCAAC
AATCAAACTCACCAGACCGATTAAATAGGTTAAGGCATACCCGAGGCTCAGATTATCCAG
TGCCAGTGAGAGCTGCCTGCTTTCCATGCCGGAATGACGCAGTGTATCGCCAGCACCGAC
CAGAACCGGTGTCGACGTCATAGAGCCTGCTAACATACCGGCCGTCAGGCCAATATCCCA
GCCAAACAGCTTACCTAACCCTAAGGCGATCACCAGCGCACTGCCAACCATCACCAGTGC
TAACATTAGGTAATTTTTCCCATCGCGAAAAAAAATGGAAAAAAAGTTCGGTCCGGCTTC
GACCCCGACGCAGAAAATAAACAGCATAAAGCCAAGATTAAGCGCATCGGTGTTAATGCT
GAAATGTTGTTGGCCTAATAACAGCGATACGACTAAAACGCCAATGGAATTACCCAGTTG
GATCGAACCAAGTCGTAACTTTCCGAGACATAGCCCAAGCGCGAGGACCACAAATAATAA
CAGAATGTAATTCCCATTTAACAATTCGGCGACGTTTATATTCACGGAGGCTAACTTCTT
GTTTACTAGTAAGCTGTTGAAAGAAATGGTAATTTACGATAATGTTTTTTACCAGAATTC
AGGGCGCAGATTCATTCAGCGCACCTAAACGATAGTAAAGTAACAATATATTTTACTAGT
GTAATCACATTAGGTATCAACGGCTATATGAATTGCGTTGGCCTATATTAGCATGGAATG
CGAAGCGGCTTTATCTTACTGAACGCCACACTGGCGAAAAATGTGTTCGATAGACGCAGT
GTCAGGAGGAACGAGTGAAACATAAACAACGTTGGGCGGGGGCAATCTGCTGTTTTGTCC
TCTTCATTGTGGTGTGCCTTTTTCTGGCGACGCACATGAAAGGCGCTTTTCGGGCTGCCG
GGCATCCTGAAATCGGCTTGCTATTTTTCATTCTTCCTGGAGCAGTCGCCAGCTTCTTTT
CACAGCGTAGAGAAGTCCTGAAACCTCTGTTTGGCGCAATGCTGGCGGCACCCTGTTCGA
TGCTCATTATGCGGCTGTTTTTTTCACCGACGCGCTCATTCTGGCAAGAGCTGGCATGGT
TACTAAGCGCGGTGTTCTGGTGTGCGCTGGGGGCACTGTGTTTCTTATTTATCAGTAGTT
TGTTTAAACCACAGCACAGAAAAAATCAGTAAAGCCCTCAACGCGAGGGCTTGTCAGACG
ATCAGGCGTCCAGATTTTCTTTCACCCATGCAGCAAAATCGGTATAGCCGCCGATATGTT
GCTGATCGACAAAAATCTGCGGCACGGTTTCTACGGGTTTACCTGCCTTTTGTTGTAGAT
CTTCTTTAGTGATCCCTTCCGCACGAATATCTACATACTGATACTGAAAATCATCGCGTT
CATTGCTCAATTTCTCAGCCAGATCTTTTGCACGCACACAGTAAGGGCAACCCGAACGAC
CAAAAATAACGGTTTGCATTATTTCTCTCCTCATAGATTTATGCCTGTAATGATCACGCT
AAAATGTATTCGCTGAAAGTAGGTTTAACCTGTTGCATTAATTGCTAAAAGCTATAACTG
TTAAACACAATACAGTGAAAAGTTTTAGACTGAAGGCTCACTTTGCAGAGGGAAGCGTAT
GCGCGCGATCGGTAAATTGCCTAAAGGCGTGTTGATACTGGAATTTATCGGAATGATGCT
ACTGGCGGTGGCGCTGCTGTCGGTAAGCGACTCCCTGTCGCTGCCTGAGCCATTTTCTCG
GCCAGAAGTGCAGATTCTGATGATTTTTCTCGGTGTTTTGCTCATGCTTCCCGCTGCGGT
GGTGGTTATTCTTCAGGTGGCAAAACGTCTTGCCCCACAGCTGATGAACCGTCCACCGCA
ATATTCACGTTCAGAAAGAGAAAAAGATAATGACGCCAACCATTGAACTTATTTGTGGCC
ATCGCTCCATTCGCCATTTCACTGATGAACCCATTTCCGAAGCGCAGCGTGAGGCGATTA
TTAACAGCGCCCGTGCGACGTCCAGTTCCAGTTTTTTGCAGTGCAGTAGCATTATTCGCA
TTACCGACAAAGCGTTACGTGAAGAACTGGTGACGCTGACCGGCGGGCAAAAACACGTAG
CGCAAGCGGCGGAGTTCTGGGTGTTCTGTGCCGACTTTAACCGCCATTTACAGATCTGTC
CGGATGCTCAGCTCGGCCTGGCGGAACAACTGTTGCTCGGTGTCGTTGATACGGCAATGA
TGGCGCAGAATGCATTAATCGCAGCGGAATCGCTGGGATTGGGCGGGGTATATATCGGCG
GCCTGCGCAATAATATTGAAGCGGTGACGAAACTGCTTAAATTACCGCAGCATGTTCTGC
CGCTGTTTGGGCTGTGCCTTGGCTGGCCTGCGGATAATCCGGATCTTAAGCCGCGTTTAC
CGGCCTCCATTTTGGTGCATGAAAACAGCTATCAACCGCTGGATAAAGGCGCACTGGCGC
AGTATGACGAGCAACTGGCGGAATATTACCTCACCCGTGGCAGCAATAATCGCCGGGATA
CCTGGAGCGATCATATCCGCCGAACAATCATTAAAGAAAGCCGCCCATTTATTCTGGATT
ATTTGCACAAACAGGGTTGGGCGACGCGCTAAAACCGCCACGTCGATGTATGATACGCGG
GCTTTTGACCAGGTCTGACAGAGAGGTGCAGGGTGAAAATTGCCATATTGTCCCGGGATG
GAACGCTCTATTCGTGTAAGCGGCTGCGTGAAGCCGCTATACAGCGCGGTCACCTGGTTG
AAATTCTTGATCCGCTTTCTTGCTACATGAACATAAATCCTGCGGCGTCTTCTATTCACT
ACAAAGGCCGCAAGTTACCCCATTTTGACGCAGTGATCCCGCGTATTGGCACCGCCATTA
CCTTTTATGGGACGGCGGCACTGCGCCAGTTCGAGATGCTGGGGAGCTATCCGCTCAATG
AGTCGGTCGCCATTGCCCGGGCGCGTGACAAATTGCGTTCCATGCAACTGCTGGCGCGTC
AGGGCATCGACCTGCCTGTCACGGGCATTGCGCATTCGCCGGATGATACCAGCGATTTAA
TCGACATGGTCGGTGGTGCGCCGCTGGTGGTCAAGTTGGTTGAAGGCACGCAGGGAATTG
GCGTCGTGCTGGCGGAGACGCGTCAGGCGGCGGAAAGCGTGATTGACGCTTTCCGCGGTC
TGAACGCGCATATTCTGGTGCAGGAATATATCAAAGAGGCGCAAGGGTGCGATATCCGCT
GTCTGGTTGTTGGCGATGAAGTGGTCGCTGCGATTGAACGGCGGGCGAAAGAGGGCGATT
TTCGTTCCAATTTGCATCGTGGCGGCGCGGCAAGCGTCGCCAGTATCACACCACAGGAGC
GTGAAATCGCGATAAAAGCCGCGCGAACGATGGCGCTGGACGTTGCTGGTGTGGATATTC
TGCGTGCTAATCGCGGGCCGTTGGTGATGGAGGTGAATGCGTCGCCGGGGCTGGAAGGAA
TAGAAAAAACCACCGGTATCGACATCGCGGGTAAAATGATCCGCTGGATCGAACGCCACG
CTACGACAGAATATTGCCTGAAAACGGGTGGTTAGTCGCAATCACATTACTGATCATGGT
TTTGCCTGCGCTTTTTGCGTAAGCTGTGCCGGTCTTTTTATCGAAAGAGGTTGTACAAAA
TTATGACATCGCTGGTCGTTCCTGGTCTGGATACGCTGCGTCAATGGCTCGATGACCTGG
GGATGAGTTTTTTTGAATGTGATAACTGTCAGGCTCTGCATCTGCCCCATATGCAGAATT
TCGACGGTGTCTTTGATGCCAAAATCGATCTGATCGATAACACGATCCTGTTTTCTGCCA
TGGCGGAAGTCCGACCTTCAGCCGTATTGCCGCTGGCGGCGGATTTATCTGCCATCAATG
CCAGTTCGCTGACCGTGAAAGCATTTCTTGATATGCAGGATGATAATCTGCCAAAGCTGG
TGGTTTGCCAGTCTTTATCCGTTATGCAGGGCGTAACCTATGAGCAGTTTGCATGGTTCG
TGCGTCAGAGCGAAGAGCAGATTTCGATGGTCATTCTTGAAGCTAATGCCCATCAACTGC
TGTTACCGACTGATGATGAAGGGCAAAACAACGTTACCGAAAACTATTTCCTCCACTGAT
