MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download LD3-5-1.seq
 Deletion LD3-5-1
 Length 63652
 Fasta Format

>LD3-5-1
GCAATTTCCTCGACGCTGGCGTTACGTAAACCTTGCAAACCGCCCATATATTTCAACAAC
ATTTGCCGACGTTTTGGCCCGACGCCTTCAATGGTTTCCAGGGAACTGGTATTTTTGACC
TTCGCCCGTTTTTTACGGTGCCCGCCAATCGCGTGATCATGTGATTCATCGCGAATATGC
TGGATAACATGCAGCGCGGGTGAATCTGGCGGCAAACTAAATCCCTCACCTTCCGGCTCA
AAGAACAGCGTTTCCAGTCCAGCCTTACGATCTGCTCCTTTGGCAACGCCAAGTAGCAGC
GGATGATTTTTATCCCATGAGACATCCAGTTCGGCGAAGACATTTTTCGCCTGCGCAAGC
TGGCCTTTGCCGCCGTCGATAAGGATCACATCCGGGATCTTACTGTCGTCAATGGCTTTA
CCATAACGCCGACGCAGCACCTGATTCATCGCCGCATAATCATCGCCCGGCGTGATGCCT
GTAATGTTATAGCGCCGATACTCCGCACGCAGCGGGCCGTTAGCATCAAACACCACACAG
GAAGCGACGGTTTGTTCGCCCATGGTATGGCTGATGTCAAAGCACTCCATCCGCTTCACT
TCCGGCAATTTCAACACGCTGGCAAGCGCGGTCAGTCGCTGGTGAACGGTAGATTGCTGC
GAAAGTTTGCTGGTTAAGGCCGTCGCCGCATTGGTGCGCGCGAGTTTCAGATAACGCGCC
CTATCGCCGCGAGGTTTGGTTTGAACATTAATCTTGCGTCCCGCCAGTTCTGAAAGGGAA
TCGGCGAGCAGCGTTTTATCGCTAAGATTAAAATCGAGCAGGATCTCACCCGGTAAGGTG
CGCATCTGGCTGCCTTGTAAATAGAACTGGCCTACGAAGGTTTCTACCACCTCGCTCAGT
TCCGTACCGCCAGGCACTTTCGGGAAATAGCTGCGGCTGCCGAGCACTTTGCCCTGACGA
ATGAACAATACGTGGACACAAGCCATGCCCGCATCGAACGCCACACCAATAACGTCGAGG
TCGTCGCCGGTATTGGAAACGAATTGTTTTTCGGTGACGCGTCGCACCGCCTGAATTTGG
TCGCGAATACGTGCAGCTTCTTCAAACTCCAGATTCTGGCTGGCAGTTTCCATACGACTA
ATGAGTTGCGTAAGCACCTGATCATCTTTGCCAGACAAAAACAGGCGCACATACTCGACC
TGCTGAGCGTATTCTTCTTCACTCACCAGTCCTTCAACGCACGGTCCCAGACAGCGCCCT
ATCTGGTATTGCAGACACGGACGCGAGCGATTGCGATAAACACTATTTTCGCACTGGCGA
ATGGGGAAAATCTTTTGCAGTAGCGCCAGTGTTTCACGTACGGCATAGCCATTCGGGAAC
GGGCCGAAATATTCACCTTTGGCATGCTTCGCACCACGATGCATCGCCAGACGCGGGTGG
GTATCACCACTCAGGAAGATAAAAGGATATGATTTATCATCGCGTAGCAAAACGTTGTAA
CGCGGCTGATAGAGTTTGATGTAGTTGTGTTCCAGCAACAGCGCTTCGGTTTCTGTGTGA
GTAACCGTTACATCAATTTGCTGGATCTGGGCGACCAGCGCTTCGGTTTTGCGCGAAGCG
AGGTTGCTACGGAAATAGCTGGAAAGCCGTTTTTTCAGGTCTTTCGCTTTGCCGACATAG
ATAACCGTACCACCAGCATCGTACATGCGATAAACGCCTGGCTGGCTGGTTACGGTTTTT
AAAAACGCTTTTGCGTCAAACTGATCACTCACTGACTTGATAATGTCTCCGCATTACACA
GACCATGGCGAATTGCCAGGTGAGTCAGCTCAACATCGCCATGAATGTTTAGTTTACTGA
ACATACGATAGCGGTAGCTGTTCACCGTTTTCGGACTGAGATTGAGCTGTTCTGAGATCT
CATTGACCTTCTGGCCCTTGGTGATCATCAGCATAATCTGCAATTCACGTTCAGACAAAC
TGGCAAATGGGCTTTCTGTTTTTTCTGGTTCGATCTGGCTTAACGCCATTTGTTGAGCGA
TGTCAGAAGCAATGTAACGCTGCCCTGAATAGACAGAACGAATCGCACTCACGACTTCCT
GCGGAGCCGCGCCTTTGCTGAGGTAGCCCGCAGCACCGGCCTGCATGACTTTCGCTGGTA
AAGGGTTTTCTGTATGGACGGTAAGCATGATGATTTTGACATCAGCTGTGGAACGCGCGA
TTTTACGCGTCGCCTCAAGACCGCCAATGCCCGGCATACTCATGTCCATTAGCACCACGT
CAACGGCATTTGTCCGGCACCACTTAACGGCGTCTTCACCGCACGATGCCTCACCGACGA
CTTTTATACCCTTTATATCTTCCAGAATGCGTCGTATCCCTGCGCGCACCAGTTCGTGGT
CATCAACAAGTAGAACGTTGATCAAAGGAATATCTCCAGAAATAGGGATAACGCTACTGA
TAGTTAGTCATTCGTATATTAGCGGTTTTTATTGCAACTTTGAAACGTTAAAAATGGTGG
GTATTCGATTTTTCTCTCGTTTTTGTCAATTCGATTGTCCACAGTTATGGTCACGCCCGT
CACCAACGGCTTACCGGATCGTTTCACAGTAAGCCCTACGATGAAATGTGACAAAAATTG
ACTTTATTCAGCAAAAATGAAAATCAGCCCGCTGAATATGTAACATTAATTAACCCGAAC
AATACGGGCAAAAAACATTCATGATAAAAATATTTATTGGTCATTATATTAACGTATTTT
ATAGCACTGCCGATATCACGCTCAAAAAACAACCACTGCTATTTTTAGCAAAGCTTATGG
TATACTCCGCCGCCTTAACATTTTTCACCGCAAATTTTCATTGCAACATGACGAGGAAAA
TAAATGAGTACGCCTGATTTTTCTACTGCCGAGAATAATCAAGAACTGGCAAATGAAGTC
TCCTGCCTGAAAGCGATGCTGACGCTGATGCTGCAGGCGATGGGACAAGCTGACGCGGGC
CGCGTGATGTTAAAGATGGAAAAACAGCTTGCGCTGATCGAAGACGAAACCCAGGCTGCA
GTATTTTCCAAAACGGTTAAGCAAATTAAACAAGCCTACCGTCAGTAATATAAAACCGGC
TGATAGCGTGCCTTTCAGCCGGTTTTTGCATCTGGCACGCAGGACAGAAAAGAGATCAAA
TTAAGCCAGTAGCGGCCGCGTAACAGGCAACCTGGGTCTTATTTGGTGCATTAATTTTTT
TCTGCATGTTTTTCTGGTGGAAATTGACCGTATTCTCAGAGATTGACAAAATCATCGCTA
TCTCTGCTGATGTTTTCCCTTCCGCCGTCCACCTCAGAATTTCTTTTTCGCGCTTGCTGA
AATTCATCTCTGGCGTCATCACTATTTCATCATTTAAACGCATCAGAGCCATCAGACTTT
CGCGCACCAGTAACTGCATTTTTAATTGCAGTTCATCACTAAGAATGGGTATTTCGCGCG
CGCTGCAACGGGAAAAGGACAAAAAGCCCAGCGCCCGGTTTGGCAGCATTAAATACTGAG
TGACACCGCGGCGTAAACCATGTGCGCGCGCGGCTTCCCATAACGGCTGTGCTTCGCTGA
ATAAGTCATCATTCCACATTAAATGGCCCTGACTAAAGTTTTCAGGGTTCAGCACCGGAT
CAATTGCGAGAAAGTTTTTTGCCTGATAATAACTAACCCACGCCTCAGGGTAATTGGTGT
AAAAAGCCACTTTAGGTCGAGTGAATGGTACCGGGTGGCGGACACATAACGAATAGTAAT
CGTACTCCAGCTGCTGAGCCTGAAGCTCAATTTCATGGTAGACCTCTTCTGCGGTCTCCA
TCCTCTGAAAACGCAACAGCATCGTGCGACGCCAGCTGAAAAAATCCTTATCCTGCATAG
TAAACCGCAACGCCCCTGAGAGTGAGTATCATTTATAATGATAATTCAAACTATCACATA
AATAAGATTTATATATAATTTATATTATTCAGGCAATGAATTACTTTTGCAAGCCATCGC
ATTCTCTTATGTTATTAATGAGTTATGCTGATTTGTTAAGCAGTTTTATCAGGCTTGAAA
TGGCGTCCAGCCCCGACAGGTGAATCGTCGGGGCTGATTTTTTCTTATTATTGCAGCAGA
AACTTCTCGAGGAACTGGCGGGTGCGAGGCTGCTCGGGGTCGGCAAATAACGCTTTTGCG
GCCCCCTGCTCGACTATCCGCCCCTGGTCCATAAAGATCGCCCGGTCCGCAACATCCCGG
GCAAAGCTCATTTCGTGCGTCACAATCACCATCGTGCGCTTTTCCTGCGCCAGCTGACGG
ATGGTGTTCAGGACTTCACCCACCAGCTCTGGATCCAGCGCTGACGTTGGCTCGTCAAAC
AAAATCACCTCAGGACGCATTGCCAGCGCACGCGCAATCGCAACACGCTGCTGTTGACCG
CCAGACAAACGACGTGGATAGCTGGTTTCTTTACCTGCCAGCCCAACTTTTGCCAGCAGC
TCGCGAGCGCGCGCCGTGGCCTCTTCTTTCGGTTCACCTTTGACGATCACCGGCCCTTCA
ATAATGTTCTCCAGCACCGTACGATGCGGAAACAAATTAAAGTTCTGGAAGACAAACCCG
ACGTGCTGACGCAACTGGCGAATCAGAGATTTTTGCTGACTTAATGAACGTGCAGTATCA
ATAGTGATATCGCCAACGGTGATCGTTCCCGCTTCGGGTTGTTCCAGCAGATTTATGCTG
CGTAGCAACGTGGTTTTGCCGGAACCACTCGGACCGATAATTGCCACCACTTCGCCAGGC
TTTACCTCAAGGTCGATACCGTGCAGCACCGTCTGACCGTGGAATTTTTTCACCAGGTTC
TTAACTTCAATGGCACTCATTTTGGTTCTCTCTCCTGGCGATTAAGTTGATTCTCAAAAT
GGTTCTGCAACGTCGATAACACAGTCGCCATGATCCAGTAGATGAGCGAAGCCGCCAGAT
