MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download OCL37(-Km).seq
 Deletion OCL37(-Km)
 Length 20303
 Fasta Format

>OCL37(-Km)
TGTTTGCTCATCAAGCGAACATAATTAATACAGACTTGTTTTGCGTGATAAAAAAATAGA
TGTTCTCACGCTCTTAATTATTTAGCAGGTTATCTGAACGCAAAACATTATTGCTGCATG
GATAATAAAGCGAGAAATGATTTTCAATTAATAAGACAGAATAATGTAAATGAAGCCGGA
TGATATTAACGATCATCCGGCTTTATTGATTTACGAGACTAACATCCCGGTAAACACATA
CGCCTGCAGCAGGGTGATAATGCCGATAACGCTGGCAAAAATCAGACTGTGCTTCACGGT
GTAGCGGAACAGTTCAGATTCTCGGCCCACCATGCCCGTCGCGGCGCAGGCCACGGCGAT
AGATTGCGGGGAGATCATCTTGCCAGTTACGCCGCCGCTGGTGTTTGCTGCCACCAGCAG
GGTGTCAGAGACGTTGATTTGCTGCGCCGTGGTCGATTGCAGTGAACCAAACAGGGCGTT
AGAGGAGGTGTCCGAGCCGGTAAGGAATACGCCCAGCCAGCCGAGAAACGGTGAGAAGAA
CGGGAACATCACGCCTGTACCTGCCAGTACCAGCGCCAGCGTGGTGGACATGCCAGAATA
GTTGGTGACGAAGGCGAACGCCAGCACCATGCCAATCGACAGTATCGGCCACTTCAAGCT
AATTAGCGTTTCGGCAAAGACGCCAATACCTTTCTTGATCCCCACACCGAGGATGAAGAT
AGAGATAATCGCCGCAATAAAAATAGCGGTGCCGCCAGCCGAGAGGGGGTCGAATTTAAA
CACCGCATCCATTGGCGTTGGTTGGGCGACAATGGGTGCCGCTTTCAACACTTGTTGATG
CAAATGAGGGATCTGGAAATTAATCACCAGTGAATAAAACGCGCCGCCCGGAGCAAATAA
CGCTTTAAACGGCTTCATGGTCCAGATGGTGACCAGCACCGTTAAGATTAAAAACGGTGA
CCACGCTCGAATGATTTGCCCCAGACTATATTCTGAAGGCACGGGACCGCCAGAAGATGG
CTTATTTACCACCATCGCACCTGCGGATTGTCCCATGCTGATTGCCGTTTCGGTATTTTT
CGGCCGCCAGACTTTAAGGAATAAAGCGAGTGAGACGATACTCACCAGCGCCGAAGTAAT
ATCCGGCAGTTCCGGACCAATATAGTTAGAGGTAAAGAACTGAGTGACAGCGAAGCTTCC
CCCAGCAACCAGCGCCGCTGGCCACGTCTCTTTCACCCCTTTCCAGCCGTCCATCATTGC
TACCAGCCAGAACGGCACAAGAACCGACAGGAACGGTAACTGACGTCCCGCCATTGCGCC
AATGTGGAACGGATCGATTCCCGTTACCTGACCGGCGACCAGAATCGGCACGCCCAACGC
ACCAAACGCCACCGGCGCAGTATTGGCAATCAGACACAGCCCCGCCGCGTATAACGGTTT
GAAGCCCAGGCCCACCAGCAGCGCACCGGTAATCGCCACCGGCGCACCAAAGCCAGCCGC
TCCTTCCAGCAACGCACCAAAGGAGAAACCAATCAGTAACACCTGCAAACGCTGATCGTC
GGTGATGGAGATAACCGAGCTGCGGATAATATCGAACTGCCCGCTGGCAACGGTTAATTT
ATACAGGAACACCGCCGCGACAATAATCCACGCTATTGGCCATAATCCATAAATAAAGCC
ATAGCCCGCAGCAGCAAATGCCATATCAATCGGCATTTTAAAGGCGAATATTGCAATCAG
GATAGATAATATAAGGGTTATTGCTCCAGCGACATGTCCTTTCAGACGTAATACCGCGAG
TGCAACGAAGAAGAATATTATCGGGATCAGGGCGACCAGAGCGGATAGCCCCAGTCCTCC
CATCGGCATATACATTTGGGTCCAGGTAACCATATTGTTCAGTCTCTTATTATCTTTATA
TGCTTGATATACTTAAGGTTGTAATAAGCAAAAGAGGACTGAACTGTAAAATATAGGCGT
TATACTTTACAGCAACAGTACGCCGCTAACGCAATTGCTACCTCTGGCATAACAAGTATA
TCGGGTAAGGGTTTCTGTTCCGCACACGCAGACGCAGAGTATCGTTAAGATGTCCATATT
GTTGTTTTAGGCCCGCTAGTAATGCGCTACGGGTATTTAATATTGTTAAACCCTGATAAT
CGCTCCGGTTATTTCCGGGATAAATGTACTACCGCAGTTACTATCATAGCCCCGACAATA
AAACTTGCCGGGGCTTTTTTGACGCTATTAATGACTTTCTTTTTCGCGTAAACGCCAGGC
GTGTAATAACGGTTCGGTATAGCCGTTTGGCTGTTTCACGCCGAGGAAGATTAAATCGCT
GGCAGCTTTAAAAGCACACGAGTTAGCGAAATTCCCCGCCATCGGACGATAAGCCGGATC
