MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download LD3-11-2.seq
 Deletion LD3-11-2
 Length 22656
 Fasta Format

>LD3-11-2
TGCGTGTAACGTGGGTATTATGGGAACATCCTTGAGCGGACTGGATGCGGCAATGGCAGT
GGCTATTCAGCATGGTTCGTTCATTGAAGATGATAAACAACACGTCGTTTTTCACCGCGA
TAACGCAAGTGAAAAGCTAAATATCACGTTGTTGTCGCGCACGGGTATTTTACCCGAAGC
CGATTTCTATTGCCCTATTCCCTACGAGCCCTTACACATCGTCACCGATCAGGCATTAAA
TGCTGAGATTCAAAAAGGCGAAGAGGGCCTTTTGGATCGGGTATTTAGATTGATAGTAGA
GGAAATCAAGTTTGCTGATCCAGACTGGAGTCAACGCATAGCCTTAGAGAGCCTGAATGT
CGATTCCTTTGCTCAAGCCTGGTTTGCCGAGCGCAAACAACGCGACCCATTTGACTGGGC
AGAAAAAAATCTCCAGGAAGTCGAACGCAATAAACGAGAAAAACATACTGTTCCCTGGCG
TTATGTCATTCTGCGCCTGCATGAAGCCGTACAGGAAATTGTTCCACATCTGAATGAACA
CGACCATAAACGGTTCAGTAAAGGCCTTGCCCGGGTTTTCATCGATAATTATGCGGCAAT
CCCTTCAGAGTCTATTCGTCGCCTACTTGCCTTACGTGAAGCGGGAATCATTCATATTCT
CGCCCTCGGTGAAGACTACAAAATGGAAATTAATGAGTCGCGCACCGTCCTGAAAACGGA
AGACAACAGCTACTCGTTTGACGTTTTTATTGATGCCCGCGGACAACGTCCGCTTAAAGT
GAAAGATATCCCTTTCCCTGGGCTACGCGAGCAATTACAGAAAACAGGGGATGAAATCCC
TGATGTTGGCGAAGATTATACGTTACAGCAACCCGAAGATATTCGTGGGCGCGTAGCGTT
CGGCGCGTTGCCCTGGTTGATGCACGACCAGCCTTTCGTTCAGGGACTTACGGCATGTGC
AGAAATTGGTGAGGCGATGGCTCGGGCGGTCGTAAAGCCTGCATCCCGTGCTCGTCGGCG
TCTTTCGTTTGATTAAAGGTAAAGCTATCAGCACTCAACAAACTGATGCTGTTCATTAAG
ACGATAGCGGACTCCGGCTCGAATATTGTTTTCACCTTCAATGGCGACGGCGAAGCGAAC
TCTTTCGCCGTCATGATATGCCAGTGCGGCGCTTCCTCCTGGCCCGAGAATAATTGAGTC
GACCACGCCCGTGCTCACTACCGTTGAATTTTCACCGCTGGCAATGATGTGTACATTGTC
GCCGCTGTTGGCAATTCTGGCGTTTGCGCCAAAGCTGGCGATTTGCACCAGGTCACCATT
ACTGGCGACATGACACCGTTCACCCAATGTACAAACGCGTACTCGCATTCCGGTATTCGC
AATCCGACTGCTATCTCCAGCGCTGCTTATCCGCGAAGAATTACCGGTTACAGCAACCCG
TGCGCGTTCACCGGAGCTGCCAATGTGACTGTTAAAGCCGACACTTCCAATCCGCACGCT
ATAACCCATACTGGCAATTTGCGCGGCATACCCAGCGGTTGCGATTCTGGCGTTATCCTC
ACAACAGCCGATGCGAGCATGATCGTCGCTGCGGGCAAACTGACTGCAAAATGGTCTCTC
TCCGGGGTCTGTGGCCAGTTTTTGCATAGAGGAAACTTCCTGATGCGCGAAGTTTTCATC
CGCCAGCCATTTTTTCCACGCATACTCAACCAGACTCTCCGCCCAGTCCGTATATCCTTC
CTCAATCAGTGCATGATGAATATCGGCATAACTACCGCCGCGTGGGAAATGGCGCAGGAA
CCAGCGATACATCACCGCTCCGATACGCCATTCTCGCAGGTCTGCTTGTGTAATGATCAT
TCGTTAGTGCCGGTGATAGCCATCGACCATGCTTTTAAAGGTTTCGTGTGGCGTACGCCC
CGTGGTGCAAAGATAAAGATGACCGAAGATAAAAAAGAGGCTTATAAATGCCAGAGCAAA
ATGTGTCTGCAATAACCAGTATCTTACGCCAGGAAACACATCTCCCACGGCTTGCGGATA
GAGACACAGCAGCCCCGTCAATAGTAACAACGGCAGCAATCCATACATGACACCAACATA
GGCGACCTGCTGTAAGGGATTAAATTTAGACTGGGTTGTTGCCGGGAAAGGATGTTCTTC
CCCCTGCATAATGCCAAACAAATAAAATCGCGTTTGTTTTGCCGCTCGTTCCAGCCACCC
CTGACGACGAATGCGATAGTGGTGACCATTATCCCCAACGGCATTGATCAGCACAAAGCC
GAGCCAGCATGCCAGTAACAAAAATCCGCAAACTTCATGCACCGCAACCAGACTTTTAAC
CGCAGTTGCGCCCACCATCGCAAAGTGATTTATCAGCCCACTGGCCAGCAACAATACAAA
GAGTAACGCATTCGACCAGTGCCATAATCTGACCGCTTTGCTGTAAAGATAAATCTTCTC
ACCATGATCGGTGGCTGATTTCTTCACGCCACGAGCACGAAGCAAGGCATGCAGCCCCAG
CACCAACCACATCCCAACCAGCAATACTCCGGCAATGATCAACCACACCGGCCAAAATTC
GGGAGTGAACTGTGGCACATAGTTCGCTAACTGGCTCTGAAACTGTTCAGCATGTTGCGA
CGGGTTCATACATTTTCCTTTTTAATCAAATGTTGACCGAACCGGCGATACAGATGCGGT