AACTCCTTTCGAGCACGCAGTCGCTGGTGCAGTGGCTGCGCGCTGCAAAATTATCTGCTG
TTTTTAACCTTTTCTTAAAGATTATTTCACTTCTCTTGTGTCGATTTGGCTTTATCACAT
AGAGCAAATATGCATAAAAATTTGTTAAATACCGTTTTTTAATCCGAGCTATAGTCTCAA
ACCCTGGCTAAAGTTATTCTTGCGATGCTTTTATATAGCGAGCAGTGCTGGCCGGGAGAA
AGTTCTCTTTTCTTACACCGCGCCGATAAAAAATATGCACGTTTATTGCATATCTTTCAG
TGTGACAACTTTTGTTCGTTTGTTAACGAACTTTCAGAAGGAAAGAGATATGACCGCCTT
AAATAAAAAATGGCTATCGGGTCTGGTTGCGGGTGCTCTGATGGCCGTCTCTGTCGGCAC
GCTCGCGGCTGAACAAAAAACACTCCACATTTATAACTGGTCTGATTATATCGCCCCGGA
CACGGTGGCCAATTTTGAAAAAGAAACCGGTATTAAAGTCGTCTACGATGTTTTCGACTC
TAACGAAGTACTGGAAGGCAAATTAATGGCCGGGAGTACCGGCTTTGATCTGGTGGTTCC
ATCTGCCAGCTTTCTGGAGCGCCAGTTGACTGCGGGAGTTTTCCAGCCGCTGGACAAAAG
CAAATTGCCGGAGTGGAAGAATCTCGACCCGGAACTGCTGAAGCTGGTCGCCAAACACGA
TCCCGACAATAAATTTGCTATGCCCTATATGTGGGCGACGACCGGGATTGGCTATAACGT
TGATAAAGTTAAAGCGGTGCTGGGCGAAAACGCGCCCGTCGATAGCTGGGACTTGATCCT
CAAACCTGAAAATCTGGAAAAACTGAAAAGCTGCGGTGTCTCTTTCCTGGATGCGCCAGA
AGAAGTTTTTGCTACCGTGTTGAATTATCTCGGCAAAGATCCCAACAGCACTAAAGCGGA
TGATTACACCGGACCGGCAACAGATCTGCTGTTAAAGCTGCGCCCGAACATTCGTTATTT
CCATTCATCTCAATACATTAACGACCTGGCAAACGGCGATATTTGCGTCGCTATCGGCTG
GGCAGGTGATGTCTGGCAGGCGTCAAACCGCGCGAAGGAAGCGAAGAATGGCGTGAATGT
CTCGTTCTCGATTCCAAAAGAAGGGGCGATGGCGTTCTTTGATGTATTCGCCATGCCTGC
GGATGCCAAAAACAAAGACGAAGCCTATCAGTTCCTGAATTACCTGCTGCGCCCGGATGT
AGTAGCGCATATTTCCGACCATGTGTTCTATGCCAACGCCAATAAAGCAGCCACGCCGCT
GGTGAGTGCGGAAGTCCGTGAGAACCCAGGTATTTATCCGCCTGCGGATGTTCGTGCGAA
GCTGTTCACTCTGAAAGTGCAGGATCCGAAAATCGACCGTGTGCGCACCCGCGCGTGGAC
CAAAGTGAAGAGCGGAAAATAATCCGCAGTCGTAGATGCCGGAGGGGCGCACCACACCCG
CCGGCAATTCGCACCATTATGGTGCGCTTGCACACATTCAATGCCGGAGAGCAGCCGTGA
ATGACGCTATCCCTCGCCCGCAGGCGAAAACCCGTAAGGCGCTGACGCCGCTATTAGAAA
TCCGCAACCTGACCAAATCCTACGATGGTCAACATGCGGTGGATGATGTCAGCCTGACCA
TCTACAAAGGTGAAATCTTCGCGCTGCTGGGCGCATCCGGCTGTGGCAAGTCCACGCTGC
TGCGTATGCTGGCAGGTTTCGAACAACCTTCTGCCGGACAGATAATGCTTGATGGCGTCG
ATTTGTCACAGGTTCCGCCTTACCTGCGCCCCATCAATATGATGTTTCAGTCTTACGCGC
TGTTTCCGCATATGACCGTGGAACAGAACATCGCTTTTGGCCTGAAACAGGACAAACTAC
CGAAAGCGGAAATTGCCAGCCGGGTCAATGAGATGCTCGGCCTGGTGCATATGCAGGAGT
TCGCCAAACGCAAACCGCATCAGCTTTCCGGTGGTCAGCGACAACGTGTGGCCCTGGCCC
GAAGCCTTGCGAAGCGCCCGAAACTATTACTGCTCGATGAGCCGATGGGCGCGCTGGATA
AAAAGCTGCGTGACAGGATGCAGCTTGAAGTGGTGGATATTCTGGAGCGCGTCGGTGTGA
CTTGTGTGATGGTCACCCACGATCAGGAAGAGGCGATGACCATGGCGGGGCGCATCGCCA
TTATGAATCGTGGGAAATTTGTCCAGATTGGCGAACCGGAAGAGATCTACGAGCATCCGA
CTACCCGCTATAGCGCCGAATTTATTGGCTCGGTAAACGTCTTTGAAGGCGTACTCAAAG
AGCGTCAGGAAGATGGCCTGGTGCTTGATTCGCCGGGGCTGGTGCATCCACTGAAAGTCG
ACGCGGATGCCTCGGTGGTCGATAACGTGCCGGTACATGTGGCGCTGCGCCCGGAAAAAA
TCATGCTTTGCGAAGAGCCGCCCGCCAATGGTTGTAACTTCGCGGTGGGGGAGGTGATAC
ACATTGCCTATCTCGGCGATCTTTCGGTGTATCACGTTCGTCTGAAAAGTGGGCAGATGA
TTAGCGCCCAGCTACAAAACGCCCATCGTCATCGTAAAGGGTTACCGACCTGGGGCGACG
AAGTGCGTTTGTGCTGGGAAGTGGACAGCTGTGTGGTGCTGACGGTTTAAGGAGCAAAGA
TGAGTACACTTGAACCTGCTGCCCAGTCGAAACCGCCGGGCGGATTTAAGCTGTGGTTGT
CGCAGCTGCAAATGAAGCATGGGCGCAAACTGGTCATTGCGTTGCCATATATCTGGTTGA
TCTTGCTGTTTCTGCTGCCATTTCTGATTGTCTTTAAAATAAGCCTGGCGGAGATGGCGC
GCGCTATTCCACCTTATACCGAACTGATGGAGTGGGCTGACGGGCAACTGTCCATCACTC
TTAATCTCGGTAATTTTCTGCAACTGACCGACGATCCGCTCTATTTCGATGCTTATCTCC
AGTCGCTACAGGTGGCTGCGATTTCGACATTTTGCTGTTTACTGATCGGCTATCCGCTGG
CGTGGGCGGTGGCGCACAGTAAGCCTTCGACCCGTAATATTTTATTACTACTGGTGATCC
TGCCGTCGTGGACCTCGTTTCTGATCCGCGTTTATGCCTGGATGGGAATATTAAAAAACA
ACGGTGTGCTGAATAATTTTCTGCTGTGGCTGGGGGTTATCGATCAACCGCTGACCATTC
TGCATACCAATCTGGCCGTTTATATCGGCATTGTTTACGCTTACGTGCCGTTTATGGTAC
TGCCGATTTATACCGCGTTGATTCGTATTGATTATTCGCTGGTGGAAGCAGCGCTGGATC
TCGGTGCACGACCGCTGAAAACGTTCTTTACTGTGATCGTGCCGCTGACTAAAGGTGGGA
TTATTGCCGGATCGATGCTGGTGTTTATCCCGGCTGTGGGCGAGTTTGTGATCCCGGAAC
TGCTCGGTGGCCCGGACAGCATCATGATCGGGCGCGTGCTATGGCAAGAGTTTTTCAATA
ACCGCGACTGGCCGGTGGCCTCGGCGGTAGCGATCATCATGTTGCTGCTGCTAATTGTGC
CGATAATGTGGTTCCACAAACACCAGCAAAAAAGCGTGGGAGAACACGGATGAATAATTT
ACCGGTAGTTCGTTCGCCCTGGCGGATTGTGATTTTGCTGCTGGGCTTTACCTTTCTCTA
CGCGCCAATGCTGATGCTGGTTATCTATTCGTTTAACAGCTCGAAGCTGGTGACGGTGTG
GGCCGGCTGGTCAACGCGCTGGTATGGTGAGTTATTGCGCGATGACGCGATGATGAGTGC
GGTTGGTTTAAGTCTGACAATTGCGGCCTGTGCGGCGACGGCGGCGGCGATCCTCGGAAC
TATTGCGGCGGTGGTGCTGGTGCGCTTTGGCAGGTTTCGCGGATCAAATGGCTTTGCCTT
TATGATCACCGCGCCGCTGGTAATGCCAGATGTCATCACGGGCTTGTCGCTGTTGTTATT
ATTCGTCGCGCTTGCTCATGCCATTGGCTGGCCTGCGGACCGCGGTATGCTCACCATCTG