ACATGGTGAACACCTCCAGCGTACGCGAGGTAATCAACTGCGCCTGACGGAACAGCTCCG
GCACCTGGATTGTCGCGGCCAGCGACGTATCTTTTACCAGGCTAATAAAGCTGTTCGACA
GCGGCGGCAACGCCACACGCGCCGCCTGTGGCAAAATCGCGCGACGCATGGTCTGCCACG
GCGTCATACCAATACTGGCTGCCGCTTCCCACTGACCTTTATCAATAGAAGAAATGGCGG
CGCGCAGCGTTTCGGCAGCATAGGCGGCAGTGTTCAACGACAGACCAATCATTGCTGACG
GAATGGGATCTAATTCGATACCAAACTGCGGCAGGCCGTAATAGATCATAAACAGTTGTG
CGATGAGCGGCGTACCACGAAAAATAGAGATATAAAAACGCGCCAGCCAGCGCACGGGCC
AGATTGGCGACAGACGCATCAGCGCGAGAATAAACCCGAGCAGTAAGCCAAAAAACATGC
CGCCGATACTGAGTTGCAGCGTATACCCAGCCCCTTTCAGCAGGAACGGCAAGGAATCAA
TAACCAGTTGTATACTTTCTTGCATGAGCGTTTCCGGAGCTAAACGTGGGGATGATAGGC
GAACAGCGCAGGCGCACCGCCGGTATGAATAAACAGAATCGGCCCTTCATCTTTGAAGCG
TTTCTGACTGATACCGTCAATCAGCCCCGCCATCGCTTTTCCGGTATACACAGGATCAAG
CAGAATGCCTTCCAGCCGCGCCAGCAATTTCACTGCTTCCATGCCTTCGTCGTTCGGCAC
GCCGTAGCCAGGTGCAAAATAGTCATCCCAGAGTAAAATTTCCGCTGATGCGGTCAGCTC
CAGTTCTTTCGCAATCGCCTGTTGTAGGTTAACCACTTTCGGCAATTGATCGGCAACGGA
ACGCGACACGGTCACGCCAATCAGTTCGCTTTCAGGCATCAGGTGTTCCAGCCCAACAGC
CAGTCCGGCGTGAGTTCCGGCACTGCCCGATGCGACTACCACCGATGAAATATTAACCGC
CCCTTCACACTGTTGCGCGATTTCCAGCGCACTCTCCACATAACCTAGCGCGCCAAGAGC
ATTAGAACCGCCAACCGGAATGACATACGGGCGAAAGCCTTGTGCTTCGACTCGCGTCGC
CAGCTCTTCCAGTTGGGCATTGGGATCGGTCAGTGCGTCGCACATTTCAATCTGGGTATT
GAACAGATCCAGCAACAAGCGATTGCCGTTGGTTAAATAGTTTTCTGCGGTTGTGCCAAT
AGGATTTTCCAGCAGCGCCACGCAGTGCAGACCGAGTTTGGCAGCGACTGCGGCAGTCTG
CCGCACATGGTTAGACTGGATCGCCCCGGCAGTAATCAGCGTATCGGCACCTTCACGCAG
AGCATCTGCCGCGAGAAATTCCAGCTTACGTAATTTATTGCCGCCCATTGCCATGGGGGT
GACGTCATCCCGTTTGATGAAAATTTCCCGTCCTAGATAATCAGAAAAGCGCGGCAGATA
TTCGAGCGGCGTTGGCGCGCCGATAAACTCCAGCCGTGGAAAACGGGTTAAATTATGCAG
TGGCATAACAGCCTCCGATGTGTGTTGTTGTGATTTTCTTATTATGCACGCTGAAAACGC
GTAAATAAAAAAGGCGCTAGTGAAAGCGCCCTTTTTTGTCATTATGCTGATTATTTGGTC
ACATCAGCACCAAACCATTTTTCGGAAAGGGCTTGCAGAGTGCCATCTTTTTGCATTTCC
GCAATTGCATCATTCACTGCTTTCAGCAGGTCCTCATTTCCTTTACGCAGCGCCACGCCA
GACTCCTGACGGGAGAATGCTTCACCGGTTACTGCCAGCGTATCGTTGGTTTTCTTCACC
AGATCCAGCGCCGCCAGACGATCAACGAGGATCGCATCGATACGCCCTACGCGCAGATCC
TGATATTTGGTCGGGTCATCATCATAGGTACGCACATCGACGCCCTGAACATTCTGCCGC
AGCCACTCTTCATAGTTGGTGCCCAGACCGACCCCCACTTTTTTGCCTTTCAGATCATCG
GCTGTTTTAATGGTGCCTTCGTTACCTTTTTTCACCAGCGCCTGAATACCAGAAATGGTG
TACGGGGTTGAGAAATCGTATTTTTTCTTGCGCTCATCAGAAATGGTGACCTGATTAATC
ACCACATCAATACGTTTAGAGTCCAGCGACGCCAGCATACCGTCCCATTTGGTCGGTTTT
AGTGACGCCTCAACGCCAAGATGTTTTGCCAGCTGTTGGGCAAATTCCACTTCAAAACCG
GTTAATTTGCCGTCATCTCCCTGAAAACTGAACGGCGGATAAGTTCCTTCCAGCCCTACC
AGCAGCGTGCCGCGCTCTTTAACTTTATTAAGCAGACCTTCATCTGCAAAACTTTTAACG
CTCATGCCCGCAACCAGCGCCACGGCCATCACACCCATCAATGCCTGACGTCCCAGATGT
GCTAATTTCATATTCACCCCGAATGTTGTTATGTCTGTTTGCAGTGTAGAGCCATTGTTT
GTAAACACAAAAACAACTCCGCTACATCTTATTCTTATTTAATATATATCAGAAGAAGGC
AGGCTGGAGGATTTCTGCACAAGTCTGGTACAGGTTTGGCGCTGATAGTGTTGATACTTC
CGTAACGCGATGCGGTAATTGTTGGTGCTGGTGGTGGGCAGCCACGGGGCGAGGATTTCA
TCAAGGAAACCGTCCTGCAGCTGATCGAGGGAAATATTTTGCTCGTGTAGATGATTCCCC
AAACGGCGCAAACGAACGACATATTCACGCACCGTACCTGGGCTCATTTCAGTTTGCTCA
AAAAGAAATTGCTTAAAGCCGATAATATCGAAAAAATCACTCTGCGTTTTGCAATGTAAA
TCACCGCAAAATCGGCACAATGCCGCCCATGATTTTTGTTCCGTTTGCCAGCCATTTTCA
TCAAGCAGCGTGTCCAGGCGGGAAATCTCGATTTTATTCACTATTTTGCCGTCGCGAACT
AAGGTAATGCGATCGAGTAATTTACGGCAATGCGCGCAATGGGTCTGGCTGTGTTTAAAG
TCTTTAAGATAGCGGCTTAATGGCCGTCTTTTCAGGTGCTGCACCATCATTAAGAACTCC
TGGTAGTCAAAGTTAAAGTGCGGCATTTACTGACGTTATAACTTACCCAGTTTAGTGCGT
AACCGTTTAATAGCCTGGCTGTGTAACTGACTGACCCGCGATTCCCCGACCTCCAGCACC
GCGCCAATCTCTTTGAGATTCAGCTCTTCCTGGTAATAGAGGGTTAATACCAGTTTTTCG
CGCTCCGGCAACGTTTCGATGGCTTCCATCACCCGCTGGCGCAGATTACTGTCCAGTAGT
TGTTGTAGCGGGTTTTCTCGCTGATGATCATCAGTAACCAGTTCGATGCTATCGCCGTGC
TCTTCGCGCCACTCATCGTAGGAGAAGAGCTGGCTGTTATTGGTGTCGAGCAACATTTGG
CGATAATCGGCAATATCGATCCCTAAACGTTCCGCTACCTCAGTTTCCGTGGCGTTGCGG
CCAAGTTCCTGCTCCAGTTGCCCTATTGCCTGTGCCACTTCACGCGCGTTGCGTCGCACG
CTGCGCGGCACCCAGTCACGGCTGCGAAGTTCATCCAGCATAGCGCCACGGATACGCTGC
ACTGCGTAAGTTGTAAATGCCGTTCCTTGTAGGGCGTCATAGCGTTCGACGGCATTAAGT
AACCCAATGCCGCCCGCCTGTAGCAGATCGTCAAGTTCCACGCTCGCGGGCAGTCGAACC
TGCAGGCGCAATGCTTCGTGACGCACCAGCGGGACATAACGCTGCCACAGCGAGTGTTTA
TCCATTACACCTTCAGCGGTATAGAGTGAATTCACGATAAACAGCCCTGCGTTATATGAG
TTATCGGCATGATTATCCGTTTCTGCAGGGTTTTTAATCGGACGATTAGTGGGTGAAATG
AGGGGTTATTTGGGGGTTACAGGTAAATTCCAGGCAGAAAAAAACCCCGCCGGTGGCGGG
GAAGCACGTTGCTGACAAATTGCGCTTTATGTTGCCGGATGCGGCGTAAACGCCTTATCC
GGCCTACAAAAATGTGCAAATTCAATAAATTGCAATTCAACTTGTAGGCCTGATAAGCGC
AGCGCATCAGGCAATTTGGCGTTGCCGTCAGTCTCAGTTAATCAGGTTACAACGATTAAC
CCTGCAGCAGAGACAGAACCTGCTGCGGTACCTGGTTAGCTTTTGCCAACACGGAGTTAC
CGGCCTGCTGGATGATCTGCGCTTTCGACATATTGGACACTTCGGTCGCATAGTCGGCGT
CCTGAATACGGGACTGCGCTTCAGACAGGTTGGTAGTGGTGTTGTTCAGGTTGGTAACCG
CGGAATCCAGACGGTTTTGCACCGCACCGAGGGAAGAACGGAATTTGTCTACAGATGCGA
TAGCATCGTCCAGCGCTTTCAGCGGATCCGTGGTTTTACCATTTGCAACAGCAGTCAGAG
CCTCACCACCAGCAGTCAAACCTGTTTGCAGATTACCGCCATTTAAATCGGCAGAATCGT
ATGTTTTACCATCAATATCGACCACTTCTGTTTTGCCATCATCTCCGCCCAGTTTGACCG
CGGTTGGAGAACTGGCGGCACCGGAAGAGTCAGTATAGGTAATAGTTTTAACAGAAACAG
CACCAGTAGTTTCATTCACATCCGCAGCGTAAAGATTGCCATTTGTATCTTTAAGCGCAT
ATGTATCGGTATCATTACCCTTGGAATCCTGCAGTTTTACTAAGCTAACAGCACCAAGGT
TGGCAGTTGCGGAACCTGCAGTATTATCAATCTGAACAGGTGTACCGCCTGAAGTGATAG
TTGTAGCTTTAGTAGTATTTGCATCAGTTACAGTTGCATTTGCCGTTGCTCCAGTCGCCA
TTGTCACTGTACCATCATTAGCAACTGTTACTGCGTAATACTTCCCATCGTTATCACCAC
CGGTGATTTTCGCATAGTAATCATTACCATTATCAGTATAAACACCCTCAATTGAAGCTG
GGTTAGTTCCGCCAGTATCAGTGGCTGCTTCCGTAGAAAGGGTAATTCCAGTAAGTTTAA
TATTGTTTGTGGTGGTAGCACCAAAAGCAGTTACTGGAGCACTAGTGGTAACTGTATCGT