TTCCCGGCACCAGGTAGCTGATATTGATAGTATTTATTTTGCTGCAACCACGCCTGAATT
TCTGGGCTATCTTCGCGACCAAAGATCAATGCGTGTTCCGGGCAGGCGCTGACGCAAATG
GGCGGAAAGCCTTTTGCCAGTCGGGACTCAGCGCAGAAATCACATTTATCTGCCACTTTA
GTGACAGGGTTAAGGTAGCGAACCTGGTACGGACAAGCGCCAATGCAATAACTGCAGCCG
ATGCACTGCGATTTTTCTACCCGCACGATCCCCTGCTCATCACGCCACGACGCCCCCGTC
GGGCAAACGTCGATGCACGGAGCATCTTCGCAGTGCTGACATGACTGGCGAAAAAAGTGA
TACTGCGTTTCGTTGTCGTTATCGGTGACTGGAATGTGTGCTATCGATAAACGGCTTCCC
TGAGCGGGGACGTGGTTAGTTTTACGGCATGCGCGGGCGCAAATATTACAGCCATTGCAC
CGTGACTCGTCATGAATCATGGCATACCGAACTTCCTTTTCTTGCCTCGTGTTCGCTAAC
AGAGAAGACGCAGAACCAGTAAAAAAGATTACTGTTCCCATCCCCAGAACAAATTTGCGT
CGAGTGAAGGACATCTGATTATCCCCTAATGCAGTGGCTGCAACTGTCCACCCTATCCAT
GACATCTCCCTGAAATTTCAGGGGTTCTGAAACTGCTCTACCTCGAACCATTCGCATAAG
CCATAAGCCTTGCCATAGGTCATAAATCGCTCGCTAAACAAGTACAACACCGCCGTCGAT
GACTCCACCTGCCGTATATCGGCATATTCAGGTGCAACATCCATCGCGGCGATCGCGGCT
TCAATCTGCGCTTCCTGGAAGTAATATGGCGCTTGCATCAGCATGGCGACTTTGTAAGGA
CGAGGATACGTCTGGCACTCAAAACGAACGGCGTGTGCAATGGCGCGACAAATGTCCTGC
TCCACAACTTGCAAAGACATCGCCGCGTAGTTTTCACTCATGGCCTGCGTTGAGTAATAG
TAATCATCCTTGCTTCCCGTCAAACAAGCGATATCCGCGTAGTCTCCGTTCTGCTTAATG
CTTTCCAGCAAAACTGACAGTTCCTCTTCTGCAACCAAATAGGGTGGCGAGAGAAACACG
GCGCGCGCCACCAGCTGCCCAGCCGCAGAATGCTGGCGAATGAACTCAGCCAGGATTTCA
GCAGGTTCTGGTTCGGTTACCGTATCAACGGGGTGACGCATCCCCTGCAACCATTGCCGC
TTCGCCTCGTCAACTTCGCTGACTTTCGCTAACGGCAATTCATCCTGATGGTTCATCTTA
CCCATTCCTTACGCAGGCAGTAGATTGTGTGCTGCCAGATCGGCGGCAATATCTTCCAGC
CCCAGACGCTGCAATGTTTCGCGGGTTGGACAACCAAGCTGTGGGTCCCAGCCCATTTCT
TTGTAGAACATCGTGAGCGAAGCATGCATATCGTCACGATCCATTTTGTCAGTACCTTCA
GTAAAGACCGGGATCTGCGGATCCTTGTCGAATACCCAGGAACAGATAAGATCGTGTTCA
TTACGCATATCTTTGGTTTGCATCAGTTTTACCGTGTAGGCACGATGCAACGTAAAAATA
CGCTCTGCAGCTAAATCTAATTTTTCCTGAGTCATCTCTTCGCCGGTGATCGCTTTGAAG
AATTTGGCTTCAAGCGCCAGATCGCCCCGGTAATTACGGCTTTTCAGCGGCGAAACGGTC
ATTGGCCAGACCCAGTTGCACAGGGTGACGGCGTTATGCAAACAGACCCGCAACAGCGAC
CACTTTGCATATTTAATTTTTGCGTCATTGATTGGCGTGTAGTTTTTGGTTTCATCGTAA
GCATCTTCAGAACCAAAAAGTTCTTTCGCCACTTCACGTTGCAGTTTCAATGGCAAGCCG
GAACCAATAAAGTTGATATGGGTATGCGTCATGCAGTCACGGTTGAACATACAGTTAACA
ATGGAACCGACCTGCGCTGACGCTTCATTGGCATGGTGAACCGGATAGCCAAACGGCGAC
CAGAGTTTATTTTTCGCGTAGCCCCAGTACTCTTCACCCAAATTCCAGCGTTCTGCGATG
GCATATGAACCATCAGCCAGGTGACTCAGCTCACCCACACGATGCGCCAGACGGTAGTAA
AAATCTTTAATGAAGTTAACGTCACCCGCTTCCAGTTGATCCCAGCGAATTTCTGCATAC
TCTTCAGCTGGCAGAACACGCTTGAACACACCTTTGCTGTAACAATAAGTAAAGTCGCGA
TGCAACTGCCCGTAGTTACACCATAGGCCGTAGTCATCGAACAAATTCAGACCCACCAGG
TTACCAATCACACGACCATCGTCTTTATCTTCAAAATCTTTCGGCCCGTTCGGGAAGATG
GTGGTATGGACAAAGTTTGCTACACAAGTGTTACCACCTGTGCTGGGCACGCCAAACTCT
TTCACCCGAGGAATATTCATTTGGGTCATACAACGGATCGGGCAAGAGTGGCAGCCGCTC
ATTTTTACTGTGTATTTCTCTGCCGCCGGTCCTAAGTCAAAAACGGATTTATAGGTACGA
AAGCCGACCGTATTCTGATTGCCTGGCGGAATTTCACCCGTTTCAATCGGACCACCTTCA
GCCGCGCCCCAAAACAGCCCTTTACGTGCTGTCCAGCGTGACTTGGGATCTGAATACTCT
GCCCACGATTGTGGCGTACTTGGCACGACATGGTTGTTATTCGCACCAATAAGTTCAGTC
ATCATGTAATCATTGAGACGCTTCATCTCCTGACGATCGGCAATGTTGACCCCTTTCGTC
CCTTCAACCGCAATCGCTTTCAGGTTTTTCGAACCCATTATTGCGCCAGTTCCCGCACCG
