MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download LD3-15-1Y.seq
 Deletion LD3-15-1Y
 Length 35703
 Fasta Format

>LD3-15-1Y
TAAAGCTAAGTTCGGACTGAAAGGAGCAAGTGTATGACGGGCAAAGAGGCAATTATTCAT
TACCTGGGGACGCATAAGAGCTTCTGTGCACAGGACGTTGCCGCGGTAACAGGCGCAACC
GTAATCTGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAG
AGGTGACTCACATGACAAAAACAGTATCAACCAGTAAAAAACCCCGTAAACAGCATTCGC
CTGAATTTCGCAGTGAAGCCCTGAAGCTTGCTGAACGCATCGGTGTTACTGCCGCAGCCC
GTGAACTCAGCCTGTATGAATCACAACTCTACAACTGGCGCAGTAAACAGCAAAATCAGC
AGACGTCTTCTGAACGTGAACTGGAGATGTCTACCGAGATTGCACGTCTCAAACGCCAGC
TGGCAGAACGGGATGAAGAGCTGGCTATCCTCCAAAAGGCCGCGACATACTTCGCGAAGC
GCCTGAAATGAAGTATGTCTTTATTGAAAAACATCAGGCTGAGTTCAGCATCAAAGCAAT
GTGCCGCGTGCTCCGGGTGGCCCGCAGCGGCTGGTATACGTGGTGTCAGCGGCGGACAAG
GATAAGCACGCGTCAGCAGTTCCGCCAACACTGCGACAGCGTTGTCCTCGCGGCTTTTAC
CCGGTCAAAACAGCGTTACGGTGCCCCACGCCTGACGGATGAACTGCGTGCTCAGGGTTA
CCCCTTTAACGTAAAAACCGTGGCGGCAAGCCTGCGCCGTCAGGGACTGAGGGCAAAGGC
CTCCCGGAAGTTCAGCCCGGTCAGCTACCGCGCACACGGCCTGCCTGTGTCAGAAAATCT
GTTGGAGCAGGATTTTTACGCCAGTGGCCCGAACCAGAAGTGGGCAGGAGACATCACGTA
CTTACGTACAGATGAAGGCTGGCTGTATCTGGCAGTGGTCATTGACCTGTGGTCACGTGC
CGTTATTGGCTGGTCAATGTCGCCACGCATGACGGCGCAACTGGCCTGCGATGCCCTGCA
GATGGCGCTGTGGCGGCGTAAGAGGCCCCGGAACGTTATCGTTCACACGGACCGTGGAGG
CCAGTACTGTTCAGCAGATTATCAGGCGCAACTGAAGCGGCATAATCTGCGTGGAAGTAT
GAGCGCAAAAGGTTGCTGCTACGATAATGCCTGCGTGGAAAGCTTCTTTCATTCGCTGAA
AGTGGAATGTATCCATGGAGAACACTTTATCAGCCGGGAAATAATGCGGGCAACGGTGTT
TAATTATATCGAATGTGATTACAATCGGTGGCGGCGGCACAGTTGGTGTGGCGGCCTCAG
TCCGGAACAATTTGAAAACAAGAACCTCGCTTAGGCCTGTGTCCATATTACGTGGGTAGG
ATCAACCAGCATAAATCAGGCTGCGGCTAAAATGGCGCGGGCAGGAATCCTGGTCGTTGA
TGGTAAGGTCTGGCGAACGGTGTATTACCGGTTCGCTACCAGAGAAGAATGGGAAGGAAA
GGTGAGCACGAATCTGATTTTTAAGGAGTGTCGCCAGAGTGCCGCGATGAAACGGGTATT
GAGGGTATATAAAAGAACATCAATGGGAACACAATGATGAAACAGGTGAGTTGAGTTCAA
ACTGTAGTACAATTCTCTCCAGTTTGAACAGGAAAGAATATGCTATGAACCCTTATATTT
ATCTTGGTGGTGCAATACTTGCAGAGGTCATTGGTACAACCTTAATGAAGTTTTCAGAAG
GTTTTACACGGTTATGGCCATCTGTTGGTACAATTATTTGTTATTGTGCATCATTCTGGT
TATTAGCTCAGACGCTGGCTTATATTCCTACAGGGATTGCTTATGCTATCTGGTCAGGAG
TCGGTATTGTCCTGATTAGCTTACTGTCATGGGGATTTTTCGGCCAACGGCTGGACCTGC
CAGCCATTATAGGCATGATGTTGATTTGTGCCGGTGTGTTGATTATTAATTTATTGTCAC
GAAGCACACCACATTAAAATAATTTGTTTCTAAACGACTAAAATATGGAGGCTCTTATAT
TTATATGAGCCTCGTTTTATGCTTTTTGTTAATGTCTTTATTTTTTATGTATTCTTTTGT
GCTTTCAAGATTATGGCGTAAGAAAATTGCAATACGATTATTGTTGTATATTCAAGATAA
TGTGACCTTAATTGTCTTTTTAAATAAAAAATAAACAAAAATTATATCCCACCACTAAGG
TTTATAAAAGCATACGTTAGCAGGTGTCACCATGAAAAAAGCCATAGCATATATGCGATT
TTCATCACCAGGTCAGATGTCTGGCGACTCATTAAACCGACAGAGAAGACTTATTGCTGA
ATGGTTAAAGGTAAATAGTGATTATTATCTTGATACCATAACATATGAAGATTTAGGATT
AAGTGCATTCAAAGGAAAGCATGCACAATCAGGAGCTTTTTCGGAATTTTTAGATGCTAT
AGAGCATGGTTATATATTGCCAGGAACTACATTGTTAGTTGAAAGTCTGGACAGACTTTC
AAGAGAAAAAGTCGGTGAAGCGATTGAACGTCTGAAATTGATTTTGAATCACGGTATTGA
TGTTATAACTCTTTGCGACAATACAGTCTATAATATTGACTCTTTGAATGAGCCATATTC
ATTAATAAAAGCCATACTTATAGCACAAAGGGCAAATGAAGAAAGCGAGATAAAGTCAAG
TCGGGTTAAATTATCATGGAAGAAAAAACGGCAGGATGCACTGGAATCAGGTACGATTAT
GACGGCGTCTTGTCCGAGATGGCTCTCCTTAGATGACAAAAGAACGGCTTTTGTTCCAGA
CCCCGACAGGGTGAAAACTATTGAGCTAATTTTTAAACTCAGGATGGAAAGGCGCTCATT
GAATGCAATAGCCAAGTATTTAAATGATCATGCTGTAAAGAATTTCTCAGGAAAAGAAAG
TGCATGGGGACCTTCTGTAATTGAAAAATTATTAGCGAATAAAGCTCTGATAGGTATTTG
CGTACCTTCATATCGTGCAAGAGGGAAAGGGATAAGTGAAATCGCTGGCTATTATCCCAG
AGTCATATCAGATGATTTGTTTTACGCTGTACAGGAAATTCGGTTGGCACCTTTTGGTAT
TAGCAATAGTAGCAAGAATCCTATGCTAATAAATCTACTTCGAACAGTTATGAAGTGTGA
GGCTTGTGGTAATACCATGATTGTTCATGCGGTATCTGGAAGTTTGCATGGCTATTATGT
TTGTCCGATGAGAAGATTACATCGATGTGACAGGCCATCAATAAAAAGAGATTTGGTTGA
TTATAATATCATTAATGAATTGCTTTTTAATTGTAGCAAAATTCAACCAGTTGAAAACAA
GAAAGATGCTAATGAAACTTTAGAGTTAAAAATTATTGAGCTTCAGATGAAAATTAATAA
TTTAATCGTTGCATTGTCTGTCGCGCCTGAAGTTACCGCTATAGCAGAGAAAATAAGACT
ATTAGATAAGGAATTACGAAGGGCTTCGGTATCATTGAAAACTTTGAAGAGTAAAGGTGT
AAATTCATTCAGTGATTTTTATGCTATTGACTTAACCAGTAAAAATGGACGAGAGTTATG
CCGTACACTTGCCTATAAAACATTCGAAAAAATCATAATTAATACGGATAATAAAACCTG
TGATATCTATTTTATGAATGGCATTGTTTTTAAACACTATCCTTTAATGAAAGTAATATC
CGCCCAGCAGGCGATAAGTGCTCTCAAATATATGGTTGATGGTGAGATTTATTTCTAAAT
AATGATCTCGGATTTTAAGTTATGCTATGGTGATAAAGTGCAAGACAGAATTAATTATCT
TTGACGAAACTTAATGGGTAATTACTTTGTTTGCTCCCACAAGCGAGTTTTGTACGGCTG
TATTGGGGTAGTAAATGAGCTATACAATCTTAATCATTTGTTAGGTGAGAACTCTTGGTC
GCAGATTCAAATACTGAAAATACGTGACAAATTATTATGAGCAAAATGGTGTATGTCACG
TATTTTGAATGGTAGGTTAAAAAATAACACCGACTTTCGTAGGTGTTACTAATAATAAAG
CAGAGTTTTTAGATAGTATCAATGTGCTTTGTGTATATTGTGGCAAATAATTGGGTTGGG
GGTACAATTGTGATTGCTTTTGCATGAACATTGCGCCTTTATGCATAATGAGATAAAGGA
ATATCAAATAAAATAACGATAGGTCATAACAAAGAGGTTTTTATGAAAACACTTATCGTT
TCAACTGTATTGGCATTCATAACATTTTCTGCGCAGGCTGCAGCATTTCAGGTCACTAGT
AATGAAATAAAAACAGGAGAGCAACTTACAACGTCTCATGTCTTTTCTGGATTTGGGTGT