GCCAGCGTTTTGCTGATCAACCACTTTCGCCATATTCTCCAGCGACGCCTGCACCTGTTC
TTTGGTCAGAATACCGTGACGTAACCAGTTGGCGATATGCTGGCTGGAGATACGCAGCGT
TGCGCGGTCTTCCATCAACGCCACATTGTGAATATCCGGCACTTTTGAACAACCAATCCC
CTGCTCCACCCAGCGCACCACGTACCCCAGAATCCCCTGCACGTTGTTATCCAGCTCTTG
TTGGATCTCTTGCGCCGACCAGTTAGCGTTTTCAGCAACCGGAATAGTCAGCAGATCGTC
CAGCAGCGGTTCAAATTCAGCATTGAACTCGGTCTGGGCAATGTTGGCTTGTACGCTCTG
TACGTTGGTTTGGTGGTAGTGCAGCGCATGGAGCGTAGCAGCGGTTGGTGACGGAACCCA
GGCTGTGTTTGCCCCGGCACGCAGTTGGTCGCCCTTCTGGCTGTACATGTCTGCCATCAG
GTCCGGCATTGCCCACATGCCTTTACCAATTTGCGCTTTACCGCGCAGCCCACAGAACAG
ACCGGAAAGCACGTTATTACGCTCGTAGGCTTTGATCCAAGGCGTCGATTTCATCTGATT
TTTACGCAGCATCGGGCCAGCTTCCATCACCGAATGCATTTCATCGCCGGTACGGTCGAG
GAAACCGGTATTGATGAACGCCACGCGGTTGCGCGCCTGAGCGATACAGCTACGCAAGTT
CAGCGAGGTCCGACGTTCTTCATCCATAATGCCCATTTTCAGGGTATTCGGTGCCATACC
GAGCATTGTCTCAATGCGGGTAAACAGTTTGTTGGCGAACGCCACTTCCTGCGGACCGTG
CATTTTCGGTTTCACAATATAGACGCTGCCAGTGCGCGAGTTTTTCTGCACTTTTAAATC
ATAGAGGGCAATCGCGCCAGTCATGACGCCATCAAGAATGCCTTCCGGGATTTCATTGCC
TTCGCTGTCCCAAATCACAGGAATGGTCATCAAATGACCCACGTTGCGGATAAACAGCAG
CGAGCGTCCGTGCAGAGAAATTTCAGAGCCATCGGCGGCGGTGTAATGACGATCGTCATT
CAGTTTACGCACGATTTGCCGACCGTTTTTCTCCATTTTCTCTTGCAGAGTCCCCTGCAT
CAGGCCCAGCAGGTTGCGGTACAGCAGGATTTTATCTTCCGCATCAACCGCCGCGACCGA
ATCTTCGCAGTCGAGAATGGTACTGATAGCAGCTTCGACGATAACATCGTTGATGTGCGC
CGGATCGTCTTTGCCAATCCGCCCATTGGCATCGATTTGCAGCTCAATATGCAGGCCGTT
ATTTTTCAGCAAAATGCAGGTCGGCGCAGCGGCATCGCCACGGTAACCGACAAACTGTGC
TGGAGTACGTAACGTGGTTTCTTTACCATTTTTCAACTGGATGCGTAATTGTTTATCAAC
CACCTTAAACGCCACCACATCCTGATAGCTGCCGTTTTCCAGCGGTAGAGATTCATCGAG
GAAACGCCGAACCCAGGCGATAACCTGCTCACCGCGTTGCGGATCGTAGCCGCTGACCAT
CGCCCCTTCCTGCGGGATGATGTCGCTGCCGTATAACGCATCGTACAGTGAGCCCCAGCG
AGCGTTCGCCGCGTTCAGCGCGTAGCGGGCGTTCATTGCCGGAACCACCAGCTGCGGCCC
CGCCTGGCTGGTGATTTCGCTGTCAATGCCCGTGGTTTCCACCGTCACGCGCTCCGGTTG
CGGCACCAGGTAGCCCAGTTCACGCAGGAAAGATTTATAGGCCGCTTTATCTTTTACCGG
CCCCGGATTGCTGCGATGCCACTCATCAAGCGCTGCCTGAATGCGATCGCGTTCTGCCAG
CAACTGACGATTTTCTGGTGCCAGATCATGAACGATCTCATCAAAATTGCGCCAGAACGC
CGCAGCGTCCAGCCCTGTTCCCGGTAAAACTTCTTCATCCACAAAACGTTTAAAATTGGC
GTCAATGCGTAAACGGCTCTGGGTTATGGTTTGACTCATTGTTTATCTCCTCGTTTTCGC
TTATTTCGCCAACACCGCTGCTGCCGCTTTCGCGACCTGCGCATCCTGTGCTCCGGTTAA
ACCAGAAACGCCCACGGCACCAATAATTTGCCCATCCACAACAACCGGTACGCCGCCTTC
CAGCGACGTTAATAACGGCGCAGTCACGAACGCGGTACGTCCGTTGTTCACCATCTCTTC
ATAGCCCTTAGTTTCACGACGCCCCAGCGCGGCGGTACGCGCTTTCTCCTGGGAGATATA
AGCCGCAATCGGCGCGCAATCGTCCATGCGACTTAACGCCAGCAGATGACCGCCGTCATC
GGCAACAGCAATGGAAACAGACCAGTTATTTTTCTGCGCCTCTTCCTGACCTGCGGCAAT
AATTGCACTCGCCATTTGCTGGCTAAGAATGACTTTAGTTTTCATTTTGTTATTCCTTTT
CAAGGGCTTGTTCTACAATTTCAATCCAGTGACGCACAGAGGTACGACCGGCGCTCGCCA
GATGCGTCTGGCAACCAATGTTGGCGGTGACGATCATTTCCGGTTTGCCGCTTTCCAGCG