CCGCTGTGGTTACGGCTATTCAACATGCCAGAGAGAGGAACAAGGTTTTCCCCAGCCTGA
CCAATAGCCGCCACACAGGTTTCCGGACTGGTCAATCGACAAATTTCTTCCGTCGTTGCG
CGCGTCCCTTTTCCCCATAAGAAATCGGCTTTTTCCAGGCTAACTTTGTCATCTTTAATC
TTCAGCCATACCGGTGATTTCGCCTTCCCTTCGATAATAATGACGTCGTATCCAGCGAAT
TTCATTTGCGCTGCAAAAAAGCCACCCATATGGGCATCGACGACTAAATTTCCTTTGGTA
AAAGTAGAAAGTGAGGTGATATTTACGCGAGAACTACAGGGGGCACCAGATCCAGTTAAT
GGGCCGGTAGCAAAGACTAATTTATTCGCTTCATCGAAAGGTTTCGTGCCTGGCGGTACT
TCGTCATACATAATTTTGTAGCCGAAGCCCATGCCACCGACAAAACTTTTAAACTTACTG
GAATCTTCGAGGGTAATATTTCCTGTCGTGAGATTGACTCTTAATATATTACCTGTCCAA
CCGTTAGCCATGATTTTTTCCTTTGCAAGATTCACACAGTAATATCTTTCCACTCGATAA
TTTTTAACGCCCCTGTTGGGCAGGCGTTTGCGCATTCACCGCATAACACACATTTCGAGG
ATTTTTTACTTTCGGTATTTACGGTGGCCATCATCCACGGGCATGCCGTAGTACAGGCGC
TACAGCCAATACAGCGTTTATGATCGACGGTAATACAGCCTTCTTTCTGCTGCCAGGTAA
TCGCACCAATCGGGCAGACGTTCATGCATTGCGGCTCTTTGCATTGACGGCAGGTGTCCG
CGGTATAGTTGAGATCGCCATACAGGCCGCCGCCAGAGCCAACCCCGTTGTCGCCAAAGA
AATAATTGCGATGGATTTTGATACGGGAGAAGAATGTCCCTACTGAGCCATCGTTGAAGT
TGGTACAAGAGATTTCACAGCGGTGGCAACCCGTGCATCGCGCTCGCTGGGTCACCAGCA
CCCCTTTGGGGGTATTTATCAACCCTACTGTGCCGCTATCAATATCTTCCTGTTTGCAAC
CCAAAAGTGACAGTAACGCAGGGGCAATTGTTAGACCAGCAAGGCCTTTTCCTGATATAC
GCAAGAATTCTAATCGCGTTAAGCCAATATCTAATAGTGGACGATCAACCGGGTTCATTT
ATTTCGCATCCTCTTCGCAAACACAGTGCTGACAATTCAGCAGCCTGATATTAAGCATTC
AACTAATACGCTGCTGACTCTGTCCCCAACACCAGATATTTTCCCTAACCCGATAGTGTA
TGAGAAAAGATTAACGCCGATAAACTAATCCTTTATGGTTAGGAGAAAAAATAATGTGAT
TATTCTGAGCCCTTAACATTGATCGTTATCAATTAAAATTACAAAGCAAGAAATTATAAG
TGAACTGATATTTATTATCATTTGAAATAAATTTAACTTAAGCGACAATTATTTGTGACT
TTCATTGCAGAAAATAAAAATAACATTATCGCTATAAATTAAAATACATACCGAAATTCG
TATAATTTCAGCAGTTGTTATTTAGAATGATTAACTGGACCGCAACTGAAGCAAGAATAT
CAGGATGAAGCTTACCGCCTCATCCTGAATGGTCATTTTACCAGTGCGTTAATGACGGTT
TCCATCGCCTGCTTTTCCAGCTCACTGCGCTGAATGCGTTTATTGGCTAATGCTGTACGT
AATACGCCTGCGATAACAATATGCTTTGGTTCCTGCCCCAGATCGCGCATTTCCAGCACA
ACTTTACCGACAACTCTGCACATTTCTCGGTACAGTTCATCCTCTTTTGTCCGATTTCCC
ATTCTTTATACCTATTTATCATGCCAACTATCAGCATATATCAATCTAACCAATTAAACA
AAAATCAAACAAAATCAGACAAATAACGCGATAAATTATTTTAACTGTAGCAATTGAGCG
ATGATATATTTATACACCGGATGAACTTTCACTTATCCTCACACTGACAACTTCGGCACC
AGACGTTGCGCAAACAGTGAAGTTTTTGCGTAACCTTTTCCCTGGAACGTTAAATCTTTG
ATAACAATTTATTGTCTAACAAGTTGTATATTTTTTGAAACGCTGTTTTTGTTTTCCTTT
TGGATTAATTTCAGCGTATAATGCGCGCCAATTGACTCTTGAATGGTTTCAGCACTTTGG
ACTGTAGAACTCAACGACTCAAAAACAGGCACTCACGTTGGGCTGAGACACAAGCACACA
TTCCTCTGCACGCTTTTTCGATGTCACCTATCCTTAGAGCGAGGCACCACCACTTTCGTA
ATACCGGATTCGCTTTCCGGCAGTGCGCCCAGAAAGCAAGTTTCTCCCATCCTTCTCAAC
TTAAAGACTAAGACTGTCATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAACC
GAATCTGAAGAGATGTTAGCTAAAATGCTGGACGCTGGCATGAACGTTATGCGTCTGAAC
TTCTCTCATGGTGACTATGCAGAACACGGTCAGCGCATTCAGAATCTGCGCAACGTGATG
AGCAAAACTGGTAAAACCGCCGCTATCCTGCTTGATACCAAAGGTCCGGAAATCCGCACC
ATGAAACTGGAAGGCGGTAACGACGTTTCTCTGAAAGCTGGTCAGACCTTTACTTTCACC
ACTGATAAATCTGTTATCGGCAACAGCGAAATGGTTGCGGTAACGTATGAAGGTTTCACT
ACTGACCTGTCTGTTGGCAACACCGTACTGGTTGACGATGGTCTGATCGGTATGGAAGTT
