MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download LD3-4-1.seq
 Deletion LD3-4-1
 Length 36841
 Fasta Format

>LD3-4-1
CCCCCACTCCCGCATCCGCTGATGCAGCGTCAGTGACGGCTTCTCGGAAAACAGCTGCTG
GTAATCCGTGGCAAATTGCCCCAGATGCCAGAATCCCCACTGCATGGCGGCGTCTTTTAC
CGTCATACTTTGCGACCACGGACTTATCAGTTCGCGGCGTACGGCGTTCAGGCGAATGCG
TTTCAGCCACGCGTTCGGGCCAATGCCTAAAATAGCGTGAAACGCGTTTTGTAGCGTGCG
GCGGCTGACATGCAGTTGATTACACAAATCCAGCACCGTCACCGGTTCGGACATGTTTTC
CAGCACATATTCACGGGCGCGGGAAAGCAATCGACGGTAACTCTGATGACTGATGCTTTC
CGCCGTCACCATTGGTTGCGCTTCTTCCAGCATGGCCCCCATCGCCATTAGCAAATTATC
CCCCAGCACTTTTCGCACTGCAGGCTGATGGAGATTTTCCGGATTCTCGCAAAACGTCGC
CAGCGCCTGTTGGACAAAGCCCCACAGCGCGGCTTTATGCTGCTCTTTCACTTCCAGCGC
CGACTGGTTACGCAACATATGTAATACCCGATCCGGGTTATGCAAAAAGTTAGCCTGCCG
GGTGATGACATCTTCAGAAAGCACCACGCCCAGGATCGTGTAATCATCCGGCGTGCTCAG
TTCAAATTCAGTGCCACCAGGGCGGGTGGCGATTTCCGCGCTTCCCAGACATTGCGAACC
GATAAATCCCTGCTCACCGCGCGTCGCCGGAATGCCAAACCAGAACGAGTTCGGCCAGAC
CAGGCACGACTGACGCAGCGCCAGACCGGTGTATTCACGAAAAACCTGAATATCATCGAG
TAGAATTTCCGTAAATTCACCATGAAACTTGCCCGGATGCAGCTGATCGTAAATCTGCTG
CCAGGCGGTAATCGTTAAAGCATGTTCATAGACATCCGTTGTCTGTCGTTGATGAACATT
ATCCACTTCGACCTTCGGCGTGAGCTTCAGGTTTTCGGGTAAGGGTTCATGATAAAGATG
GTGCAAATTGGCTGTACGGGTCTTTTTCATGATGTTAATGCCGGGTGTTGTAGGACACCC
GGCACCTCCGACAGGTTAATGGGGCTTGAGACGATAACGACTACTGCGTTTACGTAACGT
CCCGGCAGAAAAGAGCTGTTCGAGCGCATTTCTGGCTTTTTCCAGCGGCCAGCCAAAGTG
GGCAGCCACTTCTCCTGCCGTCATTCCCTGACGTACTGATGTTAACAGCGCCAACAACTC
GTCAGCAGATTCCGCGACGATAACTGGCGCGTCGGGTTCCCTTACGGGTTGCTTCGGCTG
GCGGTTAAAGCCAGTAACCAGCCACTGGGTGTCATCGTCTGGCCGACCGATCTCCTTGCG
GCTGATGACACGCCCGGTACGCATCGCGGCAGCACAACCTGCGTCCAGCGCCGCACGACA
CGCCGCCAGATCGCCTTCCACCACCAGCGTTAAGCGACCAGGGTCAAGCACTTCGTGACT
GAGCAGACGAACGTTAGCTGCTTTGAGCATGGCATCCGCTGCATCTATCGCGGCGACCAT
GCCGTCCACTTCCAGCAATCCCAGTGCATTGATCATCGGCAACCTCCGTTACGCACGCTG
GATTGGATTACGCGCGATTTCCAGCACTGCATCGGTAAAGGCGTTACAGGCTGCTTTACA
CGCTGCCTGGCTACCGGTTAAAAATGCTGCCGAGTAGTTGGTTTCAGACGGTGGCGGGAC
ATAGGTCGCCAGCTGTACGTCGGCAGACTTCAGGGCTGCATCAATGCCATAGGTCGCTTC
CAGCGGCGGTGCCACCAGATACGCCATCGGATCGCCAAGCGTGATCCCGGCGGTTGATGA
GAGATAAGAACCGGTACGCGAAACTACATGTGCCAGGAATGCCGTATCTTGCGCGTCATT
AGCCCACTGGAAAGCTGCGCCATTTTCAATATGCGCAATCATCGCATCCAGACCTGCACG
CACTTCCGCCGGGTTTGGCCCACCAAGCATAATCAGCACTTCACCGGCAGTCGGTGACGG
GCCGTGTGCAGCGCCCGCATATAGCGAGCGGCCATACACCACTTCCACCATCGCCTGCTT
GGTCGCTTCATCAGCGGCAATGTAGGTGACGTCATCGGAGTCGGCAGAAATCAGACCGAG
GCTACGAATATGCGGCGGCAATTTCAGTTCACGCGCAAAATCGGCGTTAACGGAGGCAAT
CACCCGCATAGCGGTGACAGACGGTCGAATCAAATCTAAAGCTGGCATGATGCCTCCTTA
TCGGGTCATGTTGATGCCGGATGCTTTCTGCTCCAGCATACGTTTCGCCAAATCCACAAT
GACGGCTGCGGCTTCAACCGGCGGCGTGCCGCCCTGGTGAATGTTAGAGATACAGGTGCG
ATCGGCCTCAACGGTGGTCGCCATACGCGGCGAGTAAACGGCGTAGCAGGAGAGGCTTTC
TGACTGACCCAACCCCGGACGTTCGCCCACCAGCAGGATCACTACTTTCGCGCCGAGGAT
CTCACCGATCTGATCTTCAATCTTCACGCGACCATAACGAACAAAGAATGGTGTACCGAC
TTTCAGCCCGGCCTGTTTCAGGCCCGCCATCAGCGGTGGCAGGATCTCTTCGTAGTTCAC
GGTGATCGCATCAGTTGACAGGCCATCAGAAATAACGACCTGTACGTCCGGATTGGCAAC
ACACTGCGCTTTCAGCGCTTCAACAGCTTCTGCACACAGGCGGCGGCCCATATCCGGGCG
AGTCAGGTAGAGATTTTTGTCGCTAATTTCAGAGCGTACTTCCAGCAAGCCCTGCGCTTT
CACCCACTCTTCCGGCACTTCTTTCAGTACGGTATCTTTCGAACGAGAGTGATCGGCCAG
GAAACGCAGCAGCGCCTGCGTACGTGGACGCGGACCGGCACGACCGGTACAAACGCGGGC
CACGGTGCTGCGGCGCAGTTCTGTTAATACGTCTGCGCGATGCGGATTTTCAACACCAAT
CCACGCTTTTGCTTCAGCGGAACCTAAATCCAGCGCACAGCTTTCCGAGGTCACCGGTGC
CGCACAGTTGGTGGTGGCGCACTTTGCTTCTGACGGCGCGGGGGCCGCTTGTCCCATTGA
CGCCATCACGCTGCGTACAATTTCTTCAATCTGTTTTTGATCCATGATATGTTATCTCCG
CGTCATCAGAAGAACAGTGACGGATCGCCCGCCCGTTTGGTCAGGCGACCGTTTGCCATA
ATGCCCATGCTTTCCAGCCAGCGTTCAAACTCCGGTGACGGGCGCAGGTTGAGTAACTGA
CGCACAGTGGCGGTATCGTGGAATGCGGTGGTCTGGTAGTTGAGCATGATGTCATCACCC
AGCGGCATCCCCATGATGTAGTTGCAGCCTGCGGTGGCGAGCAGGATCATCAGGTTTTCG
TTGAGGTTCTGGTCAGCGTCAGCGTGGTTGGTATAACAGCAGTCACAGCCCATAGAGATG
CCGCTCAGCTTGCCCATAAAGTGATCTTCTAAGCCAGCACGGATAATCTGGCGGTCGTTG
TAGAGATACTCCGGCCCAATAAAGCCGACCACGGTGTTGACGATAAACGGATCGTAATGA
CGCGCCAGCCCGTAGTTACGTGCTTCCATCGTTACCTGGTCTGCGCCGAAGTTAGCGCCA
GCGGATAGCGCAGAGCCTTGTCCGGTTTCGAAGTAGAGGCAGTTTTCCCCGGCGATACGG
TTGAACTCCGCGCCCACTGCGCGCGCTTCGTCGAGCATCGCCAGCTCCACGCCAAACTCT
TTCAGCCCTTTTTCGCTGCCACAGATACTCTGGAAAATCAGCCCGCCCGGTGCGCCACGA
CGGATCGCTTCGATCTGGGTGGTGACGTGCGCCAGTACACAGCCCTGAGTTGGGATGTTG
AATTTGTCGATCACGCCATAGATGGTATCCAACACGCGGCTTAAGTTTTCCACGTCGTCA
GTCACCGGGTTAACGCCGATCACCGCATCGCCCACCCCGAAGGAAAGCCCTTCGTAGATT
TGCGCGGCGATACTTTGCACGTCGTCACGGGTGTCATTTGGCTGCAAACGGGCGCTAAAG
GTGCCCGGAATACCGATGGTGGTATTGGCCTTTTTGATTACCGGCATTTTCTTCGCGCCG
TAGATCAGGTCCGCGTTGGAGCAAATCTTCGCTACCGCCGCGACCACTTCCGAGGTCAGC
CCTTTGCGGGTAAAGGCAATGTCGTCCACGCTGGTTTCATCGCTCAGCACATACTCACGC
AGTTCGCTGATGCTCCAGTTTTTAATCTGGTTGTAGGCCGTTTCGTTAACATCGTCCTGA
ATCAGCCGCGTCACGCAGTCATCTTCATAGGCAATCACCGGATTATTGCGGATGTCCGCT
ACGGTCATTTCCGACAACACCTGCTTTGCCGCCACGCGCTCCTGTGAGCTTGCCGCTGCG
ACGCCCGCCAGCACATCCCCCGAACGCAGTTCGTTGGCTTTAGCCAGCACCTCTTTTACA