CATTCATTTTGTTATCCCGCAGCTGGCGTGCCAGATCGGGATGCGTTAACGCATATGTTC
CCGCTGAACCGCAGCACAGATGGCTGTCGGGAACGTCCGTTAAGGTAAATCCAAGACGAA
GCAACACTTTTTCCACTTCGCCGTTCAGCTTTTGCGCATGTTGTAGGGTACACGGACAGT
GGAAGGCCAGCTTTTTATCGCCGCGAATTGCCAGTTTTTCCAGCGGTTCCTCGCGCAGAA
GTTCGACTAAATCGACCGCCAGTTCACTGACCTGACGTGCTTTATCGGCATATAACGCAT
CGTTTTTCAGCATCTGCCCATACTCTTTGACAAACGCGCCGCAGCCGCTGGCGGTTTGCA
AAATTGCCTCGGCACCTGCTTCAATCGCGGGCCACCAGGCATCAATATTATTGCGCGCCC
GTGCCAGCCCTTTCTCCTGCGCATTAAGATGATAGTCCACCGCGCCACAACAGCCTGCTT
CGTTAGCTGGCATGACGCTGATCCCCAGACGATCCAGCACTCGCGCAGTTGCCGCGTTGG
TGTTGGGCGAAAGCGTAGGCTGGGCGCAGCCTTCCAACATTAAAACCCGACGCTTATGGC
GCAGCGGCGGACGCGGTTTAGCTTTCACCGTTTCAGCAGGCAGTTTTGCTCTGACCTGTT
CCGGTAAAAACGGTCGCAGCACCAGCCCTACCTGCGTCAGCGCACGGAAGACCGCCGGAC
GCGGCACTACCTGGCGCAATCCTTCGCGCAGTATTCGCTCCGGCAGTGGGCGTTTCACTT
TCTGCTCGACAATATCACGCCCGATATCCAGCAAATTGTGATAGCGCACACCAGAAGGAC
AGGTGGTTTCACAATTACGGCAAGTGAGGCAGCGATCGAGATGCTCCTGTGTTTTAAGCG
TGACTTCGTTGCCTTCCAGCACCTGTTTAATCAGATAGATGCGCCCGCGCGGCCCGTCCA
GTTCATCGCCCAGAAGCTGATAGGTTGGGCAGGTTGCGGTACAAAATCCGCAGTGAACAC
AGGCGCGCAGGATGCTGTCGGCTTCCAGCGCGCGCGCGTTCTGCCGCATCTCTTCAGTTA
ATTGGGTTTGCATAGCCTGCTCCTCAAAGTTCCGCGTACATGCGACCGGGGTTAAACACG
CCGCAAGGGTCGAGCTGCTGTTTAAGCTGCTGGTGATAGCGGAATAAAGGAGCCGATAGC
GGGGCAAAGCCACCATCTCCGGCACTAAAGCGGGTCGCATGACCGCCAGCGTTGCGGGCG
ATGCGATGGATTTGATTGTCCTCGGCTGTCGATTTCAGCCAGCGTAACGCCCCGCCCCAG
TCGATCAGTTGCTCGCCGGGTAAATCCATCATCGGCGCATCACTGGGTAATGAAATGCGC
CATAAGGTACCTGGTAACGAGAAGAACGGCAGTTGTTGTTCACGCAATTGCTGCCAGAAC
TGACCGGCAACCTCTTCGCCACCCAGCAGTTCACGCGCTGCTTTTACCGATCCTTCGCCG
CCCTCAAGGCGGATCCACAACGCATTGTCGAAGTAACATAAGCCACTAATGGGTAATGGC
TGGAGTTGCCACTCGGCGATTTCACTCATGGCTTCTTGCAGGCTGATTTCCCGACGCAGG
CTCAGGGAGGCGCGCGGTCGCGGTAACACTTTCATTGAGATTTCAGTGAGCACGCCAAGA
CAACCGTAGCTTCCGACCATTAACCGTGAGAGATCGTATCCGGCAACGTTTTTCATCACT
TCGCCACCAAAACGCAGATGTTTTCCAGCGCCGGTAATGATGCGCGTGCCGAGGACAAAA
TCGCGGACCGAACCGCTCCACGGGCGACGCGGCCCCGCCAGCCCGCAGGCGACCATCCCG
CCCCAGGTGGCTTCTTCACCATAATGCGGCGGCTCACAGGGGAGCATTTGCCCCGCGCTT
TCCAGCGCCGCTTCAATTGTCACCAGCGGCGTTCCGACACGCGCGGTTATCACCAGCTCG
GTCGGGTCGTAATTAACAATGCCGCGATGACAACGAACATCCAGCGTTTGCCCGGTGACA
GGGCGACCTAAAAAGGCTTTGCTATTGCTGCCCTGAATCACCAGCGGCGTTTTATCGCTA
ATCGCCTGATTCACCTGCTCCAGCAGCGCCTGGCTGTAATCACACTCGCGTAGCATCAGA
AACGCTCCAGTTCAGGGAAAGGTAAATGACCGTGATGCACATGCATGGCACCAAATTCAG
CACAGCGGTGTAGCGTGGGAATGTTTTTCCCAGGGTTCAGCAAACCATCGGGGTCAAACG
CCGCCTTGACCGCATGGAAGGTCGTGATTTCATCGCTGTTGAACTGGGCGCACATTTGAT
TGATTTTTTCTCGCCCGATGCCATGTTCGCCACTGATGCTGCCGCCAACTTCAACGCAGA
GTTCGAGGATCTTCCCGCCCAGCTCTTCCGCGCGGGCAAATTCACCGGGTTCGTTGGCAT
CGAAAAGGATTAACGGGTGCATGTTGCCATCTCCGGCATGAAAGACGTTGGCAACACGTA
AATCATATTGCTGCGATAAACGGGCAATGCCTTCCAGTACGCCAGGCAGGGCGCGACGCG