ACCGCCATTGAAGGTAACAAAGTTATCTGTAAAGTGCTGAACAACGGTGACCTGGGCGAA
AACAAAGGTGTGAACCTGCCTGGCGTTTCCATTGCTCTGCCAGCACTGGCTGAAAAAGAC
AAACAGGACCTGATCTTTGGTTGCGAACAAGGCGTAGACTTTGTTGCTGCTTCCTTTATT
CGTAAGCGTTCTGACGTTATCGAAATCCGTGAGCACCTGAAAGCGCACGGCGGCGAAAAC
ATCCACATCATCTCCAAAATCGAAAACCAGGAAGGCCTCAACAACTTCGACGAAATCCTC
GAAGCCTCTGACGGCATCATGGTTGCGCGTGGCGACCTGGGTGTAGAAATCCCGGTAGAA
GAAGTTATCTTCGCCCAGAAGATGATGATCGAAAAATGTATCCGTGCACGTAAAGTCGTT
ATCACTGCGACCCAGATGCTGGATTCCATGATCAAAAACCCACGCCCGACTCGCGCAGAA
GCCGGTGACGTTGCAAACGCCATCCTCGACGGTACTGACGCAGTGATGCTGTCTGGTGAA
TCCGCAAAAGGTAAATACCCGCTGGAAGCGGTTTCTATCATGGCGACCATCTGCGAACGT
ACCGACCGCGTGATGAACAGCCGTCTCGAGTTCAACAATGACAACCGTAAACTGCGCATT
ACCGAAGCGGTATGCCGTGGTGCCGTTGAAACTGCTGAAAAACTGGATGCTCCGCTGATC
GTGGTTGCTACTCAGGGCGGTAAATCTGCTCGCGCAGTACGTAAATACTTCCCGGATGCC
ACCATCCTGGCACTGACCACCAACGAAAAAACGGCTCATCAGTTGGTACTGAGCAAAGGC
GTTGTGCCGCAGCTTGTTAAAGAGATCACTTCTACTGATGATTTCTACCGTCTGGGTAAA
GAACTGGCTCTGCAGAGCGGTCTGGCACACAAAGGTGACGTTGTAGTTATGGTTTCTGGT
GCACTGGTACCGAGCGGCACTACTAACACCGCATCTGTTCACGTCCTGTAATATTGCTTT
TGTGAATTAATTTGTATATCGAAGCGCCCTGATGGGCGCTTTTTTTATTTAATCGATAAC
CAGAAGCAATAAAAAATCAAATCGGATTTCACTATATAATCTCACTTTATCTAAGATGAA
TCCGATGGAAGCATCCTGTTTTCTCTCAATTTTTTTATCTAAAACCCAGCGTTCGATGCT
TCTTTGAGCGAACGATCAAAAATAAGTGCCTTCCCATCAAAAAAATATTCTCAACATAAA
AAACTTTGTGTAATACTTGTAACGCTACATGGAGATTAACTCAATCTAGAGGGTATTAAT
AATGAAAGCTACTAAACTGGTACTGGGCGCGGTAATCCTGGGTTCTACTCTGCTGGCAGG
TTGCTCCAGCAACGCTAAAATCGATCAGCTGTCTTCTGACGTTCAGACTCTGAACGCTAA
AGTTGACCAGCTGAGCAACGACGTGAACGCAATGCGTTCCGACGTTCAGGCTGCTAAAGA
TGACGCAGCTCGTGCTAACCAGCGTCTGGACAACATGGCTACTAAATACCGCAAGTAATA
GTACCTGTGAAGTGAAAAATGGCGCACATTGTGCGCCATTTTTTTTGTCTGCCGTTTACC
GCTACTGCGTCACGCGTAACATATTCCCTTGCTCTGGTTCACCATTCTGCGCTGACTCTA
CTGAAGGCGCATTGCTGGCTGCGGGAGTTGCTCCACTGCTCACCGAAACCGGATACCCTG
CCCGACGATACAACGCTTTATCGACTAACTTCTGATCTACAGCCTTATTGTCTTTAAATT
GCGTAAAGCCTGCTGGCAGTGTGTATGGCATTGTCTGAACGTTCTGCTGTTCTTCTGCCG
ATAGTGGTCGATGTACTTCAACATAACGCATCCCGTTAGGCTCCACGGAATATTTCACCG
GTTCGTTGATCACTTTCACCGGCGTTCCCGTCCGCACGCTGGAGAACAAGGCTTTAATAT
CCGGTGCATTCATGCGAATACACCCTGAACTGACGCGCAAACCGACGCTGTCCGGCGCAC
TGGTACCATGAATGAGGTATTCGCCATTACCATGCGCGAGGCGCAGTGCGTAACGTCCTA
GCGGGTTATTTGGTCCGGCAGGAACGACTGGCGGTAATTTAATGCCACGCTCCAGCGAAC
GCTGACGAATGCCTGCCGTAGGCGTCCAGGTTGGGTTAGGGATTTTCTGCCCAACACGCG
TTTCCATCACCGGCGTTTCCAGCCCCTGCAATCCAATACCTATTGGATAAACCTGCACAA
TATTTTCTCCCGGCGGATAATAATAAAGGCGCAGCTCTGCAAGGTTAACGATAATCCCCT
GACGCGGTGCATCAGGTAATAACAGTTGTGAAGGAATAGTTATCGTCGTACCAGGTTTTG
GCACCGGGGCGATAGTGTTATTGGCTTCAAGGATCAACATTGCCGCAGTATCAAAACGTC
GGGCAATAGCCTGAAGGTTTTTATCCCCTTCTTGCACCGTATACGTTTGATTTTGCCCAA
CCAGTCGGCTTCCGGTTGGTGGTAGCGGATAATCAACCGCCCAGGCAGCCTGGATGGCGC
TAAAAGCGCCGATAAGCGTGAGTGTAAGCAAAGACGCGCGTTTCATTGTAAACCTCCTGT
ATTTGCCGGAGACTCACGCTGAAACGTCGGATGGCGCTTATGTTCACCTGAAACCAAAAC
ACTCCTGTGCAGGTCAGTGTAAACATTGACCATCCGGCAATGTGAGCCAACCGGATGAAA
GCTGTCCTTTTAGTTTAGCTAAGTGCAGCGGCTTTGGCGCGAATTGCGCGAATCATCGCT
TCCAGACCTTGTGAACGAGATGGGGTGAGATGTTGGGTGAGCGCCATTTTTTCAAACCAC