GCTGGCGCATGTCACTTTTTGTACGGCTTATGTGGCGGTCGTTATTTCTTCAAGATTGCG
GGAACTGGATCGCTCGATAGAAGAAGCAGCGATGGATCTCGGTGCGACGCCGCTGAAAGT
GTTTTTCGTCATTACGCTACCGATGATCATGCCCGCGATCATTTCTGGCTGGTTACTGGC
TTTTACTTTGTCGCTTGATGATCTGGTGATCGCCAGCTTTGTTTCCGGGCCGGGAGCCAC
CACGTTACCGATGCTGGTCTTTTCCAGCGTGCGGATGGGGGTGAATCCGGAAATCAACGC
CCTGGCAACATTGATCCTCGGCGCGGTCGGAATTGTCGGATTTATCGCCTGGTATCTGAT
GGCTCGCGCAGAAAAACAGCGGATACGCGACATCCAGCGTGCAAGACGTGGCTGAAGACA
CTAAAATTTGCCAACCTGGCTACATAATGCCGCGCATGTCGCGGCATTGTTTTCATGGAA
GACGAAACGTTGGGATTTTTTAAGAAAACATCTTCATCTCATGCTCGCCTGAATGTGCCT
GCGCTGGTGCAGGTGGCGGCGCTCGCCATTATTATGATCCGTGGCCTCGACGTGCTGATG
ATTTTCAATACGCTGGGCGTGCGCGGTATTGGCGAGTTCATTCATCGCAGCGTACAAACC
TGGAGTTTAACGCTGGTCTTTTTAAGCAGTCTGGTGCTGGTTTTCATTGAGATCTGGTGT
GCGTTTTCACTGGTGAAAGGGCGTCGCTGGGCGCGCTGGCTATATCTGCTGACACAAATC
ACCGCCGCAAGTTACTTGTGGGCGGCTTCGCTGGGGTACGGTTATCCGGAGCTGTTCAGC
ATTCCCGGTGAATCAAAACGTGAAATCTTCCATAGCCTGATGCTGCAGAAGCTGCCGGAT
ATGCTCATCCTGATGCTGCTGTTCGTTCCCTCGACCAGTCGGCGGTTCTTCCAGTTGCAA
TAATGTGTATAATCGTCGCCCCTGATGATGTGAAGGTCAATGTATGCAGTGCGCACTTTA
CGACGCGGGTCGCTGTCGTTCCTGTCAGTGGATAATGCAGCCGATTCCAGAGCAACTCTC
CGCTAAAACCGCCGATCTTAAAAATCTGCTCGCCGACTTTCCGGTTGAGGAATGGTGCGC
GCCGGTGTCAGGCCCGGAACAAGGGTTTCGTAATAAAGCCAAAATGGTGGTGAGTGGTAG
CGTTGAAAAACCACTGCTCGGTATGCTGCATCGCGATGGCACACCAGAAGACCTTTGTGA
CTGCCCGCTTTATCCTGCCTCATTTGCGCCCGTTTTTGCGGCGCTAAAACCGTTTATCGC
CCGAGCGGGGTTAACGCCCTACAACGTGGCGCGTAAGCGTGGCGAACTGAAATACATTCT
GCTGACTGAAAGCCAGAGTGATGGAGGCATGATGCTGCGCTTTGTACTGCGTTCTGATAC
CAAGCTGGCGCAACTGCGTAAGGCGCTGCCGTGGTTACACGAACAACTACCGCAGCTGAA
AGTTATTACCGTCAATATTCAGCCGGTACATATGGCGATTATGGAAGGGGAGACGGAGAT
CTACCTGACCGAACAACAGGCACTGGCGGAGCGTTTTAATGACGTACCGCTGTGGATCCG
TCCGCAAAGTTTCTTCCAGACTAATCCGGCGGTCGCCAGCCAGTTGTACGCCACCGCGCG
CGACTGGGTACGACAGCTGCCGGTTAAACATATGTGGGATCTGTTCTGCGGTGTGGGGGG
CTTTGGTTTACACTGCGCGACGCCTGACATGCAGTTAACCGGGATCGAAATTGCATCAGA
GGCCATTGCCTGTGCAAAGCAGTCAGCCGCTGAACTGGGCTTAACGCGTTTGCAATTTCA
GGCGCTGGACTCCACTCAGTTTGCCACCGCTCAGGGGGATGTGCCGGAGCTGGTGCTGGT
TAACCCGCCGCGCCGCGGCATTGGTAAACCGCTGTGTGATTATCTCTCAACGATGGCACC
GCGTTTTATCATCTACTCCAGCTGTAACGCCCAAACTATGGCGAAAGATATCCGCGAACT
GCCTGGGTTTCGTATTGAACGGGTGCAGCTTTTCGATATGTTCCCGCATACCGCGCACTA
TGAAGTGCTGACGCTGCTGGTGAAGCAATAAAAAAGCCGCATGTGCGGCTTCAGATTGCT
GACAAAGTGCGCGTTGTTTATGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACAAAAG
CGTGCAAATTCAATACATTGCATGGGCCATGTAGGCCTGATAAGCGTAGCGCATCAGGCA
ATTTTACCTTTGTCATCAGTCTCAAGCCGCGGTTGCGGCTTTCTGAATCTTACTGTGGGA
ACCACTGGTCACTGATTTTTTGATAAGTACCGTCAGCTTTAATTGCTGCCAGCGCGTTAT
TCAGTTTTTCCAGCAGGGCTTTGTTATCCGGACGTACAGCGATGCCCAGGCCGGTGCCAA
AATATTGCGGATCGGTCACTTTCTCAGTAGCAACACCAAGTTGTGGATTGGTTTTCAGCC
ATTCGTTTACCACCGCTGTGTCACCAAATACCCCATCAATACGACCATTTTTCAGATCGA
TAAAGGCATTCTGATAACTGTCATAAGAGACAGTTTTCACTTCCGGGTGCTGATCCTGAA
TATATTTCTGGTGCGTAGTACCGTTTTCCATCCCAATACGTTTGCCTTTCAGATCGGCAA
ACGTTTTGTAGGTATCTTTTTTGGCAATCACGACGGCTGAGTTTTCATAGTAGGGCGTGG
TAAACGATACCTGTTTGCTACGCTCCGGGGTGATATCCATACCGGAGATTACGGCGTCAT
ATTTTCTGAATTTCAGGGACGGGATCAGGCTGTCGAACGCGTGATTAGTAAAAGTACATT
CTGCCTGCATTTGTTTGCACAAGGCTTTTGCCAGATCGATATCAAAGCCGACAATCTCAT
TATTAGCACCTATAGATTCAAAGGGTGGATAGGTGGCTGAAACGCCAAAATTGATTTTCT
CTGCGGCAGAAGCACCGAAAGTAAAGGAAGCAAGTAAAGCGGCAAGAACTAACTTTTTCA
TGATGGAACTCCCGTCTGTCAATCTTATGATTTTTGGCCGTGTCTGCGGCATGGGATAAC
AATGCCATCAAGTGAATTTATATGCAATAAACATGATTAAATAATTTAAATGAAATAAAA
AAGACGGACAACTTAGTGGGTTGTCCGTCTTCATTATAAGAATTTATGCACTATGTAGGC
CGGATAAGGCGTCCCCGCCGCATCCGGCACAGGCACCGTGCTGATGTCTGATGCGACGCT
GGCGCGTCTTATCAGACCTACAAAACCCCCCGGCGAATGTACGCAGCCACATTAATTTCG
CCGTTCGAATGCCAGCGCTTTGCGCTCGATCAGACGCATCATCAGCGTCAGCAGGCCGTT
AACGACCAGGTAAATAATCCCTGCCGCACCGAACACCATTACATCGTAGGTGCGTCCGTA
CAACAACTGGCTGTATCCCATCACTTCCATCAGCGTAATGGTGTATGCCAGAGAGGTACT
TTTGAATACCAGCACCACTTCGTTGGAATAAGAAGAGAGCGAGCGTTTAAAGGCATACGG
CAGCAGGATCGCCAGCGTATCTTTTTTGCTCATTCCCAGGGCGCTACAGGACTGCCACTG
ACCTTCCGGGATCGCACGAATTGCACCGTAAAACAGCTGCGTGGTATACGCCGCACTATT
CAGCGACAACGCAATCAGCGCACATAACCACGGTTCTGACAACAAATGCCACAGTGCCGG
ATACTCCTGCAAAGTCGGAAACTGGCCCGGCCCGTAATAAATCAGGAAGATCTGCACCAG
CAGCGGCGTACCGGTAAACAGCGTGATATAACCCCGCACCAGCCACACCAGCACCGGCGT
TTTCAGCGTCAGGATGATGGTAAAAATCAATGCCAGAATCAGTGCCACAATCAGCGAGGC
AACGGTTAGCGTCAGGCTGGTGTGTAGCCCTTTCATCAGTTCGGGTAAATACTCAAACAT
TAGCTGGGCCTCCGCTCAAAACGTGTCGCGCGCAGGTCAATGCGTTTGAGAATGTACTGA
CTGAGCAGGGTGATCACCAGGTAAATCGCCGCCGCCACAATGTACCAGGTAAATGGTTCC