GGATGGTGCCATCCATGCAGTAGTAATCCGGGGAGATACGTCCTACCGCCGGGAACGCAT
TTTTGCGACCGGCCCAGAAACGTACGCGCTCTGCTTCGTCCTGTGCCAGACGGACGTCAG
TCGCGCCCGCTTTCAACAAGATGTCGTTAACCCGCTCGCAGTCTTCCTGTACGTCAGACT
CCACGCCGTCCAGCTCGCATAACAAAATCGCTTCGGCGTCGACGGGATAACCGGCATGAA
TAAAATCTTCCGCCGCGCGGATCGACAGGTTATCCATCATCTCCAGCCCGCCGGGGATAA
TGCCATTGGCGATGATGTCACCAACCGCAAGTCCGGCTTTTTCTACCGAGTCAAAGCTGG
CTAACAGAACCCGCGCCACGGGCGGCTTCGGCAGCAGTTTTACCGTCACTTCGGTGGTCA
CGCCGAGCATACCTTCCGATCCGGTGAACAGCGCCAGCAGGTCAAAACCAGGTGAATCCA
GCGCGTCCGATCCAAGCGTCAGTGCCTCGCCGTCCAGCGTTTGCACTTCAATTTTCAGCA
GGTTATGTACGGTCAGACCATATTTCAGGCAGTGGACGCCGCCGGCATTTTCAGCCACAT
TGCCGCCAATGGAACAGGCGATTTGTGAGGAAGGGTCCGGTGCGTAGTAGAGATTATGCG
GTGCAACGGCCTGGGAGATCGCCAGGTTACGCACGCCTGGCTGCACGCGCGCGCGGCGAC
CAACGGGGTTAATGTCGAGGATCTCTTTAAAGCGCGCCATCACCAACAACACACCTTTTT
CCAGCGGCAGCGCGCCACCAGAAAGCCCGGTGCCTGCACCACGGGTCACCACCGGTACAC
GCAGGCGATGGCAGACAGCCAGAATCGCTGTCACCTGTTCCATTTGCTTAGGCAGAACAA
CCAGTAATGGACGCGTGCGATACGCGCTCAACCCGTCACACTCGTAAGGAATGATCTCCT
CATCGGTATGCAGGATCTCAAGTCCAGGGACATGCTCACGCAGTGCCATCAGTACCGATG
TGCGGTCGACATCGGGTAAAGCGCCATCAAGACGCTCTTCGTACAAGATGCTCATGAGTA
GGCTTCGCTTTGTTGTGTTGTGTGGCAGCTGATTTTTGCGCGCTGCTTCTGTGAACAGTT
ATTAAGCGGGCTTTTCGTTTTCGTCTATCTCTTTAGCTACCGGTCAGACCATTTTTTTTC
CAGCTCTGTGACCTTGTCTTGGTTAACTCAATGTTAAATTGATGTAACATAATCACTTAC
GTGATGTGCGTGTTTTGCGAGTTAAGAACAGAAAAATTGGTCCTACCTGTGCACGAGGTC
CGGGAATGAAAGATGAACGTCGCCCTATTTGCGAAGTGGTTGCAGAGAGTATCGAACGGT
TAATTATCGACGGCGTACTGAAGGTCGGTCAGCCGCTTCCCTCGGAACGTCGACTGTGTG
AAAAGCTCGGCTTCTCACGCTCCGCACTGCGTGAAGGGCTGACCGTGCTGCGCGGGCGCG
GGATTATTGAAACGGCGCAGGGTCGCGATTCTCGTGTCGCACGGCTTAATCGGGTGCAGG
ACACCAGCCCGCTGATCCATCTGTTCAGTACGCAGCCGCGAACGCTGTACGATCTGCTCG
ACGTTCGCGCATTACTGGAGGGCGAATCGGCAAGGCTGGCGGCAACGCTGGGAACGCAGG
CTGATTTTGTTGTGATAACCCGCTGTTATGAAAAAATGCTCGCCGCCAGTGAGAACAACA
AAGAGATTTCGCTGATCGAACATGCGCAGTTGGATCACGCTTTCCATCTCGCCATTTGTC
AGGCTTCTCACAATCAGGTGCTGGTGTTTACGCTGCAATCATTGACCGATCTGATGTTTA
ATTCAGTGTTTGCCAGCGTAAATAATCTCTACCATCGACCACAGCAAAAAAAGCAGATCG
ATCGCCAGCATGCGCGGATCTACAACGCGGTGTTGCAGCGGCTGCCGCACGTCGCCCAGC
GCGCAGCACGCGATCATGTGCGGACCGTGAAAAAGAATCTCCACGATATCGAGCTGGAAG
GCCACCATTTGATTCGCTCGGCGGTGCCGCTGGAGATGAACCTGAGTTAGCTGGTATTAA
ATCTGCTTTTCATACAATCGGTAACGCTTGTACGGCTCCGCCCCAATGCGTTCCAGCATG
TTATTCATGCCTGTATTGGTTTCGAGGATCCATGACATCTCCAGCGCATCGATCTTCCGG
CGGGCAAACGGATCGCGTAAGGCTTCAATCAATAACAGCGCAATCACCGGGCCGATGCGG
CTGAACTGATACTCGTCGCGCACGCCCATCAGCGGTACTCGCGCAGTTCGCACACCGCTG
ACTTTCAAACGCCACAGCAATTTTGCCCAGCCGAAGGGAAAGAGCGATCCGTTCAGATCG
GCAATCGCCTCGTTGATGTTCGGCAAGCCGACAATAAACGCGCAGGGTGCAGAATCAATC
TCAGCGATATAGATCATATCGTCCGGCACCAGATATTTAAGTTGATCGCCCATGGTCGCG
AATTCATGTTCGGTAAACGGCACAAATCCCCAGTTGTGCTGCCAGCCAGAGTTGAAAATC