GGACGCACATCGAAATTGACAATATCCTGCGGCGTCATCTGATCGTAGAGAATAAAGACG
ACCGCAATAAGCCCTTTCACAATCGCCGCATCGCTGTCGCCCTGTAATTCAATAATTCCC
TGGGCATTCTGGCGCATGACAATCCACACCTGACTCTGACAGCCCTGAATGCTATTTTGT
GGACTTCTGTCTTCGTCGCGTAATTCTGGCAGACGCTGGCCCAGCTCAATAATGTAGAGA
TATTTCTCTTCCCAGTTGGCGCAGCGTAAAAAATTACGCAGCAACTTTTCTTTATCCGGC
AATAAAGCCATAGTGCCTCCCTGTTATCCCAGCAAACGGTGAATACGTTGCAGGCCGGTC
ACCAGACGATCCACTTCTTCATGGGTGTTATACATGGCCAGCGACGCCCGACACATCGCA
GGGACGTTGTAATAGGCCATCAATGGCATTGCGCAGTGATGTCCGGTACGCACAGCAATG
CCGTAATTATCGAGAAAACTGCCAACATCATAGGCGTGGTGTTTACCGAGATTAAAAGCA
ATAACGCCAAGCCTGTTTTGTGGGCCATAGAGAGTGAGATCCGGTACAGATTCCAGCTGT
GATAGCGCATAATGCATCAGATTCTGTTCATACTCGGCTATGTTATTAAGCCCCAGCGCC
GAAACATACTCCAGCGCCGCGCCAAGACCAATGATGCCCCCGGTATTGGGTGTACCGGCT
TCAAACCGCCATGGTGCTTTGGTCCAGGTAGTGCCTTCACTCAGGCTGACGGTGGCGATC
ATAGAACCGCCCCCTTCCCACGGCGGCATCTCCTGCAACAAGGCTTCTTTCACATAAAGA
ATGCCAATTCCGGTGGGGCCATACAGTTTATGCCCGGAGAACACGTAAAAGTCGCAATCC
AGCGCCTGAACATCCACCGGATGATGCATCACCGCCTGAGCGCCATCCACCAGCACTTTT
GCGCCATGCTGGTGCGCAAGCGTGATCATTTCCGCCAGTGGATTTTCTGTGCCAAGCACG
TTGGAGACATGAGTAATTGCCAGCAGGCGAGTTTTCTCATCAAACAGCGTAGGCAGCGTC
TCCAGTTGCAACGTACCATCGGGATTGAGCGGGATCACACGCAGCTCTGCGCCAACGCGT
GCGCAAAGCATCTGCCAGGGAACAATGTTAGCGTGGTGCTCCATCTGACTGATGATGATG
TTATCGCCCGCCCGCACGTTGCTGTTGCCCCAGCTATTGGCGACCAGATTGATCCCTTCC
GTCGTGCCGCGGACGAACACCAGCTCTTCCGCCGAACGGGCATTAATAAACAGCGATGCC
CGCTTGCGCACGTTCTCCATTTTCTCGGTCGCCTGGGCGCTTAAGGTATGAATACCACGA
TGCACCGCCGCGTAGCCATGACGATAAAACTCGGCCTCGGCGTCAATCACCTGGCTCGGT
TTCTGCGCACTGGCGGCGCTGTCGAGATAAGCCAGCGGCAAACCGTTTACCTCACGCGAA
AGCACCGGAAAGTCGGCCCGCACTTTGTCGACGGAAAAAATCATCTTGCACCTCCTGGCA
GCCGTTGACCGATTCGGGCCAGCACCTGCTGTTTAAGCCCCTCATCACGCAGTGCTTCCG
TCAGTTCGGCAGCGAAGGCGTAAATGATCATCTGCTGGGCATCCTGCTGATTGATCCCGC
GCGAGCGCAGATAGAATATCTGTTCATCATCAATACGCCCCACCGTCGCGCCGTGGCTGC
ATTTCACATCATCTGCATAGATTTCCAGCTGCGGTTTCGTATCCACTTCCGCCAGTTTGC
CCATCAGCAGATTGTTGTTGGTCATCTGACCATCCGTTTTGATGGCGTGCTGCGCGACGT
TGATCAAACCGTTAAATACCGCGCGGCCTTTGTCGCTGACGATAGTTTTGTGCAACTGTC
GGCTGTTACAAAAACCTTTATTGTGTTCCAGCCAGGTACGGGTATCACACACCTCGTTTT
TCACCGGCATCGCCAGGCTATTGATCCGCAGCGTGCTGTTTTCGCCATTGAGTTGCGTAC
TGGTGTTGTGTCGTAACACTGCGCCACCCAGCAGGAAACTGTGGCTAAATGCGGTGGCAT
CCTCAGCCAGCAACAAATCGTTATGAGCAAAGTGGTGACTGAGCGGGTTTTCAAACGCCA
GCTTGATATGCTGCAAGTGGGCATTCGCTGCGACGTTGATAGTGAACCGTGCCCCGGTAA
AATGACGAGCATCATTCAGGCTGACAAAATGTTCGATCACCGTTGCTTCGGCACCTTCCG
CCAGATCCAGATGATGTCGGTAATGGGCAGTGTTCACCTCTTCACCTGCCACGCCCTGGG
TGATATGCATTAACAGCAATGGCTTTGCCGGCCGTTGACCGCGCTTCACGGCGATATGCG
TCACGCTTTGTGCCAGGCTTTCCGTCAAATGCAGAAACACTTCCGCCTGAATAGCGTCGG
GTAAACCCTGACGGTCGTCGTTAATGCTCACTTCATATCCGCTGCCTTCAGTTGCATCGC
TCAGTGCGGGCACGTAACGCCCATCGACAAACACCAGCCGCACGGAGTCTAACGTTAACG
CTAAGGCATCACGCTGCTGTGGGGATATCTCTCCCGCAATGCTGACAAACTGGCTATTGA
TCAGCCCTTCCAGCGGCGTATATTTCCAGTTTTCATGTTTACGTGTCGGCAGTCCGGTAC
GCAGCAATTGTTGTAAATGCTGCTGTGCTTGCGGGGAGCGTTTTGTCCCTTCAGCTTCAA
ACAAGTGATGCCACTGTTGCAGCGCGTTACTGCTGTTCGGTAAGCCAGCCATAACCCTGC