GAAGGTGGTAATACATCGCCCTCATTAACCTGGTCTGGTGTTCCTGAAGGTACCAAAAGC
TTTGCCGTAACTGTATATGATCCAGATGCACCTACAGGCAGTGGTTGGTGGCATTGGACT
GTTGTTAATATTCCAGCAACAGTAACATATTTGCCCGTTGATGCAGGGAGACGTGATGGA
ACAAAACTGCCGACTGGTGCTGTTCAAGGCCGAAATGATTTTGGCTATGCTGGGTTTGGT
GGCGCATGTCCTCCTAAAGGAGATAAACCACATCATTACCAGTTTAAAGTATGGGCTCTA
AAAACTGAAAAGATTCCTGTAGATTCTAACTCCAGCGGAGCGTTAGTTGGTTATATGCTT
AATGCTAATAAAATCGCAACCGCTGAGATAACACCAGTTTATGAGATAAAGTAGGGTGAG
AGTATGCTGGCAAGAGGTAAGACTAACTTAAAGATCGAAGAAATACGGATGCATAAACAT
CATGAGATTCATAGGGTTAAGCCTCTTATGCCAGCTTTGTGTCGTATCCGTCAGGGAAAG
AAAGTTATCAATTGGGAGACGCATACTTTAACTGTTGATAATAATCAAATAATATTATTT
CCTTGTGGTTATGAATTTTATATTGAGAATTATCCTGAAGCAGGGCTTTATCTTGCAGAA
ATGCTTTACTTACCCATTGATTTAATTGAGAGTTTCCAAAAACTTTATACGGTAACTGAT
CAAATACGTAACAAAACAAGTTTCTTTTTACCTCAGAATCCTGAGTTAATATATTGTTGG
GAGCAACTAAAAACATCTGTTTCCCGAGGCTTCTCAACTAAAATTCAGGAGCACTTAGCA
ATGGGCGTTCTACTTTCGTTAGGAGTGAATCATGTTAATCATTTACTTTTATCATATAGT
AAACAATCATTGATAAGTCGTTGTTATAACCTGCTGCTATCCGAACCCGGCACAAAATGG
ACAGCAAACAAGGTTGCTCGATATCTCTACATTTCTGTTTCTACATTACATCGCCGTCTA
GCAAGCGAGGGGGTAAGTTTCCAAAGTATACTGGACGATGTGAGGTTAAATAATGCGTTG
TCTGCTATACAAACGACGGTAAAACCTATAAGCGAGATTGCCAGAGAAAATGGTTATAAG
TGTCCTTCTCGTTTTACTGAAAGATTTCATAATCGTTTTAATATAACACCAAGAGAGATA
AGAAAAGCTTCCAGAGAGTAAAAGTGTTTTAAGAAGGAGCAATTCTATCGATTTTGATTT
TGGGAAATCAACACGGCATAATTATGTCACCGGAGCCTGAACAACTCCGGTGACTTCTGC
GCTAAACGGGGACGTTTATGCGCACATACAATCCAAACTCTCTTCTCCCTTCACAGATGC
AGAAATGCACCTGCAATTCTTTGCATCTAGCGTTTGACCTCTGCGGAGGGGAAGCGTGAA
CCTCTCACAAGACGGCATCAAATTACATCGCGGCAACTTCACCGCTATCGGTCGGCAGAT
CCAGCCTTATCTGGAGGAGGGCAAATGCTTTCGCATGGTGCTTAAACCGTGGCGTGAGAA
ACGCAGTCTTTCCCAGAATGCACTCAGCCACATGTGGTACAGCGAAATCAGTGAATACCT
CATCAGCAGGGGTAAAACGTTCGCCACTCCAGCTTGGGTAAAAGATGCTCTCAAACACAC
ATATCTCGGTTATGAAACCAAAGACCTGGTTGATGTCGTAACCGGTGATATCACCACTAT
CCAGTCGTTACGCCATACCTCCGATCTTGATACCGGAGAGATGTATGTCTTCCTGTGTAA
GGTTGAAGCCTGGGCGATGAATATTGGTTGCCACCTGACTATTCCACAGAGCTGCGAGTT
CCAGCTGCTGCGCGACAAGCAGGAGGCGTAATGGCTACACCGCTTATTCGTGTCATGAAC
GGACACATCTACAGAGTACCAAATCGTCGTAAGCGTAAACCTGAGCTGAAGCCATCCGAA
ATACCAACACTGCTCGGATATACCGCCAGCTTGGTTGATAAAAAATGGTTGCGACTGGCA
GCAAGGAGGAGTCATGGCTGATTTGAGAAAAGCAGCGCGTGGTCGGGAATGCCAGGTAAG
AATCCCTGGCGTATGTAATGGCAACCCTGAAACGTCTGTACTGGCACATATCCGGCTGAC
TGGATTGTGCGGCACCGGTACGAAACCGCCAGACCTGATTGCCACCATTGCATGTTCTGC
CTGCCACGACGAAATCGACCGCCGCACGCATTTTGTTGACGCTGGATATGCAAAAGAATG
CGCGCTGGAAGGTATGGCGAGAACACAGGTTATCTGGCTGAAAGAGGGGGTTATTAAGGC
GTGAATACCTACAGCATCACATTACCCTGGCCTCCGAGCAATAATCGCTATTACCGCCAT
AATCGCGGGCGCACGCACGTCAGCGCAGAGGGGCAGGCATACCGCGATAACGTCGCCCGA
ATCATTAAAAACGCAATGCTGGATATCGGCCTGGCTATGCCTGTGAAAATCCGCATTGAG
TGCCACATGCCGGATCGCCGTCGCCGTGACCTGGATAATCTGCAAAAAGCCGCTTTTGAC
GCACTCACTAAAGCAGGTTTCTGGCTGGATGATGCTCAGGTCGTTGATTACCGCGTTGTG
AAGATGCCTGTTACCAAAGGTGGGAGGCTGGAACTGACCATCACCGAAATGGGGAATGAA
TGATGTTTGAGTTTAATATGGCAGAACTTCTTCGCCACCGCTGGGGGCGTCTGCGCTTAT
ATCGTTTCCCCGGTTCTGTTTTGACCGATTACCGAATACTGAAGAATTACGCCAAAACCC
TGACAGGAGCAGGAGTATGAAGTCAGAGATAACAATCAACTAATACTGTTTTGTTGATTT
TTGCTTGTAATTGGCGTTCTGGTCTGATTTTTGTGGAGTAAGTTGATGCGTGATATTCAG
ATGGTTCTTGAGCGTTGGGGAGCGTGGGCGGCTAATAATCATGAAGATGTGACCTGGTCG
TCCATTGCCGCCGGTTTTAAGGGATTAATTACTTCAAAAGTAAAATCTCGCCCGCAATGT
TGTGACGATGACGCGATGATCATTTGCGGGTGCATGGCCCGTCTGAAAAAGAACAACAGC
GATTTGCACGATTTATTAGTAGATTATTATGTAGTCGGTATGACATTCATGTCACTGGCA
GGTAAGCATTGCTGCTCTGATGGTTATATCGGGAAAAGGTTACAGAAGGCTGAGGGCATA
ATTGAAGGGATGTTAATGGCATTAGATATCCGGTTAGAGATGGATATCGTTGTTAATAAC
TCTAATTAATATGCCAATTGTTTACTAAAAATTATTAAAAATGGGGCGTTGAGACGCCCC
CAAAAATAAAGGGTAATATATAACAGAAGGTTTATATAGTTAGAAGCAAGGTTGTGCTTC
TAAAGGAAGTGGCTTGAGGGAGCCACTTATATGTTGGGGAGGCAACGCCTCCCGCAACAT
ATCTTTTTCGTAATCAGATTAGAACTGGTAAACCAGACCTACAGCAACGATGTCATCAGT
GCTTACACCGAGTGCTTTAGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACT
CAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAG
CCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCT
CCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCA
GTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCT
TGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTATTCGATGT
TGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCT
CGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGT
AGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGA
GGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGA
CACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCT
CCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCAT
CGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCT
TGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGG
TGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAGGCGATTT
CGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAA
TGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACG
GCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAA
TCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGAT
GACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGAC
TTGTTCGCACCTTCCTTAGTGAAGTCATTTTTGTCAAGCAGGTTGATTTTGTAATCAACG
AAAGTAGACATATTTTTGTTGAAGTAATAGGTTGCACCTACATCAACATATTTGACTAAG
TCCTGATCGCCCCATACTCCAAGATCCTTACCTTTAGATTGCAGGTAAGCAACGGACGGA
CGCAGACCGAAATCGAACTGATATTGTGCAACAGCTTCGAAGTTTTGGGCTTTATTAGCA
ACGAAGTGATCAGCAAATACAGTCATATTCTGGGTTTCAGAATAGGTAGTGGCCAGGTAA
ATGTTGTTAGCGTCATATTTCAGACCTGCGGCCCAAACTTCTGCATTTTTACCGGAAGCA
AATACTTCAGGAAGAACTTTCCCTGCATTAACTTGAGTGTCGGTACGATCAGATTTCGCA
TAAGTTGCACCGATACCGAATCCTTCGTATTCATAGGTAGCAGAGAAACCGAAGCCATCA
CCGTTACCTTCAGTGTAGTTATCGAAATCGCTACGATCGTTTTTGCCTTGGTACTGAGCA
GCAAAGTTCAGACCATCAACCAGACCAAAGAAGTCGTTGTTACGATAGGTTGCAACACCA
GTTGCACGTTGAGTCATGAACACGTCGGTTTGAGTCCAAGTGTCACCACCGAATTCTGGC
AGGACGTCAGTCCACGCACCGATGTCGTATGCTACACCGTAGTTACGGCCGTAATCGATG
GAGCCGTAGTCACCGAATTTCAGGCCAGCGAAGGCAAGACGGGTTTTATCTTTGGAGGAA
CCTTGAGATTCAGCGCGGTTGCCTTTGAATTCATATTCCCACTGACCGAAACCAGTCAGT
TGATCGTTGATTTGGGTTTCACCTTTGAAGCCAAGACGGGCATAAGTAGTATCACCATCA
TCTGCATCATTAGAGGAGAAGTAGTGCTTAGCATTAACTTTCCCGTACAGATCCAGCTTG
TTACTGTCTTTATTATAAATTTCAGCTGCCTGAGCAGACATCGCCATTAGTACTGATGCA
GCTACAGCAGAAATTGCCACTGTTAATTTTTTCATCGTGAGCCCTTTTTTTGAACTATTA
TTAAAAAATGATGTCACTGCGCGATAAATATTCATCTAATCAATGTGATTATTTCAAGAT
GTAAGTTTTGGTTTCTCGTTTGATTTGTGAAGTAGATCTCTATTTTTATCTGAACTTTTT
TCTATCGAATCCTATTCATGGCTCTTGGCTGAATAAAAATAAATCTATTAGCCAATTTAT
ATTAACGGCTGTTATTTATAAGTGCTCTATAATTTGAAGGTTCAATTTAAACCGGCTAAA
AATAACACTGGAAATTATTTTTTGGTTATTTGTTGAGATTTGCTTATGTATTTGTAGTGG
TGTTTTCAATACTCGGTAGCATTCTCTCAAATATCATTTAGTGGTTTACGTACGTAAAAA
ATTGGTTATGCTGTTAAGAGTGGTTACTTCGTCACACAGCTTAAACCCGCCGTCGAGCGG
GTTTTTCCATTTTTTGAGTCTCGATATTAGCTGATAACCCAATACCTGAGTTATTCACTG
ACTCCGAGTCTGTTACGTTTCGTAGTATTCCCTCAATTTACACCCGCTTTGTCTGCGAGG
TGGGGTTATGAAATCCATGGATAAGTTAACAACGGGTGTCGCCTATGGCACCTCAGCAGG
TAGTGCCGGGTACTGGTTTTTACAGCTGCTAGATAAAGTCACTCCCTCACAGTGGGCAGC
AATAGGTGTGCTGGGTAGCCTGGTATTTGGCCTGCTGACGTACCTGACAAACCTTTATTT
CAAGATTAAAGAAGATAAGCGCAAGGCTGCGAGAGGTGAATAATGCCTCCATCATTACGA
AAAGCCGTTGCTGCTGCTATTGGTGGCGGAGCAATTGCTATAGCATCAGTGTTAATCACT
GGCCCAAGTGGTAACGATGGTCTGGAAGGTGTCAGCTACATACCATACAAAGATATTGTT
GGTGTATGGACTGTATGTCACGGACACACCGGAAAAGACATCATGCTCGGTAAAACGTAT
ACCAAAGCAGAATGCAAAGCACTCTTGAATAAAGACCTTGCCACTGTCGCCAGACAAATT
AACCCGTATATCAAAGTCGATATACCGGAAACAACGCGCGGCGCTCTTTACTCATTCGTT
TACAACGTGGGTGCTGGCAATTTTAGAACATCGACGCTTCTTCGCAAAATAAACCAGGGC
GATATCAAAGGCGCATGTGATCAGCTGCGTCGCTGGACATACGCTGGCGGTAAGCAATGG
AAAGGCCTGATGACTCGTCGTGAGATTGAGCGTGAAGTCTGTTTGTGGGGGCAACAGTGA
GCAGAGTAACCGCGATTATATCCGCTCTGATTATCTGCATCATCGTCAGCCTGTCATGGG
CGGTCAATCATTACCGTGATAACGCAATCGCCTACAAAGTCCAGCGCGACAAAAATGCCA
GAGAACTGAAGCTAGCGAACGCGGCAATTACTGACATGCAGATGCGTCAGCGTGATGTTG
CTGCGCTCGATGCAAAATACACGAAGGAGTTAGCTGATGCGAAAGCTGAAAATGATGCTC
TGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCACATCAAAGCAGTCTGTCAGTCAG
TGCGTGAAGCCACCACGGCCTCCGGCGTGGATAATGCAGCCTCCCCCCGACTGGCAGACA
CCGCTGAACGGGATTATTTCACCCTCAGAGAGAGGCTGATCACTATGCAAAAACAACTGG
AAGGAACCCAGAAGTATATTAATGAGCAGTGCAGATAGAGCTGACCATATCGATGGGCAA
CTCATGCAATTATTTTGAGCAATACACACGCGCTTCCAGCGGAGTATAAATGCCTAAAGT
AATAAAACCGAGCAATCCATTTACGAATGTTTGCTGGGTTTCTGTTTTAACAACATTTTC
TGCGCCGCCACAAATTTTAGCTGCATCGACAGTTTTCTTCTGCCCAATTCCAGAAACGAA
GAAATGATGGGTGATGGTTTCCTTTGGTGCTACTGCTGTCTGTTTGTTTTGAACAGTAAA
TGTCTGTTGAGCACATCCTGTAATAAGCAGGGCCAGCGCAGTAGCGAGTAGCATTTTTTT
CATGGTGTTATTCCCGATGCTTTTTGAAGTTCGCAGAATCGTATGTGTAGAAAATTAAAC
AAACCCTAAACAATGAGTTGAAATTTCATATTGTTAATATTTATTAATGTATGCCAGGTG
CGATGAATCGTCATTGTATTCCCGGATTAACTATGTCCACAGCCCTGACGGGGAACTTCT
CTGCGGGAGTGTCCGGGAATAATTAAAAACGATGCACACAGGGTTTAGCGCGTACATGTA
TTGTATTATGCCAACACCCCGGTGCTGACACGGAAGAAACCGGACGTTATGATTTAGCGT
GGAAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAAATAGTAATGAATTATCAAAGGTA
TAGTAATATCTTTTATGTTCGTGGATATTTGTAATCCATCGGAAAACTCCTGCTTTAGCA
AGATTTTCCCTGTATTGCTGAAATGTGATTTCTCTTGATTTCAACCTATCATAGGACGTT
TCTATAAGATGCGTATTTCTTGAGAATTTAACATTTACAACCTTTTTAAGTCCTTTTATT
AACACGGTGTTATCGTTTTCTAACACAATGTGAATATTATCTGTGGCTAGATAGTAAATA
TAATGTGAGACATTGTGACGTTTTAGTTCAGAATAAAACAATTCACAGTTTAAATCTTTT
CGCACTTGATCGAATATTTCTTTAAAAATGGCAACCTGAGCCATTGGTAAAACCTTCCAT
GTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGCTTCAATCTGGTCTGACCTC
TTTGTGTTTTGTTGATGATTTATGTCAAATATTAGGAATGTTTTCAATTAATAGTATTGG
TTGCGTAACAAAGTGCGGTCCTGCTGGCATTCTGGAGGGAAATACAACCGACAGATGTAT
GTAAGGCCAACGTGCTCAAACCTTCATACAGAAAGATTTGAAGTAATATTTTAACCGCTA
GATGAAGAGCAAGCGCATGGAGCGACAAAATGAATAAAGAACAATCTGCTGATGATCCCT
CCGTGGATCTGATTCGTGTAAAAAATATGCTTAATAGCACCATTTCTATGAGTTACCCTG