TCACGCAGGATCTGCATCTCTTCGGCAAACCGCTGACGATTGATGCAGCGAATGGTCACC
TTTTTGCGCACCTGATCCATCAGTTTTTTTAGCGCCGGAGAGAAAGTGAGATCGGTTCGC
TGCATCCACCACGCCAGTAAATCAATGCCTTTGTGATAACCCAGTTGTTCAATATGCGCG
GCATACCACGGTTTGCCGTGTGGCATCATCGCACAGGGTGGTGTGTCAAAACCTTCAATC
AGTAATCCGCTTTCCTGATTGATATTCAGGCTGAAAGGACCGCTGATCTTACTTGCACCT
TGTGACTTCAACCACGCTTCCGCTGCGCCAAACAACGCGGCAAAAACCTGCGGATCATCA
ATGGCGTCAATCATGCCGAAATGACCGGTATCTTTGCCGTAACGCTCGCGGTGCAAGGTA
TCTATTTGCGCGGTAATACGCCCAACTATCTGCCCCGCTTTTTTTGCCACCCACGCCTGC
CAGATGATATGGTCCGTCCCCGGATTTTTCGCAGACAAATGCTCGTTGCGTTCAATGAAT
AAAGGGGGTATCCAGTTTGGATCGTCGGGATAAAGTGATGACGGAAAAGCGATAAATGCC
TTAAGGTCATTTTTATTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTC
ATCTGGAGCCATAGAACAGGGTTCATCATGAGTCATCAACTTACCTTCGCCGACAGTGAA
TTCAGCAGTAAGCGCCGTCAGACCAGAAAAGAGATTTTCTTGTCCCGCATGGAGCAGATT
CTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTACCCCAAGGCTGGTAATGGC
CGGCGACCTTATCCGCTGGAAACCATGCTACGCATTCACTGCATGCAGCATTGGTACAAC
CTGAGCGATGGCGCGATGGAAGATGCTCTGTACGAAATCGCCTCCATGCGTCTGTTTGCC
CGGTTATCCCTGGATAGCGCCTTGCCGGACCGCACCACCATCATGAATTTCCGCCACCTG
CTGGAGCAGCATCAACTGGCCCGCCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAA
GCAGGCGTCATGATGACTCAAGGCACCTTGGTCGATGCCACCATCATTGAGGCACCCAGC
TCGACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAAT
CAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCAC
AGCCTGGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTGCAT
GGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAG
CTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTG
AAACAGCATCCACGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATC
CGGGCCAGGGTGGAGCACCCATTTCGCATCATCAAGCGACAGTTCGGCTTCGTGAAAGCC
AGATACAAGGGGTTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACGCTGGCCAAC
CTGTTTCGGGCGGACCAAATGATACGTCAGTGGGAGAGATCTCACTAAAAACTGGGGATA
ACGCCTTAAATGGCGAAGAAACGGTCTAAATAGGCTGATTCAAGGCATTTACGGGAGAAA
AAATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCT
TATTCGCACCTTCCCTAAATCAGGTCATACGCTTCGAGATACTTAACGCCAAACACCAGC
GAAATGAGCGGCTTGCCGACGATCAACACCGCGAGCGCCACCAGAATACCGATTCCGCCC
GCCAGTAAACCGGACTTCACACCTAACAACCACGGTCTGGTGGTGCGCGGATCTAAACGC
ATCACCTCTGGGTAAAAACTTTTACCCAGCAAACCCGCTGGCGTTCCGGCGGCGTCGAAG
AATGTCATGGCGATTTTAAATAACCCGGCGGCAGCGGGTCCTAACACGATCCCCACCAAC
ACTGTGCTGCACGAGTTACGCGCCGACCAGATGGAGTGGGCAATGTTGGTTGACCAGACA
AAACTCCACGCGCCTTTAATGTATCGGGCAGACTCAAACAGATTCAATTTGAAGGCGTTA
TGGATATTTCGGCGGCGTAATTCGCGCGCGGCAAACCACCAGTACATGGTGCCGCCAACC
AGATTCGACACGTACCAGGCAATAACAAAACCCGCAAAACCAAAGTCAAAATACCAGGCT
ACGACGCTCCCCGCTGCGCGCAGAAAAGGTTTCGTCGCCTGCTGTACAGCAATTAAATCG
AAGCGATCTACCGCACGCAGAATGCCGGTCGGCGTGGAGGAAGCCATTGAAGGAATGAGC