TCCTCCAGTTGTTTGACCAACGTGAAATCGCCGGATTTCACAATTCGTCCCTGATATAGC
ACATGAACGTAATCAGGCTTGATGTAGTCGAGAATGCGTTGGTAGTGCGTAACAATGATG
AATGAGCGCTTGCCATCACGCAGCGAGTTCACGCCATCGGCGACCACTTTTAATGCGTCA
ATATCCAGCCCGGAGTCCGACTCATCAAGAATGCATAACTCCGGTTCCAGCACCGCCATT
TGCAAAATATCGTTGCGCTTTTTCTCGCCGCCGGAAAAACCAACGTTTACCGAACGGGTT
AATAAATCTTCCGGCATCTTCAGGAGAGCGATTTTCTCTTCCATCAAATCCTGAAAATCA
AAGCGGTCGAGCGTTTCCTGGCCGCGATAGCTGCGCACCGCATTAAGTGCCGTTTGCAGG
AAAAACTGGTTACTGACACCTGGAATCTCCACCGGATACTGGAAGGCCATAAAGATGCCT
TCGCCCGCGCGATCTTCCGGCGACAGCGCAAGCAAATCTTTGCCTTTGAACTCAACCGTG
CCGCCCGTCACTTCATAATCTTCTCGCCCGGCAAGCGTTGCCGATAAGGTACTTTTGCCC
GAACCGTTTGGCCCCATAATGGCGTGAACTTCGCCGGGATGAACGTCGAGGCTTAATCCG
CGCAGGATAGCTTTATCTTCCACGCTGACGTGTAAATCTTTAATACTTAACATGTTTATT
CCTTATCCGACGCTGTGTTCAAGACTGATGGCGAGGAGTTTTTGTGCTTCAACGGCAAAT
TCCAACGGCAGCTCCGAGAACACGTCTTTGCAGAAACCGTTAACAATCATCGAGATGGCG
TCTTCTTCGCTGATCCCGCGTTGCAGGCAGTAAAACAGTTGATCTTCACCAATACGTGAT
GTCGTTGCCTCGTGTTCCAGTTGCGCACTATTGTTACGACACTCAACATACGGGAAGGTA
TGCGCCCCACAATTAGCGCCAATCAGCATTGAGTCGCACTGAGTGAAATTGCGCGCATTG
GTTGCCGTCGGCATGATTTTCACTAAGCCGCGATAACTGTTCTGACTATGTCCGGCAGAG
ATCCCTTTCGAGATAATGGTCGATTTGGTGTTTTTACCGATGTGGATCATCTTGGTGCCG
GTATCCGCTTGCTGATGACCGCTGGTCAGCGCCACTGAGTAAAACTCACCAATGGAGTTA
TCGCCGCGCAAAATGCAGCTGGGATATTTCCACGTAATCGCTGACCCGGTTTCTGATTGC
GTCCATGACATTTTGCTGTTTTCGCCTTCGCACAAAGCACGCTTGGTGACGAAGTTGAGA
ATACCGCCGGTGTTGTTATCGCCAGGAAACCAGTTTTGTACCGTGGAATATTTCACCTCG
GCGTTTTTATGGATGATGACTTCCACCACTGCCGCGTGTAACTGATAGCTGTCACGCACC
GGAGCGGAACAGCCTTCAATGTAGCTGACGTAGCTGTCTTCGTCGGCCACCAGAATGGTG
CGCTCAAACTGCCCGGTTTTTTCTGCGTTAATGCGAAAATAGGTGGAAAGTTCCATCGGG
CAGCGCACGCCTTTAGGCACATAAATAAACGTACCATCAGAGGCTACCGCCGCATTAAGC
GCGGCAAAGAAGTTGTCATTCCCCGGCACCACGGTGCCGAGATATTTACGCACCAGTTCC
GGGTGATCGTGGATCGCCTCACCAAAGGAACAGAAAATAATTCCCTGCTCCGCCAGTTTT
TCGCGATAAGTAGTGGCAACCGAAACTGAGTCGAAAATGGCATCCACCGCCACCTCTTTG
CCTTCCCGCACGGGAACGCCCAACTGCTCAAACGCCGCCTCCACCTCTTTACTTAAAAAG
GCGTTCGCGCCAGTTTGCTGCACCGCGCCAGGTTCAGACGCGCAAGTGTCGTCACAATTA
CCGCACGATGGTGCTGAGTAGTAGCTGTAATCCTGATAATTCAGCTTGTCGTAGTGCGCT
TTCAACCAGTGCGGTTCTTCCATCTCCAGCCATGCGCGATAGGCGTTTAGACGAAACTCC
AGCATCCACTCCGGCTCATTACGCTTCGCCGAAATTGCGCGCACCACCTCTTCGTTTATC
CCCTTTGCCAGCTCATCGGTGGCTAACTGGGTGAAGAATCCTTCTTTATAATTCAGCGGG
CCGCCGGTCCAGGTTTTGACATCGTCAGTTGCTTCAGTATTACGAGACATAGTACCGCCT
ATACCCCAAAGCTTTCGCCACAGCCACATTCATTCTGGGCTTTAGGGTTGTGAAATTTGA
ATATCTGATTAAGTCCTTCACGAACGAAATCGACTTCCGTGCCATCAATAAACGGCATCG
CTTGCAGCGGGACAAACAGCTTCGCGCCGTCGTGTTCAAACAGCAGATCGTCTTTGTCCG
GCTCGCTAACACTGTCGAGCACATAGCCAAAGCCCGCGCAGCCCGTTTGCTTCACGCCTA
AGCGCACGCCGACCATACCCGGCTGCTTTGCCACCAGCTCACGGATGTGTATCGCCGCTG
CGGGTGTCAGCGTTAAGCCTTGCCAGGCGAAATCTTGTGGGTTAAAGGTTCCTGAATGCA
TGTCCATCGATTTACCTCACTTCATCGCTTTCAGCGTATAACAGCATGTTAGTGATAATG
ATTATCAGTTCAACCCAGCAAACGCAGGGGCTTTACCGTAAAACATGCTTTTTGCCTGCT
TTTAATAAGCATAGACCCTGATGTGTGGGTTAACAGGCACGCTAAGAATTAGGTATCTCA
TTGTTAGATAATGGTTATTATCTAAGGAGCATTAAGGCTGTGATGAAAAAGAAAAAGTTG
TATTGAAAATGACTATTTAAGAGATAGGTAAAAAAGTGCAGCGTTCAGAAATAAGAAAAC