ATGTTGTAATTGCATGTATAGAACATAAGGTGTCTCTGGAAGCATTCAGGGCAATTGAGG
CAGCGTTGGTGAAGCACGATAATAATATGAAGGATTATTCCCTGGTGGTTGACTGATCAC
CATAACTGCTAATCATTCAAACTACTTAACCTGTGACAGAGCCAACACGCAGTCTGTCAC
TGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAAT
TTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAA
TTGATGTATATGCTCTCTTTTCTGACGTTAGCCTCCGACGGCAGGCTTCAATGACCCAGG
CTGAGAAATTCCCGGACCCTTTTTGCTCAAGAGCGATGTTAATTTGTTCAATCATTTGGT
TAGGAAAGCGGATGTTGCGGGTTGTTGTTCTGCGGGTTCTGTTCTTAGTTGACATGAGGT
TGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTGAT
GCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGCGT
AGATGCACGTTGTGACATGTAGATGATAATTATTATCATTTTGTGGGTCCTTTCCGGCGA
TCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGT
TTAAGGTGTTTCCGTTCTTCTTCGTCGTAACTTAATGTATTTATTTAAAATACCCCCTGA
AAAGAAAGGAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTCTC
TGTTTTTGTCCGTGGAATGTGCAATGGAAGTCAACAAAAAGCAGCTGGCTGACATTTTCG
GTGCGAGTATCCGTACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTGCGAGGCG
GTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAA
GGGATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCTGCAGGCCA
GCGAGACAGATCTCCAGCCAGGGACTATTGAGTACGAACGCCATCGACTTACGCGTGCGC
AGGCCGATGCACAGGAGCTGAAAAATGCCAGAGACTCCGCTGAAGTGGTGGAAACCGCAT
TCTGTACTTTCGTGCTGTCGCGGATCGCAGGTGAAATTGCCAGTATTCTCGACGGGATCC
CCCTGTCGGTGCAGCGGCGTTTTCCGGAACTGGAAAACCGACATGTTGATTTCCTGAAAC
GGGATATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGAACTGATACCGGGGTTGC
TGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTCCGCGCCGGGCTT
CGCTCACTGTTCAGGCCGGAGCCACAGACCGCCGTTGAATGGGCGGATGCTAATTACTAT
CTCCCGAAAGAATCCGCATACCAGGAAGGGCGCTGGGAAACACTGCCCTTTCAGCGGGCC
ATCATGAATGCGATGGGCAGCGACTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGT
GTCGGTTATTCCAAAATGCTGCTGGGTGTTTATGCCTACTTTATAGAGCATAAGCAGCGC
AACACCCTTATTCCAGCTGGCTTCGTGGCTGTTTTCAACAGTGATGAGTCATCGTGGCAT
CTCGTTGAAGATCATCGGGGTAAAACGGTTTATGACGTAGCGTCAGGGGACGCGTTATTT
ATTTCTGAACTCGGTCCGTTACCGGAAAATGTTACCTGGTTATCGCCGGAAGGGGAGTTT
CAGAAGTGGAACGGTACAGCCTGGGTGAAAGATGCAGAAGCAGAAAAACTGTTCCGGATT
CGGGAGGCGGAAGAAACAAAAAACAGCCTGATGCAGGTAGCCAGTGAGCATATTGCGCCA
CTTCAGGATGCTGTAGATCTGGAAATCGCAACGGAGGAAGAAACCTCATTGCTGGAAGCC
TGGAAAAAATATCGGGTGTTGCTGAACCGTGTTGATACATCAACTGCACCTGATATTGAG
TGGCCTACGAACCCTGTCAGGGAGTAATCATTGGGATTATGCCGCAGCACGTCTTAAGCA
AGAACATGCTGCGGTTGGATGCTATTTTTTTCCTGAAGCGGAAAACATTACTACAGTACC
TTGAACCTTGGTTTTAACATTCTCGAAATGCTCTGAGAGTATATGTGTTAAGCCTTCTTC
GGAATCTTTTGTGTTTGAAAAGATGCCTTTCTGATTGTAAATGCGCATCAGTTTTTGACC
GAAGCTATTGTGCACAACTCCATCGCCAAGAATTGTGGCTCCGTATAGAGTTCCATCGTC
AGTTAAGGCCTGCGCCGCATTGCGTATTACACAGCTTTTTGTAGATATATTTCCAGGCAG
GCAGTGAAGAAGGTAAGACATGGAAATGGAATCAAATTGACCATGTAACGCCGCGGGATA
AGGTTCAAAAACATCATGGCTAATTTTATGTTTAATTTTTGATTCCCCAGCCCTTGTAGA
TGCCGCGTTCAGGCTAGCTTCGTTCAAATCCATTAAAGATATCAGACTACTCTCAGGTAC
GTGAGTAAGGTAAAACCCAGTTCCAACACCAATATCCAGATGGTTGTTACCTAAATGTTC
CAGAAAGTGTGGAAGAAGGTGTTCCTTTGTAGGACATCCCCATGCAAGCCGATTTGATAC
TCCCAAAACCCACCAGTCATAAAGCTTTAGGGTAAGTGGTGTGTAAATTCTAGCCCCATC
ATCTGTGTTTTTTTATTAATTTCACCATGTTATAGTTTTATTTGTGAATTAAATCAATTA
TGGCAATGAATTACAAGGGGTTAAATGCTGCCGCAGCATAGCGATATTGAAATAGCCTGG
TATGCTTCAATACAGCAGGAGCCGAATGGCTGGAAGACCGTCACCACACAGTTCTACATC
CAGGAATTCAGTGAGTATATTGCGCCACTGCAGGATGCTGTAGATCTGGAAATCGCAACG
GAGGAAGAAAGATCGTTGCTGGAAGCCTGAAAAAAGTATCGGGTGCTGCTAAACCGTGTG
GACACTTCCGTAGCACCAGATATCGAGTGGCTTATTCAACCATAATAAACAGTATGTATA
TCATAGGTTATTAATTGTGAGTTTTTTCGGTGTGTTATTTGTTTGTTTGATGTTATGCTT
TTGCGCCCCAAAAGGTTGTTTAGATGTATTTTATCAATTGATTTTCAATATCGTTTAATA
AAGAAAAATTAAGCAAGCTGGATGTTGGTTTTTTGTTAATTGAATGGTTCTAATAATGTT
TTTTTACTGTTGTTGAATGTGACTTGATAAGAAATGCAAGTAAAAATGATACTCTTTTTA
TTTTAAATTCAAACGGTTGACATATATATAGCAAGAGGTTTCAGGTGCGTTGTAGTGAGT
TTATGTTAATAAAAAGCATAGTAAGCGTTGAAAAATGTAACTTTGAAATAAGTTAGAATA
AAAAACAACATACATATAATAATTTAATCTTAAATGAAATTTATTAAAATTTGCAAACTA
TAATTTTGTGTATAAAAATATAAATGCACATCATCCTGATTATGATTGTGTATTTAATTG
GTTGTTATTTGACTACTATCAACTTGTTTTAATTTTATGATAGGTGCAAGATGGATTATG
TTTGCTCCGTAGTTTTCATCTGTCAATCATTTGATTTAATTATAAACAGGAGAGTTATCT
CGTTCAAAAAAAATTCATTGTTTATTGTAAGCGACAAAATTAGAAGGGAGTTACCAGTAT
GCCCCTCTAAACTAAGAATTGTTGATATAGATAAGAAAACATGTTTATCCTTTTTTATCG
ACGTGAATAATGAGCTGCCTGGCAAATTTACTCTTGATAAGAATGGCTATATTGCTGAAG
AGGAACCTCCATTATCGCTTGTTTTTTCTCTGTTTGAAGGGATTAAAATAGCAGACTCAC
ACTCCCTTTGGTTAAAAGAAAGACTATGTATATCCTTACTTGCCATGTTCAAAAAACGCG
AAAGTGTAAATTCATTTATACTAACAAATATAAATACATTTACCTGTAAAATTACTGGAA
TAATCAGTTTTAATATTGAGCGGCAATGGCATTTAAAAGATATTGCGGAATTGATTTATA
CGAGTGAAAGTTTAATAAAAAAAAGATTAAGGGATGAAGGAACGTCATTTACTGAAATAT
TGAGAGATACTAGGATGAGGTATGCAAAAAAACTCATAACTTCAAACTCTTATTCTATCA
ATGTCGTAGCCCAGAAATGTGGCTATAACAGTACTTCATATTTCATATGTGCATTTAAAG
ATTATTATGGTGTCACGCCATCTCATTATTTTGAGAAAATAATCGGCGTCACAGATGGAA