TATTTTTAACGCTAAAACCATCAAGGCCAAGAGTTTTAGCATCAATCTGCTTCAGATCGA
TAGTGATAGTCTGGTTATCATTTGCGCCAACCTGGATTTTCATGGAGCCATTTTTTGCCA
GCACGTTCACGCCGTTGAACTGGGTCTGACCAGATACGCGGTCAATTTCATCCAGACGGG
ATTTAATTTCGTCCTGGATAGAAGACAGATCAGACTCAGAGTTAGTACCGGTAGTGGCCT
GTACCGTCAGTTCACGCACACGCTGTAAGTTGTTGTTGATTTCGGACAGCGCGCCTTCGG
TGGTCTGCGCAACGGAGATACCGTCGTTGGCGTTACGGGCCGCCTGAGTCAGGCCTTTAA
TGTTAGAGGTGAAACGGTTAGCAATCGCCTGACCCGCTGCGTCATCCTTCGCGCTGTTAA
TACGCAAGCCAGAAGACAGACGCTCGATAGAACTCGACAGCGCAGACTGGTTCTTGTTGA
TATTATTTTGAGTGATCAGCGAGAGGCTGTTGGTATTAATGACTTGTGCCATGATTCGTT
ATCCTATATTGCAAGTCGTTGATTACGTATTGGGTTTCCACCCGTCGGCTCAATCGCCGT
CAACCCTGTTATCGTCTGTCGTAAAACAACCTTTAGAATTTTTTTCAAAAACAGCCATTT
TTTGTTAGTCGCCGAAATACTCTTTTCTCTGCCCCTTATTCCCGCTATTAAAAAAAACAA
TTAAACGTAAACTTTGCGCAATTCAGACCGATAACCCCGGTATTCGTTTTACGTGTCGAA
AGATAAAAGGAAATCGCATGGCAAGTATTTCATCGCTGGGAGTCGGGTCAGGTCTGGATT
TAAGTTCCATCCTTGATAGCCTCACCGCCGCGCAAAAAGCGACGCTAACCCCCATTTCAA
ATCAGCAATCGTCGTTTACCGCTAAACTTAGCGCCTACGGTACGCTGAAAAGCGCGCTGA
CGACTTTCCAGACCGCCAATACTGCATTGTCTAAAGCCGATCTTTTTTCCGCCACCAGCA
CCACCAGCAGCACCACCGCGTTCAGTGCCACCACTGCGGGTAACGCCATCGCCGGGAAAT
ACACCATCAGCGTCACCCATCTGGCGCAGGCGCAAACCCTGACCACGCGCACCACCAGAG
ACGATACGAAAACGGCGATCGCCACCAGCGACAGTAAACTCACCATTCAACAAGGCGGCG
ACAAAGATCCGATTACCATTGATATCAGCGCGGCTAACTCATCGTTAAGCGGGATCCGTG
ATGCCATCAACAACGCAAAAGCAGGCGTAAGCGCAAGCATCATTAACGTGGGTAACGGTG
AATATCGTCTGTCAGTCACATCAAATGACACCGGCCTTGATAATGCGATGACACTCTCGG
TCAGCGGTGATGATGCGCTACAAAGTTTTATGGGCTATGACGCCAGTGCCAGCAGCAACG
GTATGGAGGTCTCGGTTGCCGCCCAGAATGCGCAGCTGACAGTCAACAACGTCGCCATCG
AGAACAGCAGCAACACCATCAGCGACGCGCTGGAAAACATCACCCTGAACCTGAACGATG
TCACCACGGGCAACCAGACGCTAACCATCACTCAGGACACCTCCAAAGCGCAAACGGCGA
TTAAAGACTGGGTGAATGCCTACAACTCGCTAATAGATACCTTCAGCAGCCTGACCAAAT
ACACCGCCGTAGATGCGGGAGCTGATAGCCAGAGTTCTAGCAATGGTGCACTGCTCGGCG
ACTCCACGCTGCGGACGATTCAGACGCAGTTGAAATCGATGCTGAGTAATACCGTCAGTT
CTTCCAGCTATAAAACGTTGGCGCAGATTGGTATCACGACCGATCCCAGCGATGGCAAAC
TGGAACTGGATGCCGACAAACTCACCGCTGCACTGAAAAAAGATGCCAGCGGCGTAGGTG
CATTGATTGTTGGCGATGGTAAAAAAACCGGCATCACGACCACCATCGGCAGCAACCTGA
CCAGTTGGCTTTCGACAACGGGCATTATTAAAGCCGCTACCGATGGCGTTAGTAAGACCC
TGAATAAATTAACTAAAGACTACAACGCCGCCAGCGATCGCATTGATGCGCAGGTCGCTC
GCTACAAAGAACAATTTACCCAACTGGACGTTTTAATGACCTCGTTAAACAGCACCAGCA
GCTACTTAACGCAGCAGTTCGAAAACAACAGTAATTCCAAGTAAGCAATATTCATCGGGA
GACAGGTCATGTACGCGGCAAAAGGCACCCAGGCCTATGCACAAATTGGCGTCGAAAGCG
CCGTAATGAGCGCCAGCCAGCAGCAGCTGGTCACCATGCTATTTGATGGAGTGCTGAGCG
CACTGGTTAGAGCGAGCCTGTTTATGCAGGACAACAATCAGCAAGGCAAAGGCGTCTCTT
TGTCAAAAGCGATCAACATCATTGAGAACGGACTGCGGGTGAGTCTTGATGAAGAGAGCA
AAGACGAACTAACCCAAAACTTGATTGCTCTTTATAGCTATATGGTCAGGCGCTTGCTGC
AAGCCAATTTACGCAACGATGTCTCCGCAGTCGAAGAAGTGGAAGCATTAATGCGCAATA
TTGCCGATGCCTGGAAAGAGTCGTTACTCTCCCCTTCTTTGATTCAGGACCCAGTCTGAT
GAACCATGCACCGCATTTATATTTCGCCTGGCAACAACTCGTCGAAAAAAGCCAGCTCAT
GTTACGCCTGGCAACGGAAGAACAATGGGACGAACTCATCGCCAGCGAAATGGCGTATGT
GAATGCGGTGCAGGAGATTGCACATTTGACTGAAGAGGTTGACCCGTCCACCACGATGCA
GGAGCAGCTCCGCCCGATGCTGCGCCTGATTCTCGACAACGAAAGCAAGGTAAAGCAGTT
ATTACAGATTCGGATGGATGAACTGGCGAAACTGGTCGGTCAGTCATCGGTGCAAAAATC
GGTGTTAAGTGCCTATGGCGATCAGGGCGGCTTTGTGCTGGCTCCGCAGGATAACCTCTT
TTGAATCTGAATGAGTCGATGGCTCGCGAATAATCCGATTACGGCTACGCTTCTAATGTT
CCCCTTGAATGGAGTCGAAGAATGCGTAATCCCACGCTGTTACAATGTTTTCACTGGTAT
TACCCGGAAGGCGGTAAGCTCTGGCCTGAACTGGCCGAGCGCGCCGACGGTTTTAATGAT
ATTGGTATCAATATGGTCTGGTTGCCGCCCGCCTATAAAGGCGCATCGGGCGGGTATTCG
GTCGGCTACGACTCCTATGATTTATTTGATTTAGGCGAGTTTGATCAGAAAGGCAGCATC
CCTACTAAATATGGCGATAAAGCACAACTGCTGGCCGCCATTGATGCTCTGAAACGTAAT
GACATTGCGGTGCTGTTGGATGTGGTAGTCAACCACAAAATGGGCGCGGATGAAAAAGAA
GCTATTCGCGTGCAGCGTGTAAATGCTGATGACCGTACGCAAATTGACGAAGAAATCATT
GAGTGTGAAGGCTGGACGCGTTACACCTTCCCCGCCCGTGCCGGGCAATACTCGCAGTTT
ATCTGGGATTTCAAATGTTTTAGCGGTATCGACCATATCGAAAACCCTGACGAAGATGGC
ATTTTTAAAATTGTTAACGACTACACCGGCGAAGGCTGGAACGATCAGGTTGATGATGAA
TTAGGTAATTTCGATTATCTGATGGGCGAGAATATCGATTTTCGCAATCATGCCGTGACG
GAAGAGATTAAATACTGGGCGCGCTGGGTGATGGAACAAACGCAATGCGACGGTTTTCGT
CTTGATGCGGTCAAACATATTCCAGCCTGGTTTTATAAAGAGTGGATCGAACACGTACAG
GAAGTTGCGCCAAAGCCGCTGTTTATTGTGGCGGAGTACTGGTCGCATGAAGTTGATAAG
CTGCAAACGTATATTGATCAGGTGGAAGGCAAAACCATGCTGTTTGATGCGCCGCTGCAG
ATGAAATTCCATGAAGCATCGCGCATGGGGCGCGACTACGACATGACGCAGATTTTCACG
GGTACATTAGTGGAAGCCGATCCTTTCCACGCCGTGACGCTCGTTGCCAATCACGACACC
CAACCGTTGCAAGCCCTCGAAGCGCCGGTCGAACCGTGGTTTAAACCGCTGGCGTATGCC
TTAATTTTGTTGCGGGAAAATGGCGTTCCTTCGGTATTCTATCCGGACCTCTACGGTGCG
CATTACGAAGATGTCGGTGGTGACGGGCAAACCTATCCGATAGATATGCCAATAATCGAA
CAGCTTGATGAGTTAATTCTCGCCCGTCAGCGTTTCGCCCACGGTGTACAGACGTTATTT
TTCGACCATCCGAACTGCATTGCCTTTAGCCGCAGTGGCACCGACGAATTTCCCGGCTGC
GTGGTGGTCATGTCGAACGGGGATGATGGCGAAAAAACCATTCATCTGGGAGAGAATTAC
GGCAATAAAACCTGGCGTGATTTTCTGGGGAACCGGCAAGAGAGAGTAGTGACCGACGAA
AACGGCGAAGCAACCTTCTTTTGCAACGGCGGCAGCGTCAGCGTGTGGGTTATCGAAGAG
GTGATTTAAATTCATCCCCGGCGGCAAGCCGGGGAGATTTCATTACGGCAGTGGCGTCGG
TAACGGCGCTTTATCCAGCGCGGCGGCACACTCTGCTGTCGGGCGATCCACACGCTCCAT
CGTCATACCATCGTACTCAATGGTGTTACCGTCACGCTCAACCTCGTACAGCTCACGTTT
TACGGTAACGTTAGTGAGATCATCAGACATCAATGTCAACTTACCCGGCACGGCAATCAC
CCGCTGCCACTGACGGCAATCCAGGGTATCGCCCTCTTTAGTGACAATCAGGCTGCCTAT
CGCTTCCGGGCTGACCAGCGCACGTTGCGGCCCTTTGGTCTGCCAGTAGCCCGCCAGCCA
GTCCGGCGCGGGGGTTTTCACGACATTGTTATAGTTTTCGACTTCGGCACAGCCCGCCAG
CAACAAGAGCGCGCCTGCAATTGCGAGTTTTTTCATCATTCGTCCTGCATGAGAAGAAAA
GAGGATTGTGGCATTAAAGCCCTGATGTCGCCAGCCTTTCAAGGTTCAGAGAGAAATTTG