CCTTAAGTCTGTGCGACACAGGCTTAAGGGTTTCTACCCCATCCGGCGCTTATCTCCGGC
ACTCTCAGTGGCTTAGCTCTTGAAGGGGCGATAAGAATAATCTCATAAAGCTAACCCGCC
GTTTTAACACAAACTGCGATTAGTATTATTTTTGAACAATATCAGGCGGTAGATAAGCAG
TATTAAGAAGGTCATCGAACCTGGACGGAGGTTAATCCAGGTCGATTTGGCGAACTTGCG
GCATTAAGTCAGGATCAATGCACGCCCAGACGCCAGGCAAAGTAGATTTCTTCTTTTAAT
TCAGCAGAAGAGAGAGTAAGCAGGTCAGCAAATTCAAGTTCTAGTTGTTTCAGACGTTTG
AGATATTGGGCAGGTGAAAGATTGCTCTGGTCACGGCGTAAAAATTCAATGGCCAGCTGG
GTGGGATCAAGTTGAGTAGACATAGCATCCTCGCTTTTAGACAAGACCTGCACAGTATAC
CACCGTTTACTGTGCAGATAATGACCAAAAGCAATATGCGTCACACTTTTCTGGTGACAA
CGTCACAAAATGGCGGTCGTCAATCGTGACGAACAGCACAAACGCCCTTTCTCATCGAAG
ATTTCAATCTGCCAGACCTGGTGACGCGAACCGAGATGCAACGGTTTGCATACGCCGCGC
ACCCGCCCTTCTCGTGCCGAGCGGACGTGGTTAGCATTGATTTCCAGACCAACCACTTTT
TGCTCACCTTCGGTACATAAATAACCGGCAACGGAACCGATACTTTCGGCCAGTACCACG
GATGCTCCTCCATGCAGCAACCCGAAAGGCTGCTTTGTCCGCGAGTCTACTGGCATTGTC
GCTTCAAGGGTGTCATCACCAATATGTTCAAAGCGAATATCCAGGAACCCCACCATGTTT
CCTTCACCCATAGCATTCAGTGCTTCCAGGGTGATTTTCCGTTTCCATATCATTTAATAA
TCTCCAGTAAAGCCTGCACAGGATGGCGTACCCCCGTGCCTTCAACCCGTTTTACCTGGC
TACGGCAGGAATATCCGGTCGCCAGACAGCGGTTACGCGGCAGTCGCTGCATAGCCTGAT
GCCAGGATAACTCATAGATCCCGAGCGAATTTTCATGGTTTTTCGCTTCATGTCCGTAAG
TCCCTGCCATGCCGCAGCAACCCACGCTGACATTTTCCAGTTTCGCGCCAAAACGGGCAA
ATATCGCGGCCCATTGTGCTGGCGCACCCGGCAAGGCGGTAACTTCGGTACAGTGACCAA
AGAAATACCATGATTCACCGCTGACTGTAGCCACTGGCTGTGACTCAAGTGCGCTTGCCA
GCCATTCATTCGCCAGTAAGACGTTAAACTCGCCACGCTCCTCGCCCAGCGCCAGTTTAT
ATTCATCGCGATAACAAAGTACCAGCGCCGGATCGACGCCCACCATTGGCATACCCAGCT
TCGCCATACGGTTGAGGAAATCCGCCGTCTTTTTCGCCGTCTTCGCAAAACGATTAAGAA
AACCTTTAATATGCTGGGCTTTGCCATTTGGCGAAAATGGCAGTAACACAGGCTGGAAAC
CTAATTTTTCGACCAGACGGACAAAATCCGCCACCACTTGCGCATCGTAATAGCTGGTAA
AGGGGTCCTGCACCACCAACACTGTGCGCGCTTTCTGCTCTGCATTGAGAGATTCAAGCT
GTTCCAGCGTCATGTTTGCCGAGCGATGCCCCACCATTTGTTGTTGTAGCGAGGGGACCG
ACAGCAGCGGCAAATCAACCATGCCGATATGTTTTTCCGAGAGTTTGCGCACCAGCGGCT
GGTTAATGAAGAAGTTAAAGGTTTTCGGCGCGCGTGCCATCAGCGGCGCGTAGCTCTCGA
CCGTAGCGACGAGGTGGTCGCGCAGCGGGCGTAAATAACGGGTGTGATAGAGCTGCAGAA
AACGAGAGCGAAACTCCGGCACATCAATTTTGATGGGGCACTGGGTCGAACACGCTTTAC
AGGCCAGACAGCCCGACATCGCCTCTTTGACTTCGTGTGAGAAGTCATATTCGCCTTTAT
TCGCATGCCAGCTATTGCGCGTGCGGGCAATTAACGTCCGCAAACTGACGCCGGATTCAG
GCAGTTCTTGTTCCAGTTTGAGTGGATCAACGCCGCGATCCGCCAACAAACGCAGCCATT
CACGCACCAGCGTTGCGCGCCCTTTCGGTGAATGAATCCGGTTCTGGGTGATCTTCATCG
ACGGACACATCGGACTACGGGCATCAAAGTTGAAGCATAAACCGTTGCCGTTACACTCCA
TCGCACCGCGCCACTGCTGGCGTACCGCAATGGGGATCTGCCGATCGAATGTACCGCGCT
TCACCGCGTCCACTTTCATCATCGGCGCATCGAGACCTTCTGGCGGGCAAATCTTCCCTG
GGTTGAGTCGGTTATGCGGGTCAAATGCCGCTTTCACTTTGCGCAGTTCTGCAAAAAGTT
CCTCACCGAAAAACGCCGGGCTGTATTCAGCGCGAAAACCTTTGCCGTGCTCGCCCCACA
ACAAACCACCGTATTTCGCAGTCAGCGCCACCACGTCATCAGAGATTTGCTTCATCAAAA
TCTCTTGTTGAGGATCGCACATATCCAGCGCTGGACGGACGTGCAAGACACCTGCGTCGA
CGTGACCGAACATACCGTAGCTTAAGCCGTGGCTGTCGAGCAGCGCGCGAAATTCAGCAA
TATAATCCGCCAGGTGTTCCGGCGGTACGCAGGTATCCTCAGCAAACGGAATTGGCTTAG
CGGCACCTTTGGCATTGCCAAGCAGACCAACGGCTTTTTTGCGCATTGCATAGATACGTT