TCCTTAAACTGATATACATTGCCGAACAATGTGGTCTTTAGTTTCATAAGTCGTTCCCTC
AGGAAGAATCGATGATTGGCATTTTTCACAGCATTCTAACAATCACGTTTCATCGTCAGC
CCTTGTCGTGTAAGGTGGTTGCCTAAACACGCCCGTTATTCATCACGCCGAACGCGCCGG
ATACATGATCGGGGTTATCCAGTCGTTAAATCAAGGTATCCGGTTTTGAGCAAGACACCA
CTCACAGCAAAGGCCATAGACGCCGCACAGCCGCAGGACAAGCCCTATAAACTCACCGAT
TCACTGACGCCGGGGCTGTTTTTGCTGGTGCATCCCAACGGTTCGAAATACTGGCGATTC
AGGTATTGGCTGAATAAACGAGAGTTTTTGCAGGCCATTGGAGTTTACCCGCTAATCACA
CTCAAAGAAGCACGCAGGCGCGCCACGGAGAGCAGATCCCTTATTGCCAATGGAATTAAC
CCAGTGGAACAAGCCCGCAAGGAAAAAGCCATTGATGCGCTCAACATGGCGGCAGGATTT
AAGAAGGTGGCGGAAGACTGGTTTGCTACCAGGGTTGGAGGGTGGTCGGAATCCTATGCA
AAACAGGTCAGATCGGCACTAGAAAAAGACGTCTATCCGGTACTTGGCAAGCGGTCGATT
GTCGATATAACCGCCCGTGACGTGCTGGCATTACTCCAGAAGAAAGAACGTACCGCACCG
GAGCAGGCCCGCAAGCTACGCCGGCGCATCGGTGAGATCTTCAAGTTTGCCGTTATCACC
GAACTGGTAACGAGGAATCCGGTTGCAGATCTTGATACGGCACTGAAGGCCCGCCGACCT
GGTCACAACGCGTGGATACCGATTAGTGAAATTCCGGCCTTCTACAAAGCCCTTGAGAGG
GCCGGGAGCGTCCAGATTCAGACGGCAATACGTTTGCTTATATTAACGGCATTAAGGACC
GCAGAACTGCGTTTGTGCCGTTGGGAATGGATAAACCTGGAGGACGCAACAATCACATTG
CCCGCTGAAGTCATGAAGGCCCGCCGCCCGCATGTGGTCCCGCTATCACGGCAGGCGGTC
GAGCTATTGCAGGACCAGTTCACACGCAGCGGATACAGTGCTTTCGTCTTTCCAGGCCGA
TTCATGGATAAACCCTTGTCAGCCAGCGCGATACTTAAAGCGCTTGAGCGTATCGGGTAC
AAGTCGATAGCCACAGGCCACGGCTGGCGCACAACGTTCAGCACCGCACTTAACGAATCA
GGCAGATACTCGCCGGATTGGATTGAGATCCAACTAGCCCACGTCCCGAAGGGAATAAGG
GGCGTTTATAACCAGGCTGCCTACCTGAAGCAACGGCGAGCAATGATGCAGGATTACGCC
GACGCTATTGATTCAATATTGGCAGGTAACGGCAATCCTCTAGAACCGGAATGAATAATT
AAGCGGCTTTTTTGCAAAGCGCAATTTTGCATTTTGTATAAGTATTTGTTTTGTGTGGTT
TAACTATCACCTGATAAGAAACCTGTATTCAATTTGCCGGATTCGTCCGGCTTTTCTTTT
TCGCTAATTATTCCATTATTCCAATTAAGTGGAATAAATTATTCAATATCAAGAACTTAA
ATCCATGTTTGCAACGAAAGATCCAGAGTTCGAAAATAGGATCAACACAAATAAAAGCCC
CCGGAATGCTGCAACATGCCGGGGGCGGTATGAGAAACAAGCTAAAGGAGAATTTCTCAT
GTCTGATATGCTAGCAGTAGAACAAGAAACAAACAATGATGTTCGTCAATTTTTAAACAA
AATTAACGAGTTACGGAATAAAGCACCCAAAAACGAAGAGACTAAACACGAAGAACACAC
GCCAGATAATCACGAGGAAACAGATCATCACGAGGCAAAACAGCAGGAGCAAGCCTGGCG
TGGCAACCTGCGCTACCTGGACACATTAAACCGACTTGATGAAGTATTGCCCCGCAAACT
GTACGAAAGATGGGAGAAAGAACATACAGTCAACGACGAGGCTGTGCTACGTGCTCTTTG
TTACTTCGCTGGTACTGGCAAAAACTCACAGTTGGGATGGTGCAGGGTTGGTAGGGGAAC
AATCGACAAACGAGCCAGGCTATCAAAAAACACGGTTAAAAAATGCCTCGATCGTCTGGT
CAACCACTTCAAACTTGTTGAGCGTACTGAAGGCTATATACCAGGATCGGCAGAAAGGGA
GTGCAACGAATACCAGTTATTATTCAAGCCGTACAACATGAAATAACGGAATCAGGCGGG
CAATGTTCCCGCCTTTTCTTTGCCTTAATTCCATGAATTCAGGTGGGTCAAAAGTTGCCG
TTAGTGGTGGGTCAAAAGTTGCCGTTAAGGTGGGTCAAAAGTTGCCGTTAAGGTGGGTCA
AAAGTTGCCGAGTAAGAATTCTACTATTAAGAATTCTAGGCGACGGGAGTTTTTTAGCCT
CCCGGTCGGTCATAGAGAGTCGCCTAGAGTTAAACAGAAGAATTATTTCGCCGCCTGATA
GGTCGGCTGGTTGCGAGCATTAACCATGCTGATTAGCGCAATCATTTCCAGCAAGCTGGA
AACGCCCATTCACTCACGCACAACCTGAACAGCAGACCAACAAACCATCATGGCATTCGT
TCATGGGGAGCGCGGTATATCTCAAAGGGTGATTTCTTATTGGTGGGCCTTCGGAAGGCT
TCGAGCAATTGCCAGCTTAAAAGACGGGCTTAGCAGTGATGGTTATCCGCCACGAATGTC
CGTCATATTGCATTGCGCAGAAACGCGTGGCACTGAGGGAGTTTTCCGAATTAGTTTTGG
GGACCCTTTCCCTGCTTCTGGAGCAAAAGACGAACGGCAAATGCAGTGCTTCCTTGTACG
ACTGCAGCGAAGAAGAAAAGCTGTTTGTTAAGCGCCTGAAGTTAATCAAAGCGGATATCC
ACGCCCAGCTGAAGGCCTGTGATTGCGATATTTCTGAATGACAGGTGGAATCATGAAACA
CGTTTTTAAATATCTTGATTTTGCAGAAGACCGCGAACACGCAGAATCAGTGGCGACCAA
AGAGTTAAAACTGGACCACGTAGAAAAATTCGCTATCCGCGATCTAGCCAATGATATCAA
AGAGCGTGGGTGTGTTGAGCTTGTCCAGCCTGGTGGATTCGATGAGCTGGTTCAGATCTA
TGAGGCCGGAGGCGATGGAATAGAGCCACTCAATTGTGGAATCGAATCAAGGAAGGTGGC
AATTGCTGCCCTGCTTCGCGTCATGCGTGAACCAGACTTTCAATGCCTGGAAATGGTTCA
CGAAATCATAAGAATTGCTAGAGATTTGGAAGCGCCAGTTGACGCTCCGTTAGATTGCTA
ACGCCAAAATTAGCGCTGAATTAATGGGTAATTATTGCGGTTTTTGTCAATTTTCAACCT
CAATTCTTGCGAAAAATGGCAAAAATAACGGTATTTTTCATCATTTATTGGGGGTTTTAT
GGAAGGCGAACTGATAGAAAACAATGGGTTAGACATTTATGACACCAGCGAAACACCGAA
AAAGCGCGGTCGGCCAGCTAAATATAATGAAAAAATAGCAACGCAAATCGTCCTATTGGT
AAGCGAAGGTTATAGTTTGCGCAAGATCAGCATGATGCCAGGGATGCCGAGCCACCGTCA
GATGATGCGCTGGCAACTGGAGCATATGGACTTCAGGGAAGGGATAGCCTGGATGTCGTG
GCTATGGTGCGCTGAAGCTGGCCGACGTGCCGTCGAGATAATCGACGAGGTTGATATAAA
CGCAGAGGATGGGCCGAAGCAGTTGCGCAAAGCAGAAGCAAAGGCAAAGGCACTACTGGC
AGCAGCCAAGCTGAATAGTTTGAAACATTCACCATTTGGAGATGACAAACAATGAGCCTG
ATCCGCACTGAAACCAGAGACACAAAACGCGCAGCTGACCCACTGCACGACCTGCGTAGC
AAGCCGTTTTCTGAGTGGGGCGAAGATGAAATCAGGCGTTTTAATCTGATAGACGCGCTT
CTTGAGTTTGTCTACACAGACACATCCAGCCCGTTCGGTATCGGCATGACCTTCGATTAC
ACGGAGTGCTGGGAAATTGGTGTTCGTGACGACTGCCTGGTAATGACACGCGTTAAGCCG
GTGCATCCAGAATATGCGAAGCACTGGAACATGAAAGGCGTCATGAATGACAAAACCCGC
TTCCACGCCGACAAGTGGGTAGGGTACAGCAAGGTGCTTGCCTGGGTGAGCTTATCGCAC
AAAGACACCTTCACGGGTGCGAAACGGTTTCAATACTTCCAAACGATGTACGACATGGAA
CGGCAAATCAACGCAAACCTGCCGGTTGGCGGCCTTCCCAACGTTGACACAGAGCGAACT
GGCAAACTGTTCCAACGCGATGACTTTTCTGAGGATAGCCATGCCAACGATCCGAAGTTG
GTTGGTGATGATTACGTCCCCCAGGCACCGGAGCAAATCAACTGAATTTTCGGACAAACG
CGCGCGTAGCCGACGTCAGCGGCAAGACTGGCGGTCATTTCCCCGCTCCTACGCGAAAAA
TCCCTCACAACTACCCTGCAAATTTTCCAGATTTCACGTACACGCGCCAAAAATAAAGGC