ATCTAACTATTATTTTTGTGAATTATTACCCCGAAAATAAATTTGCATGGTGTATGATTC
GCGACTCTTGTTTCAAACCTTCTGAGTTCAGAGGCTACATTCATGTCATGGCAGCAATTC
AAACACGCCTGGTTGATTAAATTCTGGGCCCCCATCCCTGCGGTCATCGCGGCGGGTATT
CTCTCTACTTACTATTTTGGCATTACTGGCACCTTTTGGGCTGTCACGGGTGAATTTACC
CGTTGGGGCGGCCAGCTCCTGCAACTGTTCGGCGTCCATGCTGAAGAGTGGGGTTACTTT
AAAATTATCCATCTGGAAGGATCGCCATTAACCCGCATCGACGGGATGATGATCCTCGGT
ATGTTTGGCGGCTGCTTTGCCGCAGCGCTGTGGGCCAACAATGTCAAACTGCGAATGCCG
CGCAGCCGTATCCGCATTATGCAGGCCATCATTGGCGGCATTATCGCCGGTTTTGGCGCG
CGTCTGGCAATGGGCTGTAACCTGGCGGCGTTCTTTACCGGTATTCCTCAGTTCTCGCTG
CATGCCTGGTTCTTTGCCATCGCCACTGCCATTGGTTCATGGTTTGGCGCGCGCTTTACC
CTGCTGCCCATCTTCCGTATTCCCGTGAAAATGCAGAAAGTTTCTGCCGCCTCACCGCTG
ACGCAAAAACCGGATCAGGCGCGGCGTCGTTTTCGTCTCGGGATGCTGGTCTTTTTCGGC
ATGCTGGGCTGGGCGCTGCTCACAGCGATGAACCAACCCAAACTGGGGCTGGCAATGCTG
TTTGGCGTCGGCTTTGGTTTACTGATTGAACGTGCGCAAATCTGCTTTACTTCAGCGTTC
CGCGATATGTGGATCACCGGACGTACCCATATGGCGAAAGCAATCATTATCGGTATGGCG
GTGAGTGCCATCGGGATCTTCAGTTACGTACAGTTAGGCGTTGAACCCAAAATCATGTGG
GCGGGACCAAACGCGGTAATTGGTGGTTTACTGTTTGGTTTTGGCATCGTGCTGGCTGGC
GGCTGCGAAACCGGCTGGATGTACCGCGCGGTAGAAGGCCAGGTGCACTACTGGTGGGTC
GGTCTGGGCAATGTGATCGGCTCAACGATTCTGGCGTATTACTGGGATGATTTCGCTCCG
GCGCTGGCCACCGACTGGGACAAAATCAACCTGCTGAAAACCTTTGGTCCGATGGGTGGC
CTGCTGGTGACATATTTGCTGTTGTTTGCTGCGCTGATGTTGATTATCGGCTGGGAAAAA
CGCTTCTTCCGCCGTGCGGCACCGCAGACTGCTAAGGAGATCGCATGAAAAATATCGTTC
CTGATTACCGCCTTGATATGGTGGGTGAACCCTGCCCTTATCCGGCAGTCGCAACCCTTG
AGGCGATGCCGCAGTTAAAAAAAGGGGAAATCCTGGAAGTGGTGAGCGACTGTCCGCAGT
CGATCAATAATATTCCACTGGATGCGCGTAATCACGGCTATACGGTGCTGGATATTCAGC
AAGACGGGCCGACCATTCGTTATTTAATTCAGAAGTAATCCCTCATTCCCGCTGTGACCC
ACAGCGGGAACATCGTTACCTTTGTATCACATAGATTTTACCCGCCCCCACTCCTATTCT
TTTCAGTATGATCTCAGGAGGTTTCTATGTGTGGACGCTTTGCCCAATCCCAAACGCGTG
AAGATTACCTTGCGCTTCTCGCGGAAGATATTGAACGCGATATTCCCTATGATCCCGAAC
CCATTGGCAGATACAACGTCGCGCCGGGAACCAAAGTCCTACTGCTCAGTGAACGTGATG
AACACCTTCATCTGGATCCGGTTTTCTGGGGATATGCTCCCGGATGGTGGGATAAACCGC
CGCTGATTAACGCCCGCGTAGAAACTGCGGCAACCAGTCGTATGTTTAAACCGCTCTGGC
AACATGGTCGGGCAATCTGTTTTGCCGATGGCTGGTTTGAGTGGAAAAAAGAAGGCGACA
AAAAACAGCCTTTTTTTATCTATCGTGCTGATGGACAACCTATTTTTATGGCCGCGATAG
GTAGCACACCATTTGAGCGTGGTGACGAAGCCGAAGGATTTTTGATCGTCACTGCTGCGG
CAGATCAAGGTCTGGTAGATATTCATGACCGCCGCCCACTGGTACTGTCGCCAGAAGCTG
CGCGGGAATGGATGCGGCAAGAGATTAGCGGTAAAGAAGCCTCAGAAATCGCGGCCAGTG
GCTGTGTTCCAGCAAACCAGTTCTCCTGGCACCCGGTATCGCGCGCGGTGGGTAATGTTA
AAAACCAGGGCGCGGAGTTAATTCAACCTGTTTGATAAGCCTGGAGATTATTGATCAACA
ATACTGCGTCATAAGAAATCTCTATTAGACAAAGATTTCATTACCTGTTGGCATATTGCA
AAAATAACACCAATACGGAATCGTCATGTTCACGATTAAAACAGATGATCTCACCCATCC
AGCAGTGCAAGCATTAGTGGCTTACCATATTTCCGGCATGCTGCAGCAGTCTCCCCCCGA
AAGCAGTCATGCTTTAGATGTGCAAAAATTACGTAACCCGACAGTGACATTCTGGTCAGT
ATGGGAAGGCGAACAACTCGCAGGAATTGGTGCGCTGAAGTTGCTGGATGATAAACACGG
CGAGCTGAAATCAATGCGTACCGCGCCAAATTATTTACGTCGTGGTGTCGCCAGTCTGAT
TTTACGCCACATTTTGCAGGTCGCCCAGGACAGATGCCTTCATCGCCTGAGCTTAGAAAC
GGGTACACAGGCTGGATTTACGGCCTGCCATCAACTTTATTTGAAGCATGGTTTCGCTGA
TTGCGAACCGTTTGCTGATTATCGACTTGATCCACACAGTCGATTTTTATCATTGACGCT
ATGCGAAAATAATGAATTGCCATGAGCCAGACGCAGCACATTCTTGCATTCGACGTGCTG
CGCCTTTATTTATCACCAGCAGGAAACGCCTTGTCCATAGACGCCCCTTCCACATGCGCC
ACAAGAAACCTCTATTCCAGTGACACAATTGCGCCTAATTAATTACATTTAATATTTAAT
TATGAGTTCCTCACCATCTATTACATACTTTTTAACCATATCGGAATATTTATCATAATC
AGCGGGATTCGTAACAATATATTTTCGCTGCGATCTTTCATAGCAAATCCCTGTCAAAGT
CCATGATATAAAAATGTCTCTTCAAAAGAATTACATTCTTTAAAAAGTAATTCTTTATTG
CTATATATCGCAGAGACAACCTCAATATCACACTCCATACGTGCTTTCTCCAGATGATTT
GGGAAGTATTGAATTTCTTTTATCTTATTATCGCCACAATTAAACAGCTTAGTAGTCTCA
GGCATTGCTGGTATTTACCATATTTTATTGCGATAAATAGAAATTGTCATAGCCTTTGAC
GGAGATGAGTCAACACGCGATATCAGATTATTATCTACGGAGACCTGGGTAATTCCATCG
GATACTTTTGGAAATACCATATAATTATTGAAATCGAGCTCTAATTCTTTGCAGAATTTG
GGAATTTGTATTGTGGCAAGGCCATTATGACGAAGATAAAGCACCTCAATCCAGGATGGA
AGAGGTGGCAAAGACCCCAAGTGAAGATCTGTTAAGTCAAGTTTACTATTGTGGAGTTCA
ACACATTTAAACAATCTCACCAATGCTATATCCACATTTTTTTTGAAGTCATTCGATGCG
CCTTCTTTTACTGAATTAGCCCAGTCGCTGAAACCTTTGCAAAGTCTGGAATCTGTAATT
TTCGTAAAGTTGTCTAGAAACTCTGCAATATTAGTCGATATAAACTCTAATTTATGCCGA
ATGGGTGGGTTACCAGTTCCCTGATTTTTTCTATCATGATAAAACCTATCTTATTATAAA
TCGAGAAATCTTGAAACCAGAGACTATAATCACCCCATTCGAAATATTCTGAGTGCAATA
ACTTAAATTCTGACAGCATATTAAATAATTTGCTGTCTTCACTAATTGGTGTAAACTTAC
CATTTCCAAGACAACTGACTAACTCACTTGATAATTCATTTATGATTGCATCATCAGATA
CTAACTCATGTTGTTTTATCGTAGATTCAGTATTAGATGTGACTTTATTTAATTGAACCG
GCTGAGTTTTTAACGAAAGATCATTTAATGGAAACATTTACACTCCTGTTTAATAAATTA
TATTGCCCAGGGCGCATTCTAAAACACAATAAAATTACCACTATCAAAAATCGCTCATAT
CCATCGCCCGGAATATGAATAAAAACATCAACAAAGATTAAATTATCCAGAGGTTACTGT
TGCGTCTGTGGTCGTAACAACATCCGACGTGGTGATGTGTCAAATGAGACGCTCTGATGT
TCAGGGGGGTTATCGCGTATACGGATCGTGGATGGCAGAAAACGTTCAGGATCAGGTATC
CATTTTAAACCAGAAATTGAGTGAGTTTGCCCCATCCATGCCCCACGCGGTGAGATCGGA
TGTAATTAACAACAGGTTACAAAACCTACACCTGCATGCTCATCACTTCCTGATACGCCG
CCACCAGCTTATTACGCACCTGAATCCCCATTTGCATAGAAACTGAGGCTTTTTGCATAT
CGGTCATCACATCGTTTAACGCCACGCCGGGTTCACCGAGAGTGAATTTTTCTGCCTGCG
TGCGGGCAGCTGTTTGTGTATCACTAATGCGATCGAGCGCGGCGTGCAGCTGCCCGGCAA
AACTAATGGTCGGTTGCGGCAGTGATTCCTGCGCACGCGCACTCATCGCCGTAGCCTGTA
ACTGGCTGATAACCCCTTCAATCCCCTGTATCGCTGACATTCTCGTCTCCCGGATAATTT
CTGGTAGCAAAGCCTACCAGTAAGTCAATAAGACAAAGGCGCTAAATAGCAACAAAAAAA
CGGGTTTATTGGCGGATAGAAAAAAACGAAAGCACAAATAATGGGAGCGTCAATTTTTCG
AGTTTGCTGACCCGGGAGTGAGTCTTGTTCCACTTTGCCAATAACGCCGTCCATAATCAG
CCACGAGGTGCGCGATGAATGCGACTGCAGCCCAGACAAAATCTCTTGAGTGGCTTAATC