GTGCAATAGAGCGCTGCCAGCCAAAAACTTTGGTCATCCAGACCTAATGAATGGGAAAGG
AATGGCAGTAAGGCAATGCCACCGACAATCGCCACCGCGCCGCTGACGATATCCAGCGAG
AAGGAAAATGAGACGACATTGCGGAATTGCTGCGGATTATTGTTGGTTAATGCTGGTGTT
CCGTACTGAACCACCAGTTGCCATGTCTGAAACTTAATAAAATCGCTGATCGACTTGGCG
TACGATTGCACAATCACCAGTACGCCAAACATGGCGGGCGTCATCCCTTTACCGGCACAC
GAGAGCGCCAACAGACCCAGCAAGGCGCTCACGACATTACTGGAGCCTAACCAGGCGCTA
TTGCGAATAATGGTGCGAAACGCGCCATCTGCAAACCAATGTTTGATGTTAAAACCCGCC
AATTCAGCCTGACCTTATCGTTGATAGTAAAAAGTATCCCGCCAGCCTTAAGTTAAACTT
CGGCGGTCAGAAACGATGGCAACCAGAGAAACCGCCTTCTGTGCCTGTTCCAGCACTTCG
CTGTAGGGCGCTCTGGAATCAATCTCAAGAATTTTTGTGCCGTTATAGCCAATCTTCGAC
ATGACACCGATTTTGTCCTGCAGCTCGGCATAGTCATGGTCAGGCTTGCGGGAGATGGCA
GTCTCAATATCAATGCCCAGGCGAATAATTAATTCCGGGCGATATTGCGCCATTTGTTGG
TATAAACGCCGTTCGCGCTGCGCCAGAAACATGCTGATTTTCCCGGTCGCACGTTCGACG
CCAATCCCCGGTCCATCATAATAAAAGCCCGAAATTTCAGCCTGCGGGAAGCGATCGCTG
ACCACCAGAACGCCACTTTGCGCCAGTCGCTGAACCTTGCGTAGATTCGCCATTCTTCGC
AGCGAGAAGCAGTACATAATCACCGCCGCCCATAGCGCCGGAGATTTGGTTTTCATGCTT
TGGGTTTTCGAGGATTTGGCCGCCAGTCGCCGTTCCAGCCAGACGCCAACCAACGGCAAT
CGTTTGATTTTGTCGCCGTCTTCGCCGGAGAGCAGCCCCAGATAGCGCCGCTCGGTTTGC
CAGTGTTGTTGCAGCGATTTCACCAGGTCGGTGGTCAGTGTGGATTTACCGGTGCCATCA
CACCCGACCACCGCAATCAGCCCCGGAATGTAGTTGGGCTGCGGCGCGGTTGTACTATTA
ACAGTTTGAGTTTGTAGTGCATCCATTCGTTAAATCATCCCCTATCCATTTTGGTGATCA
GGAAAGCGCGGCGTGAATTGCGCGTAGTGACGCTTGCAGAATTTCATCGGCGGGGTGTCG
CCCATCCAGTTCAAGGATCTTTGCGCCATTGAATGTCAGTTGCGGCGTAACGGCGATTTT
TTCCTGTAACGCTGCCAGTTGGTGGTCAGGTTTACGCGCAAACGCGGTTTGTTCATCAAT
GCCAAGACGAATCAACAATACGGGCAAATAAGATGCCATCCATTGGTACAGCTTCAGCTC
GCGCTGCCTTAACATTTTTATCCAACCGTTACCGCCCGTGGTTTTTGCCAATTGCGGGCC
ATCAAAGCGAAACCCCGGCACTTCAACCTGCGGGTAGCGGTCGGTGATGAGCAGAAAGCC
TTGCTGGCTTTTACACAACATTTTGCGAAACTTGTACGCCCGCCAGCAGGAAAGCAGATA
GATAACCAGTGCAGTAATATTGCCAGGCGGTGTTGAGGGCTTTTCGTGCACATGTGCCGC
TTTACTTCGCAGATAACGCCCAAAAGGTGCGCCAATAACAGGGAGCTGTGAAATCCATTC
GCCAATTCGCCCGGACGATTGCCCGAGATAAATGTGTTCTGTTGGCATTCTTGCTGCCAG
TTCATTTACCAGGCTTGCCGTGAGGGTCGATTTACCTGAACCATCACATCCTACAATGGC
AATAACACGCACTGGCGTGGAATTAATTATTGACATATTACGTTGATTCACGAAAAACCC
GGCAGTAAATAATGTATTGAATATTACGTGGTCCGTGCTCAGAATATCCGTTCAACCTTA
TTGTGACAATGGTTAATTGTGACATTGACCTGAATTACGCTTTCATAAAAACATATTAAC
CAAATAAATATTTTTAATGGATATTTAAATTAAAGGATATATTCATGCAGTCAATAACAC
CTCCATTAATTGCCGTTATTGGTAGCGATGGTTCAGGCAAGTCAACGGTGTGTGAACATC
TTATTACCGTTGTCGAAAAATATGGTGCTGCCGAAAGAGTTCATTTAGGAAAACAGGCCG
GAAATGTCGGTCGTGCAGTGACAAAATTACCGTTGATGGGAAAATCCTTACATAAAACAA
TTGAACGAAATCAGGTGAAAACAGCAAAAAAATTGCCTGGACCAGTTCCGGCGCTGGTAA
TTACAGCGTTTGTCGCCCGTCGCTTACTGCGCTTTCGTCATATGCTTGCCTGTCGTCGTC
GCGGGTTAATTGTTCTAACCGACCGTTATCCTCAGGACCAAATTCCTGGCGCTTACGATG
GTACGGTGTTCCCACCTAACGTTGAAGGTGGTCGTTTTGTCTCATGGCTGGCAAGCCAGG