TGGGTACGAGTAGCGATGCTTTTTGTTTGCAGCATTAAATCATTCACACTAATCAAACTG
ACCAGCGCGGTATCTTTCAGCAGCACCAGCCACTGGTTACCGAGGCCAGGCAGCGCATGA
CGCCACATCTGCGGCATCACCAGACGGAAAAAGATAGCCGATTTCGACAGCCCCAGCGCC
TGACCAGACTCCCACTGACCCACCGGCACCGCTTTCAACGCGCCCCGAAGCGTTTGCGAG
GCATAGGCGGCATACAGCAGTGACAGAGCGATGACACCACAAAGGAACGGGCTAACGTCG
AAGTTCTCAATGTCCATCTGCACTGGGATCTGCACGAACCCAAGATTGATAGTGAAGCCA
TCCGAAAGCGTCAGCAGCAGCTGCGAGGAGCCAAAATAGATAAACAGCACCACCAGAATT
TCTGGCAGGCCACGCAGAATGGTTACCAGCGCTGAACCTGCCCACGCGACAGGACGCCAT
TTTGCCGACTCCCATACCGCAAAGAACATCGCCAGCGCCAGCCCGACAATCAATGCACAA
ACGGCAAGGCCGACGGTCATCCCGGCGGCGCTTGCTAAAGGAAAAAATTCATTCATCAGG
AATTACTTCTGGAACCATTTGTTGTAGATGGTTTCGTAAGTGCCATCTTTCTTCACTTTT
TCCAGCGCAGTGTTGAGTTTCTGCTGCAGCTCAGTGTTGCCCTGACGTACCGCGATGCCG
AGGCCAGTGCCGAAGTAATCTTTATCGGTCACTTTGTCGCCCACCGCCGCCAGTTTCGGG
TTATCTTTCAGCCACTCAGTGACCACTGCGGTGTCACCGAAGACGCCGTCGATACGCCCG
TTTTGCAGATCCAGTTTTGCGTTCTGGTAGCTGTCATACGGAACGGTAGTGATTTCCGGG
TGCTTATCCATAATGAATTTCTGGTGTGTCGTCCCGTTCTGTACGCCGACTTTTTTGCCT
TTCAGCTGATCAACACTGGTGTATTTGCCTTGCTGACCCACAAACAGGGCAGAGTTGTCA
TAGTACGGGGTGGTAAACAGCACCTGCTTTTCACGCTCCGGAGTGATATCCATGCCCGCC
ATCACGGCTTCTACGCGACGGAATTTCAGGCTTGGGATCAGGCTGTCAAACGCCTGGTTA
GAGAAAGTGCAGGTTGCATCAATCTCTTTACACAGCGCTTGTGCCAGGTCGACGTCAAAA
CCAACGATCTGGTTGTTTGCATCAATCGATTCAAACGGAGGATAGGAGGCTTCGGTAGCA
AAACGAATGGTTTCGGCAGCTGTGGCGGAAAGACTAAAACCTGCAATTAACGCGGCAATC
AGAACTTTTTTCATTGTTGTTATCCCGAATCTTAGTGAGAGAGATAGTTTTTAAATGCTT
CGGTTTGCGGCTCGGTAAAGCAGCTCGCGTCGCCTTGTTCTACGATATGACCATTTTCCA
TATACACCACTCGGCTGGCGGTTTTACGCGCCACTTCAACTTCGTGGGTGACGATCACCT
GGGTAATATTCGTTTCTGCCAGCTCACGAATGATGCTGACGATTTGTGCCGTAATTTCCG
GGTCCAGTGCGGCGGTCGGTTCATCGAACAGCAGTACCTGCGGTTCCATCATCAACGCAC
GGGCAATAGCAACACGCTGCTGCTGACCACCAGAAAGATGCAGCGGGTAACGATCGCTAT
AAGGTTTGAGACGCAGACGTTCCAGCAGTTTTTCTGCACGGGCCAGCGCCTGATCTTTAC
TCAACCCCAGTACACGGCAGGGCGCTTCAATCAGGTTTTGCTGCACGGTCAGATGCGGCC
ACAGGTTGTATTGCTGAAACACCATGCCAACGTTACGACGCAAATCGCGAATCGCTTTGT
CAGAGGGTGTTTTGGTGAAATCGAAATGGTTGCCTGCAATGTTGAGCGTACCGGAGCGCG
GCATCTCAAGCAGATTGAGTACACGCAGCAGCGAGCTTTTACCCGCGCCGCTGGGGCCAA
GTAACACCAGCGTTTCGCCCTGTGGGCAATCCAGCGTGATATCGAACAGCGCCTGATGCG
CGCCGTAGAAGCAATTAATGCCGTTTAATTGAATACTCATTGACACTCGTATACTGGCAG
TCTGATAGCTATTGAGGTCGAAGATAGTACCTTTGACAGAATAATTATGCAATATTTCTG
CTTTAAAAGTTAAAAGCAAAGCGCATTATTCAATAAACATAGCACAAAATAACGGGGGCG
GTGGTCGGCGAGCATAAATGTCGGCATTCCTCACGAAATGCCGGACAATTTACGGGGTTT
ATTGGTTGATCAAGGCGTTAGCGATTCTCGATGGACTGACGGAGCGTACCCGCCGTGGCA
TGAACGCTACCGCCTAAGTAACGCACATCGTCGATGACCCAACACTGGCCTTCCTGAATC
ATTAACACTTCATCCTGCCAACCCTGGTCACCCTGTTTGAGATCCACGCGCAATGGAATG
TTACGGGCATCACGATTAGGGATAGTCGATGCACTGGCAACGTGGGCGCTATCTGGCAAG
GTGGTTCGACTGGAGAATGGATCGTTGGTCAGTAGTTCCCGATGGTTATTATCCCGGGAG
GCATCGCTAAGCAGTGTCGCCAGTTTGTCGCTCAGATAAGGGCGCAAGGCGGTGATGTCG
TTGCTGCGGTGCAAAATGCGGTAGTCATAAAATTGCTGGGCCACGTTATCCGGGCCTCCT
TCAACGCAAGGACCACTGCGTGTGCCGTTATCTTTATAAGCTGGAGTGACTGTGGTGCAG
GCACTGAGGAGCAGTGCGCAGGGGATAAGCATTGTCAATTTGCTGTAGCGCATAATGATT
TCCTTATAAGCGATCGCTCTGAAAGCGTTCTACGATAATAATGATATCCTTTCAATAATA
GCGTATCAGTCTGATAATGCTTTTGAGATCGAAGGCTTAGCAAACAAGGAGATCGATCAT
GCAATTTTCTACAACCCCAACTCTGGAAGGCCAGACCATCGTTGAATATTGCGGTGTGGT
GACCGGCGAAGCGATTTTAGGTGCCAATATTTTCCGTGATTTCTTTGCCGGTATCCGCGA
TATCGTTGGCGGACGTTCCGGTGCGTATGAAAAAGAACTGCGTAAAGCACGGGAGATCGC
CTTTGAGGAATTAGGCTCCCAGGCGCGGGCGCTGGGGGCCGATGCCGTCGTCGGTATTGA
TATCGACTACGAAACGGTCGGGCAAAACGGCAGTATGCTGATGGTTAGCGTCAGCGGTAC
GGCGGTGAAAACGCGTCGATGAGAAGATTCTTCTGGCTGGTCGCTGCCGCTCTGTTATTG
GCAGGGTGTGCAGGCGAAAAAGGCATTGTCGAGAAAGAGGGATATCAGCTTGATACCCGA
CGCCAGGCGCAGGCGGCGTATCCGCGCATTAAAGTGCTGGTGATCCACTACACCGCAGAT
GATTTTGATAGCTCGCTGGCGACACTGACCGATAAGCAGGTCAGCTCGCATTATCTGGTC
CCTGCGGTACCACCGCGATACAACGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAA
GAACTGGCCTGGCATGCGGGGATTAGCGCCTGGCGCGGGGCAACGCGCCTTAACGACACC
TCTATTGGCATTGAGCTGGAAAACCGTGGCTGGCAAAAATCGGCCGGAGTGAAATATTTT
GCCCCGTTTGAACCGGCACAGATTCAGGCGCTTATTCCACTGGCGAAAGATATTATTGCC
CGTTATCACATCAAGCCGGAAAACGTAGTGGCACATGCGGATATCGCACCGCAGCGCAAA
GACGATCCGGGGCCATTATTTCCCTGGCAGCAACTGGCGCAGCAGGGGATTGGTGCCTGG
CCGGATGCGCAGCGGGTTAACTTTTACCTTGCCGGGCGCGCGCCGCACACACCGGTAGAT
ACCGCGTCATTGCTGGAGCTTTTGGCGCGCTACGGTTATGACGTTAAACCTGATATGACA
CCGCGCGAGCAGCGGCGCGTGATTATGGCATTCCAGATGCATTTCCGCCCGACGTTATAT
AACGGCGAAGCGGATGCAGAAACTCAGGCGATTGCCGAAGCATTGCTGGAGAAATACGGG