TAAACAAAACAATTGACTGATAATGTTTATTACAAGTTGTCTACATGTTAATTATAATAT
TATACAGCGTTTTTTTTGATGTGATATTCTGGAACCATTAATTTGTAATTGGGTTGCTGT
CGCCTATTTTATACATACTATAATTGATGGTTTTCTATGTGATTTAGTTAATAACCTTCT
GGGTTTATTTTAAGGGTTAATTGTTACATTGAAATGGCTAGTTATTCCCCGGGGCGATTT
TCACCTCGGGGAAATTTTAGTTGGCGTTCTTAAAATGTGTACTTAAGACCAGCAGTAGTG
ATGAAGTTATAGTTTTCTATACCTGCTCCATTTTTGCTGTAGTCTGAAGTGTTATTATTG
TGATCATAAAGTGAAGTATTACCTTTTTTATTCGTAACCCGATTCCATGCGCCTTCAACA
TAAACTTTTGCGTTAGGTGTGACGTAATAACCTGCATTGACTGCAACAGAATAGTAATTT
TGGTCTTTGACCTTACTGCGATAAGTGATTCTTTTTCCCGGGTCATAGTGTTCATCGTTA
TCAGATGATTCCACCCAGCCGCTGTATTTAAATGTGCCACCGAGTTCAAAATCTTCATAA
CGATAACTTCCAGTCAAGCCAATGTAGGGCATTTTAAAACGTTGTTTGTAGCCGATTGCT
CTTTCTCCATTCGGGAAGGAGCCGATATCATCTCTGAATCCCTCCTCAGAACTGTAGATA
TAGGAACCACCTCTGGCTGTAAAGCTATAACGGCTTTCCTGATATCCGGCCATGAGTCCC
AGGCGGTAATTGGGTTCGTTGAGGAGCCAGCCTTTGATATTCAGATCAAATTCGTTGGCA
TAATTGAGTTGTGTATCAGGGTGTCTACTTTCATCCGTCCAGGTTCCGGGGTTACTGGAA
TCCATCCAGTCCTGATCGACCATATTGCCACCTCGGCTGCCGAGAGTTGTCCAGCCAGCA
GCCCCGATAGATATCTGGGGCATCAAATCCCAATTAATTGCACCTTTAATAATTGCAGCG
TTATTGAATTTCCAGTCGAGTTGACTGACTTTTCGGCCTCCTTCTTCGGCTAGATAAACA
CGCTCTTTTGTTTTTCCGCTCAGAGTTCCAAGACTAATGTCCGCATTTATGTTGTCAGGA
GTAAACGATAAAGTCTCGGTAGAAGCAAAAGAGCTGATCGCAATAGGGGTTGTCAGGACT
ATTCCCAGAAGTTTCGCCCGCATAAAAGTTCTCCATTCAATCGTTTTAATGATTGAATAT
GTATTTTTTATATCTAACTTAATGAGTCAATTACATATTGCTCCACTGTTTATATTTTGT
TTAGTATTGAATGATTATCACAATGCGCTATCTGTTTTTGGTTTAATTATCTGTTATTGT
TTCATATTTCGGTTTTACTGTGTGGTTTTTTTATGCTTTTGTGGTGCTTTTATCTATTTA
AGTGCCATGCCTTTAGAGGCATATAAGCGAAAATAGCATGAGGTTTATCCTCAATTACTA
TGTTTTTTAGTACAAAAAAGAGGGACAAAACTGAGACACATAAGGCCTCGCAATGGCTTG
CAAGGCTTTACATGTTTTGAGGTAGTGGGACGTGTGAGCGCAGAGATGGCGCGGTAAGTT
GTTGACTTAAAATGTCGTTCTAGGAACTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGC
AGGGCGCGCCATTTCTTCCTCATTTATGCCCGTCTTATCCGTTTCCGCTTTGCCCTTCAC
CACATCACTTTTTGTCGCTGTTTGGCGAGATAATTCAACGGTGTCAGGCCGTAAAACGCC
TTAAAAACAGAGATAAAGTACGACGTGCTGCTATAGCCACATAATTGCGCCACCTGAGTG
ATATTTTTGTTATCCATCAATAACATCTGTACGGCGTAACGCATACGACACTCTGTGACA
ATCTGGCTATAGCTGGTATTTTCGTTTTTTAATTTCTTTTTGAGCAGGCTGGGGCTTAAA
CATAGCGAACTGGCGACAATTCGCAGATTCCAGTAATGCTGAATATCGCTTTGAATAATG
CGGCAGACGCTGTCGCGGACGCTGCTGCGTAAGATATACATCAGTAGGGCAATAAACCGC
GATTGCTCAAGAAAGTTAGACAATACGGTAAAAAGCAATGCGCGCGTCAACTCCGCTTCG
CAGGGTCTGCTGGGTTGCTGCTTGCTGTGGTTGGCGGCTAGCCGGAACACTTCCGGTGTA
CGGCTATGACAAGCGATAACCGGGGTTGCCAGCCGCGACCAGGGCTTTACACAGGTTAAG
TTCTTATTTAAAAACAACAGATAATCGTTGATGATGTTACGGTTGATGTGGGTGATTAAT
ACGTGATTTAACGTTGAGAGTTCAATGACGTTATTGTTGCACGCGAAGGCGGCCAGGTAG
TTTTTCGGAAGGGTAAACGTAGCATGGTTATTGACGCTTACCTCTACCTCTTTTTCGGTC
AGGATCACCACGCAAGGTTCACTGCTGCTCAATTGCATTTCGCACTCCTCAGATATCAGA
AACTCCGCTCAAAGGATCTATGCTTCCTGCATGAGTGATCGGCCCGTTCGCCGATAACGA
TCTTCTTTCTTTAGCACGCTTTTTAGCAATTAATCTTGATGGAATTCTGATGAGAGCGAA
AGAGGTAAGCCAGGTCGTACCCGACTTACCTGGAGGAGATTTAATACTCGAGAATGCCGT
GCGCGACGGGCAAATAGCGCAGAGAGAAATAGAGAGTGTCTTTACCGCAAGAGGAACGTT
TCGCTAACAGCGAGGCAATTTCTGCGTCCGGTTTCGGTTTCGCTGTAAAGGTTTTGCCTT
TGCCGGCGACAAAAAGTTCATAAACAACGCCGCTGGCAGGGGCGGGACTTTGGCAATCGG
CGCTGGCCTGTAAATAACGTTCACGCTGTTCAGCGGTCAGTTTATCCACGCCGCTGCCAT
CCTGTACCCAGACATTAACGCCGGTTGCTTTAACGTGTTCCAGCAGTTGGCGATAGCCAT
CGGGCGACATGTTTCCGGCGAAAAAACTACTGATATAAACCGGTTTTGCTGAAACATCGC
TAATCAGCCGCTGCGCGTTGTTTAACCATGTTAGCAAAGGCTGACGGGCGGCTTCGCTGC
GCCAGTTCAGGTCGTCAATTTCCGCGCTGATGTACCAGCCATCCGGCGTTATGCCAGGCG
CGGCGCTCCATAATCTGGCTTGCTGGAGATCGGCAGCCAGCAGGCGATTAAGATAGCTTT
CCAGCGCTGCGGACGACTGTTTCTGGTGCATAAAAAATTCCGGATCGGCGTTCAGCCCGA
CAATAAGCTTCAGACCAGCCTGTTGCGCAGCTGCGGCCCGCTTAAACAATAACGTGCGCT
GTTCTGGCTGGGTAAATGCATCGCCGTAACGGGTCCATTGCAAAACAAGGGTATCGAAGC
CTTGCAAACGTAACTGACTCATCAGCCCCTGCCACTGGGTATCGGTAACCTGACTATCTC
GGTTTTGTGGTTGCCAGATAATACCTTTCATCGCAAAGGAAAAAGGGCTGACCAAAAGCA
GTGTCAGCAATACGAAAATGAACTTACGCATTTACCAGTGCACTCCAATGGTGAGAAACG
CGTTGTTGCGCTCTCCGTTACGTTGATTAATCGCCTTAAAGGTATGTTGATACTCGACGC
CGAGACTGACTTTGTGCGGCCAGGCGTCGTAGTGCGTCTCGCCGGTCCAGATATTCCAGC
GGACCCCGACTCCGCCAAGCTGCGCGCCCTGAGTGCCTTTATCACGATAGCCGTTGTCCT
GAACGTGAGCGTAAGGCTCAATAGTCTGTCCGTTAGCTACCTTCTGATGCCAGCTGACGC
GATAATCTGCCGTCCACGCCTGAATATCCTGGCGGATATATTGCGCCGCATCGAGGTACA
GGTTTTGGGCAAACCAGCCTGAACCGTTCGGGTGCCATTCGTCGCTGTATTTGCCGCCAT
TAAAGAATGAGGCGCTGGCGCGCAGCATGGTATCGGATGCGCCATTTTGGCCGTTCAGCG
GCAACTGCTGTTCGACGGCGATGAAAAAGATCTGATCGCGCAGCGGCTTCCAGCGCAGAC
CGGTGCCGGACATCGGATTTTTCACCGGCATCATCACCCCGTTTTCTCCGGTATCGGCAA
AGACGCGGCTATAAACTGAGAGCAGGTCGCCTTCCAGCAGCATATTGCGTCCGATGCGGT
ACTCGGCTTCCAGTTGTCCGTAGCTACGATAGCTTTTCCCTGGCGCTGCGCCGCCGACAT
TATTGTTAGCGGTACTCATTGCGCCGGAACGCAAGCCGATGGAAGAATCGAAACTGAACG
TCCAGCGGCGACCGACCTCCTCATGCAAACGGCGGAAATTGAAGCGTTGTTGATTTTGTT
CTGGGGTCAGTGGGGTTATCAGCGCCTGATTATCAATGTCATCAATCACCAGCCGGGCGT