CCAGGCAGTTAGCAACCTACCCGGGCCTTTCTCACAATCCCCGCTGACATTATATCACCC
ATCTTTCCGTTTTCAGGTGGGAGACTGATGGCCGCCGACGTTGCACAATTGATTAATTTC
TGAACATTCAAATCAACTCCCACCAAAGCCAACAAGATGGGAGGTGAATTTTGTGATGCA
GATCGCTTTTTCCCTTCAGGCATTTTTGTTTAATTCAATCAACGAAAGGCAGTTCCCAAC
AACAAAATAAAGATGGGAGGTAAAAATGAAACGGTGGGAAGTGGCTTTACTGGTGATGGT
AATGTTGGTTTGCTGTATTGAACTGTGAAGGAGGACGCCATGAAACTTTTAATCGCAATC
ATCCTGATGGTGCTGACTGGTGTTTGCTTTGCAGATGTTGGTGATTACAGGCTGAACGGG
GAGGATAACGCAAGAATTGAATCAGTCGTTACTGATAACTGTGAAAAAACAGCCGTATTG
GTAGGCGGTGACAGGCTTGCGAGGGTTGAGATCGAATATATAGCGACATTGTGCAAGCCG
GTGGCTTTGGTGATTATTTACGACAGATTTGACGATATAGCGGCAATCCCTCTTAAGGTG
ACGTTGAAAAAGGTATTGAAAGAGAATAGCGATGAAAAGATTAACCTATTGAACAAGATG
GGGGATCTGGCTGGTCGTATCGTTGCAGAGCAGTATTTAGGCATGAGTTTTGAGTAAGGA
GGCAATCATGAAAGTGTTAGGTAATATTTTATGGTGGGCTTTTGTTGGTTTCATGGCTTA
CGCCACTTTGATTAAGCCGGACAACACTGATCCAGCTGTTGTGAACTATGAAGAGCCTTT
GCCTATGGAGCTTGCCAACTATGGCGAACCAGGTGAAGGGGCGAAAATCATGAATGCCGC
AAAAATAATGGGTCGCGACTACGCATGGAAACATGTAAAAGAAGACAGGTTGCCATGTCT
GTTTGCCGCCGGGGTTGTTGCTGATAACATCCTGGTAAAATACCATTTCAGCAATGAAAC
TGAGTTCAAACTTAAAGCGGCAGCGGTCAGAGAATGCGCCAACGTAGCAGAAAACAACGG
CTTTGTTTTGGTAGGTAGAGTATTTGAAAAACGTAATTGATTGCGAATAGCAACAACTAA
ACAACCAATACACCCGGCCCCTCGCCGGGTTTTTTGTGATCTGCGTCAATATTCCCTTCC
GTTACGCTTACCCTCCACCAATACGCGTGTTAACCTCCCAATGGATTCTATGAGATGGGA
GATAAAAATCATGAGTTACGAAATCAAAATTTGCGACATCCTCAAAGGCGCTGCGATGGA
AGGACAATATAAGGGCGCTCAACGTGGGGCCAAATGCGAGGAGATCGCAAACGAGTTAAC
TCGCCGGGGAGTTAAAAACAACAAGGGAGAGGTTATTACTAAGGGCGGCGTTAGCCATTG
GCTGGAAGGTAGACGGGAGCCAAATTTCGACACTCTGGCTGAACTGTGCGACATGTTCGG
CGTTTATGCCCTGATGCCGATGCGTGGCGGTAAATGGATTCGAGTTCACCCGGAAGACCG
TGGAGAAATGGAATTACGCGAGGCTGTAGCTGAACGAGATGCTATTATCGACGACCTGAA
GGCCCGTATCGCTGAGCTTGAGGCGGCACTAGCAAATAAACAAGTCCCAGCAGAAGCGGA
AGAGATGGGAGGTGAAAAAGTGGAAGAAGTGGCAGCAGAGCAAGCGCCCAACGATGAAAA
AGAGATGGGAGCTAAGGAGTGGGTTAACCCGAACCCGAAAAAATACAGCGTCGGCATGTT
GTGTCAGGTACTGGCTGCAATGGGCGGCGAATACCTGGGCAACAACGCAGGGTTACAGCA
GAAGATCACTGTGTTGGATAACGACGGCAACCGGAAGCCAATCAGTAACGGCGCGTTTTA
TCGACTGATTGAGCAGGCCAAAGGGAGAGGATTGATTAGCGTTGAACAGGAAATCAAACA
CAAGAAAGACGAAAACGGCAACCAGATCGGCAAAGGCAAGAAAGGTGACAAGCTGATAAC
TTTGCTTCCCAACTGGATTGATAAGCTGGGAGACGAATAAACCAGCCTTCAACCCCATCT
CATCAATCAACGCCCGGCCCCGCTGCCGGGTTTTTGCTATGCACCACAATTACCCCAACC
GGATACACAGCCGGATACAATTCCACCAGCACCCAGCCACCCAGCGCCACCGCTGGCGAA
TACCGCATTCAGGAAGGAAATGCGAGTGATTTCACCGTCACCGGCACAACCGATCCGCCA
AAAAGAGGCGTACCAATGTCGATATAGTCCCCCGCGCGGACAATCACTTCGTCAATGACT
GCCAACGGGAGTTGTTGTAGCTGTGGGCGCAACAACATGCCCAGAGCTTTACCAAAGTCC
TGCCCGGCCACCACCAGCAGGGGATGCGGATTCGGAAAACGCGCGACGAAATCGACCAAC
GCGTTGATGACCGTCAGTACCGCGGCGTAACGCACAGGCAGCGAGGCGGGAAGCGCCAGC
ACGTACGCGTCAGTTTTGGGATCAAGATCCAGCTGAATCAGCGCCTGTTGCCAGGCCCCC
ACCAGATCCGTTTCATCAATCGGGATCGCCACCGGCAAATTGCGCAGCGGCAGTTGTACG
CCCTCAAGCCAGATTGTGCTGCCAGAGAGCGAAAGGGTATGCGCGCCCGCGCCAATCACC
GTGGCGCGCACGGTTTGCGCCGGAAACTGTACGTTCATCTCACGCAGGCGCGGATGGTCA
TGCAGCGCAGTTGCCAGCAGCGGGCCAATATCGGCAAAACAGAACGGGTCGGCGGGCTGG
TGGCGATAACATTCGCCCACGCCGCCAGAAAGCGTAATGATTTCGGGCGTAACACCTGCG
GGCAGCAAACCGGTTTGCATCAATGCCTGCGCGAGCGGTGAGAGCGTTCCGTCAATCACT
TCGACAATCAGTTCTGCCATCCGCCGGGTCACCTGCACCAGCTGCGCGCCGGTCAGCGAA
CGGGCGTCGGTGCCTGCACCGAAGCACTCATCCACAATCATCTGCCCCGGTTTATGAGCG
TAAACCACGCGCCCGTGGCTGTCGGTTTCCAGCAGGCGACCACCGACGTTGAGGCAGGCA
GTGCCGCTGATTTTTCCGGCATCGAACAGGGCGTAGTTCGCGGTGCCACCGCCGATGTCG
ATATTCAGTACCCGACACAGCCGTTGTTCAGAAAGGGTTTGTGCCCCGGCTCCGTGACCG
GCGATCACGGATTCGAGGTGCGGCCCGGCGCTGGCAACGACAAAATCGCCCAGCGACTGA
GAGAGCGCCATCACCGCCGGGCGAGCATTGCGGGTTTTCGCGCTTTCACCGGTGATGATG
ATGGCACCAGAATCAACGCTTTCCGGCTCAATACCCGCAGCATGATATTGCTCGAGTATT
AAGGTTTTCAGTTCCGCTTCTTTTAAACCGCCCTGTTTATCGACAGGGGTAAAGAACACC
GGACTTTGCCAGCTAATTTCGCGTTTAATGAATTCGTAGCGCGGCACCTGCGACACCGCC
GCACGGTTAACCAGCTCCAGCCGGGAGAAAATCACCTGGGTGGTGGTGGTGCCGATATCG
ATACCGACGCTCAATAGCTGGCGAGTGTTCACGATTGTGCCTCCGCTTCGGTTTTAGTCG
CGGTCGCGTCTTCTTTTGGCACCAGCATCATCGCCACGCCAATCGCCGTTACGCCGCCGA
TCAACTTGCCGACAATCATCGGGAAGATCATGGCGTTCATGTTGGCAGCGGCGAAGCCTA
AGTGGTCGCCCAGGGCGAAAGCAGCGGAAACGGCGAAGGCGCAGTTGATGACTTTGCCGC
GGGTATCCATCTGCTTCATCATGCCGAACATCGGGATGTTGTTGGCAAGCGTTGCCACCA
TGCCGGCTGCCGCGATGTTGTTCATATTCAGTACTTTACCGACGCTCATCAGCGGTTTTT
CAAACCAGCGAGTCAGCAGCAGCACCATCGGATACGCCCCTAACAGAACGCAGGAGATAG
AACCGATAACTTCAATGGCGCGCATCACCTCACCGGGTTTATCGCCAGGGGCCATAAAGA
TAGGATCCAGACCGGGGATCAGTTCCCAGCCAAGCAGGAATTTCACTACCGCAGCGGCAA
GACCGAGGGTGATCAATGCAACGAGGAATTTGGCGAAGATCTGGAAGCCGTTGATCATTT
TTTCCGGGATGAATTTCAGCCCCAGCGCCACCAGAATCGCAACAATGATCACCGGGATCA
TGTTCATCAGGATCAGGGCGAAAGTGAATTCCACCGGCTGGCCGTTGATCTGCACACCGG
AGTACATAGCAACCAGACCACCAGCGATACAACCAATCGGAATGGTCACAATGCCCGCCA
GCACGCCGAGCGCCAGATAACGACGGTCAGAAGGTTCGATAATGCCGAGCGCCACCGGAA
TGGAAAACACAATCGTTGGCCCCATCATCGACCCGAGAATTAACCCAGAGTATAGCCACG
CGGCTACGTCGCCGCCCGCCAGCTCTTTGGCGAGGAAGAAGCCGCCCATATCGCACGCCA
GCAGTGTTCCGGCGAACATCGATGGGTTAGCGCCGAGCATTTCGTAAACCGGAATAATTA