CAGGATTAGCGCGGCAGTTTTCCGTGGTCGCGTAGCCAGGCGGCAGTTTTCTCGATACCT
TCATCCAGGGTGATGACCGGCTGATAACCTAACTCTTCCTGCGCACGCGTAATATCCAGC
GTAAAGTCAAAATTCAACTTGGAGACGCCGTAGTGGGTCAGCGGCGGCTCTTTTGCTGAC
TTGCGGCCTAAACGCTCCATGCTGCGGGCGATCATATCCAGCATCGGGTAGGGGACGGAA
CGAATACGACAGTCAATATTCAACTCGTCGATCAGCTTCTGCACGATGCTGCGCAGTGTG
CGATGCTCGCCGTTGGTGATGTTGTACACACGCCCGGAAGGTAGCTTATCGCAGGCTTCC
TGGCTTGCCAGCCACATTGCGTGCACGGCATTTTCATAGTAGGTCATATCGACCAGCGCA
CTGCCGCCATGCGGTAACAGAATACTGCCGTAGTGGTGCATCATATGCGCCAGACGGGGA
ATAAAGACTTTATCGTGCGGTCCGAACAGACTTTGTGGGCGCAGAATAGTAAAGCGCGTT
TGTGGATTCGCCTGCGAAAGCATATTGATCACTTCTTCGCTGGCTGCTTTGCTGCGGGCA
AACTCGTTGGCGAAGCGGTGAGGGCGAAAATCTTCTTTAATATCGCGATGGTGGTGATAA
TCGAAGTACAGGGAGGGGGAAGAGATATGAATAAAGTTACGCACACCCCAGGCGACAGCC
CATTCACCCAGGCGGCGAGTGGCGCGAACGTTAGCCAGATCGAAAGCCTGTTGTGTCCCC
CAGGGTGAGGTAAAGCTGGAGCAGTGCCACAGCGTATCAATGCCCGCGAGCATCACTTTA
GCTTGTGATGAAACCAGCTCGGTCAGATCCGCCGGAACAAACTCTGCGCCCATTTTTTCC
AGCAATTTGCCCATTGCCTCGTTGCGACCGGTCGCTCGCACGCTGATGCCTTTCTGGCAT
AAAAACTCTACCGCGTTTCGACCTAAGCCGCTGGTGGCGCCGGTAACCAGTACCTTCATA
TCAATCCACTGTTGTTGAGAAAATAACGTGCGCATTCTTCCGTGATTTCCCCCATGATGC
AATGGGAAACATGAAAGAATAACGCAGGTTTTGTCGATTAATCTGTGCTTTGTTCTGCCA
GTCTGGCGATTTGTTTTGCCATTCCGCGAAAAATAAACAGATGCGCGGGGATCATCAATA
ACCAGTAAAACAGCCCCGGCATACCGTGCGGATGCCAGAAAGCGCGGACATCGATAGTAC
GATAGTCGCCTTTATCTTCCAGGCTAAAACACAGTCGTCCCAGCCCCGGCGCTTTCATGC
CAAATAACAACGTAAGTTGTTTTTCCGGTTCAACGACAATCACTTTCCAGCTATCCACCG
CATCGCCAGTCTGTAAATATTCGCGCTCCGGGCGGCCTTTCGCCAGCTTATGACCGATCG
CGCGGTCCATCAACGCCCGTGTCTGCCACAAAATATTGCCAAAGAAATAACGCTCTTTAC
CGCCGATTTGGTTCACTACCTGCCATAAAGCAGCAAGGCTGGCGGACGTTTTAACGGTAA
ACCCCGCCTGTTTGGCAAAATAACCGTACTCCGGTCGCCAGCGGGCAAAGGCCTGAGCGT
CGTAGCCCCAGTCGCTGGAGTTGACCAGTTTTTCCTCCTCTTTCAACGTGCTACGTACCG
CGTCATCGAAAGCGATCAGCCGTTGTGGGATGAGTGCACGTAGCGCGGTATCATCCGCCA
GCAGATCGTGTTTCAGCCCCTGAATCAACGCCCTGGCGGTGGTGGGCGGTACGGAAGTAA
TCACATTGAGAAACCACACCGAAATCCAGCGGGTGGGGAGGGGGATGGGGATCAACCAGC
GGCGCTTACCGCTCACCGCCATAAAATGTTCAAACTGTTGCTGATAACTGAGCACCTCTG
GTCCGGCGGCTTCGAAGATGCGGTGTTCGCTGGCCGGATGATCTAACAACGCAACCAGAT
AGTGCAGCAAGTTTTCCAGCGCAATGGGCGTGGTGCGTGAACGAACCCAGCGCGGAGGCG
TTAAGACTGGCAGGTTGTAGACCATATCGCGCATGACTTCGAACGCCGCGGAACCTGCGC
CAACGATAATTCCGGCCCGCAGTTCGGTCACGGGTACATTCGCTTCACGCAGAATGTCCG
CCGTAGCCTGACGAGCACGCAGATGATCCGACTGCTCATGTGGCGGGGCCTGCAACGAAC
TAAGAAAGATTAATTGCTTAACTGGTACTTCACGTAGCGCATCGCGGACGTTGAGAGCCA
CCTGGCGCTCCTGAGCGATAAAATCGCCGCCTTCGCCCATGCTGTGCACCAGAAAATAGA
CCGTATCGATATCCTGCAACAGGGCCGGTAGGTTATCCGGCCAGCTGAGATCGACTTTAT
GGCAACTGACGTTTGCCAGTTGCAGCTTTGCAAGCCTGTCGACATGACGTGCCGCCGCCA
GGATCTGATGCCCTTGCTGGCTGAGTGTGCGCACCAGATGCTGACCAATGTAGCCACTGG
CACCGAGAACTAAAATGCGTTGCGGCACGTCTCTCTCCTTAACGCGCCAGGAATGCACGC
CAGTGGGCGGCGACTTCCGCCAGTTGTTCGCGCGAGACGTCAAGATGCGTCACCAGGCGG
ACAATCGGCGAGGCGTTAATCAGCACGTTTCTCGCTTTCATGTATTCGCCTAACGCGGCA
GCATTTTCTTCCCCGACGCGAACAAACAGCATATTGGTGTCCTGACGCATCACATCCGCG
CCTGCTTCACGCAGCTGCTCCGCCATCCAGGCAGCGTTGTCGTGGTCTTCCTGCAAGCGC
GCAACGTTATTTTTCAGGGCATATATCCCGGCGGCAGCCAGAATGCCGGACTGGCGCATC
CCGCCACCTGTCATTTTCCGCCAGCGAATGGCACGTTTAATGTAATCACGATTACCGACG
AGTAATGAACCGACTGGCGTCCCAAGACCTTTCGACAGGCAAATGGTGAACGAATCACAA
TATTGCGTGATCTCTTTCAGTTCGCAGCCGTAAGCCACCACGGCATTAAAGATGCGCGCA
CCGTCAACATGCAGCGCCAGATTGCGCTCGCGGGTAAATTCCCATGCTTCTTTCAGGTAT
TCCCGCGGCAACACTTTGCCGTTGTGGGTGTTTTCCAGACTGAGTAATTTGGTGCGGGCG
AAATGGATATCGTCGGGTTTGATTTTCATCGCCACTTTATCCAGCGGTAGCGTGCCGTCG
GCAGCCGCGTCTATGGGTTGCGGTTGAATACTGCCCAGCACCGCCGCGCCACCGGCTTCA
AACAGATAGTTATGCGCGGCCTGACCGACAATATACTCTTCGCCGCGTTCGCAGTGACTG
AGCAGAGCGACCAGGTTGGCCTGAGTGCCGGTAGGCAGAAAAATGGCGGCTTCTTTACCG
GAAAGCTCTGCTGCGTAGTCCTGCAGAGCATTAACGGTAGGGTCGTCTCCGTAAACGTCG
TCCCCAACCGGGGCGGCCATCATCGCTTCGAGCATGGCGCGGCTTGGTCGGGTAACGGTA
TCACTGCGTAAATCAATCATGGCATGTCCTTATTATGACGGGAAATGCCACCCTTTTTAC
CTTAGCCAGTTTGTTTTCGCCAGTTCGATCACTTCATCACCGCGTCCGCTGATGATTGCG
CGCAGCATATACAGGCTGAAACCTTTGGCCTGTTCGAGTTTGATCTGCGGTGGAATGGCT
AACTCTTCTTTGGCGACCACCACATCCACCAACACCGGACCGTCGATGGAGAAGGCGCGT
TGCAGGGCTTCATCAACTTCAGACGCTTTTTCTACACGGATACCCGTAATGCCGCACGCT
TCGGCAATGCGGGCAAAGTTTGTGTCGTGTAGTTCGGTGCCGTCAGTCAAATAGCCACCA
GCTTTCATCTCCATCGCCACAAAGCCCAGCACGCTGTTGTTAAAGACGACAATTTTCACT
GGCAGTTTCATCTGCACTACTGAGAGGAAATCGCCCATCAACATGCTAAAACCGCCATCG
CCGCACATGGCGACCACCTGACGTTCTGGCTCTGTCGCCTGCGCACCCAGCGCCTGCGGC
ATGGCGTTAGCCATCGAACCGTGGTTAAACGAACCTAACAGGCGACGCTTGCCGTTCATT