GCCTGCGTGCGAATCCGAAAATTCCATTGATTGTTGCCGGTTCCGCGGCAGTGGCGGTCA
TGGTCGCACTGATCCTGTGGGCGAAAGCCCCCGACTACCGCACATTATTCAGCAATCTTT
CCGATCAGGATGGTGGCGCAATTGTCAGCCAACTGACGCAAATGAATATTCCTTACCGCT
TCAGCGAAGCCAGCGGCGCTATTGAAGTTCCGGCAGATAAAGTTCACGAACTGCGTCTGC
GCCTGGCACAACAAGGTTTGCCAAAAGGCGGCGCGGTCGGTTTCGAACTGCTTGATCAGG
AAAAGTTTGGTATCAGCCAGTTCAGCGAACAGGTGAATTATCAGCGGGCGCTGGAAGGCG
AGCTTTCTCGTACCATCGAAACTATCGGCCCGGTAAAAGGGGCGCGCGTACATCTGGCAA
TGCCGAAACCGTCTTTATTCGTCCGTGAACAAAAATCCCCTTCTGCATCGGTGACGGTAA
ATCTGTTACCCGGCCGCGCACTCGATGAAGGGCAAATTAGCGCCATTGTGCATCTGGTTT
CCAGCGCCGTTGCTGGTCTGCCGCCGGGAAACGTCACGCTGGTGGATCAGGGCGGACATC
TGTTAACCCAGTCCAATACCAGCGGGCGCGATCTTAATGACGCTCAGTTGAAATATGCCA
GCGATGTCGAAGGCCGTATTCAGCGGCGTATTGAAGCGATCCTGTCGCCTATTGTTGGTA
ACGGTAATATTCACGCCCAGGTTACGGCGCAGCTGGACTTCGCCAGTAAAGAACAAACGG
AAGAACAGTATCGCCCTAACGGTGATGAATCTCATGCGGCGCTTCGTTCACGCCAGCTTA
ATGAGAGCGAGCAAAGCGGTTCCGGTTATCCGGGCGGCGTACCGGGGGCGTTGTCGAATC
AACCGGCACCTGCGAATAACGCGCCAATCAGCACGCCTCCGGCAAATCAAAATAACCGCC
AGCAGCAGGCGAGCACCACCAGCAATAGTGGGCCGCGTAGCACACAGCGGAATGAAACCA
GTAACTACGAAGTCGATCGCACCATTCGTCATACCAAAATGAACGTGGGCGATGTGCAAC
GTCTGTCAGTCGCGGTCGTGGTGAATTACAAAACCTTGCCAGATGGCAAACCGTTGCCTC
TCAGCAACGAACAGATGAAGCAAATTGAAGATCTGACCCGCGAGGCGATGGGCTTTTCTG
AAAAACGCGGTGACTCGCTCAATGTCGTTAACTCGCCGTTCAATAGCAGTGACGAAAGCG
GCGGAGAACTGCCATTCTGGCAACAGCAAGCGTTTATCGATCAGTTACTTGCTGCCGGTC
GCTGGTTGCTGGTACTGCTGGTGGCGTGGCTGCTGTGGCGGAAAGCGGTACGTCCGCAGC
TAACACGTCGCGCTGAGGCGATGAAAGCTGTACAGCAACAGGCGCAGGCCCGCGAGGAAG
TGGAAGATGCGGTGGAAGTCCGCCTGAGCAAAGACGAACAACTACAACAACGGCGCGCTA
ACCAACGTCTGGGGGCAGAAGTCATGAGCCAGCGTATCCGTGAAATGTCTGATAACGATC
CGCGCGTGGTGGCGCTGGTCATTCGCCAGTGGATAAATAACGATCATGAGTAACCTGACA
GGCACCGATAAAAGCGTCATCCTGCTGATGACCATTGGCGAAGACCGGGCGGCAGAGGTG
TTCAAGCACCTCTCCCAGCGTGAAGTACAAACCCTGAGCGCTGCAATGGCGAACGTCACG
CAGATCTCCAACAAGCAGCTAACCGATGTGCTGGCGGAGTTTGAGCAAGAAGCTGAACAG
TTTGCCGCACTGAATATCAACGCCAACGATTATCTGCGCTCGGTATTGGTCAAAGCTCTG
GGTGAAGAACGTGCCGCCAGCCTGCTGGAAGATATTCTCGAAACTCGCGATACCGCCAGC
GGTATTGAAACGCTCAACTTTATGGAGCCACAGAGCGCCGCCGATCTGATTCGCGATGAG
CATCCGCAAATTATCGCCACCATTCTGGTGCATCTGAAGCGCGCCCAAGCCGCCGATATT
CTGGCGTTGTTCGATGAACGTCTGCGCCACGACGTGATGTTGCGTATCGCCACCTTTGGC
GGCGTGCAGCCAGCCGCGCTGGCGGAGCTGACCGAAGTACTGAATGGCTTGCTCGACGGT
CAGAATCTCAAGCGCAGCAAAATGGGCGGCGTGAGAACGGCAGCCGAAATTATCAACCTG
ATGAAAACTCAGCAGGAAGAAGCCGTTATTACCGCCGTGCGTGAATTCGACGGCGAGCTG
GCGCAGAAAATCATCGACGAGATGTTCCTGTTCGAGAATCTGGTGGATGTCGACGATCGC
AGCATTCAGCGTCTGTTGCAGGAAGTGGATTCCGAATCGCTGTTGATCGCGCTGAAAGGA
GCCGAGCAGCCACTGCGCGAGAAATTCTTGCGCAATATGTCGCAGCGTGCCGCCGATATT
CTGCGCGACGATCTCGCCAACCGTGGTCCGGTGCGTCTGTCGCAGGTGGAAAACGAACAG
AAAGCGATTCTGCTGATTGTGCGCCGCCTTGCCGAAACTGGCGAGATGGTAATTGGCAGC
GGCGAGGATACCTATGTCTGATAATCTGCCGTGGAAAACCTGGACGCCGGACGATCTCGC
GCCACCACAGGCAGAGTTTGTGCCCATAGTCGAGCCGGAAGAAACCATCATTGAAGAGGC
TGAACCCAGCCTTGAGCAGCAACTGGCGCAACTGCAAATGCAGGCCCATGAGCAAGGTTA
TCAGGCGGGTATTGCCGAAGGTCGCCAGCAAGGTCATAAGCAGGGCTATCAGGAAGGACT
GGCCCAGGGGCTGGAGCAAGGTCTGGCAGAGGCGAAGTCTCAACAAGCGCCAATTCATGC
CCGGATGCAGCAACTGGTCAGCGAATTTCAAACTACCCTTGATGCACTTGATAGTGTGAT
AGCGTCGCGCCTGATGCAGATGGCGCTGGAGGCGGCACGTCAGGTCATCGGTCAGACGCC
AACGGTGGATAACTCGGCACTGATCAAACAGATCCAACAGTTGTTGCAGCAAGAACCGTT
ATTCAGCGGTAAACCACAGCTGCGCGTGCACCCGGATGATCTGCAACGTGTGGATGATAT
GCTCGGCGCTACCTTAAGTTTGCATGGCTGGCGCTTGCGGGGCGATCCCACCCTCCATCC
TGGCGGCTGTAAAGTCTCCGCCGATGAAGGCGATCTCGACGCCAGTGTCGCCACTCGCTG
GCAAGAACTCTGCCGTCTGGCAGCACCAGGAGTGGTGTAATGACCACGCGCCTGACTCGC
TGGCTAACCACGCTGGATAACTTTGAAGCCAAAATGGCGCAGTTGCCTGCGGTACGTCGC
TACGGGCGATTAACCCGCGCTACCGGGCTGGTGCTGGAAGCCACCGGATTACAATTGCCG
CTCGGCGCAACCTGTGTCATTGAGCGCCAGAACGGCAGCGAAACGCACGAAGTAGAAAGC
GAAGTCGTTGGCTTTAACGGTCAACGGCTGTTTTTAATGCCGCTGGAGGAAGTCGAAGGT
GTCCTGCCCGGCGCGCGTGTTTATGCCAAAAACATTTCGGCAGAAGGGCTGCAAAGCGGC
AAGCAGTTGCCGCTCGGTCCGGCGTTATTAGGTCGCGTTCTGGACGGCAGCGGTAAACCG
CTCGATGGCCTGCCCTCCCCCGATACGACGGAAACCGGTGCGCTGATTACCCCGCCATTT
AACCCGTTGCAACGTACACCGATTGAACATGTGCTGGACACCGGCGTGCGCCCAATCAAT
GCCCTGCTTACCGTTGGGCGTGGGCAGCGTATGGGGCTGTTTGCCGGGTCCGGCGTTGGT
AAAAGTGTGCTGCTGGGGATGATGGCACGTTACACCCGCGCCGATGTCATTGTCGTGGGT
TTGATTGGTGAACGTGGGCGCGAAGTAAAAGATTTTATTGAGAACATCCTCGGTGCCGAA
GGGCGTGCACGCTCAGTGGTGATTGCCGCTCCGGCGGATGTTTCTCCGCTCCTGCGAATG
CAGGGTGCCGCCTATGCCACGCGCATTGCCGAAGATTTTCGCGATCGTGGTCAGCATGTG
TTGCTGATTATGGACTCCCTCACCCGCTACGCGATGGCCCAGCGTGAAATTGCGCTGGCG
ATTGGCGAACCCCCCGCCACCAAAGGTTATCCACCGTCGGTGTTTGCCAAATTACCGGCA
CTGGTCGAGCGTGCCGGAAATGGCATTAGCGGCGGCGGCTCGATTACCGCGTTTTATACC
GTGCTCACTGAAGGCGATGACCAGCAGGATCCGATTGCCGACTCCGCGCGGGCGATCCTC
GACGGTCACATTGTGCTGTCTCGCCGACTGGCGGAAGCCGGGCACTATCCGGCTATCGAT
ATTGAAGCGTCGATCAGCCGCGCAATGACGGCGTTGATCAGTGAGCAACATTACGCGCGA
GTGCGCACCTTCAAACAGCTGTTGTCGAGTTTTCAGCGTAACCGCGATCTGGTTAGCGTC
GGCGCGTATGCCAAAGGCAGCGATCCGATGCTCGATAAAGCCATCGCCCTGTGGCCGCAG
CTGGAGGGCTATTTGCAACAAGGCATTTTTGAACGCGCGGACTGGGAAGCGTCTCTCCAG
GGGCTGGAGCGTATTTTCCCGACAGTGTCATAACCCAGGAGATAACGGCAGATGGCAGAA
CATGGTGCGCTGGCGACCCTGAAAGATCTGGCAGAAAAAGAGGTAGAGGATGCCGCGCGC
CTGCTGGGTGAAATGCGTCGCGGATGTCAGCAGGCGGAAGAACAGCTCAAAATGCTGATT
GATTATCAGAATGAATATCGCAATAACCTCAACAGCGATATGAGTGCCGGGATAACCAGC
AACCGCTGGATCAACTATCAGCAGTTTATCCAGACGCTGGAAAAAGCCATTACTCAGCAT
CGCCAGCAACTTAATCAGTGGACGCAGAAAGTTGACATTGCCCTGAACAGTTGGCGAGAA
AAAAAACAACGTTTGCAGGCCTGGCAGACACTGCAGGAACGGCAATCCACGGCGGCACTG
CTTGCAGAAAACCGCCTCGATCAGAAAAAGATGGATGAGTTCGCCCAGCGCGCCGCCATG
AGGAAACCTGAATGATTCGCTTAGCGCCCTTGATTACCGCCGACGTTGACACCACCACAT