CCGGCCCGAGAACGTGAGCCAGTACCGGTGCCAGCGCGGTCATACCGACCATCGCCAGGC
CCAGTGCGCCCATTGCCATAAAGCCTTCTTCGAACTGACCGCCTGATCCTTCGATACTTT
TACCGAACTTACCGAGGAAACGAGCAGAACCGCCGAACTGCGACAGGATCCTGTCTACGG
CAGCTATCAGCATAAAGAACATCATGATGTACATGATGATTTCGTTAATTCCCATCGCCT
TTACTCCCTGTTAGTTGTTATTTATTGGCGGATGCGGCGTAAACGCCTTATCCGCCCTAC
ATGTGCAATCCCGTAGGCTGGATAAGACGCGGCAAGCGTCGCATCCGGCAATTGCACCGC
GCCACTGGCGGATGCGGCGTGAACGCCTTATCCGCCCTACATGTGCAATCCCGTAGGCTG
GATAAGATGCGGCAAGCGTCGCATCCGGCATTTATTGCGCCGCTGCGTACAGGCCGACAA
TCTGCTCCAGGCTGGCGGTACGCGGGTTACTGCGCAGACAAATATCTTCCAGCGCGGCCT
GCGCCCATGCGCCGTAATGCGCAGATGTCGCACCAACATCGCCCAGTCGTTTACCAATCC
CAACTTCCGCAATCAGCTCACTTACCGCGTTAATAGCGTCACGATCGTCGGATTTTTTAG
TTCGCAGTGCCCGACCAATCTGACTAAAGCGTTCACGACAAACCATCCGGTTAAATTCCA
TCACCGTTGGCAGCAACATGGCGTTCGCGAGACCGTGCGGAATATGCAGCGCCGCGCCCG
GCTGATGCGCCATCGCGTGGCACAACCCAAGACCCGCACTGGAAAACGCCATTCCCGCCA
TACATGAAGCCAGCAACATGCTCTCGCGCGCGGCAAGGTCGTGACCGTAGCCCACCGCTT
TCGGCAGCGATTTGCCAATCATCGCAATGGCACCAATCGCCAGACTGTCGGTAAACGGTG
TAGCGTTCAGGGCGCTGTATGCTTCAATGGCATGGGTTAACGCATCAATGCCGGTCATCG
CCGTGACATGCGACGGCACACCTTCGGTCAATGCGGCGTCGAGGATCGCCACATCCGGCA
TCAGCGAGGCATGGGCTAACACCTGCTTGCGCCCGCTCACCGCGTCGATAATCACCGTTA
CATTGGTGGTTTCAGAGCCGGTTCCGGCGGTAGTTGGAATGGCAATCAGCGGCAAGCGCG
GTTGCAGAACGCTGGTTTCTGACATCTCTGCCAGCGTGCTATCCGGGTTCGTCACCAGCA
ACGTCACGGCTTTCGCCGCATCCAGCACCGAGCCGCCGCCAAACGCGATCACCCCATCAC
AGCCTGACTCACGCAACTGCGCCACGGCTGCACACACGTCGGTAATGCACGGTTCGCCCA
CCGGACATGGCCAGAGCGTCATGGCGATACCTTTAACGGTCAGGCTACGCGTCAGCCCGG
CGGTCATCCCTGCCTGATGCAAAAAGCTGTCTGCCATCACGAACAGATGTTTCAGCCCAC
GCGTTTGCGCTTGCTGTCCGCAACTGCTCACCGAGCCCGGACCGCAAAGCGTCACCGGTG
GAACGCTAAATGTTTTTACCCGTTGCAGATTCAGGGTATCGAACGCCTGAAAGAGCGCGG
TCTGCAATTCATTTTGCATATAGCCCCTCCGCTTTCTCTCGCCCACTACTGGCGATCGCC
AGCGGGGTCATAAACAAACTGTGCTGCGGTAAATGCACCTGTAACGCCGGGAATTGTTTG
CGAAACAGTTCCGCCACGCCCGGTTGCATACAAGAGCCGCCCGCCAGCCATAAATCAGTA
ATGCCCTGCCCTTCAATATGCCGGGCGACAATGTCCGCCATTTTTTCGTACACCGGTTTC
ACCGCAGGCCAAATCTCTTCACCGTGACCGCGCTTGTACTGCTCCGCCTCTTCCAGCGAA
ATACGGCGATTTCCGGCGAGAGTCAGAGAGATGTGATGTCCGCCGGTGGCTTCATCCGCC
GAGTACGTCACCTTGCCCTTTTTCACGATGGCAATGCCGGTAGTGCCGCCGCCGATATCC
ACTACACCGGCGTTGTCCAGTTGCAGCAGATCCGCAACTGCGGTTGGCTCATCCAGCACA
TGGCTCACTTCCAGTCCGGCAGATTCCAGCACGTTGATGGAAATACGCGGGTCCGTACCT
GGAGGAAATGAAGTCGCCGCATGGCTAAAACGACGACCGAATTGCTGCTCGAGCGTGTCG
AGATGGCGACGAACAATGGTGACAGCGCCGAAGAAATCCCAGACGATGCCGTCGCGAACC
ACATCGGCCCAGTCGAGGCATACCGCCACTGGCTGACCGTCGCGGTCGACAACCATCGAC
ACCACATCGCAGGTGCCCAGATCCACCCCCAGCCACAGCGGAGATTCCGTCGCGGCGGGC
GTCTGGTTACACAGCGTTGCCGCCGTTTGCAGACGTGGGGTGAGCCATTGTTCGTCGTGC
GCCATCTGTTACTCCTTAAACAATGCGAAACGCATCGACTAATACACAGCGACGCAGACG
GACAAACGTACGCGCGCTGGTTACCCCTTCACCGGTTGGCGTGGTGATGGTCATGGTGGT
CCAGCCTTCCCCGCCCAGCCCCAGCCCGGCAATGCACGGTCCGTTCTTAACGAAAATGCT
GGTATCAATAGCATTCGCCATCTGGTTCATGTTTTCGATGTTGCGCGAGTGCATTGCCGC
CGTGTGGTGGCAACCGCCTTCCAGTTTCACCGCTAGCGCAATGGCATCCGCCACGTTGGC
GACGCGCACGACGGGCAACACCGGCATCATCAGTTCAGTCACGGCAAACGGATGTTCTGC
GGTGGTTTCCACAAACAGCAGGCGCGTTTCTTGCGGAACTTTAAGGCCGATTGCCGCCGC
GATTTTGCCTGCGTCGCGACCAACCCAGTCACGGCTGACGGTGCCTTTTCCGCGCTCGTC
GATATTTTTCAGCAACACCGGTTGCAGCTGCTGCGCCTGTTCTGCGGTCAGTTTCACCGC
GTGCTGGCCTTCCATCAGACGCATCAGTTCATCGGCTACGCTATCAACAACAATCAGTAC
CTTTTCGTCGGCACAAATGATGTTGTTATCGAAAGAAGCGCCTTTGACGATGGACTGAGC
GGCACGGGCGAGGTCGGCGGTTTCATCCACCACTACCGGCGGGTTGCCAGCGCCTGCGGC
AATCAGACGTTTATTGGTGTGTTTACGCGCCGCTTCTACTACCGCTTCGCCGCCGGTTAC
CACCAGCAGGCCGATACCCGGAAACTTGAACAAGCGTTGCGCGGTTTCGATATCCGGATT
TGCCACAGTAACCAGTAAGTTTTCCGGCCCACCTGCGGCAACAATCGCCTGGTTGAGCAG
CGTAATCGCCCGCTGGGAGACTTTTTTCGCCGCCGGATGCGGGGCAAAAATGACGCTGTT
GCCCGCGGCAATCAGGCTGATGGCGTTGTTAATTACGGTTGCCGCCGGGTTAGTGGAAGG
CGTCACCGAAGCCACCACGCCCCAGGGTGCGTTTTCAATTAGGGTCAGGCCGTTGTCGCC
AGTCAGCACTTGCGGAGAGAGGCACTCAACGCCTGGTGTGCCGCGCGCCTGAGCGACGTT
TTTTGCAAATTTATCTTCAACGCGCCCCATGCCGGTTTCACTGACGGCAAGTTCCGCTAA
ATCTCTGGCGTGTTTTTCGCCTGCTTCACGAATGGCAGCAATGGCTAACTGGCGCATTGC
CACGCTTTTTAACCCTTGCTGGGCGACTTTGGCTGCCGCAACGGCGTCATCCAGGGACGC
GAAAACGCCCATCTCATGAACGGCGGCGGACGGCGTGTCACTGCTTTGCATTTTCAGCAG
TACCGCTTTCACCACCTGTTCAATATCCTGTTGATTCATGATGTTCTGCCTTATTTGTGG
AAAATTACCTGACCGCCAGACACCACCTCATCGACAATGCCAATCACGCACAGATCGACC
GGTGACGTTTCGCTTTTATGCGCCTGGCGGGCGGAACTGCCACTCACCAGTAACACCCAC
TCCCCGGTTCCCGCGCCAATATTGTCGATGGCGACGGCGCATTGCCCGTCAGGATTACCT
TGTGGATCAATCATTTCCACCATCAGCAATTTGTCATGCGCCAGTCCGTGATGGCGTACG
GTACAAACAATTTGTCCAGTGACGACTGCCAGTTTCATACCCGCCTCCGTGGCGTATTTC
AGGTAAAAGCTCCCCCTACCCTCCGCAGAAGGTAAAATGAAAAAGGAGAGAGCGTGACGC
CCGAATCGACGTCACACAGGGTGATTACAGGTTGCTGCTATCGCCTTTCAGGCCGATCGG
GAAGACTTCTTCCAGGTCGCCGTGCGGACGCGGGATAACGTGTACAGATACCAGCTCGCC
GATACGCTGTGCCGCTGCGGCACCTGCATCGGTCGCGGCTTTACAGGCTGCAACATCACC
ACGAACCATGGCAGTACACAGGCCGCCGCCAATCTGCTTAACACCAACCAGCTTGACGCG
CGCAGCTTTCACCATCGCGTCAGAAGCCTCAATCAGTGCAACCAGGCCCCGGGTTTCGAT
CATTCCTAATGCTTCCATTGTGCTTTCCTCTTTATCAGGGTCCAGAACGGGACCGTTCAT