CAACCCCCGCCAGCTCACGGCACACCTGCCAGCCGATGACACCTGCTTGATGACTGGCGA
TCAGCTCATCCAACCGCGCACAGAGTGCATTTACCCGCTCATCAATCAGCGCCTCATCAT
CACCAGCAAATTCCACAATGTTCAGCCCGAGCATCTCTTGGTCAGGCACATCGGTAATCA
ACTCGCTGACGGAATGCCAGACAATATCTTCCCGCGCCAGATTCAGCACTTTTGAGTCCA
CCGTCTCTACCGAAAGCGCCCGCGCCTCAACCATAAACGGCGCGTTACGCAGCGCAGAGT
CAAAAGAGTCATATTTGACGTTCACCAGACGGCGCACTTTAGGCAAGCGTGTAATATCCA
GCCGCGCTTCGGTAATAAAGGCCAGCGTCCCTTCTGAACCCGTCAGAATGCGCGTCAGGT
CGAACTCGGTCATCTCATCGTTAAAGACATGACGCAGATCGTAACCGGTAAGAAAGCGGT
TAAGTTTGGGGAAGTTGTCGATAATTAACTGGCGTTGCTGACGGCAACGTTGATAAACCG
TGTTATAAATTCGCCCGATTGTGGTATTGGATTTACCCAGCGTTTCCGCCAATTCGACGG
GTAAAGGTTGCGTATCGAGAATATCGCCCCCCAACAACACCGCGCGTACGCCAAGTACGT
GATCTGACGTTTTGCCATAGACCAGCGATCCCTGACCGGATGCATCGGTATTGATCATCC
CACCGAGCGTTGCCCGGTTGCTGGTCGAAAGTTCCGGCGCAAAAAAGTAGCCGAACGGTT
TCAGGTACTGATTGAGTTGATCTTTTATCACCCCGGCCTCAACGCGCACCCAGCCCTCTT
CAGGGTTAATTTCGATGATGCGGTTCATATGGCGGGACATATCAACAATAATCCCCTGGT
TGAGCGCCTGACCGTTAGTGCCGGTGCCGCCGCCGCGGGGGGTAAAGATCAGCGATGAAT
AGCGTTCCTGCGCGGCAAGACGGGCGATCAGCGCCACATCTGCGGTTGAACGCGGAAATA
CCACCGCATCGGGGAGAAGTTGGTAAATACTGTTGTCGGTCGACATTGTCAGACGATCGG
CATAACTTGTCGCCGTATCGCCGGTAAAACCTTGTTGCTCCAGCTCTTGCAAAAAATTAA
GCACCAGTTGAACGACGCCGGGTGCCTGGGAAATCTGTGGAATCATTATATTGACCCTTT
CCTGCGGTCTGTGATGTAGGTCGATACACTATTCTTTCAGGCTGCTGCAATAGCGCACTG
AAAGGTGATGTTTGTTTACTCTATGGATTTCGTGTTGCAGGAAGGCGGCAAGCGAGTGAA
CTCCAGGAGCTTACAATAGTAAGTGACTGGGGTGAACGAACGTAGCCGCAGCACATGCAA
CTTGAAATACGACGAGTAAATCGTTTGCGTGTTGCCTGAGTTGTTGTACCACATTTTTTT
CTAACACGCCCATCAGAATTAAGGGCAGAATCGGCCTGTTAAAAACCGCTGAAATTGCTC
ATCATTATGCAGGTGAGTTTCGCGTGTTCACGTCGCGTCGACGATTTGACGCACAAAAAA
GGTGAAAAGTAGTTATGGTAAATGTTCGTCAGCCCAGGGATGTCGCACAAATTCTGCTTT
CGGTGCTGTTTTTAGCCATCATGATTGTGGCATGTCTGTGGATTGTTCAACCCTTTATTC
TCGGCTTTGCATGGGCCGGTACGGTGGTTATCGCCACCTGGCCGGTATTGTTACGTTTGC
AAAAGATCATGTTTGGCCGCCGCTCTCTCGCCGTTCTGGTGATGACGCTGTTATTAGTGA
TGGTGTTTATCATCCCTATTGCTTTGCTGGTTAACAGTATCGTCGACGGCAGCGGCCCGC
TAATTAAAGCCATTTCCAGCGGTGACATGACGTTACCCGATCTGGCGTGGCTTAATACCA
TTCCGGTGATTGGCGCGAAGCTGTATGCAGGCTGGCACAACTTGCTGGATATGGGGGGGA
CGGCGATCATGGCGAAAGTCCGCCCTTATATTGGCACCACCACCACCTGGTTCGTTGGGC
AGGCGGCGCATATCGGGCGCTTTATGGTGCATTGTGCGCTGATGCTTCTCTTCAGTGCCC
TGCTGTACTGGCGCGGTGAACAGGTGGCACAAGGCATTCGCCATTTTGCAACCCGTCTGG
CAGGCGTTCGCGGAGATGCCGCCGTGCTGCTGGCGGCACAGGCTATCCGCGCGGTGGCGC
TGGGTGTGGTGGTGACGGCGTTAGTACAGGCAGTGCTTGGCGGTATCGGCCTCGCCGTAT
CCGGCGTACCTTATGCAACGTTGCTAACGGTGTTAATGATCCTCTCCTGCCTTGTCCAGC
TTGGCCCGTTGCCGGTACTGATTCCGGCGATTATCTGGCTCTACTGGACTGGCGATACCA
CCTGGGGAACGGTATTGTTAGTGTGGAGCGGTGTGGTTGGCACGCTGGATAACGTCATCC
GCCCAATGTTAATTCGCATGGGTGCCGATTTACCGCTGATCCTGATTCTCTCTGGCGTTA
TTGGTGGTTTGATTGCTTTCGGGATGATCGGTCTGTTTATTGGTCCGGTTCTGTTAGCCG
TTTCCTGGCGTCTGTTTGCCGCGTGGGTGGAAGAAGTCCCGCCGCCGACGGACCAACCGG
AAGAAATTCTCGAAGAACTTGGCGAAATCGAGAAACCGAATAAGTAATTTCTCATCAGGC
GGCTCTGCCGCCTGATTGTTAACCACCGCTAATTGATATTTGCTTGCTCTTCCCCATATT
TTCCTGCTTACCGCCATTCAGCTGGTAGTACCTGTCGCAAATTCTTTACAGTTTTTAAAC
TAATGAGACGAATCTGATCGACGCAAAAAGTCCGTA