TGCCTGGCGGCAAAGCCAGCGATGCTGCACAAGATTTTCTCGCGTTGTTGAGCGAAGCAT
TAGCAGGCGAGACAACTACCGACAAAGCGGCCCCCCAGTTGCTGGTGGCAACAGATAAGC
CCACGACAAAAGGCGAGCCGCTGATCAGCGATATTGTTTCCGACGCGCAACAAGCTAATT
TACTGATCCCTGTGGATGAAACACCGCCTGTCATCAACGACGAACAATCCACATCAACAC
CGTTAACCACCGCTCAGACGATGGCGTTGGCTGCGGTGGCTGACAAAAATACGACAAAAG
ACGAAAAAGCGGATGATCTGAATGAAGACGTCACCGCAAGCCTGAGCGCCCTTTTTGCGA
TGTTGCCGGGTTTTGACAATACGCCCAAAGTGACTGATGCGCCGTCAACCGTGTTACCGA
CAGAGAAACCAACGCTCTTCACAAAACTGACTTCTGAGCAACTCACAACAGCACAGCCTG
ATGACGCCCCCGGCACACCAGCTCAGCCATTAACACCGCTGGTAGCAGAAGCCCAGAGTA
AAGCGGAAGTCATCAGCACACCTTCACCGGTGACCGCTGCCGCCAGCCCGCTAATCACTC
CACACCAGACACAGCCACTGCCCACCGTCGCCGCACCTGTTTTGAGTGCACCGCTGGGTT
CTCACGAATGGCAACAATCATTAAGCCAGCATATTTCGCTGTTCACCCGCCAGGGGCAAC
AAAGTGCAGAGTTGCGTCTGCACCCGCAGGATTTAGGTGAAGTGCAAATCTCCCTCAAAG
TGGATGATAACCAGGCGCAAATCCAGATGGTTTCACCGCATCAGCATGTACGCGCCGCCC
TGGAAGCAGCGCTGCCGGTACTGCGCACGCAGCTGGCCGAAAGTGGCATTCAGTTAGGGC
AAAGCAACATCAGTGGCGAAAGCTTTAGTGGTCAGCAGCAGGCCGCTTCCCAGCAACAGC
AAAGCCAACGCACAGCAAACCATGAACCTCTGGCGGGGGAAGACGACGATACGCTTCCGG
TTCCCGTCTCTTTACAAGGGCGTGTAACAGGCAACAGCGGCGTTGATATTTTCGCCTAAC
GTCAGAGGTAGCACCGTAATCCGCGTCTTTTCCCCGCTTTGTTGCGCTCAAGACGCAGGA
TAATTAGCCGATAAGCAGTAGCGACACAGGAAGACCGCAACACATGACTGATTACGCGAT
AAGCAAGAAAAGCAAGCGATCGCTTTGGATCCCGATTCTGGTATTCATTACCCTCGCGGC
CTGTGCCAGCGCAGGTTACAGCTACTGGCATTCGCATCAGGTTGCCGCTGACGACAAAGC
GCAGCAACGCGTCGTGCCCTCACCGGTCTTCTACGCGCTGGATACCTTCACGGTCAATTT
GGGCGATGCGGATCGCGTACTTTATATCGGCATAACCCTGCGCCTGAAAGATGAAGCTAC
CCGCTCGCGGCTGAGTGAGTATTTGCCGGAAGTCCGTAGTCGCTTGCTGTTACTGTTTTC
GCGTCAGGATGCTGCCGTACTGGCGACAGAAGAAGGCAAGAAAAACCTGATTGCCGAGAT
TAAAACCACACTTTCCACCCCGCTTGTTGCCGGGCAACCGAAACAGGATGTCACCGACGT
GCTGTATACCGCTTTTATTCTGCGATAACGACATGGGCGATAGTATTCTTTCTCAAGCTG
AAATTGATGCGCTGTTGAATGGTGACAGCGAAGTCAAAGACGAACCGACAGCCAGTGTTA
GCGGCGAAAGTGACATTCGTCCGTACGATCCGAATACCCAACGACGGGTTGTGCGCGAAC
GTTTGCAGGCGCTGGAAATCATTAATGAGCGCTTTGCCCGCCATTTTCGTATGGGGCTGT
TCAACCTGCTGCGTCGTAGCCCGGATATAACCGTCGGGGCCATCCGCATTCAGCCGTACC
ATGAATTTGCCCGCAACCTGCCGGTGCCGACCAACCTGAACCTTATCCATCTGAAACCGC
TGCGCGGCACTGGGCTGGTGGTGTTCTCACCGAGTCTGGTGTTTATCGCCGTGGATAACC
TGTTTGGCGGCGATGGACGCTTCCCGACCAAAGTGGAAGGTCGCGAGTTTACCCATACCG
AACAGCGCGTCATCAACCGCATGTTGAAACTGGCGCTTGAAGGCTATAGCGACGCCTGGA
AGGCGATTAATCCGCTGGAAGTTGAGTACGTGCGTTCGGAAATGCAGGTGAAATTTACCA
ATATCACCACCTCGCCGAACGACATTGTGGTTAACACGCCGTTCCATGTGGAGATTGGCA
ACCTGACCGGCGAATTTAATATCTGCCTGCCATTCAGCATGATCGAGCCGCTACGGGAAT
TGTTGGTTAACCCGCCGCTGGAAAACTCGCGTAATGAAGATCAGAACTGGCGCGATAACC
TGGTGCGCCAGGTGCAGCATTCACAGCTGGAGCTGGTCGCCAACTTTGCCGATATCTCGC
TACGCCTGTCGCAGATTTTAAAACTGAACCCCGGCGACGTCCTGCCGATAGAAAAACCCG
ATCGCATCATCGCCCATGTTGACGGCGTCCCGGTGCTGACCAGTCAGTATGGCACCCTCA
ACGGTCAGTATGCGTTACGGATAGAACATTTGATTAACCCGATTTTAAATTCTCTGAACG
AGGAACAGCCCAAATGAGTGACATGAATAATCCGGCCGATGACAACAACGGCGCAATGGA
CGATCTGTGGGCTGAAGCGTTGAGCGAACAAAAATCAACCAGCAGCAAAAGCGCTGCCGA
GACGGTGTTCCAGCAATTTGGCGGTGGTGATGTCAGCGGAACGTTGCAGGATATCGACCT
GATTATGGATATTCCGGTCAAGCTGACCGTCGAGCTGGGCCGTACGCGGATGACCATCAA
AGAGCTGTTGCGTCTGACGCAAGGGTCCGTCGTGGCGCTGGACGGTCTGGCGGGCGAACC
ACTGGATATTCTGATCAACGGTTATTTAATCGCCCAGGGCGAAGTGGTGGTCGTTGCCGA
TAAATATGGCGTGCGGATCACCGATATCATTACTCCGTCTGAGCGAATGCGCCGCCTGAG
CCGTTAGTGATGAATAACCACGCTACTGTGCAATCTTCCGCGCCGGTTTCTGCTGCGCCA
CTGCTGCAGGTGAGCGGCGCACTCATCGCCATTATTGCCCTGATCCTCGCTGCTGCCTGG
CTGGTAAAACGGTTGGGATTTGCCCCTAAACGCACTGGCGTTAACGGTCTGAAAATTAGC
GCCAGTGCTTCACTGGGCGCGCGTGAAAGGGTTGTGGTGGTCGATGTGGAAGATGCACGG
CTGGTGCTCGGCGTTACCGCAGGTCAAATCAATCTGCTGCATAAACTTCCCCCTTCTGCA
CCAACGGAAGAGATACCGCAGACCGATTTTCAGTCGGTCATGAAAAATTTGCTTAAGCGT
AGCGGGAGATCCTGATGCGTCGTTTATTGTCTGTCGCACCTGTCCTTCTCTGGCTGATTA
CGCCCCTCGCCTTCGCGCAACTGCCGGGTATCACCAGCCAGCCGCTGCCTGGCGGTGGAC
AAAGCTGGTCGCTCCCGGTGCAGACGCTGGTGTTCATCACCTCGTTGACGTTTATTCCGG
CAATTTTACTGATGATGACCAGTTTCACCCGCATCATCATTGTTTTTGGTTTATTGCGTA
ACGCGCTGGGAACACCCTCCGCGCCACCTAACCAGGTATTGCTGGGGCTGGCACTGTTTT
TGACCTTTTTTATTATGTCACCGGTGATCGACAAAATTTATGTAGATGCGTACCAGCCAT
TCAGCGAAGAGAAAATATCAATGCAGGAGGCGCTGGAAAAAGGGGCGCAGCCGCTGCGTG
AGTTTATGCTGCGTCAGACCCGTGAGGCAGATTTAGGGTTGTTTGCCAGACTGGCGAATA
CCGGCCCGTTGCAGGGACCTGAAGCCGTGCCGATGCGCATTTTGCTCCCGGCCTACGTGA
CCAGCGAGTTGAAAACCGCATTTCAGATAGGCTTCACGATTTTCATCCCTTTTTTGATTA
TCGACCTGGTGATAGCCAGCGTGTTGATGGCATTGGGGATGATGATGGTTCCCCCAGCCA
CCATTGCTCTGCCCTTTAAACTGATGCTGTTTGTACTGGTGGATGGCTGGCAATTGCTGG
TCGGTTCGCTGGCGCAGAGCTTTTACAGCTAGAGAGGCAAAATGACACCTGAATCGGTCA
TGATGATGGGGACTGAAGCGATGAAAGTCGCGCTGGCACTGGCTGCCCCGCTATTGTTGG
TAGCGTTGGTCACGGGCCTTATCATCAGTATTTTGCAGGCCGCCACGCAGATTAACGAAA
TGACGCTGTCGTTTATTCCGAAAATCATCGCCGTATTTATCGCCATTATTATTGCCGGAC
CGTGGATGCTCAATCTGTTGCTGGATTACGTCCGCACCTTGTTCACTAACCTGCCGTATA
TCATCGGGTAGCCGTACTATGTTGCAGGTGACAAGCGAACAATGGCTATCCTGGTTAAAC
CTGTACTTCTGGCCGTTACTGCGCGTGCTGGCGCTGATCTCCACCGCGCCGATTCTGAGC
GAACGCAGCGTACCGAAACGGGTAAAACTGGGTCTGGCAATGATGATCACGTTCGCCATT
GCCCCATCATTACCTGCCAACGATGTTCCTGTTTTTTCGTTCTTTGCTCTGTGGCTGGCC
GTGCAGCAGATCCTGATCGGCATTGCGCTTGGTTTTACCATGCAATTTGCCTTTGCCGCT
GTGCGAACCGCTGGCGAAATTATCGGTCTGCAAATGGGGCTGTCATTTGCGACGTTTGTC
GATCCGGCCAGCCATCTTAATATGCCCGTTTTAGCGCGTATCATGGATATGCTGGCGTTA
CTGCTGTTCCTGACATTTAACGGTCATTTATGGTTGATTTCACTGCTGGTCGATACCTTT
CACACCCTGCCGATTGGTGGCGAACCGTTGAACAGCAATGCGTTTCTGGCACTCACCAAA
GCAGGGAGTTTGATTTTCCTTAACGGGCTGATGCTGGCGTTACCGCTCATTACTCTGCTG
CTGACACTGAATCTGGCATTAGGTTTACTTAATCGTATGGCCCCGCAATTATCCATTTTT