TCAACCAGTGTTTGTAAACTGCTTTCGCGGTTCACTTCTGTCTGACGCGGCACAGCTGCC
ACCAGCGCCAGCTCGATAATTTCCTGCACGCTACAACCACGAGAGAGATCGTGCATCGGC
GCGGCAAGTCCTTGTATCAGTGGCCCGACGGCACGATATCCGCCGAGTCGTTGTGCGATT
TTGTAACCAATATTTCCGGCTTCCAGCGACGGAAAAACCATCACATTGGCCTTGCCCTGT
AGCGGGCTGGCAGGCGCTTTTTGCGCCGCCACTTCCGGCACGAAGGCGGCGTCAAACTGT
AACTCGCCATCCACCACCAGCTTTGGTGCGCGCTCACGGACGATTTCTGTCGCCTGCTGG
ACGTTAGCAACACAGGGGTGACGGGCGCTACCATTGCTGGAAAACGACAGCATCGCCACG
CGCGGCTCTTCTCCGGTGATGGCGCGCCAGGTTTCGGCACTGGCAAGCGCGATATCCGCC
AGCTGCGCCGCCGTCGGCTGTGGCACCACGCTGCAATCGGCAAAGCCCAACGCCGGGCCG
CTGTACTGTGGCAACATCAGGAAAATGGAAGAGAGCGTTTTACAGCCTGGCTGCAAGCCG
ATAATGCGTAATCCGGCACGCAGCACATTTGCCGTGGAAGAGAGGTTGCCCGCGATACAG
ACATCCGCTTTACCGGCGCTGACCATTGCTGCGGCGAACATCAGAGGGTCGGTAAGTTTT
TCCAGCGCATCCGGCGGCGTTTTTTCGCCCGCGCGGGCCAGCCAGCGATGAGCAAATTCT
TCCCGCATTGCGAGGTTGCCATGCGGATCAATCACCTGTAGCCCGTCCATCGCCACGCCG
TGACTGAGCGCAAACTGACGAAGTTCAAACGGATTGGCGACCAGAATGGGCGTTGCCAGA
CCTTGTTGATGTAAATATTGCGCGGCTTTCAGCACACGTTGGTCTAACGCATCCGGAAAA
ACCACTCTGGCGGGCGCTCGCAACGCCAGTTCACGACAACGTTCAATAATCATTGCGTTT
CCCCCAGTCGTTGTTGGATCTGCTTCACCGTTAGCGGCTGCTTCGTTACGCTCAGGATCA
TCATCACGTAGACCGTGCTCGAAAGGCGGTTCAGCGCCTGCAAAATGTCCGGGCGTAATA
CTTCAAAGCTGCGGGTGATAAAGACCTGCGCCGCTACGGTTTCGGTTTCCCGCACTTTGG
TGCGTAGCAGATTGAGCAACGCAGCATCGCGCCCGTGGCTGGCTTCCGGCACCAGATGAT
CGTGGTCGAGATAGCGCAGCGGCTGATGAGAAAGCCGATGCAGATCTTCGTCAGAAAGCC
CGACAATCGCCTGGCAGCCCAGCGGTTCCCCCAGCGCATCGGCGCGCATAATGTTGCCAA
GACGCGAACGGATATCCGCCAGCCACGGCTGCCACGGTTCCGCCAGTTCAATTTGCAGCC
ACACTGCCAGCGCAATGGTGCTGTCGAGAACCGCGCGAAAACCCAGACGCGGATCGCTTT
TGGCGACCATTTTTTCCGCCGACAGGTGAGTCAGCGTATCCGGCTTTTTTGCCACCGGCT
GGCGACACAGTTCGCAGCACGCCTGCGGATGTTCATCGCTACTGGTCAGCCCATGAACGG
GCTGCGGCTGCTGCTGTTCATCGTCAACAAACAGGCGGCCCTGCTCGTCAATAAACTTGA
TGCGCAGATGGCGGCTTTCCAGCAACTCCCGGGCAGAGGGCGTCAGGCGACTGTCCGCAG
GGAGATGGATCTCTGCGCCTTCGCTGAGCGTATGGTTCGCTCTTAGCCATGCTTCGGTGA
TGAAATCTTTCATAGGGATTGCCAGTTAGCCGGCCAGGCGACATACAGGAATTTCACGCT
GGATGTCGTACCAAATTCGATGCTGGAGCCTTTCGGGATAAACATCACGTCGCCTGCTTT
GGCGATCATGGTTTGGCCTTCGTGGCGAACATGCAGCTCCCCTTCCAGCACCATGTCGAT
TTCGTCGTAGTTCAGGGTCCACGGGAAGAATGCGTTCTCCCACTGCATAAAACCGGCGGC
CATGCTGCTGCCGTCGTCTCCGGTCACAAGATCAGTCAAGCCCACGCAATGCGGCTCTGC
GCCGTCGAAACGACCAAACTTGACGCTACTGCCATCAATCACTTTGATGCCGCCTTTGCC
GGTCACCGATTTGAAGCTCGGCTGCATTGCGCCCTGCTCCAGCGACTGTTTTTCCTTCAT
CACTTTTTCCATCAGCTGTGCGACCAGGCTTTCGGTAAACTGGCCTTCCGGCAGCTGGGC
AATGATGGTTTCGCGGATGCGCTGGCTTTCGGTTTTGTCGGCTGGCACGCTGGCGGGCAC
GGACGCCGTTACCGGGATCGATTCATCACATTCGGTGATGGTAAAACCCAGTAGATCCGC
CACTTCACGGGCTTCCGGGGTAATAATGCTGGCGCGCAGAACCACGGACATTGCCTGTTC
GCCGCGCGCGTGTGCTTCACGAATATCATTCGCTGTGATGAGTTTTTTCACCTGCTTCCT
CCTGTTTGGTGAGAGATGCCAGATAATCCACCAGTTGCTGCACGCTTTGCGGGTCGTGGC
TGTTTAGCTCGAACATCGGCTCTTCGAAACCCGTCTCAAGCAATAACTTTCGCGTTGCGG
CGACGTCAGCATCTGGCATGTCCGTTTTACTGATGACGGCGATTTGCCGTTTGCTGACGC
CAATATCCAGCAACCCGGCAGGCAACCGACTTTCCGGGTCATTTGCGCCATGGACATAGA
TCAGCATGTCTACATCCTGTAGCGTGGTAATTAAGGCGTGATACCAGCGGGGATGGTTAA
AATATTCACCCGGCGTATCAATATCGCCCTTATCATTAAATTCCACGGCCTGTGTTTTTC
TGGCGAGGGTATAATTCCCCTGCAACGCATTAAATAACGTTGTTTTTCCTGCCCCGACGC
TACCCACAAACGCAATTCGTTTCATGAATGCCTCGTATTAACTTTTGGTCATTTCACAAA
GCGTATAATTTAATAAGCGACCTAAACCGCTGACGGTTTGTGATAACGCTTCTTCTACTG
CGCCCACCGAGCCATAAATCACCAATGCACCGCTGAATCGGTCGAGAAAACCGATATGCA
CATCAGCGGCTTTCAGCGCTAAATCACCGGCGATCATCGCCGTTTCGCCGGGAGTTAGCG
TCATAATGCCAATTGCGCCCGCATCCGGAACGCCGATTTTCTTCGCCAGTTCCTCACCGG
GATGCGCGATGAGATGCGCCAGTGTGACCTGTTTGCCGGGCACAAATTCCTGAATGATGC
GTTCTTTATCCATGAGTCGCCGCCTGTGAAAAACTTTCGTGTATCGTGACAATTTTTCGT
CAGAGTAAATAACAAAATTCGGCAAGCGCGTTTAAAAGGTGAGGTAGATCACTAAGAATG
GAGAGATATTCGCTGTGGTGCATAAACTTTCATATGCAACGCATGAATATAAATAAAATA
ATATCGAGATATTATATAGACTGCTTTTTTTTATTATTCGCAAACTCAGTAATAAGCTTT
ACTAATATATTGCAGCTAAACTGCTTACCCTGAATATTCAGGGTAAGCGTGAGAGTTAAA
AAAAATTACAGCGGTTGGGTTTGCGCTTCTACCACGGCCAGCGCCACCATGTTGACGATA
CGACGCACCGATGCGATCGGCGTTAACACGTGAACCGGTTTCGCCACACCCATCAGCACC
GGGCCGACAGTCACACCTTCCGAGCTGGAAACACGCAGTAAGTTGTAACTAATGCGGGCA
GCTTCCATGTTCGGCATCACCAGAATATTGGCGGAACCTTTCAAAGAGCTGTCCGGCATA
CGGTCGTTGCGAATCGCTTCCACCAGCGCTGCATCGCCGTGCATTTCACCATCAATCATC
AGTTCTGGTGCACGTTCCCTGACCAGTTCCAGCGCCTGACGCATTTTGCTCGACGACGGG
CAGTCAGAAGAACCAAAGTTGGAGTGCGACAACAAAGCAACGCGCGGCTCAATACCAAAA
CGACGGACAGTTTCTGCCGCCATCAAGGTGATCTCCGCCAGCTCTTCTGCATCCGGTTCA
TCATTAACATATGTATCGGCAATAAAGGTGTTACCACTCGGCAGCAGCAGCGCGTTCATG
GCACCTGCGGTGTGAACGCCATCGCGATAACCAAAGACATTTTTCACCACGCTAAAATGT
TCATGATAATCACCCACCGTACCGCAAATCATTGCATCGGCTTCCCCACGCTGAACCATG
ATCGCGCCGATCACTGTCGGGTTACTGATCAGCGCCCGCTGCGCCTGTTCCTGAGTGACG
CCGCGACGCTTCATGATCTGGAAGTATTCGGTCCAGTACTCTTTAAAGCGCGGATCGGAT
TCGTTATTGACGATCTCAAAATCAACGCCCGCTTTGATCTGCAAGCCCAGTTTCTGAATG
CGCATTTCGATCACGTTCGGACGACCGATAAGGATCGGTTTCGCCAGTCCCAGCGTTACC
AGTTCCTGAGTGGCATGCAGAACGCGCGCCTCTTCCCCTTCCGGCAGAACAACGCGCTTC
GGCGCTTTGCGAGCCTGGGAGAAAATCGGCTTCATAAACAGGTTGGTTTTGTAAACGAAC