AGTGCTGCGTCGCAGGCATGTCATCCAGACGCTGGTTCACGTAGGCCAGTTGTCGGATCA
GTGCCGGATCGTCCGGAAGCCCTTTATGCGCCGGTTCGAGCATTTCCCGCGACTGTGCGA
TATCACCGCTATCCCACAAGGCGTAACCAAGCGCTGCCTGGGTGTTGCTATTATTCGGTT
CCAGTTCCAGCGCGGCGCGCAAATCACTCACCGCGGCCGGGACATTATGACGTTGGCGAT
AAATTGTCGCCCGCGCAACGTAAGCGTTGGCAGAAGGCGCAATATTGATTGAGCGCGTGA
GATCGTTCAGTGCGAGTTCCGGCTGACCAGGAATGTAACGTTGCGCATGCAGCCACCAGT
AGAGGGCATTGCTTCCCAGTCCACGTTTTTCTGCCTGTTGTAGCCAGCGATCGCGAGCCG
CACCATTTCCTGCCGCCTGGGCGGTATTGGCAGCAGCAAGCAGATCCTCATTGCTCATGT
CGTGAAGACTGATTTTCTGCCAGGCCGCCAGTGCGGTGGCGTAGTCCTCAACCTGATACG
CCTGATAGGCTACCGCACGATGTTGCCAGGCGCTCGGTTGTCGTTGTTCGGCCTGAAGCC
ATGCATACAACGCCACACCGGGTAGCGTGTCCCGATAACACTTTGCCAGACGGTTCCAGG
CGGCGGCATCGTAGGAAGGCGACATATCGCCCAGCAAGCGAACTATTGCCGGGCAATTAT
CTGCAATACCCGGCAACTGACTTTGCCACTGACGTTGCTCCGCCAGCGGTAAGGGTTTCG
ATAAAATCGCCACCTTCGCCGGCGTTGCCAGGTAAGGATGACTTTCCAGCAGAGACGCCA
GTCGCGCCATTAAAGTCTGGCTGACACGCGCATCGCCCTGGAAAGGATAGCGTTGCAGCA
ATAAATCGGCAGCTTCGCGTGACTGCTCGTTCTGCATCAGTTGCCAGGTTAGTTGATCCA
GGCGGGTAAGATTTGCCGGTTCTTGCTGATACAGCAATCGTGCCAGACGCAGAGCTTCAG
CCTTGTTACGGGTCGCCACGCTGACAGCATAACGCTCCTCAAGCATTTCATTGGCGGGGA
GGGTGGCGAGCAGTTTTTGCGCTGCGTCGTACTGACCTTCTTTTAACAGCACCGGTAGCG
TCGCGCCAACAACATACTGGCGGTTGTCGGCAAACTGTACCGTATAATTCGCCAACGCCT
GAACGGGGTTAGCGCTGTATTTAGATAACAGATAGAGCCAACTTTTCTCTTGTGCGTCCG
TGGTAAATAGTGGCTTATTTTCAATGAGATAATGCTGGAGGCGTGCTTTTTCGCCACGAT
AAGCCAGCGCGGTCGCGTAAGTAATATATGACTGAGGATCGGTGAAGATCCCCTGTGATT
GCAGTGCCAGGATCCGATCGTCCAGCTGCCCGGCAAGAAGCACGTCAAACCACTGACGGC
GTTCTGCCGCGCTTAATGTGTTCTGCTGGCGTGCTTCATTGTATAGCGTATCTGCCTGGG
ACCATTGTTTCAGGTAGATTGCCCGTTGCAGCAGATCGGTTCGCAGCGTTTTTCCTTCCG
GCGATGCAGCAAACGTCGCATCGTTCAGTTGCGCTCTGGCGACAGGTAACTGTGCCAGCC
GCAGGGCATTCTGCCCGACTTCACTGCGACAACGCAGGGTCGGCGCAGCATCGCACGCTT
TTTGCTGGGCAAGCAGTTCTTCAACTGTCGTAACGCTTTTCACTTCAACCGGAATAGCCG
CCAGACTGCGCTCAAGTCGGGCATCTCCTGGGTGACGTTTCAGTTGATCCTCAAGCAACA
GCCGCGCCCGGTCATCATGACCAAAATGGCGATAGGCTTCCGCAAGGTATAAAGTCAGCG
GAATATTATCCGGCACCTGCTGGTGTATATATTCAAATTCGCGGATGGCGGTTGCTTCGT
CGTTATTTTTCTGTGCCTTCAGCGCTTTATCGAGACGGGGATAAATAACAAAATGGCGAT
AATCGCTCAGCCCCAGCTCTTCTGCGCTGGTGCCGATATTGTCTGCGAGTGCGCTGGTAC
TCAATAAAGACGTCAGCAGTAAACCAGACCATCCGATGACGCGATTAAGGTTATTCTCCT
TCATTTTCGGACTCCAGTTGCGCAACCTGTTCTGTGTTTAAACCTGCTTTGAGTAATAGT
GATTGCATCGAAACTTGTAATTCGCGTTGAATTGTCAGGACGCGATCCAACGTTTCCTGG
CTGATAACGCCTTCGGTGACCAAAAACTTGCCGAGCGGCAGAGAACTGCGTTCATGGCGC
AATAACAACACGTTAATTGCTGAACGATTAATATGACCGAGCGTGGTCAGTATTTCGGCG
AACAGGAACTGATGCGGCACATATTGCCGCCAGATTTCACCGGCCTGCTGTTCCGTGAGC
CACTGATGCTGAACCGCATTGTACAACATTGCCCGCGGATCGTGACCGCGTCGGCGTGCA
TACCAGTGACGTAACCCTGTGACAATTTGTCCCCGCAGAACAATGACGTAACGCACTTTG
CGTCCGACTTTACGCGTCAGGGCCGCCAGCGAAACCGGGTCAATACCATCTTCACTGCCG
ACAATTAACTCGTCATTTTCCAGACGCAGCGGCAGTACCGCATAATGCAGCGCCACGGAG
GCCGGCATTTCGGCAATCAGCGAGGAAGGGATCTGCCAGGCATCGATGGATTCCCACGCC
ACGCCGTTTTGCTCTGCCAGCGCCTGTGCCAGCTGCTCGGCGCTAATCAGCCCCTGCATC
AGCATTGAACCGCCCAGGCGTAGACCTTCGACGCGATTACGCAGTGCTGTATCGAGTTGT
TCTTCAGTGATGACCTGATTTTCCAGCAGAATTTGACCTAACGGGCGCAACGAGCGGGTA
TCGCCAGTCACGCTGGGGAAGTCATGCGTTGTTTTATCCCACGCCACGCGACGTGGATCG
CCGTGTTGAAGTACCTGTTTTAGCGCGCGCCAGTTGGCCATGAAGTTAATCAGGTTGCCC
CAGAAAAGACGCAGGACGGAAAGCAGCCCCTGCGTCAGGCCGTAGTAGCCAGTAACGAAA
ATCACCCGCTGCACGATGCGGTTAACCATCAAACCAAAGTTTAGCCACAGCAGGGTCATT
AACCATGCGCTGCCGCTGAAAATAGAAAGGAAATGCCAGGCATCGGGCCACAAACTTTCA
TACGCCAGCAACAGCAAAAGCTGGATCATCACCAGCATCGCGAGGAAGCTGACAAAGTTA
CTGATTGCCCCTTTGCGGTCGCGCCAGAGAAAGTAGTTCAGCGTCAGGCTGGAGGTCCAT
TTATGGGTTTTAAAGCCTTGGAAAACAATGCCGATGATCCAGCGGGATTTTTGTCGAACC
GCAGTCGAAAAGGTATCGGGGAAATATTCGCGCACGCAGATCATGTTTGATGTCCGCGCG
TGCTGTAAAAATTTACGCTGCTCGCGTTCTTTGGCTTCGTCCACCACCGGAAAACGGACA
AAAATTTCCGTCATACCTTTTTCTTTCAGGCGGAAGCCAATGTCGTAATCTTCAGTAAGA
CTCTGCACGTCGAAAGCAATACCGTCACCGTCAGCTAACAGTGCGGTCACGGCGCGGCGG
CTGAAACAGGTGCCGACGCCTGCGCTGGGCACTTGTCCGGCGAGGGCTTCACGCACCGGA
ACATCTTTGCCATGCAGCTCTGAAAACTCATCAATGTAAGTCATGCTGGTGAAGTGCGTC
CATTCGCGTTCGAACGGATACACCGGGATCTGAATCAGATCTTTACGCTCGACCAGATAG
TTGAACAGACGCAATTCCATCGGTGAAATCACATCTTCGGCGTCATGCAGAATAAAACCA
GCAAAAGCGAAATTGGCGCTACGCTCAAATTGGGTGATGGCGTCCAGCACGTTGTTCAGA
CAGTCGGCTTTGCTGGTGGGGCCAGGACGCGCGCAGACTACCTTATGCACATTCGGGAAG
CGAGCGCACACTTCGTCAACATCACGCTGAGTATCGGGGTCGTTGGGGTAGGTGCCAACA
AAGATATGATAGTTTTCGTAGTCGAGCGTGGTCGCCGCCAGCTCGGCCATATTGCCGATG
ACGCCCGTTTCATTCCACGCCGGAACCATAATCGCTAACGGTTTTTCATCTGGTTTATAC
AGTTCGCGGTAACTCATTCGCGGGTAGCGGCGATAAACACTCAACTTGCGTTTAATGCGG
CGTACCCAGTAGACGACATCAATAAAAAAATCGTCCAGCCCGCTGATGAACATGATGACC
GCTAACGTTATCGCGATTACTTTTAAGCCGTAGAGCCAGGTAGCAAAAACATCAAGAAGC
CAGTCCACACAAAAACCTTACATTAACGCTGGTTATGTTTAGGGTGGCGTATATTAAGGT
TTTTTATGAATTGTGACAGCTTTTTACCATTAATAGGTATGACTATTGCGGCACGTTATT
TTTACACTGGTTATAAAAGTTGCCGTTTGCTGAAGGATTAAGCGGGTAATGTGATAACAA