GTTATTGGATTTCCATTAACTCTGACTGTCGGCATCTCTTTAATGGCGGCATTAATGCCG
TTAATTGCACCTTTTTGCGAACATTTATTCAGTGAAATTTTTAATTTGCTGGCTGATATT
ATTAGTGAATTGCCATTAATATAATTCCGTAACGTTTATCATGTTATCCTAAGGATTATC
CGAAAAATAATACCTACGAACATCTTCCAGGATACTCCTGCAGCGAAATATTTGTTTTAA
GCTCACTCACATATCGCAACATTTACTTTACTTTAAGACAATTCCAGGCAAATTATACAA
CACTTTACGGGATAGTAAGTCCGCCTGAAAAATCGCGAGAGTGGCGCATTAGGTGACCCA
TGTTGTTCCGTTTAGTCATGATGAAATATTCAGGTAAGGGGAATTATCGTTACGCATTGA
GTGAGGGTATGCCATGTCAACGATTATTATGGATTTATGTAGTTACACCCGACTAGGTTT
AACCGGGTATCTGTTGAGTAGAGGGGTTAAAAAAAGAGAAATCAACGACATTGAAACCGT
TGATGACCTTGCCATAGCTTGTGATTCACAGCGCCCTTCAGTGGTGTTTATTAATGAGGA
CTGTTTCATCCACGATGCTTCTAACAGTCAGCGTATCAAGCTCATCATTAATCAACATCC
CAATACGTTATTTATCGTTTTTATGGCAATTGCCAATGTTCATTTTGATGAATATCTATT
GGTCAGAAAAAATTTATTGATCAGTTCTAAATCGATTAAACCGGAATCTCTCGACGATAT
CCTTGGCGATATTCTGAAAAAAGAGACAACGATAACCTCGTTTTTAAATATGCCGACGTT
ATCATTGAGCCGAACCGAATCGAGTATGTTGCGAATGTGGATGGCAGGTCAGGGAACCAT
TCAAATCTCTGACCAAATGAATATCAAAGCCAAGACCGTTTCATCGCATAAAGGTAATAT
TAAACGTAAGATCAAAACGCATAATAAACAGGTTATCTACCATGTCGTCCGACTGACGGA
TAATGTGACTAATGGTATTTTTGTCAACATGCGCTAACACATTCTGACTGGTGGTTTCCC
ACCAGTCAGGCTGAATAAGATTACTCTGCTTTCTCCACAAAGATACCGTCCTGATGCCCT
GCTTCATTAAAGAACCAGATGCCGAGCGGGTAGTCTTCCAGCGAAACCAGGTACATTGTG
CCTTCACTAAACTCCTCAACTGCCAGTACCACGCCAGGACGACGCGGACCGCCATCCGTT
TTGACTGTTACCCGATCATTCACCTTCATCGTTTTCCTCCTGTGGCTTTGTGCCAGTGTA
GAACAATTTCGTTTTTCTGGCAGCGCCAGGCGCGCGCGAGTGCTGATTTTCTCGACGGTC
TATACTTAAGAGATGCCAGGCGGACTTAACGACTGGCGGCAACAACAGAGTAACGGTTGC
GAGGAAAGATGATGAAAACCGCAAAAGAGTACAGCGATACCGCAAAACGTGAGGTCAGCG
TCGATGTCGATGCCCTGCTGGCGGCGATCAATGAAATTAGCGAAAGCGAAGTTCATCGCA
GCCAGAACGATTCTGAACACGTTAGCGTCGATGGACGTGAATATCATACATGGCGTGAAT
TGGCGGATGCCTTCGAACTGGATATTCATGACTTCAGCGTCTCTGAAGTGAATCGTTGAA
TGCACAATAAAAAAATCCCGACCCTGAGGGGGTCGGGATGAAACTTGCTTAAGCAAGAAG
CACTTAAAAAATTCGTTACACCAGGAAATCTGATGTGTTCATCACCTTATCCGCAATTTT
TTTCGCTGACAAGAAAATATTCGCCATATGAATGATTAACGCTACTTATGAATAGAAATG
TGACGCACGTCACCCCTTGGTGGCTCTGGCGTCAGCGGGATCGCTCCCGAAAAAATCATC
TTTGATAATTTGTGCGGTTTTGAGAATCATCCTGGTAAGAGGAGTACTGCGCGACTATGT
TTTCAATTCAACAACCACTACTGGTTTTTAGCGATCTTGATGGCACCCTGCTGGACAGTC
ATAGTTATGACTGGCAACCGGCAGCCCCCTGGCTCACCCGTTTACGCGAAGCAAATGTTC
CCGTCATTCTCTGTAGCAGTAAAACATCAGCGGAAATGCTGTACTTGCAAAAAACGTTGG
GGCTACAAGGTTTACCGCTGATTGCCGAAAATGGCGCAGTGATCCAGCTTGCTGAGCAAT
GGCAGGAGATAGACGGTTTTCCACGCATCATCTCAGGTATTAGCCATGGCGAAATCAGCC
TGGTTTTAAATACGCTACGCGAGAAAGAACATTTTAAATTCACGACTTTTGATGATGTCG
ACGATGCAACCATCGCCGAATGGACGGGATTAAGCCGTAGCCAGGCGGCGCTGACGCAGC
TTCATGAGGCGTCGGTAACGCTAATCTGGCGCGACAGTGACGAGCGTATGGCACAATTTA
CCGCTCGTCTGAACGAACTGGGCTTACAGTTTATGCAGGGTGCGCGCTTCTGGCACGTAC
TGGATGCTTCTGCCGGAAAAGATCAGGCTGCCAACTGGATTATCGCGACCTATCAACAAT
TGTCAGGCAAACGCCCAACCACACTTGGCCTGGGCGATGGGCCAAACGATGCGCCCTTAC
TGGAGGTAATGGATTACGCGGTGATTGTGAAAGGGCTAAATCGTGAAGGGGTGCATCTGC
ATGATGAGGATCCGGCCCGCGTCTGGCGAACGCAGCGTGAAGGACCGGAAGGATGGCGTG
AAGGGCTGGACCATTTTTTCTCCGCCCGTTAAGCGTTATCGCTCGCGAATACCCGATTAC
GCCCAGCCTGTTTAGCGAGATAAAGCCGACGGTCGGCCAGTGACTGGAGTTGTTCAAAAT
CATAATCACCGGTTTCCTCGCTGCTGCTTACCCCCAGCGAGGCACTGATGCGTATCGTCG
TACTCTTGGCGATCAACATCTCTTTTTCATTTAATTTCAGTCGAATACGTTCTGCGACCT
CCGCAGCCTCCGTCAGACTCGCGCCTGGCAGAATCACACAAAACTCCTCACCACCGACCC
GCCCGGCAACGTCCTGCGCACGCAAGGAACTGCTAATTAATCCGGCAGCATGAGAAAGAA
CACGGTCGCCCGCCTGATGACCAAAGCGGTCATTAATCGCTTTAAAATGGTCAAGATCGA
CCTGAATGACAGAAAAAGGATGTTGGTGCGTCTGACACAATTTAGCGAGCGGACGGGCTT
TTTCGAACAGTGCGCCACGGTTATATAAACGCGTTAAGGTGTCGTGCCACGCCTGCCACT
GCAACGAGCTTTGCAGAACATACATGTTGCTAACCATCCGGCGAATCACATACCAGGAGA
TGAGTAACATGGTGGTAAAGAGCGCCCACAGCAGGGTTAATGCAATGCTGATACTGCCGA
AATCGCCGCGCACGCCTTCGCTTAACGTATGGACACGCACCAGCACACCGTCGAAATGGT
CCAGACGTTCCCAGCTAACATAGCGACTGTCCATACGAATGCCGCCCCGCGTGTCATGTT
CCATTGCCTGCGCCAGCAAGGCCAGTTCACGAGGATCAAAAATATTCCCTGTTGGATGGT
CAGGATTGGAAGAGGTCAAAAATCTCAGCTTACTGTCATAGAGCTGATACTCACCATCGA
GGTTTTTATCGATGGCGTTTCTTAAAAATTGCTGCATAGTACGCACGGGAATACTCATCC
CCAGCACGCCATACCAGTAGTTATTACTGTCTACCGGAACACTGACGGTAACCTGCGGTT
CAGTATTGCTGGCGTGTTCCGGTTGCGAAGTGAACCAGCGTACCGCGCGGTGACGATTTT
CTCGTTGTGAATGGCCAATAAACCAGGGTTGGGTGACATAGCCGTAATAACGCGTTGGAA
CATTGCGCGTAAACAAGGTCGGCTGCGTCGAAACGTAAAATCCGGCACGCGAGACATACA
TCGCCTGTTCAACCATCGACGAGGAGTTGTGCGCTAGTCGCAGCAAGTAACCAACTTCCA
GTGCAGCGGTAATTTCATTGTCGAGGCTTTCATTTTCGCGAGACAGGAGATTCCCCTCGC
TGACTAATGCATCCGACACACCATTAACTGGCAGAGTGCGTCGTCGGTTGAGTTCGATTT
TCCAGGCGTGCTCGTCGCGATGCTGTTCGAACTCGGTTACAGCATCACGCAGAGAGGTGA
AATCCAGTGGCGCTACGAGAGCTTCGCGCATGCCATTACGTAAAAAGATCAGTTTGTCGA
CGTTATACTGCAAATGCTTATCGAGCGCGTTGGCAACGTTTTCCAGATGATTACGCTGGC
TGGAGATATAGGCATCTTCCAGCACCACCACTTCACGCCAGGTGAGCAAGGTGGAAAAAA
GCAATACCACGATAAAGCAGAGATTAACGACATGACCAGGCCCCAGGCGGCGTGCGAGTT
TTTTCAACCAGCTCTGGTTTTCCATTTTTGTCTCGTGCTGCACCCTGACGACTCCCAACC
TGCTTTTTTATGATTCTGGCATAACCTGGCGATAGCGTACCGCAAAACAGCGATAATTTT
ATAATGGTGGCATGATAAGACGCGACTATCATTCATTGCAGGCATTAGCACACCAGGCCG
GATGTGATCCGGCCTGATGTTAATGATACCCTTTCACACTTCTTCCGCAGAACGACTCCC
CTCCCCCGGAACAAGCTCGGTTTCATGAAAAGCTTCCCGCTTGACCCCGTAACCGTCATA
CCAACGACACTCAACCATACCGCTGGAGTATCCAGTGACAATCATCCGCGGGCCGCCCTC
TTTAACCGTAACTTCCTCACTAACCATAAAGCTCATACTCGCCTCCTTTTTTCGAGTGAA
ACTTGTTCACCTTAGTTGAAGATGGCGAATTTTGCATAATAGCCAGTGCGAGTATTAATG
TGCCTGACCGCGCATTTTCTCTACGGCTTTCACTCCCAGCACCACGATGCCGCCGATGAT
AAATCCAAGAATCAGATTTAAAACAGTCGGTAATATCATCGCCACTACTGCACTTTGCTG
CCCGGCGAAATGTTCAATGGCGTGATGCAGCGGCGCAATTCCATGTACCACAATCCCACC