TCAGTCAGCTTGTCGATGTAGACGTCGAAATCAGCAATCGGACGAGTCGCCACGCCCGAC
TCCATCGCGGCTTTAGCGACCGCAGGAGCGATCTTAACGATCAAGCGCGGATCAAACGGT
TTTGGAATGATGTATTCCGGACCAAAGCTCAGATCCTGATCGCCATACGCTGAAGCCACC
ACTTCGCTCTGTTCCGCATGGGCGAGTTCTGCAATCGCACGTACCGCCGCCAGTTTCATC
TCTTCGTTGATGGCGGTTGCGCCAACGTCCAGCGCGCCACGGAAGATGAACGGGAAGCAC
AGGACGTTGTTCACCTGGTTCGGATAGTCAGAACGACCGGTGCAAATGATGGCATCCGGA
CGCACTTCTTTCGCCAGCGGCGGCAGAATTTCCGGTTCCGGGTTCGCCAGCGCCAGGATC
ATTGGCGCACGAGCCATTTTCTTCACCATTTCCTGGGTCAGCACTTTCGGGCCGGAACAG
CCCAGGAAAATATCCGCGCCTTCAATCACATCATCGAGGGTACGTTTGCCGTCATCCACC
ACCGCATATGCGGCTTTGGTTTCCGCCATGTTTGGCTCACGGCCCTGATAGATAACGCCT
TTTGAATCGCAAACCACGATGTTATGTTTTTGCAGACCCAGCGCTACCAGCAGGTTCATA
CAGGCGATTGCTGCGGCACCCGCGCCGGAAACCACCATCCGCACGTCGGAGATGTTTTTC
TCCACCACGCGCAAGCCGTTGAGGATGGCGGCAGTGCTGATAATTGCCGTGCCGTGCTGA
TCGTCGTGGAATACCGGAATATTCATCCGCTCGCGCAGTTTCTGTTCAATATAGAAACAT
TCTGGCGCTTTAATGTCTTCGAGGTTGATGCCGCCGAAGGTTGGTTCGAGCGCGGCGACA
ACTTCAATAAATTTGTCCGGGTCGAGTTCGTCAACTTCAATGTCAAATACATCAATCCCG
GCGAATTTCTTAAACAGAACGCCCTTGCCTTCCATCACCGGTTTGCCTGCCAGCGCGCCA
ATGTTGCCTAACCCCAGCACCGCCGTACCGTTAGAGATCACCGCCACCAGGTTACCTCGG
GCGGTATATTTGTAGGCTTTTAACGGGTCTTTTTCGATTTCAAGACAAGGTGCGGCAACG
CCTGGTGAGTAGGCCAGCGCCAGATCGCGCTGTGTTGCCAGAGGCTTGGTTGGAGAAACC
TGGATTTTCCCTGGAACTGGAAATTCATGGAAATCAAGTGCACTTTGTTTTAACTGGTCA
TCCATTTGGTTGTTCCTTTCACGTAACGTTCACAAATAAAGTGTGTGGGCAACAGCCCCT
GCCCACAACGTGGCGCACATTATTACCCTGCCGGAGTCTACAGACTTTGAGCAAGTCCAA
ACTCTCACCATTAATATAATGTTTTGGTAATAATCCTATAACACTGATGTTACCTGCTTA
ATCCAGCAATACCATGCCTGTCTGCTATGCTTTTTTGATGCGTTTAGCGAAATTTCTCAG
AAGTGTGAATTAACGCACTCATCTAACACTTTACTTTTCAAGGAGTATTTCCTATGAACG
AGTTAGACGGCATCAAACAGTTCACCACTGTCGTGGCAGACAGCGGCGATATTGAGTCCA
TTCGCCATTATCATCCCCAGGATGCCACCACCAATCCTTCGCTGTTACTCAAAGCTGCCG
GATTATCACAATATGAGCATTTAATAGACGATGCTATCGCCTGGGGTAAAAAAAATGGCA
AGACCCAGGAACAACAGGTGGTCGCAGCGTGTGACAAACTGGCGGTCAATTTCGGTGCTG
AAATCCTCAAAATCGTACCCGGTCGCGTGTCAACAGAAGTTGATGCACGCCTCTCTTTTG
ATAAAGAAAAGAGTATTGAGAAGGCGCGCCATCTGGTGGACTTGTATCAGCAACAAGGCG
TTGAGAAATCACGCATTCTGATCAAGCTGGCTTCGACCTGGGAAGGAATTCGCGCGGCAG
AAGAGCTGGAAAAAGAAGGTATTAACTGCAACCTGACGCTGCTGTTTTCTTTTGCACAGG
CACGGGCCTGTGCGGAAGCAGGCGTTTTTCTGATTTCGCCGTTTGTCGGGCGTATTTATG
ACTGGTATCAGGCACGCAAGCCGATGGACCCGTATGTGGTGGAAGAAGATCCGGGCGTTA
AATCGGTGCGCAATATCTACGACTACTATAAGCAACACCACTATGAAACCATTGTGATGG
GCGCGAGCTTCCGTCGCACCGAACAAATCCTCGCCTTAACCGGCTGCGATCGACTGACTA
TCGCACCGAATTTACTGAAGGAGCTGCAGGAAAAAGTTTCGCCAGTGGTACGTAAATTAA
TCCCACCTTCTCAGACGTTCCCACGCCCAGCTCCCATGAGCGAAGCGGAGTTCCGTTGGG
AGCACAATCAGGATGCGATGGCGGTAGAAAAACTGTCTGAAGGCATTCGTCTGTTCGCCG
TTGATCAACGCAAACTGGAAGATCTTCTTGCCGCCAAACTATAAACCAGCCACGGAGTGT
TATATGTCCCGAAAAGACCTTGCCAATGCGATTCGCGCACTCAGTATGGATGCGGTACAA
AAAGCCAACTCTGGTCATCCCGGCGCGCCGATGGGCATGGCTGATATTGCCGAAGTGCTG
TGGAACGATTTTCTTAAACATAACCCTACCGACCCAACCTGGTATGATCGCGACCGCTTT
ATTCTTTCCAACGGTCACGCGTCGATGCTGCTCTACAGTTTGCTACATCTGACCGGTTAC
GACCTGCCGCTGGAAGAACTGAAGAACTTCCGTCAGTTGCATTCGAAAACCCCAGGCCAC
CCGGAGATTGGCTATACGCCAGGCGTTGAAACCACCACCGGCCCGCTTGGACAAGGTTTG
GCGAACGCCGTCGGGCTGGCGATAGCAGAGCGTACACTGGCGGCGCAGTTTAACCAGCCA
GACCATGAGATCGTCGATCACTTCACCTATGTGTTTATGGGCGACGGCTGCCTGATGGAA
GGTATTTCCCACGAAGTCTGTTCGCTGGCAGGCACGCTGGGACTGGGCAAGCTGATTGGT
TTTTACGATCACAACGGTATTTCCATCGACGGTGAAACAGAAGGCTGGTTTACCGACGAT
ACGGCAAAACGTTTTGAAGCCTATCACTGGCATGTGATCCATGAAATCGACGGTCACGAT
CCGCAGGCGGTGAAGGAAGCGATCCTTGAAGCGCAAAGCGTGAAAGATAAGCCGTCGCTG
ATTATCTGCCGTACGGTGATTGGCTTTGGTTCGCCGAATAAAGCAGGTAAGGAAGAGGCG
CACGGCGCACCACTGGGGGAAGAAGAAGTGGCGCTGGCACGGCAAAAACTGGGCTGGCAC
CATCCGCCATTTGAGATCCCTAAAGAGATTTATCACGCCTGGGATGCCCGTGAAAAAGGC
GAAAAAGCGCAGCAGAGCTGGAATGAGAAGTTTGCCGCCTATAAAAAGGCTCATCCGCAA
CTGGCAGAAGAGTTTACCCGACGGATGAGCGGTGGTTTACCGAAGGACTGGGAGAAAACG
ACTCAGAAATATATCAATGAGTTACAGGCAAATCCGGCGAAAATCGCTACCCGTAAGGCT
TCGCAAAATACGCTTAACGCTTACGGGCCGATGCTGCCTGAGTTGCTCGGCGGTTCGGCG
GATCTGGCTCCCAGCAACCTGACCATCTGGAAAGGTTCTGTTTCGCTGAAGGAAGATCCA
GCGGGCAACTACATTCACTACGGGGTGCGTGAATTTGGCATGACCGCTATCGCCAACGGC
ATCGCGCACCACGGCGGCTTTGTGCCGTATACCGCGACGTTCCTGATGTTTGTTGAATAC
GCCCGTAACGCCGCGCGGATGGCGGCACTGATGAAAGCGCGGCAGATTATGGTTTATACC
CACGACTCAATTGGCCTGGGCGAAGATGGTCCGACGCACCAGGCTGTTGAGCAACTGGCC
AGCCTGCGCTTAACGCCAAATTTCAGCACCTGGCGACCGTGCGATCAGGTGGAAGCGGCG
GTGGGCTGGAAGCTGGCGGTTGAGCGCCACAACGGACCGACGGCACTGATCCTCTCAAGG
CAGAATCTGGCCCAGGTGGAACGTACGCCGGATCAGGTTAAAGAGATTGCTCGTGGCGGT
TATGTGCTGAAAGACAGCGGCGGTAAGCCAGATATTATTCTGATTGCCACCGGTTCAGAG
ATGGAAATTACCCTGCAAGCGGCAGAGAAATTAGCAGGAGAAGGTCGCAATGTACGCGTA
GTTTCCCTGCCCTCGACCGATATTTTCGACGCCCAGGATGAGGAATATCGGGAGTCGGTG
TTGCCTTCTAACGTTGCGGCTCGCGTGGCGGTGGAAGCAGGTATTGCCGATTACTGGTAC
AAGTATGTTGGTCTGAAAGGGGCAATTGTCGGGATGACGGGTTACGGGGAATCTGCTCCG
GCGGATAAGCTGTTCCCGTTCTTTGGCTTTACCGCCGAGAATATTGTGGCAAAAGCGCAT
AAGGTGCTGGGAGTGAAAGGTGCCTGATGGTGATTGCCGGATGCTGATTGCCGGATGCGA
CGCTGACGCGTCTTATCCGGCCTACAGCGTCTTATCCGGCCTACATGTCCCGCCATTTTG