ACCTTGTCCCCCGCGCATCCGACGTTACCGCAACCGTGCCTTTATGCGCGACAACAATCG
ATTTCACTATCGCCAGGCCAATACCGCTACCTTCACCTTTTCGCTGGCGGGAGGGGTCAA
CGCGATAGAAACGGTCAAACAATCGCGGTAAGTGCTCGGGCGCAATGGGCGTACCGGGGT
TTTCGACGATAACTTGCACCAGGTGATCGACCGTCTGACAGCGCACTACAATTGTCTCTC
CGGTTGGCGTATAACGCAGGGCGTTCGAAAGCAGGTTGCTTAGCGCCCGACGCAGCATCA
GCGGATCGCCCGCGACCTGACACTTGTCGCCAACAAACCGCAACTCCACGCCGCGATCTT
CCGCTAACGCCTCGAAAAAATCGAACACTTTGCCGACTTCATCCGCCAGGTTGAGCATTT
TCTTTTCGGGGATTAGCTGGTTGTTATCGGCCTGAGCGAGAAACAGCATATCGCTGACCA
TTTTCGCCATTCGCGTCAGCTCTTCGAGATTAGAGTAGAGCACATCTTCCAGCTCCTTCT
GGCTGCGCGACTGGCTGAGGGCGATTTCGGTTTGCGTTATGAGATTCGTAATTGGTGTGC
GAATTTCGTGAGCGATATCCGCTGAGAAATTGGACTGGCGGGTAAAGACATCCTCAATAC
GCTCGATCATATGGTTGAACGACAGTACCAGCTGTTCCAGCTCAATGGGCACGGTCTGCG
GGTCGAGGCGAACGTCGAGATCTTTCGAGGTAATATTCTGGATTTGACGGCTGACGCTGC
GGATCGGCGCGTGACCTTTATGTACCGCCAACAGTACGATAAAGACGATCAGGATGCTGA
TTACCGATGCGGTCATAATAAGTTTATTCATCAAATCATTTATGTAATGAAGATGAAAAT
CGATCGAAAGCGCGATGTAGAGCGTATAAATCGGTTTGCCGTCCACCAACGGGCCAACCG
GCAAGTTAATCATCCGCCAGTTGCTGTGTTCCATATGCCCGTGACCGTGGCCTGGCATCA
TCATCGTCGGGCCGGAAAGGAGATACACCTCGCCACCCTGAGCGTCTTTATCGGGTATGG
CGTCACGCGTAAACTCGCGGATATCCGGCGCACCGGGGGAGTGATACACCGTTTTACCCT
GACTATCTGCCAGGGAAATCAACACATTGGAATAACCACTGACGATATCTTCCAGCGTCA
TTAAGCGTCGGGCTTGCGTTTCGTCAGGGTGATTTAGTACCCGTTCAAGGGTGGCGCTAA
TCTCTTTTAAATCATTAATATCCTGCTCGGCAAAATGAACTTTTACTGAGTGGATCATGA
TCCATGCAAAGGCGAAAAACGCCGCGATGGTGGCCAGGCTGATAAAAAAGGTCAGGCGGG
TTGCCAGCGAAAACGGGCGCTGAAATGGCTTACTGACCATCCGGCACCTCAAGCATGTAA
CCCACGCCGCGCACGGTCTGAATTAGCTTCGGCTCAAAGTCGTTGTCGATTTTGCCGCGC
AGCCGCTTCACCGCCACATCAATAGCATTGGTATCGCTGTCAAAATTCATGTCCCATACC
TGCGAGGCGATAAGCGAGCGGGGCAGCACTTCGCCCTGATGGCGAAGGAAGAACTCCAGC
AGAGTAAACTCTTTACTGGTCAAAGTGATGCGCGTGCCGCTGCGGGTGACTTTGCGGCTG
ACGAGATCGACCATCAAATCGGCAACCTGAAACTGACTTTCGATAATCACCGCCGCCCCG
CGCCGCAGTAATGTGCGCACCCGCGCCAGCAGTTCAGCAAAAGCGAATGGCTTCACCAGG
TAGTCATCTGCCCCCAACTCCAGCCCCTTGACGCGATGTTCAATGGTGCCAAGCGCGGTA
AGCAACAGAATCGGCATCCCTTTATTGGCGGAGCGTAACATGCGCACGATATCCCAGCCG
TTCACGTCCGGCAGCATAATATCGAGGATTATCAGATCATAATCACCGGTCATCGCCAGA
TGGTAGCCATTCAGCCCGTTGTCGGCCAAATCGACCACAAAACCGGCTTCGGTTAACCCT
TTGGTCAAGTATTCTCCGGTTTTCTTTTCATCTTCGACAATCAACAGTTTCATATTTCCT
CCGCATGTTGCCCGGGCAATTCTAGAGTAGCGGGATCAGATGGCAATCGCTTATTGGCAA
AATGACAATTTTGTCATTTTTCTGTCACCGGAAAATCAGAGCCTGGCGAGTAAAGTTGGC
GGCATAAAATCACCAGAAATTATGAGCCTATGTCTCCTTGTAAACTTCTGCCATTTTGTG
TGGCCCTTGCGCTAACCGGTTGTTCACTGGCACCGGATTATCAGCGTCCGGCAATGCCCG
TGCCGCAGCAGTTCTCACTCAGCCAGAACGGCCTGGTTAACGCAGCAGATAACTATCAGA
ACGCGGGCTGGCGCACCTTTTTTGTTGATAATCAGGTGAAGACGCTGATTAGCGAGGCGC
TGGTGAATAATCGGGATTTGCGCATGGCGACGCTGAAAGTGCAGGAGGCACGGGCGCAAT
ATCGTCTGACCGATGCCGACCGCTACCCACAGCTCAATGGCGAGGGCAGCGGCAGCTGGA
GCGGTAATCTTAAAGGGAATACCGCCACGACACGGGAGTTTTCGACCGGCCTTAACGCCA
GCTTTGACCTCGATTTTTTCGGTCGCTTAAAGAACATGAGCGAAGCCGAGCGACAAAATT
ATTTAGCCACTGAGGAAGCTCAGCGCGCGGTGCATATTCTGCTGGTTTCTAATGTCGCGC
AAAGCTATTTCAATCAGCAACTGGCGTATGCGCAATTGCAAATAGCCGAAGAAACGCTGC
GTAATTATCAGCAGTCATATGCGTTTGTCGAAAAACAACTGTTGACAGGTAGCAGTAATG
TTCTGGCGCTGGAACAGGCTCGCGGGGTGATAGAAAGTACCCGCAGCGACATCGCTAAAC
GTCAGGGGGAACTGGCGCAGGCGAATAATGCATTGCAACTGTTGCTGGGAAGCTACGGCA
AGCTGCCGCAAGCGCAGACAGTAAACAGCGACAGCCTGCAAAGCGTTAAATTACCGGCGG
GATTGTCGTCGCAAATCTTATTGCAGCGCCCGGATATTATGGAAGCTGAACACGCGTTAA
TGGCGGCTAATGCCAATATTGGCGCTGCACGCGCGGCATTTTTTCCGTCTATAAGCCTGA
CCAGCGGAATATCGACCGCCAGTAGCGATCTATCGTCATTATTTAACGCCAGCAGCGGGA
TGTGGAATTTTATACCCAAAATTGAGATCCCCATTTTTAATGCCGGACGCAACCAGGCCA
ATCTGGATATCGCCGAAATTCGCCAGCAGCAGTCGGTGGTGAATTATGAACAGAAAATCC
AGAACGCCTTTAAAGAAGTGGCAGATGCGCTGGCATTACGTCAAAGCCTGAACGATCAAA
TTAGCGCCCAGCAGCGTTATCTGGCATCGCTGCAAATTACTTTGCAACGGGCGCGGGCAT
TATATCAGCACGGCGCAGTAAGTTATCTGGAAGTGCTGGATGCCGAGCGTTCTTTATTTG
CAACCCGACAAACTTTACTTGATCTGAATTATGCCCGTCAGGTTAACGAAATTTCTTTGT
ATACCGCACTTGGTGGCGGTTGACAGCAATATACTCGTCATACTTCAAGTTGCATGTGCT
GCGTCTGCGTTCGCTCACCCCAGTCACTTACTTATGTAAGCTCCTGGGGATTCACTCGCT
TGTCGCCTTCCTGCAACTCGAATTATTTAGAGTATGACTTTTAACTCCAGGAGAGAATAA
ATGAAAAAAGCACTGCAAGTCGCAATGTTCAGTCTGTTTACCGTTATTGGCTTTAATGCC
CAGGCTAACGAACATCATCATGAAACCATGAGCGAAGCACAACCACAGGTTATTAGCGCC
ACTGGCGTGGTAAAGGGTATCGATCTGGAAAGCAAAAAAATCACCATCCATCACGATCCG
ATTGCTGCCGTGAACTGGCCGGAGATGACCATGCGCTTTACCATCACCCCGCAGACGAAA
ATGAGTGAAATTAAAACCGGCGACAAAGTGGCGTTTAATTTTGTCCAGCAGGGCAACCTT
TCTTTATTACAGGATATTAAAGTCAGCCAGTAACCCAGGTTTAATGAGATGAAAAAAATC
GCGCTTATTATCGGCAGCATGATCGCGGGCGGTATTATTTCTGCGGCAGGTTTTACCTGG
GTTGCAAAGGCGGAACCGCCTGCAGAAAAAACGTCGACCGCAGAACGTAAAATCTTATTC
TGGTACGACCCAATGTATCCCAATACGCGGTTCGATAAACCAGGTAAATCGCCGTTTATG
GATATGGATCTGGTGCCGAAATATGCCGATGAAGAGAGTTCTGCGTCTGGTGTGCGCATT
GACCCGACTCAGACGCAGAATCTGGGGGTGAAAACGGCTACCGTCACGCGCGGACCGCTG
ACTTTTGCCCAGAGTTTCCCGGCGAATGTCAGTTACAACGAGTATCAGTATGCCATTGTG