TTTAGATAACGTGCCGCCCACACCGTTGGCGTACCAACGTCACAGGTGAAAATAGCGTCA
TCGGCGGCAAAATGACTAATTTGCTGCGCCAGATATTGCGGGTGAATGGCTTTCTCGCTC
GGTTTAGCTAAATCGTCCAGCCCTTTGCGGGCGTCGCGGTAATCTTCCAGCGCTTTATCC
AGAAACTTGCGATCGGCTTTTTCTTCCACCAATGGAAGCAATGCACGCAGAGTCGACTTG
ATATCGCCGACCAGTGCCATATCCACCTTGCTGTGAGCGCCGATGCTGGCTGGGTTGATA
TCAATCTGAATGATTTTGGCATCGGTCGGGTAGAAGGCGCGGTAGGGAAATTGCGTGCCG
AGTAGCACTAACGTGTCGGCGTTCATCATGGTATGGAAACCTGACGAGAAGCCGATTAAC
CCGGTCATTCCAACATCATACGGATTATCGTATTCGACATGTTCTTTACCGCGCAGGGCA
TGAACAATAGGCGCTTTAATTTTCCCGGCAAACTCAACTAACTCTTTATGCGCCCCCGCG
CAGCCGCTGCCACACATCAGGGCGATATTGCTGGAATAACGCAGCAGTTGCGCCAGTTTG
CGTAACTCTTCTTCTTCCGGCGTCACGACTGGTTGTGGCGCATGATACCAGTGCATGGTT
GCCCCTTCTGGCGCAGGTTTTAACGCCACGTCGCCTGGTAACACGACAACCGAAACGCCA
CGGTTAAGCACCGCTTTGCGCATGGCAATCGCCAGTACTTGTGGGATCTGCTCCGGGCTG
GAAACCAGCTCGCAATAGTGACTACATTCGCGGAATAGCTCTTGTGGGTGGGTTTCCTGG
AAATAGCCGCTGCCAATTTCGCTGGAGGGAATATGAGCGGCAATCGCCAGTACCGGAACG
TGATTGCGGTGGCAATCGAACAGGCCGTTGATTAAGTGCAGGTTGCCGGGGCCGCACGAT
CCGGCGCAGACCGCCAGTTCTCCGCTAAGTTGTGCTTCAGCGCCAGCGGCAAAGGCCGCC
ACTTCTTCGTGGCGGGTGGACATCCACTCGATGGTGCCCATGCGATTAAGACTGTCACTA
AGACCGTTCAGAGAGTCGCCTGTGACTCCCCAGATGCGTTTCACCCCTGCCGATTCGAGT
GTTTTGGCGATATAAGCTGCAACCGTTTGTTTCATGGTTCTCCATCTCCTGAATGTGATA
ACGGTAACAAGTTTAGTTCATCTGACGGAGGGGGAAGGGATGGGAGAGAAAGGAGGCACT
AACGGTTAAATAGCCCGATGAAAGGAATATCATCGGGCATAAGGCGATTATGCGAGAACC
AAATCCCCCTGCGGATGGCAGGAGCAGGCCAGTACGTAACCTTCAGCGATTTCGGCGTCG
GTCAGCGTCATTGTGCTGCTCACCGTATATTCACCGGAAACCACTTTTGTCTTACAGCAG
CCGCAAACACCCGCACGGCAGGCAGCGACAACCGGAACGTTATTGCTTTCCAGCGCCTCC
AGTAGCGTGGTGCCAACCGGGGCGTAAAATTCTCGTGCCGGTTGCAGTTTGGTGAATTTC
AGACCGCTGGTCGCCGCTTCTGCTACTGGGGTGAAGAATTTCTCTTTAAAGAAACGCGTC
ACGCCGAGCGCTTTCACTTCCTGCTCTACCCAATCCATATACGGAGCCGGGCCGCAGGTC
ATCACGGTACGTGAAGCTAAGTCAGGTACACCTGCCAGCAGTTCGCGAGTGAGACGACCA
GCGATAAAGCCTTCGGTAACGTTATTTTCTGCCACCAGCGTTACCGGATAGTTACGCCAC
TCATCGGCGAAAATAACATCCTGCGGCGTACGCACGTTGTAGATCACCCGCACATCGGCC
TGTGGACGGTTCTTCGCAAGCCAGCGACGCATCGACATAATCGGCGTGACGCCGCAGCCT
GCCGCCAGCAACAGGAATTTATCTTCTGCTTTATCGTCGCAGGTAAATTCCCCCATCGCG
TCCGAAAGCCAGAGATAATCACCGCGTTTTACATCGCGCGTCAGCCACTGGGAGCCGACA
CCGTCATCAATCCGCCGCACGGTCAGGGTGATATATTCACTCACGCCTGGCGTGGAGGAA
ATGGTGTAAGCACGCAGCGTTTCCGCTGAGTTTCGCACGCTGACCAGTGCATATTGCCCG
GCGCGATATGGGTAGTAATCGTGGCAAATCAGGGAAATCGTCCACACATCCGGCGTTTCT
TGCGTAATGTGATGAACCTGCATCCGCCACGGGCATTGATTCGTTGGCATCGTCATCGAC
AAACTCCTTACGCGCTCAACAGTTGCTTCATGTCTTCTTCAACAGTGGTGATAGAACGCA
GGCCGAATTTCTCGTTCAGCACCGCCAGCAGGTCTGGTGTCAGGAAACCAGGTGCAGTCG
GGCCGGTGACGATATTTTTCACGCCCAGAGAAAGCAGCGTCAGCAGAATGACGATCGCTT
TCTGTTCAAACCAGGAGAGCACCAGCGACAGCGGCAGATCGTTGACACCGCAGCCCAGTT
TCTCTGCCAGAGTGACAGCCAGAATAATCGCTGAGTAAGCATCGTTACATTGACCTGCAT
CTACCAGACGCGGCAGACCTTCGATATCGCCAAACTCAAGTTTGTTAAAGCGATATTTAC
CACAGGCGAGGGTCAGGATCAGGCAGTCATCCGGCACGCTGGTGGCGAAATCGGTGAAGT
AGTGGCGCTCGCCGCGTGCGCCGTCACAGCCACCAAGCAGGAAGATATGACGCAGTTTTT
CACGGCTCACCAGATCAATCAGCGTATCAGCAGCGCCAAGCAGCGTCTGGCGACCAAAAC
CCACGGTGATAAGGTGCGGAATTTCGCTGTACGGGAAGCCTGCCATCTGTTGCGCCTGGG
TGATAACCGCAGAGAAATCATCACCGTCCAGATGACGCACGCCAGGCCAGCCAACAATGC
TGCGGGTCCAGATACGATCGTCATAAGCGCCTACGGTTGGGTCGATGATGCAGTTCGAGG
TCATCACGATGGGGCCAGGGAAACGAGCGAACTCCACTTGCTGATTCTGCCAGCCGCTGC
CGTAGTTACCGACCAGATGCTTGAATTTACGCAGCTCCGGGTAGCCATGCGCAGGCAGCA
TTTCGCCGTGGGTGTAGACATTAACGCCCGTGCCTTCGGTCTGTTCCAGCAGGTTGTAGA
GATCTTTGAGATCGTGACCGGAAATCAGAATGCATTTACCCGCCGTCGCTTTGACGTTGA
CCTGGGTTGGCGTCGGGTGACCGTATTTACCGGTTTCGCCTGCATCCAGAATGCTCATCA
CTTTGAAGTTCATCTGGCCGATTTCCATTGAACACTCAAGAAGCGCGTTCATATCGGCAG
GCCAGGTCCCCAGCCACGCCATGATTTTATGGTACTGGGCATAAATATCGTTGTCGTATT
GACCGAGAACATGCGCGTGTTCCATATAGGCCGCCGCACCTTTCAGGCCATACAGGCACA
GCAGACGCAGGCCGAGAATGTTTTCGCCAATCGCCGCTTTATCTTTGTTAGGGGTAAATT
CTGCTGCCTGACGTTGCAGCTCGCCGAGATCGTCGCTCACCAGTTGCAGGTCAGCCATCG
GGTTATCGACGCGCGCGTTGGCATCTACAGCCAGGCATTGCGCTTTCAGCGCCTCGCGCA
GGGCAATCGCTTCACGAGCGTAGCCGACAATACGCGGAGAATCGAAGTTAACGTTGGTCA
GGGTTGAGAAAAAGGCACGTGGCGCGAAGCTGTCAACATCGTGGTTGATGATGCCGTATT
CACGCGCTTTTACCGCCCAGGCAGAAAGCCCTTGCAGCGCCGCGATGAGTAAATCCTGAA
GGTCAGAAGTTTCCGCCGTTTTACCACACATCCCCTGCGCGTATGAGCAGCCGTTTCCTG
CCGGAGTACGGATAGTTTGTTCACATTGCACACAAAACATGATCACACCTTTTAAAGTTA
TATTTAATATACATGTTTAAGGTTAAGACGCTTAACGCGGGGATAAAAGGGATTTTTCAT
GCAACTTTAAGGGAGATTGATTTAGCGCAATTTTGGCGGCAGGGATCTACCGCCAGAGAG
GTATTACGCAGAGAAAAAGGCGATGAGGATCGGCACTAACAGGCTAAGAATAAAACCGTG