TTTAACGGGTGATCCACAACGTGGGCCAGGCGTCTGGCCCATGCCAGTTATCGCAGGTGG
GTTCTGCGGCGTAACGCACCAGGCGAAAACGCTGACCGTCAAAGCGCCAGCGCGCCTGAA
TGCCACAATCGCTTAATCCGCGCCCTTTCGCTAAGGTCACCAGTTCACGCGATTTCTCAT
CAAATGTTGCGTTCATCAGTTCCAGTTCATTCGTCTCCTGACCGTTGTTGAACGGCAAAC
GCAACCGAACCGGGCGCGAAGCTAGTGGCTTTTTACGCGACACAATCCATGCCAAATCAA
TGGTGTTATAGGCCCCTGCCTCACAGCTAATCATCATCAGCGCTTTATCATCAGTCAGCG
CAGTGACATTCACCTCACGACGCAATGGATCAAGCGAGCAGCGCAGACCATTCATCCGCC
AGTTTCCATAATCCAGCAAATCGTTGCGTTCTTCGAGTGAGAGTGGCGTCGGCGTTGGGT
TAACCACCGCGACCTCTTTCAGCGCAGGCGCGGGCGGTACGCTGAGCGGCGGTTCGTCCC
CTTTCTTGATCCACGCGGTTTCACTGCCAACGCGCTTTTGCTGAGCATCAATAAACAACA
ACGCTGCTTTTAAGCCACTCAGAGAAATGGTCTGATCGCCATCGCGTAAGGTGATTGCCT
TCCCTTCCTGAATCATCTGCAAAAACGCGGTGATGGTTGCCGTATCATCGGTTACTAATA
ACCATGGTGAAATCCGCCACTTGTCACCACTTAACGCCAACGGCTCGCCATCTAACAGCA
GCCGTGGCGCTATCTCCCCTTCTGACGCCTCCGGCGACTTCAATCCGCCGCGCTCAATAC
GTAAAACGGCATCGGTATGCGCCCCGGCGCTGCGGCTCAGGGTCATCACCAGTCCATTAT
GATCGCCCGTATTACGCGCCACGCAGAAATTTTGGTTATTACAGGTGACCTGCCAGTCGG
AAAACGCCCGTTGCGCTGGTGCCGCCCACACCAAAGACGTCGGCAACAAAGCGAAAAAAA
AGAGAAGGAAAATGCGATAGCGCATGGACGGTACGACCCCAGAAGTTCAAACAAACAGCA
CAAGTCGTATCTTCGTTGCGCAGGTAGCGCGGCTCAATCGGATTTGTCGGATTGAGCCAA
TAATAAACAACGAAATATTATTGTTATTTTTCAGTCCATTAAATGTGACGTTTGCAAATA
GTTAAGCAATAACACCGTCTTACCGTCACGTATCTCGCCGGTTTTGATCATCTCCAGCGC
CTGGCTGAACGGCAGCTCGAGCACTTCAATATCTTCATCTTCGACACCGCCACCGGCGTT
AGCGCGCTGATTGTCACTGTATTCGGCGATAAAAAAGTGGATTAGCTCAGTCACACCGCC
TGGCGACATATACAGTTCAAATAATTTGCGCACTTCACCCACTTCATAGCCCGTCTCTTC
AATCGCTTCTTTGCGAATACACACTTCCGGTTCGTCGTTATCCAGCAGCCCGGCGCAGCT
TTCAATCAGCTGCCCGCTTTCATTGCCATTAACCCAGGTAGCGACACGGAACTGACGAAT
CAGAACCACGGTCTTTTTCTTCGTGTTGTACAGGAGGATCGTCGCACCATTGCCGCGATC
GTACACTTCACGTTTATGGCGGATAACTTCGCCGTCTTTGCGCGTGAGATCGTAAGTAAT
GTTGTGCAGGGTGAAATAGTTATCGGAGAGAATTTTGTCTTTAATGAGGGTGATTTGTTG
CGTCATACCGACTCCACAGCGCGAAATGAACAATTATCTTACGCTGTGAAGTCGGGTTTG
TCTGCGCAGGCTATCAGTGAGATTTGACTGATTTTACCCCCAGCCAGTCAATAATCCCCT
GTGCCGCATGACGTCCTTCTGCCATTGCGGTAACCACCAGATCCGCACCACGCACGGCGT
CACCACCAGCGAAGATTTTCGGATTGGTGGTCTGGTAACGGTACTGGCTTTCCACATCCG
CGATGATGCGGCCCCATTTGTCTACCGTTACACCGTGCGACTCCAGCCACGGCATCCCGT
GCGGATTGAAGCCAAACGCCATAATCACCGCGTCGGCTGGCATGACAAATTCACTGCCTT
CCACCGGCACTGGACGCCGACGCCCCTGGGCATCCGGCTCTCCAAGACGCGTGCGCAGGA
AACGAATCCCGCAGACGTGACCTTGTTCATTCAGCTCAAGCGCCACCGGCTGGACGTTAA
ATTCGAAGTTGGCCCCCTCTTCGCGGGCGTTCTTCACTTCTTTCTTCGAGCCTGGCATGT
TAGCTTCATCACGACGATAAGCGCAGGTGACGTTACTCGCGCCGTGGCGCAGTGCGGTAC
GCACACAGTCCATCGCGGTGTCGCCGCCGCCCAGTACCACGACGTTAAGTCCGGCGGTAT
TGATAAACGGCTCTTCCGGTAGCTCTTCGAGCCCCATCACCTGTTTAGTGTTGGCAATGA
GGAACGGCAGCGCGTCATAAACGCCCGGCGCATCTTCATTGGGTAAACCCGCTTTCATGG
AACGGTAAGTGCCTACGCCAACGAAGACCGCGTCGTATTGTTCCAAAAGCGAATCCAAAG
AGACATCTTTACCCACTTCACAATTGAGTTCGAAGTGAATCCCCATCGCGCTGAAGATTT
CCCGACGGCGTGCCAGCAGGGATTTATCCAGTTTGAAAGAAGGAATGCCGAAAGTGAGCA
AGCCACCGATTTCTGGATGGCGATCGTACACCGTCACCCCCACGCCATTGCGGGTCAGAA
CATCCGCACAGGCCAGCCCTGCCGGACCTGCACCGATAATCGCCACCCGCTTGTCCACTT
TGGTGACATGGCTTAAGTCAGGACGCCAACCTTTCGCCAACGCCTGATCTGAAATGTAGC
GTTCAATGTTGCCGATAGTTACCGCGCCGTGCTCATCGCGAATAGTACAGGCACCTTCAC
ACAAACGGTCTTGCGGACAAACGCGTCCGGTAATTTCCGGCAGGGTGTTGGTCTGGTGAG
AAAGCTCGACGGCGGCGTCGATGTTTCCGGCTTTCACCAGTTCAATCCACTGCGGTATAT
GGTTATGCAGCGGGCAGGTCCATTCACAAACGCTGTGCTCGCCGCACTTAAGGCAGCGCG
AGGCTTCCCGTTGTGCCTGGTCGGCGCGAAATGGCAGATAAATTTCATCAAAACCGGTTT
TGCGCGCTTCAATCGCCAGTTTATCCGGCTCGCCACGCGCGGGCGTTGCCTGCATTTGTT
CGACTTTACTCATTACCGGCATTTCTTGCGCCGCGGTACTGGCATGCCACGGTTGATGTT
CCTGACGCGCGGTGCGCAAGCGGCGGGATTTCGCCATGCCGGAGAGTGCGACGTCAGTGA
CCAGTTGCAGCGCGTCCGCCGGGCAATTCTCAACACAGGCAGGACCGTTTTCGCGCCCCG
CACAAAGGTCGCATTTATGCGCCGTGGCTTTTACTTTTCCTGCCGCGACGGGTGTCAGGA
CGATTTGCATCGTACCAAAAGGACAGGCCACCACGCAGGATTTACAGCCAATACACTTTT
GCTGATTGACCTGAATGCTGTCATCAACGTGGCTGATTGCGCCATTAGGGCAGCTACGGG
CGCAGGGCGCATCTTCACAATGGTGACAGGTCACTGCACTACGTTGCTGTTGATGTTTGA
TAACCGTAATTCGGGGATGAAAATGGTGTTGGCTCAGGACATGTTGCTCATCATTGTGAG
CCATGACACAGGCGATTTCACAAGCATGACAACCCAGACATTGCTGACTGTTGGCCATAA
TAAAACGATTCATAACGACCTTCTTTTTTGGTTGTAAAAACCTTATTCTTTATATGAGTG
TTGTTATTACCCGACTTACAGGGGAATCGGCAATGTTCATGTGCCCAGAATAAGTAACTA
TTTCGCTATAAACTGTGGCAGATCAAATAATCCCATCACTGACTAAATTGCGTTTCAGCG
AACTGGAACATTAATGATTTTTTGTGGAGAAGACGCGTGTGATTGTTAAACGACCCGTCT
CGGCCAGTCTGGCCCGGGCCTTTTTTTACATTGTGCTGCTGTCGATTCTTTCCACGGGTA
TCGCTCTGCTAACTCTGGCGAGCAGTTTGCGCGACGCTGAGGCTATCAATATTGCCGGAT
CGCTGCGTATGCAGAGTTACCGCCTGGGCTACGACTTGCAAAGTGGCAGTCCACAACTCA
ATGCACATCGCCAGTTATTTCAGCAGGCACTGCATTCACCGGTATTAACCAACCTCAACG
TCTGGTATGTGCCAGAAGCAGTAAAAACTCGCTATGCGCATCTGAATGCCAACTGGCTGG
AGATGAATAATCGGCTCAGCAAGGGCGATTTGCCGTGGTATCAGGCCAATATTAATAATT
ATGTTAATCAGATAGACCTGTTCGTACTGGCTTTACAGCACTACGCTGAACGCAAAATGC
TGCTGGTGGTGGCGATTTCCCTGGCTGGCGGCATCGGTATTTTCACGCTGGTCTTTTTTA
CTTTGCGCCGCATACGCCATCAGGTGGTTGCCCCGCTGAATCAGCTGGTTACCGCCAGTC
AGCGTATTGAACACGGGCAGTTCGACTCGCCGCCGCTGGATACCAACCTGCCGAATGAGC