AACGTAAAGCGTTTCACTGGATGGCGAGCCATAAGCCTGATCTGGTCATCAAACTCAATG
TTGACCTTGAAGTTGCCTGTGCACGTAAACCCGACCATAAACGGGAATCGCTGGCGAGGA
AGATTGCCATAACGCCACAGTTAACCTTTGGTGGTGCACAACTGGTTGATATCGATGCCA
ATCAGCCACTGGAACAGGTGTTGGTTGATGCAGAAAAAGCGATTACGGATTTTATGACCG
CGCGTGGTTATCACTAGTCAAAAATGGAAATGCCCGATCGCCAGGACCGGGCATTTTCAG
GAAGGTTAAATCAACTGCAATGCTATCCAGTACAGCCCACCAGAAAGAAAAATTGCCGCC
GGTAAAGTAAATACCCACGCCATCAGGATGCTGGTTACCGTTTTACGCTGTAACCCACCG
CCGTCCACCACCATCGTCCCTGCAACTGCAGACGAGAGGACGTGTGTTGTGGAGACGGGC
ATCCCAATATAACTGGCAAGACCGATAGACACTGCCGCCGTCATTTGTGCCGCCATGCCT
TGCGCATACGTCATGCCGCGCTTACCAATCTTCTCACCGATGGTCATCGCTACACGACGC
CAGCCAATCATGGTGCCAATGCCGAGCGCCAGTGCTACCGCCATGATGATCCACACCGGA
GCGTACTCAATGGTGCTTAACATATCGCTGCGAAGTTTTTTCAGCAGGTTCTGGTCTTCT
TTACTGACGCCTGGCAGTTTCGCTAGCTTCGCGGAGGTATCAGAGATGCACAGCATAATG
CGGCGCAGCTGGCTGCGCTGACTCACGCTTAACGGCTCGTAACTTTCCATATTGCCTGGC
AGCATCGTTTTAACGCGCGCAATAGCATCAAAGGTATTTGCCGGATGACAGTGAAACTCT
GTTACTTGCGTGCCATCAGTCGATGCTGCAGGCAATGGAGGTTCCATCGCAATCAACTTC
TGCGGCAGTTCAGGATGCTGTTGCAGGTAGTGTTCGAAGTTGGTAACGGCATCGCGGGTA
CGGGTAATTTCATAGCCGGACGCATTCATATTGACGACGAAGCCAGCAGGGGCAATCCCC
ACCAGTACCAGCATTACCAGGCCGATCCCTTTTTGTCCGTCGTTCGCGCCGTGCGAAAAC
GCCACGCCCGCAGCGGAAACAATCAGCGCAATACGCGTCCAGAATGGCGGTTTACGTTTG
CCTTTTTTCTTTTTGCGATCTTCCGGAATGCGGTGAATACGGTCACGCTTTTTCGTCCCG
CTCCAGTAGCGTCGCAGCAGGAATATCAGGCCTCCCGCAATGACCAGGCCGACGATAGGG
GAAACAATCAGCGAGGAGAAAATTTTGGTCACTTCACGCAGGTTTAACGCATCCATCACC
GATGAGCCGGTTAACAGCGCGTTGGTTAAACCGATGCCGATAATCGCACCAATCAAGGTG
TGCGAACTGGAGGCCGGTAAACCGAAGAACCACGTTCCCAGGTTCCAGATAATCGCCGCC
AGCAGCATGGAAAAGACCATCGCCAGGCCGTGGGTTGACCCCATATTCAGCAACAAATCG
GTTGGCAACATATGGACAATGGCATAGGCAACGCTAAGTCCGCCCAATAACACGCCAAAA
AAGTTAAAAAATGCCGCCATCACCACAGCAAGTTGTGGTTGCATGGCACGAGTATAAATA
ACGGCTGCCACCGCATTCGCCGTGTCATGAAAACCATTGATTGCTTCGTAGAACAACACA
AATGCCAGAGCAAGCAATAACAAAAGCCCTGTGTATATATCAAGGCCAACAAATAAATTT
AGCATATATTAGATTACGCCATTTTGAATTTACGAACGGACGCATTATCAGTGACTTTAA
CGGCATGGGCAAAGTGAAATATCATTTTTTAACGATAAAAAGAGTGTTATTTCTTGTGTA
TCAGACAATAAGCATTCATTCAAAACCTTTAGAAATAATCAAAACACAGGTATTCCACTG
GTTAATATATTCACATATGAAATGAATAAATATTGGAATATATAAATATTGAATATTTTG
ATTAATCCCCGTACTGATTATTCTTCATAATCAGTACGGGGTTGCTACAACATGTATTAC
TTTTTCACCACAATTAACGGTTCAATATCACTCTCTTTTTTGATGACCAGTGATTCATCA
CCGCGCAAACACGTCCCACCGTAGTTGCCGCCAACGGTGAAGGTACATACCTGAATGTAT
TTACCGTCCACTTTCGGCAAACACCACAGTTGCTGATAGATGTTTTTCTGCTCGGCAAAT
TTACCGCTGGTTTTGTCCAGCACCTCTTCATGATGGCTGACGAGGTCGATATTGCTGCCA
CAGCGACCGGCGATCGGTTTCACTGCGTAACCTGTTTTCACCAGTTCATCATTAACAGTG
AAATCGGTATCCAGCAGGTAACGATGGTGCGGGAACAGCGACCAGAGGATCGGCAGAATC
GCTTTGTTGCCGGGGATCACCGTCCACAGCGGCTCAAAGACCAGCACTTCCGGGCGCAGC
AATACGTCGATAAGACGCACTTCGTTTTGCGGATGACCGGTACGGATTGGCACCGCAGCA