AACAATTGCCGCCGGGACCATATCCAGCCCGCCAGTACGTTGAAGAACGGGCAGGGTGAA
ATCCATTGATGTGGCACCGCATAAGCCCAGTGCAGTAGAGCGGCTGCGGCGAATCAGCCC
AGGGATCAACATAATAGCAATCAGTTCACGGGCCAGATCATTAAAAAACGCCGCGCTCCC
GATTACCGGACCAAAAGATTCGGTCAATAAAATACCGGAAAGAGAATACCAGCCGAAACC
GGAGGCCATTGCCAGCGCGGTATTGATGGGGAGATCAAGAATAAAGGCGTTAATTAAACC
ACCAATTAATGAACTGACAACCACCACCACGGCGACAATCATTCCCCGGCGATTAAGGAC
AATCTGCTTTAAGGTCATGCCATTATTGCGCAACTGAATACCAACGAGGAAAAGTAGCAA
AATTAACGTGTATTCACTGGCTTCGGTCGCGTGTTGTAAGAAAGCCAGTCCACTTAGACC
AATGGCAAAACCAATCACTACTACGCCGCACAGTTTTAGCGACTCCAGCGCCATCGCAAT
ACGCGACGGGAGTTTTTCTTGCTGATGGTGGTTGCGCCACGGCAGGCCTCGCTCCAGCCA
CATCAGGGCGGCAATATTACACAGTAAAATAACGGTAATACTGACGGCAGAATAATGCAG
AATCGCCAACAGGTTACTGGCGAGGTTATCGAGAAACGCCAGACTGATACCCATAAAAAA
GAGAATAAGGTAAACCATCCAGCTTAATAGCTGATTAATAACTTTTAACGCAGCTTGTTG
GCGAAGCGGAATGAGGTAACCCACAATCAGGGGAACCAGAATGATTAACAGCCCAGAAAA
CATGAAAACCCAGTCCTTGCAAAGATGAAGTCGAAATGCGCGATGACACACTACTGAAAG
CGGAAGGACGAGTAAAGTTGCAATTAAAAGGAAATGTTATGCATAAGGAGCAGTAGAGTA
TTCGTTTTCATTTAAAGATATTCTTGCGCTTTAATTACAAACTGCACCGATGTTGGTGGC
GTCAAAATCGCCGAGGCGTTCCCTGAAGGCCGGGGCAGCCCACATGGATGTGGGCTGAGG
GCGCGTTTTACAGGGATGTTACCTCGCGCCCGACCCGGTAGCCGTAAGGGATAAGTCGAG
GGCACCGCGCAGCGGCGATTTTGTTCGCCAGAGCCCGGGGGTGCAGGGGGCGGCGGCGAT
TGGCCGCCCCCTGCGCGCTCCTTGCGCCAGTGGCAATATGTTGCTTAGCTCATGAAAGGA
GCGCAACAAGATGATGAATCAACATATAACAACATCTTAAAAAAAGGCCTGACATTACGC
CAGGCCTTCTGCGTTAATTAATCACGCTTTTCCAGCAGGGTCCGGTAAATCAGACCACCG
ATAATGCCGCCGACAATTGGCACCACCCAGAAGAACCACAGTTGTTCTAATGCCCAGCCG
CCCTGGAAGATAGCAACCGCGGTGCTGCGCGCCGGGTTAACAGAAGTGTTAGTCACCGGA
ATACTAATTAAGTGAATCAGGGTTAAGGCCAGACCAATAGCGATCGGCGCAAAACCTGCC
GGCGCGAATTTGTCGGTTGCGCCGTGGATCACCAACAGGAAACCTGCACTCAATACCAGT
TCAACTACCAGCGCGGAAAGCATGGAATAACCGCCTGGTGAATGCTCGCCATAACCGTTA
GAAGCAAAACCGCTGGCTGCCGCGTCAAAACCCGTTTTACCACTGGCAATTAAATACAGC
AGCGCCGCTGCAACAATACCGCCGACAACCTGGGCAATTACGTAGCCAACGACTTCTTTT
GCCGGAAAACGTCCGCCAGCCCATAAACCAATAGTGACCGCCGGGTTAAAATGACCACCA
GAAATATGACCAACAGCAAAGGCCATCGTCAGAACGGTCAGACCGAACGCCAACGCCACG
CCGGCAAAACCAATGCCTAATTCCGGGAAGCCTGCGGCCAGTACAGCACTACCACAGCCA
CCAAAAACAAGCCAGAAAGTACCAAAACATTCAGCTGCTAATTTTCTGAACATATCCACC
ACAATTAAAAATTGACCCTGTGAAAAATATGGTCGTTTTATAGGGTCGTCGTAAAAAAGT
GACGACGGAAATAATGCGCGGCTATTTTAAAAACGAAGGCGAGTCATTCACCAGATAAAT
AAATCCAGTAAATTTGATTTAGGGCAACAGCGGGTTGCCCCATATAGTCATTTGTCTGAT
TGACAGTGTAGTGCACGCAAAAGATTTAATCCTTTAGGCGTAATAAAAAATAATTTATCA
TGCTAATTATTTGATTTTGTTGTTTTTGCAGACTTATCAGCAAGAGGGAGTATAACGCGA
TTATTCGCTCATTTTTCAGACATTTGCCATGCTTAAATGTGATGTCATCACGTATTAGCA
AGGCCTTTCCCGTTATACTGCCAGCGTAAAGGATAAGTCACATATTTCTGGAGGGGATAT
GATTCTTGAGCGCGTTGAAATTGTGGGTTTTCGCGGTATCAACCGTTTGTCGTTGATGCT
GGAACAAAACAACGTCCTGATTGGGGAGAACGCGTGGGGTAAATCCAGCTTGCTGGACGC
CTTAACTCTGCTGCTATCGCCAGAATCAGATCTCTACCATTTTGAGCGCGACGATTTCTG
GTTCCCGCCGGGAGATATCAACGGGCGAGAACATCATCTGCATATTATTTTGACCTTCCG
CGAATCGCTGCCAGGCCGACATCGGGTTCGCCGTTATCGGCCGCTGGAAGCGTGCTGGAC
GCCATGCACCGATGGCTATCACCGTATTTTTTATCGTCTGGAAGGGGAGAGTGCGGAAGA
CGGCAGCGTGATGACACTGCGCAGTTTTCTCGATAAAGACGGACATCCGATTGATGTCGA
GGATATTAACGATCAGGCACGCCATCTGGTGCGTTTAATGCCGGTGCTGCGCTTGCGTGA
TGCCCGTTTTATGCGCCGTATTCGTAACGGCACGGTGCCAAATGTCCCTAATGTGGAAGT
CACCGCGCGCCAGCTCGATTTCCTCGCCCGTGAGTTATCCTCACATCCGCAAAATCTCTC
TGATGGGCAGATTCGTCAGGGACTTTCCGCAATGGTACAGCTGCTTGAGCATTATTTCTC
TGAGCAGGGGGCCGGACAGGCGCGATATCGTTTAATGCGGCGGCGAGCCAGCAATGAGCA
ACGAAGCTGGCGCTATCTGGATATCATCAACCGGATGATTGACCGACCTGGTGGGCGCTC
GTATCGGGTTATTTTGCTCGGCCTATTTGCTACTTTGTTGCAGGCAAAAGGCACATTGCG
ACTGGATAAAGACGCCCGTCCATTGTTGCTGATCGAAGATCCAGAAACCCGTTTACACCC
CATTATGCTTTCAGTTGCCTGGCATCTGTTGAATCTTCTGCCATTGCAGCGCATTGCCAC
CACCAACTCGGGTGAGTTGCTTTCGTTAACGCCGGTAGAGCATGTTTGCCGACTGGTACG
TGAGTCCTCGCGCGTTGCCGCCTGGCGTCTGGGGCCGAGTGGCTTGAGTACCGAAGATAG
CCGACGCATATCCTTTCACATTCGTTTTAACCGTCCGTCATCGCTGTTTGCACGCTGCTG
GTTGCTGGTGGAAGGGGAAACGGAAACCTGGGTTATCAATGAACTGGCGCGTCAGTGCGG
ACATCATTTTGATGCCGAAGGGATCAAGGTCATTGAGTTTGCCCAGTCCGGGCTAAAGCC
ACTGGTTAAATTTGCCCGCCGAATGGGGATTGAATGGCATGTACTGGTCGATGGCGATGA
AGCAGGGAAGAAATATGCCGCTACGGTACGCAGCCTGTTGAATAACGATCGGGAAGCCGA
ACGAGAACATTTAACGGCGTTACCGGCGCTGGATATGGAACATTTTATGTATCGCCAGGG
ATTTTCCGATGTGTTCCACCGCATGGCGCAAATCCCGGAAAATGTACCGATGAATCTACG
CAAAATTATCTCGAAAGCGATCCATCGCTCTTCCAAACCCGATCTTGCCATTGAAGTGGC
AATGGAGGCAGGACGTCGTGGTGTGGACTCCGTACCGACGCTGCTGAAAAAAATGTTCTC
ACGCGTGCTGTGGCTGGCGCGCGGTCGCGCGGATTAACCGCGAAACATCGTGGCCATTTG