TTGGTCTGCTTGCAAAAACCTTTAACCAGATGTCGAGCGAGCTGCATAAATTGTACCGTT
CGCTGGAAGCGTCAGTAGAAGAAAAGACCCGCGATCTCCACGAGGCCAAGCGTCGTCTGG
AGGTGTTGTATCAGTGTTCGCAGGCGCTGAACACTAGCCAGATTGATGTGCATTGTTTCC
GCCATATTTTGCAGATTGTTCGCGACAATGAAGCGGCTGAATATCTGGAGTTAAATGTCG
GTGAAAACTGGCGGATTAGCGAAGGGCAACCAAACCCGGAATTGCCGATGCAGATTTTAC
CGGTGACAATGCAAGAGACGGTTTACGGCGAACTGCACTGGCAAAATAGTCACGTTTCAT
CATCAGAACCGCTGCTTAACAGCGTTTCGTCGATGCTGGGACGCGGTTTGTACTTTAATC
AGGCGCAGAAGCATTTTCAGCAATTATTGTTGATGGAAGAACGTGCGACCATCGCCCGCG
AATTGCACGACTCGCTGGCTCAGGTACTTTCTTACTTACGTATCCAGTTGACGTTACTGA
AGCGTTCGATACCGGAAGATAACGCCACCGCACAAAGTATCATGGCCGATTTTTCCCAGG
CGTTGAATGATGCTTATCGGCAGTTACGCGAGCTGTTGACTACTTTCCGCCTGACGCTGC
AGCAGGCGGATCTCCCCTCCGCATTGAGGGAAATGCTGGATACGTTACAAAATCAAACCA
GCGCCAAACTGACCCTCGACTGCCGTCTGCCAACCCTGGCACTGGATGCGCAAATGCAGG
TGCATTTGTTGCAAATTATTCGCGAAGCGGTGCTGAATGCGATGAAGCACGCCAACGCCA
GCGAAATCGCCGTCAGTTGCGTCACCGCGCCGGACGGCAATCACACGGTTTATATCCGTG
ATAACGGGATTGGTATCGGTGAACCGAAAGAACCCGAAGGTCATTATGGTCTGAATATCA
TGCGCGAACGCGCGGAACGGCTAGGTGGGACGCTGACTTTTTCACAACCTTCCGGCGGCG
GCACGTTAGTGAGTATTAGCTTTCGCTCTGCGGAGGGTGAGGAAAGTCAGTTAATGTAAT
GCCTCCTACTGACCAAAGAATACTTGCACTTAAGGTTCAGTATAAAAGGGCATGATAATT
TACATTAACTCCTTTTTTTCTCCACGATTGGCTCGTACCTTGCCGCTACAGTGAAGCAAG
TCAAGCCTACAACGATACGCAGAAACACGAGGTCCTCTTTTAATGGCGAATTTCTTTATT
GATCGCCCCATTTTTGCCTGGGTGCTGGCAATCCTGTTGTGTCTGACAGGTACCCTGGCG
ATTTTTTCATTGCCCGTTGAACAATACCCCGATCTCGCGCCACCGAATGTGCGAGTGACC
GCTAACTATCCCGGCGCATCGGCCCAGACGCTGGAAAACACCGTGACCCAGGTTATCGAG
CAAAATATGACCGGCCTCGATAATCTCATGTATATGTCATCTCAGAGCAGTGGCACCGGT
CAGGCATCTGTCACTTTAAGTTTTAAAGCAGGCACCGATCCGGACGAAGCCGTGCAGCAA
GTACAAAACCAGCTGCAATCAGCCATGCGAAAGTTACCGCAGGCGGTGCAAAATCAGGGC
GTGACGGTGCGTAAAACCGGCGATACCAACATTCTGACCATTGCCTTCGTCTCTACCGAT
GGTTCGATGGATAAACAGGATATTGCTGATTATGTTGCCAGTAATATTCAGGACCCGTTA
AGCCGCGTGAATGGCGTCGGGGATATCGATGCCTATGGTTCGCAATATTCCATGCGTATC
TGGCTGGACCCGGCGAAACTCAACAGTTTCCAGATGACGGCTAAAGATGTCACTGATGCC
ATTGAGTCACAGAACGCGCAGATTGCGGTTGGGCAACTTGGTGGTACACCTTCCGTCGAT
AAGCAGGCGCTCAACGCCACCATTAACGCCCAGTCACTGCTGCAAACACCAGAACAGTTC
CGCGATATCACCTTGCGGGTCAATCAGGACGGCTCAGAGGTAAGGCTGGGCGATGTCGCC
ACCGTCGAAATGGGGGCGGAGAAATACGATTATCTTAGCCGCTTCAATGGTAAGCCAGCC
TCCGGGCTGGGGGTAAAACTGGCCTCCGGCGCTAACGAAATGGCGACAGCGGAGCTGGTG
CTCAATCGTCTCGACGAGCTGGCGCAGTATTTCCCGCATGGACTGGAATACAAGGTGGCG
TATGAAACCACCTCGTTTGTTAAAGCCTCCATTGAAGACGTGGTGAAAACGCTGCTGGAA
GCTATCGCTCTGGTTTTCCTCGTTATGTATCTGTTCCTGCAAAACTTCCGCGCCACGCTG
ATACCCACTATCGCCGTGCCGGTGGTGTTGATGGGAACCTTCTCCGTACTTTACGCCTTC
GGTTACAGCGTCAACACCTTAACCATGTTCGCGATGGTGCTGGCGATCGGTCTGCTGGTG
GATGACGCCATCGTGGTGGTGGAAAACGTCGAACGTATTATGAGTGAGGAAGGACTCACT
CCTCGCGAAGCCACACGTAAATCGATGGGGCAGATCCAGGGGGCACTGGTCGGGATTGCG
ATGGTTCTTTCGGCGGTATTTGTACCAATGGCCTTCTTCGGCGGCACCACCGGTGCCATC
TATCGCCAGTTCTCTATTACCATTGTTGCGGCGATGGTGCTGTCAGTACTGGTAGCGATG
ATCCTCACTCCGGCTCTGTGTGCCACACTACTTAAGCCACTGAAAAAAGGTGAGCATCAT
GGGCAAAAAGGCTTTTTTGCCTGGTTTAACCAGATGTTTAACCGCAACGCCGAACGCTAC
GAAAAAGGGGTGGCGAAAATTCTCCACCGTAGCCTGCGCTGGATTGTGATTTATGTCCTG
CTGCTTGGCGGCATGGTGTTCCTGTTCCTGCGTTTGCCGACGTCGTTCTTACCGCTGGAA
GACCGTGGCATGTTTACTACCTCGGTACAGTTGCCCAGCGGTTCAACGCAACAACAGACC
CTGAAAGTCGTTGAGCAAATCGAGAAATACTACTTCACCCATGAAAAAGACAACATCATG
TCGGTGTTTGCCACCGTTGGTTCTGGCCCTGGGGGTAACGGGCAAAACGTGGCGCGAATG
TTTATCCGCCTGAAAGACTGGAGCGAACGCGACAGTAAGACCGGCACCTCGTTTGCCATT
ATCGAGCGTGCAACGAAGGCGTTTAACCAAATTAAAGAAGCTCGCGTTATCGCCAGCAGC
CCGCCAGCAATTAGCGGTCTTGGTAGTTCTGCAGGTTTTGATATGGAGTTGCAGGACCAC
GCTGGAGCGGGTCACGATGCGCTGATGGCAGCACGTAATCAGTTGCTGGCGCTGGCGGCG
GAAAACCCGGAGCTAACCCGTGTGCGCCATAACGGCCTCGACGACAGTCCGCAGTTGCAG
ATTGATATCGACCAGCGTAAAGCTCAGGCGCTGGGCGTTGCTATCGACGATATTAACGAC
ACACTGCAAACCGCCTGGGGTTCGAGCTATGTGAATGACTTTATGGATCGCGGTCGCGTG
AAGAAAGTCTATGTGCAGGCAGCTGCGCCGTATCGCATGCTGCCAGATGACATCAATCTC
TGGTATGTCCGAAATAAAGATGGCGGCATGGTGCCCTTCTCTGCTTTCGCGACCTCACGC
TGGGAAACAGGCTCGCCGCGTCTGGAACGCTATAACGGTTATTCTGCGGTTGAGATTGTT
GGGGAAGCCGCACCGGGGGTCAGTACCGGTACGGCGATGGATATTATGGAATCGTTAGTG
AAGCAGCTGCCAAACGGCTTTGGTCTGGAGTGGACGGCGATGTCGTATCAGGAGCGGCTT
TCCGGCGCGCAGGCTCCGGCGCTGTACGCCATTTCCTTGCTGGTGGTATTCCTGTGTCTG
GCTGCGTTGTATGAAAGCTGGTCGGTGCCGTTCTCGGTAATGCTGGTCGTGCCGCTGGGG
GTAATCGGCGCGCTGCTGGCAACCTGGATGCGCGGGCTGGAAAACGACGTTTACTTCCAG
GTGGGCCTGTTAACGGTCATTGGTTTATCGGCGAAAAACGCCATCCTGATCGTCGAGTTT
GCTAACGAGATGAACCAAAAAGGCCACGACCTGTTTGAAGCGACGCTCCACGCCTGCCGT
CAGCGTTTACGCCCGATTCTGATGACCTCGCTGGCATTTATCTTCGGCGTATTGCCAATG
GCAACCAGCACGGGTGCCGGTTCCGGTGGTCAGCATGCGGTGGGTACTGGCGTAATGGGC
GGGATGATTTCGGCCACTATTCTGGCTATTTACTTCGTGCCGCTGTTCTTTGTGCTGGTG
CGCCGCCGCTTCCCGCTGAAGCCGCGCCCGGAATAAGCAATAAAAAAGGCGACATGCCAA
TGTGTCGCCTTTTTCAACTTTCCGATTAAGAACCTGCTCAGCGGGTTCTTGCTGTTTGTA
CTTTGTCTCAGGAATTACTTACGAAGCATAACTTCGATAAAGTCTTTCCAGTTCCCCAGT
TCACGTTCAATCATAACAACCTCTCTTATAATTATGGGTATTCTACGGAAACAATATACC
GTGGTGAAGCTAATTTACTCGATTGCTGCGATGACTACCTCCGGGGGACAAATCTTATGT
A