AACTCACGGTCGCTAACTTCACGAATCTGATCAAACGCGGTTTCCCACGCCCAGGTTTTC
CACACGCAGTTAACCAGTCGCCCTTCCCCATCAATCAGTTGCCCGGCAGCATCCCAGCCC
AGTTCATCCAATCCACGCAAGATACGCGTTTCAAAGCCCGCCTGGTGCAGCGCCTGCTCC
ATAAACTGCGCGTGATAGTTTTCCTCGATATCTTTGTCCTGCATGATATGGACAAACGGA
CGTGCACGACTGTGTTTCCAGGCACCAGCCAATTCGTTAATCAGCCCTTCCGCCGGATTG
AAGCCGTTGCCTTTATAGCCCTGCTCCGCCCAACGTTCGAGGATCAAGCCCGCTTCGGTA
TGACAGGAGGCGGAGTCGGCGTTGTACTCGTAAACCTTCAGGCCACGCTCATCCATGCAG
AAATCCATACGACCAGTGATCATATGGTGACGGCGACGCTGCCAGGAGAGACGCAAACGT
GGCCAGAGGATTTTCGGGATGTCGAACAGCGCCAGCAGGTTGTCATCTTTCAGCACCTTG
TCGGTTGCGTGAAGATACATCAGGTGCAGCTCGTTGGTGGCTTTAATTAGCTCCTGCTCG
GCACTCTCGGTAATGGTGTAGTAATGATAAGGATCCTGATTGATCACCTGACCGTTGGCC
TGCACATAGGCGTTTTGCAGCGGATCTTTTTCATCCAGCCATTTACCGTCAAACTGGCCT
TTGTTTTCCAGGCGCGCTCCGCTGATTTTCAGCAGCTCGCCTGCAATTTCCGGCTGCGGT
AAGCTGTATTCAGTATCTTCCGTCTGGATCATCCAGCCCAGAATGGTGGTGTCATCAAAA
GTGTCTTTCAGGGTATAGCAGCCGTTTTCGACCACCATCTCCAGCTCGCGCGTCCACTGT
TGCCCTTGCGGCAACGGGGAATGAATCACGTTCTGTTCCGCAATACGGACTTTGTTGCCA
TGCAATTGGGTAATGATGGCGACATGGCCAGTGTCTTTAAATTCACCGCCTTTATCCCAG
ATAAGAAGCGCACCCGCGACCGGCGCACGCGGCGAGCCGTTAGGAAATGCCTGCAATGGC
AGGATGTTGTCATTAACCACTTCTCGCAGGAAGCGCAGCGAGAAAATCTCCCACGCCATA
CCCACGTCAGTAAAGACCACACCGTAATTCAGAAAGAGAAAACGGCGAGCAAATTCAACG
CATTGCCACTTGTGGCCCATATATTCGTCGTCGATATAGCTACGGAATACGGCGTCATCT
TCGTATTCCTGCGGATCGAGAGAACTGTAATCTGAAGAGTAGATTGCTACCCCACCTGGG
GCGTAGCCCAATAATGTCCCGAACGGGGCATCCTGGCTGGTCGTTCCTTTGCTCATCACT
TTACCTTTAACAATACAACCTAAGCAGTTGGCGTAATTGTTGTGCTCTGATTACCTGCTC
AGCGACATTAACCGGACAGAGGTCAGACTAATCATACACCTCATCGCAGCGGCTGGCGCA
AAGGGTTAAAAAATTCACATTCTGTACAGCAAGTGACCTGCTACACTGCTTCAACACTAC
CACTCAGAAGGCAACTCACTATGACAGACAATACTTATCAGCCCGCGAAAGTCTGGACGT
GGGATAAATCCGCTGGCGGCGCGTTCGCCAATATCAATCGCCCGGTTTCTGGTCCGACGC
ATGAAAAAACGCTGCCCGTTGGCAAACACCCATTGCAACTTTATTCGCTGGGAACGCCGA
ACGGTCAGAAAGTAACGATTATGCTTGAGGAGCTGCTGGCGCTGGGCGTTACTGGTGCAG
AGTACGACGCCTGGCTGATTCGTATTGGCGATGGCGATCAATTCTCCAGCGGCTTTGTCG
AAGTGAACCCAAACTCGAAGATCCCGGCGCTGCGCGATCATACGCATAATCCGCCGATCC
GCGTGTTTGAATCTGGTTCGATCCTGCTTTATCTGGCGGAGAAATTTGGCTACTTCCTGC
CGCAGGATTTGGCAAAGCGTACTGAAACGATGAACTGGCTGTTCTGGTTACAGGGCGCGG
CACCGTTCCTCGGCGGTGGTTTTGGTCACTTTTACCATTACGCACCGGTAAAGATTGAGT
ACGCCATCAACCGCTTTACCATGGAAGCCAAACGTCTGCTCGACGTGCTGGATAAGCAAC
TGGCGCAGCATAAGTTTGTTGCGGGCGATGAGTACACCATTGCGGATATGGCGATTTGGC
CGTGGTTTGGCAACGTGGTGTTAGGTGGTGTGTATGATGCCGCTGAGTTTCTTGATGCGG
GCAGTTATAAGCATGTACAACGCTGGGCGAAAGAAGTAGGCGAACGTCCGGCGGTGAAAC
GTGGGCGTATTGTTAACCGCACCAACGGACCGCTGAATGAGCAGTTGCATGAGCGCCATG
ACGCCAGTGATTTCGAGACGAATACGGAAGATAAGCGTCAGGGGTAAGGGTTGGTGTTCG
TCGCAGCAAGCCATCCAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAATCGTGCACAA
TGCCTGATGCGACGCTGCCGCGT