TGGCTGAATAGCGTCGAGCATCTCATAGCGCCGACGGTATTCAGCCCGTTTTTTACTGGC
GATTTCGGCAATCTCTTTTCGTGCTATCTGTGCTGGAAGGCGGTAATGGCGTTCAGCATC
ACATACGCCGCCAACCGATTCCCAGAAAGCGTTGTAATCAGCGTGGATCTTGCCTTCTTT
ATCGCGATAACGCAGGCTGCGGTAAATATGCGTTTCATTGCTGACGGCAATAATCTGCTC
TACCTGCAAACGTTGGGCAAACAGACAGGCCGCTTCCATCACGAGGCGTTTGGGAAATAG
CCCGTGGCAGGCTTTCGTCGCATTCTGGATTTCCTGATGTGGAATTTCCCATTTTGCGCC
TTGCAGTCCGCCAATAAACATCGTTCTTTTCCCCTGATATTCACACAGGGTAAACGTGAT
CTCTGCCAGAGGAATACCTTCGCTGTTGCGGAACAGGATTGTGCTGTCACCTTCTTTATC
CATTGAGATCATCATGGTCAGCTCAAGCGTGAACTGCTCGCCGTTTTTGCCTTCCAGCTT
CGCCAGTTGCAGCCCGGGGGTATTCAAATATAAGCTGAATTCTTCCGCCGACATACATTC
GCGGAGTAACGCATAATGGTAACGTAACGCCTCCAGCAATTGCTTACGGCTAAGATTCGC
CGCAAGGTAAGGGCGATGCAGACGCACAGGCAGTCGCGGCTGGCGCGTTAACAATACATT
GAGATTAGGCCAGTGGGAAAGTTCGTTCATCCACTCAACGCTTAAACGCGGCATAATCAA
CGAGCGCAGCAAAAATTTCTGGCGAAAACTACGGCGATGCCAGAATTTACCCGGCCGACA
CTGTCCACGTGCCAGACTAAGAAAAAGTGACAGGCTGCTGAGAGATTCAGATGGCGTAAA
GGTCCGTTCAGTTAGCTGCGACATATTCATGAAATCAATGGTTATACATGGCGTCGATTT
CACCATTGCGTATCTTAACCAAACATCAATAGTGTGATTACTAACGTAAATTTTAGGGTT
TTGTTGATATTTCGTTGAAGTTAATGACCCGGATTGGCATATGGAGTATTCAGAAAATTT
ATGAAAAAGCGGAAAACCGTGAAGAAGCGTTACGTTATTGCGCTGGTGATAGTCATCGCC
GGACTGATTACGTTATGGAGAATTCTTAACGCACCCGTGCCGACTTATCAGACGCTGATT
GTGCGCCCCGGTGATTTACAGCAAAGCGTGCTGGCGACCGGAAAGCTGGACGCGCTGCGT
AAGGTTGATGTGGGCGCGCAGGTCAGCGGTCAGTTGAAAACTCTGTCGGTGGCGATTGGC
GATAAAGTAAAAAAAGACCAGCTTTTAGGGGTTATTGATCCTGAACAGGCTGAAAACCAG
ATTAAGGAGGTCGAAGCAACGCTGATGGAGCTACGTGCGCAGCGGCAGCAGGCGGAAGCG
GAGCTGAAACTGGCGCGGGTGACGTATTCCCGTCAGCAACGTCTGGCACAAACGAAGGCT
GTTTCACAGCAGGATCTCGACACCGCCGCGACGGAGATGGCTGTGAAACAGGCGCAAATT
GGCACCATTGACGCGCAAATCAAGCGCAATCAGGCTTCTCTCGATACGGCTAAAACCAAT
CTCGATTACACTCGCATCGTTGCCCCGATGGCCGGGGAAGTCACGCAAATCACCACTCTG
CAAGGCCAGACGGTGATTGCCGCACAACAAGCACCGAACATTCTGACGCTGGCAGATATG
AGCGCCATGCTGGTAAAAGCGCAGGTTTCTGAAGCGGATGTAATCCACCTGAAGCCGGGG
CAAAAAGCCTGGTTTACGGTGCTTGGCGATCCACTGACGCGCTACGAGGGGCAAATCAAG
GATGTACTACCGACGCCGGAAAAGGTTAACGACGCTATTTTCTATTACGCCCGTTTTGAA
GTCCCCAACCCCAATGGTTTGCTGCGGCTGGATATGACTGCGCAAGTGCATATTCAGCTC
ACCGATGTGAAAAATGTGCTGACGATCCCTCTGTCGGCGTTAGGCGATCCGGTTGGCGAT
AATCGTTATAAAGTCAAATTGTTGCGTAATGGTGAAACACGCGAGCGTGAAGTGACGATT
GGCGCACGTAACGATACCGATGTTGAGATTGTCAAAGGGCTTGAAGCGGGCGATGAAGTG
GTGATTGGTGAGGCCAAACCAGGAGCTGCACAATGACGCCTTTGCTCGAATTAAAGGATA
TTCGTCGCAGCTATCCTGCCGGTGATGAGCAGGTTGAGGTGCTGAAGGGCATCAGCCTCG
ATATTTATGCGGGTGAGATGGTCGCGATTGTTGGCGCTTCGGGTTCCGGTAAATCGACCC
TGATGAATATTCTCGGCTGTCTGGATAAGGCCACCAGCGGCACCTATCGCGTCGCCGGTC
AGGATGTTGCCACGCTGGACGCCGATGCGCTGGCGCAACTGCGCCGCGAGCATTTCGGCT
TTATTTTCCAGCGTTACCATTTGCTTTCGCATTTAACCGCCGAGCAGAACGTTGAAGTAC
CCGCCGTCTATGCTGGTCTTGAGCGGAAACAGCGACTGCTTCGTGCCCAGGAGTTGCTGC
AACGGCTGGGGCTGGAAGACCGTACAGAGTATTATCCGGCACAGCTTTCGGGTGGTCAGC
AACAGCGCGTCAGCATCGCGCGGGCATTGATGAACGGTGGTCAGGTAATTCTTGCCGATG
AACCAACCGGCGCACTGGACAGCCATTCTGGCGAAGAGGTGATGGCGATCCTGCATCAGC
TGCGCGATCGTGGGCATACGGTGATTATCGTCACCCACGATCCGCAGGTCGCTGCTCAGG
CCGAGCGGGTGATCGAAATTCGCGACGGCGAAATTGTGCGCAATCCTCCCGCCATTGAAA
AAGTGAATGTTACTGGCGGGACGGAACCTGTTGTCAACACGGTGTCTGGCTGGCGGCAGT
TTGTCAGCGGTTTTAACGAGGCGCTGACGATGGCATGGCGGGCGCTGGCAGCGAATAAAA
TGCGTACTTTACTGACCATGCTGGGGATTATTATCGGTATTGCGTCGGTGGTTTCCATTG
TCGTGGTGGGTGACGCCGCCAAACAAATGGTGCTGGCGGATATTCGTTCTATTGGTACGA
ATACTATTGATGTCTATCCCGGGAAAGATTTTGGCGATGACGATCCGCAATATCAGCAGG
CGCTGAAGTACGACGACTTAATCGCCATCCAAAAACAACCGTGGGTCGCCTCAGCCACAC
CTGCCGTCTCGCAAAACCTGCGCCTGCGTTATAACAATGTTGATGTTGCTGCCAGTGCCA
ATGGCGTGAGCGGCGATTATTTTAATGTCTATGGCATGACCTTCAGTGAAGGAAACACCT
TTAATCAGGAGCAGCTGAACGGTCGTGCGCAGGTCGTGGTTCTCGACAGTAATACTCGCC
GCCAGCTTTTCCCCCATAAAGCAGATGTGGTTGGCGAGGTGATTCTGGTCGGCAATATGC
CCGCCAGAGTCATTGGTGTGGCGGAAGAAAAACAGTCGATGTTTGGTAGCAGTAAAGTGC
TGCGTGTCTGGCTACCTTACAGCACGATGTCCGGGCGAGTTATGGGCCAGTCGTGGCTTA
ACTCCATTACTGTCAGGGTGAAAGAAGGATTTGACAGCGCCGAGGCGGAACAGCAACTCA
CGCGTTTACTTTCACTGCGCCACGGAAAGAAGGATTTCTTTACCTGGAACATGGACGGCG
TCTTGAAAACTGTTGAAAAGACCACACGTACTTTACAACTGTTTCTGACGCTGGTGGCGG
TGATTTCGCTGGTGGTGGGCGGTATTGGTGTAATGAATATTATGCTGGTGTCAGTGACCG
AGCGGACGCGGGAAATTGGCATTCGCATGGCTGTAGGTGCGCGAGCAAGCGATGTTTTGC
AACAGTTCCTGATCGAAGCCGTACTGGTTTGCCTGGTCGGTGGCGCGTTGGGAATAACAC
TGTCACTGTTAATTGCTTTCACCTTGCAGCTTTTCTTACCCGGCTGGGAGATTGGTTTTT
CACCGTTGGCGCTGCTGCTGGCGTTTCTCTGCTCGACGGTCACCGGGATTTTATTTGGCT
GGTTACCCGCACGAAAT