CAGGCTCGCGCTGCCGGGTTTATCGACAAGGTGTATCCGCTTACCGTGGGCGATAAAGTA
CAAAAGGGCACACCGCTTCTCGACCTGACCATTCCTGACTGGGTGGAAGCGCAGAGTGAG
TATTTACTGCTGCGCGAAACCGGCGGTACGGCGACCCAGACTGAAGGCATTCTTGAGCGG
CTGCGACTGGCGGGAATGCCGGAGGCGGATATTCGCCGCCTGATCGCCACGCAAAAAATC
CAGACTCGCTTTACGCTCAAAGCGCCCATTGATGGCGTGATCACCGCGTTTGATCTGCGC
GCGGGAATGAATATCGCCAAAGATAACGTGGTAGCGAAAATTCAGGGTATGGACCCGGTG
TGGGTCACTGCTGCGATCCCGGAGTCTATCGCCTGGCTGGTGAAAGATGCCTCGCAGTTT
ACCCTCACCGTTCCGGCGCGACCGGATAAAACACTCACCATCCGCAAATGGACGCTGCTA
CCTGGCGTGGATGCCGCGACCCGCACGCTGCAGCTGCGTCTGGAAGTCGACAACGCCGAC
GAGGCGCTAAAACCGGGCATGAACGCCTGGTTGCAACTCAACACCGCCAGCGAACCGATG
CTGCTCATTCCGTCACAAGCGCTGATTGATACCGGCAGCGAACAGCGGGTGATTACCGTT
GATGCCGACGGGCGCTTTGTACCGAAACGCGTTGCTGTTTTCCAGGCATCGCAAGGCGTC
ACCGCATTACGCTCTGGTCTGGCGGAAGGTGAAAAGGTGGTTTCCAGCGGCCTGTTCCTG
ATTGATTCCGAAGCCAATATTTCTGGCGCACTGGAGCGGATGCGCTCTGAAAGTGCTACC
CATGCGCATTGAGGGAATAACCAATGATTGAATGGATTATTCGTCGCTCGGTGGCGAACC
GTTTTTTGGTGCTGATGGGCGCGTTGTTTCTGAGCATCTGGGGCACCTGGACCATCATTA
ATACGCCAGTGGATGCGCTGCCGGATCTCTCCGATGTGCAGGTTATTATTAAAACCAGCT
ATCCCGGTCAGGCACCACAAATCGTTGAAAATCAGGTGACTTATCCGCTAACCACCACCA
TGTTGTCGGTGCCTGGCGCGAAGACTGTGCGCGGTTTCTCACAGTTTGGCGACTCTTATG
TGTATGTCATTTTCGAAGATGGCACCGATCCGTACTGGGCGCGTTCGCGGGTGCTGGAGT
ACCTCAACCAGGTACAGGGTAAGCTGCCTGCGGGAGTCAGCGCCGAGCTGGGGCCAGATG
CCACGGGTGTTGGCTGGATCTATGAATATGCACTGGTGGATCGCAGCGGTAAGCACGATC
TGGCCGATTTACGCTCATTACAGGACTGGTTTCTCAAATATGAGCTGAAAACCATCCCTG
ACGTTGCGGAAGTGGCGTCGGTGGGCGGTGTGGTGAAAGAGTATCAGGTGGTTATCGATC
CCCAGCGCCTGGCGCAGTATGGCATCAGTCTCGCCGAAGTAAAAAGCGCGCTGGATGCTT
CAAACCAGGAAGCGGGCGGTTCGTCGATCGAACTGGCGGAAGCGGAATATATGGTGCGCG
CCAGCGGCTATCTGCAAACGCTCGACGACTTTAATCACATCGTTTTAAAAGCCAGTGAAA
ATGGCGTGCCCGTTTATCTGCGCGATGTTGCGAAGGTCCAGATTGGCCCGGAGATGCGCC
GGGGCATTGCCGAACTAAACGGCGAAGGCGAAGTGGCGGGCGGGGTGGTGATCCTGCGAT
CCGGCAAAAACGCCCGAGAAGTGATCGCCGCCGTGAAGGACAAACTGGAAACGCTGAAAA
GTAGTCTGCCGGAAGGCGTGGAGATAGTTACAACATACGATCGCAGCCAGCTCATTGACC
GCGCCATCGACAACCTCAGCGGCAAGTTGCTGGAAGAGTTTATTGTGGTGGCGGTAGTCT
GTGCGCTGTTTCTCTGGCATGTGCGCTCGGCGCTGGTGGCGATTATTTCGTTGCCGCTGG
GGTTGTGTATTGCTTTTATTGTCATGCACTTCCAGGGACTGAATGCCAATATTATGTCGT
TGGGTGGCATTGCGATTGCCGTCGGGGCGATGGTCGATGCTGCTATCGTCATGATCGAGA
ATGCGCATAAACGGCTGGAAGAGTGGCAGCACCAGCATCCTGACGCCACGCTGGATAATA
AAACGCGCTGGCAGGTGATCACCGATGCGTCTGTTGAAGTGGGGCCGGCGCTATTTATCA
GTCTGCTGATTATCACGTTGTCGTTTATCCCGATCTTCACCCTGGAAGGGCAGGAAGGGC
GTCTGTTTGGCCCGTTGGCGTTCACCAAAACGTATGCGATGGCGGGTGCGGCGCTGCTGG
CGATCGTAGTGATCCCGATCCTGATGGGCTACTGGATCCGTGGCAAAATTCCGCCGGAAA
GCAGTAACCCGCTCAATCGCTTTTTGATTCGTGTTTATCATCCGCTGTTGCTGAAAGTAC
TGCACTGGCCGAAAACCACGCTGCTGGTGGCGGCGCTTTCGGTGCTGACGGTTCTCTGGC
CGCTCAATAAAGTTGGCGGGGAATTTTTACCGCAGATCAATGAAGGCGACTTGTTGTATA
TGCCATCGACGCTGCCGGGGATTTCCGCAGCAGAGGCGGCGAGTATGCTGCAAAAAACCG
ACAAGCTAATTATGAGCGTACCTGAAGTGGCGCGGGTATTTGGCAAAACCGGGAAAGCGG
AAACCGCCACCGATTCTGCTCCGCTGGAGATGGTAGAAACGACCATCCAGCTTAAGCCGC
AGGAGCAGTGGCGGCCAGGCATGACGATGGACAAAATCATTGAGGAACTGGATAACACCG
TGCGGCTGCCGGGGCTGGCGAATCTGTGGGTGCCGCCAATTCGTAACCGTATCGATATGC
TCTCAACCGGCATTAAAAGCCCCATCGGCATTAAAGTTTCCGGCACTGTGCTGGCGGATA
TCGACGCGATGGCTGAGCAAATTGAAGAAGTAGCGCGAACGGTGCCAGGCGTAGCTTCTG
CGCTTGCCGAGCGGCTGGAAGGTGGGCGCTATATCAACGTTGAGATTAACCGTGAAAAAG
CCGCACGTTACGGTATGACGGTGGCGGATGTGCAGTTGTTTGTGACTTCTGCGGTGGGCG
GGGCGATGGTTGGCGAAACGGTGGAAGGGATTGCCCGTTATCCAATTAATCTGCGTTATC
CGCAAAGCTGGCGCGATAGTCCGCAGGCACTGCGCCAGCTGCCGATCCTGACGCCGATGA
AGCAGCAAATCACCCTGGCAGACGTGGCCGACATTAAAGTCTCTACCGGACCGTCGATGC
TGAAAACCGAGAATGCGCGCCCGACGAGCTGGATTTATATCGATGCCCGCGATCGTGACA
TGGTGTCGGTGGTTCACGATTTGCAAAAAGCGATAGCTGAAAAAGTGCAGTTAAAACCGG
GCACCAGCGTGGCATTCTCCGGGCAGTTCGAGCTACTGGAGCGCGCCAACCATAAGCTTA
AACTCATGGTGCCGATGACGTTGATGATTATCTTCGTGCTGTTGTATCTGGCGTTCCGTC
GGGTGGGCGAAGCGTTGCTGATTATCAGCAGCGTACCGTTTGCGCTGGTGGGCGGCATCT
GGTTGCTGTGGTGGATGGGCTTTCATCTTTCCGTGGCGACGGGCACTGGCTTTATCGCCC
TCGCCGGGGTCGCCGCCGAATTTGGCGTGGTGATGCTGATGTATTTACGTCACGCCATAG
AGGCCGTGCCGTCGTTGAATAATCCACAAACATTCAGCGAGCAGAAGCTGGATGAGGCGT
TATATCACGGCGCGGTCCTGCGCGTGCGCCCGAAAGCGATGACGGTGGCGGTGATTATCG
CCGGTCTGCTGCCGATTCTGTGGGGAACGGGGGCTGGTTCAGAGGTGATGAGCCGGATTG
CCGCGCCGATGATTGGCGGCATGATCACCGCACCTTTGCTGTCGCTGTTTATTATCCCGG
CGGCGTATAAGCTGATGTGGCTGCACCGACATCGGGTACGGAAATAAAAGCAGGATACCC
CGTTTAACCGTGTGGATTGTGTCTTGCGACGATGGGCACTAAATGTTAAAAGGTGCCCCT
CAACAAAAAAGACACACAGGGGAAAGGCGTGAAAAACGCGTCAACCGTATCGGAAGATAC
TGCGTCGAATCAAGAGCCGACGCTTCATCGCGGATTACATAACCGTCATATTCAACTGAT
TGCGTTGGGTGGCGCAATTGGTACTGGTCTGTTTCTTGGCATTGGCCCGGCGATTCAGAT
GGCGGGTCCGGCTGTATTGCTGGGCTACGGCGTCGCCGGGATCATCGCTTTCCTGATTAT
GCGCCAGCTTGGCGAAATGGTGGTTGAGGAGCCGGTATCCGGTTCATTTGCCCACTTTGC
CTATAAATACTGGGGACCGTTTGCGGGCTTCCTCTCTGGCTGGAACTACTGGGTAATGTT
CGTGCTGGTGGGAATGGCAGAGCTGACCGCTGCGGGCATCTATATGCAGTACTGGTTCCC
GGA