GCCGACGAGGAACATCGCCAGCGTGCCGACAATCGATAACGCTTTCATCAGCCAGGGCGC
GATAATCAATAACCCTTTACCTAATGCCTGCATCAGCGCGCTGGATTTTTCCGCCAGCCA
ATACCCCAGGTCATCAATCTTAACGATAACCCCTACCAGACCGTAGACGCCCACGGTCAC
TACCAGCGCGATGCCTGAAAGCACCAGCACCTGATTAAGCAACGGCGCTTCGGCCACAAT
CCCCAGCGTGATGGCGACGATTTCCGCAGACAATATAAAATCGGTACGAATCGCCCCTTT
TATTTTGTCCTTTTCAAACTTCAGCGGATCCTGCGCCGCCAGCTTCTCCAGACGCTGCTG
GCTCTGCGCCGGATCTTCTTTATGTTTACGCGCCTCCAGCATATGCAGCACTTTCTCTAC
TCCTTCAAAGCAGAGAAACGCGCCACCAATCATCAACAGAGGCGTAATCGCCCACGGGAT
AAACGCACTGATGATCAGCGCCAGCGGCACCAGAATCACTTTATTAATCAGCGATCCTTT
CGCCACGCCCCAGACCACGGGAAGTTCCCGGTTGGCCCGCACGCCTGAAACTTGTTGCGC
ATTGAGCGATAAGTCATCCCCTAATACACCGGCGGTTTTCTTCGCCGCCAGTTTGCCCAT
CACGGAGATATCGTCCAGTAGTGTGGCGATATCATCGAGCAACGTCAGTAAACTACTCCC
GGCCAAAAGCATTCCCTCTCATTTTTATTGTTGAAGGGTGTAAGTATGAAGCAAAAACGG
CAGCTCTGATACTTGCTTCACAGGTCAACATTTTTTTAACAATCAAGTGCAATTATATCT
CTCGCCAGCAGAATGATTTTCACGTTTACTATGAACCACCTTTTTATTTCCACCGTGAGG
GATTATGCGTTTCCGCCAGTTGTTACCGCTTTTTGGCGCGCTGTTTGCGTTGTATATCAT
TTGGGGCTCAACCTATTTTGTCATTCGGATTGGCGTGGAAAGCTGGCCTCCGTTAATGAT
GGCGGGCGTTCGATTCCTGGCAGCCGGTATTTTATTGCTGGCATTTTTGCTACTGCGCGG
ACACAAACTCCCCCCGCTACGTCCGCTGCTCAATGCCGCGCTGATTGGCCTGTTATTGCT
GGCTGTCGGTAATGGCATGGTGACGGTTGCCGAACATCAAAATGTTCCTTCCGGCATCGC
CGCCGTAGTGGTTGCAACCGTGCCCCTCTTTACCCTGTGCTTCAGCCGCCTGTTTGGCAT
TAAAACGCGCAAACTGGAATGGGTGGGTATTGCCATTGGGCTTGCCGGAATCATCATGCT
CAATAGCGGTGGAAATTTAAGCGGCAATCCGTGGGGCGCGATTCTGATTTTAATCGGCTC
GATTAGCTGGGCGTTTGGCTCAGTTTATGGCTCGCGCATTACCTTACCTGTAGGGATGAT
GGCGGGTGCGATTGAGATGCTGGCGGCAGGCGTGGTGTTAATGATCGCGTCGATGATTGC
GGGTGAAAAACTGACGGCGCTCCCTTCCCTTTCAGGCTTCCTTGCGGTCGGCTATCTGGC
GCTGTTTGGTTCGATTATCGCCATCAACGCTTATATGTATTTAATCCGTAATGTCAGTCC
GGCTCTCGCCACCAGCTACGCTTACGTTAACCCGGTGGTCGCGGTCTTGCTGGGTACGGG
ACTGGGTGGAGAAACACTGTCGAAGATTGAATGGCTGGCGCTCGGCGTAATTGTCTTCGC
GGTGGTACTGGTCACGTTGGGAAAATATCTCTTCCCGGCAAAACCCGTAGTTGCGCCAGT
TATTCAGGACGCATCAAGCGAGTAAATGAATCCCCTGCGTGTCGATCTGCGCGCTGGCAC
CTTCGCCGCAGATCCACTCTTCCAGACGCTCGGTAAGCGCTTCATCCGTCAGCTTCTCGC
GCCCACGTAACGCGCACTCCCAGACAATCAATACGCGCCAGCCGAGTTCCTGCAAGCGAC
TGATATCGCGGCGATCGCGCTCAACATTTTTACCTATCTTCTCCAGCCAGAACTCGGTTC
GAGTCGCAGGCACTTTAAACAGATAGCAGTGATGATGATGCCAGAAGCAGCCATGGGTAA
ATATCACGCAGCGATATTCATCAACGACAAAATCCGGACGTCCGGGCAGACTGGCGTCCT
GAACGCGAAATGCCAGGCCCTGCCCGGTTAACAGACTGGCGAGGCGCTTCTCTATCGCCG
TATCACGCGTGGCAATCGCGCGCATATTTTTGCTGCGAGTGGCCTTATCGTGAACGTCGG
CCATGTTGTGCCTCTTGCTGACGCAACGCCACCGCCTGTTTGATTTTTGGCTCAAGCAGT
TTTGCCACCGCGGCAAAGACCGGCACGACCACCGAGTTACCGAACTGGCGATAGGCCTGA
GTGTCCGAAACCGGAATACGGAATTTCGCTTCTCCCGGCGCTTCAAAACCCATTAAGCGC
GCGCATTCCCGAGGCGTTAACCGACGTGGACGATGTTGCTGATTCAGCGGATCGTCAAAG
TCTTTCTCACCCGTGGCCATATCCCAGCCGCGATCGATTAAAATTTCCGCGCCATCTTTG
TAATAACGCGCAGACAGCGTACGCGTGACGCTTTGCGGATTGTTCGGATAAACCATTCCA
TAACCGAAGCCGTTACCGCGCGCCTGATGTTTTTTCGCATATCGATAGAGGTACTTCCAC
AGCACCGGCGTCAGGATATATTTCGCCTCGACCATCGGGTCCAACAGCTGCGCCAGCGTC
ACTCGCTGCGCAGGGAAACATTCGCTGATATCACGCAGGGTAAAATCGGCTTTCAGATTC
AGATCGCGACGAAAACCCACCAGCACGATGCGTTCACGGTGCTGCGGCAGAAAATGTTTG
CCGTCGATGATTTTCGGATCGTCTGGCCCATTATCTTCTGCATCAGCCACGTCATAGCCC
AGTTCGTCCAGCGTCTGCATGATGATGCGGAACGTTTTACCCTGGTCGTGACTTTTCAGG
TTTTTGACGTTTTCGAGCACAAACATCGCCGGACGACGCGCGTCGATAATGCGTACCACA
TCAAAAAACAGCGTGCCCTGGGTATCGCAGGCAAAACCGTGCGCCCGCCCGAGCGAGTTC
TTTTTCGATACGCCAGCCAGCGAAAATGGCTGACAAGGGAAACCGGCCAGTAAAACATCG
TGTTCAGGAATGTGTTGACGAATATGTTCCGCCGCCGCCTCATCACTCACGCCTTCTTTA
TGGCTGAGGGTGATGTCGCGGATATCTTCATTAAAATGATGCGTCGCCGGATCGCAATAA
TGGTTGGCTTTATAAGTGCGTACCGCATGTTTGTTCCATTCGCTGGTAAACACGCACTGT
CCGCCAATCGATTCAAAACCGCGACGGATGCCGCCAATTCCGGCGAATAGATCGATAAAG
CGAAACGCATAATGCGGATGATGTGCCGGTGGTTTGGGTAATAACGTTTGCAGATGGGCG
AACTCTTTCTCACTTAAACGGTGCCATGCCGAGTCATTCGCCAGCGCACGTTTTAAAATT
GCCGCGCTCCAGTGATTCTCACCTACACCATTAAGCTGCGCCACCAACGTTTTAACATCA
TAAATTTGCAGCAGTTTCTCCAGCATTGCCTGTGCGGCATTCCCGGTGCTGTATGAATCG
GTTACTGATATATTTTCCTGCATAGATTTCACCGGCCATCTGAGATGGCCGACAGGTTAA
CATAATTACAGCCATTTAGGGCCACGCGCTCAGCCAGCGGATGAAAACGCATCTATCACC
TTGTGATCGACACCTTCATTCTCCCCCGCCAGTTCGGCACTGAGCTTCGCCATAAACTCG
ACTAAAAAATGCGCGTTGTGCTGCGCCAGCTGCTTGCCTCTTGCGGTTTGCATGGTTTGC
GGTAGCTTCAGCAACTTAGTCTGGAAATGATCCAGCGCGTAGCGTTTATCATCAAGCGGG
CGATGCTGTGCGAACGGATCTTCACCATCAAACAGCGCCACGCCCAATGCCCCTGAAACG
GCAAACACGCGCGCCAGGCCAATCGCCCCCAGGGCTTCCAGCCGATCCGCATCCTGGACA
ATTTTAGCTTCCGTTGTTAAGGGGGCGATTTGCGCGCTGAAACTGTGAGCGGCAATGGCA
TGACAAACGGCCTCGATTTTCTCCGCCGGAAATTGCTCGAACTCTTCACGGAGCAGGCGA
CGCGTCTCTTCTGCCGCCAGGATTGAAGAACGCTGCCTTTGCGGATGATTTTTCGCCAGG
CTCACAATATCGTGAAAATAACAGGCGGTTAAAATCACCAGCATATCGACATCGTCATCT
GCCGCCAGCTTCTGTGCCGTAGCCCAGACGCGGCGAAAATGACACACGTCATGGGCCGCG
TCCTGGTGCTGATGATGGTTTTTCAACCAGTTTTCGAACTGTGCCTGCCAGTGTTGTAAG
TCCATACGCGCTCCGTTGCCAAAGAGTCGCCACCTTAGCAGTTTTTATTCATAGCGTCTG
CTACGTGCGGGACGAGGTCGGGTGTACCAGGCAATGCTGCCTAACAATGCCCCGACCAGA
GCCATAAATAAAAATCCGACCAGTGCCCCTAACCACTTTCCCGCGGTAGAGCCTAAATCG
CTTTCAAATCCCGACACGGGGGCATCGGGAATCCGGCTCATCACCCAGATGTAACGCGCC
ATTGCCCAGACGAAATAGCCACACCATGTATAGAAAGCCCACAAAGCCAGTTTGCCGCCA
GGGCTGCGAGAGAGTCTCTCTTCCATCTTTGTCGAACCGTATTCCATTTTGAGATAACCC
GGAAAATTCAGACTTAGTACTATTATGTGATAAAAGTCACATTTTTCCACATTGGATGAG
CCAGTCAAGACTCAATCATTTTTTGAACAAATAGATAAATTTTGCGCAACGGCAGTGAAT
ACAGGAAAAATCGTTTTGAGCGATTTTATTTATCTTTGATATCGGCTTTATTAATTCATT
TAATCAATATATTAGCACTGATTACAATTATACCTTTTTATTATTCTGTGTCATGATGCT
TCCGTTATTAGCCTTTTATCGTCTTGTTTATATTTTTTGGGCCGGCATGATGCCGGCTTT
TTTTTATGCCTTCATTAATGTGCGCCTGATCACACCAGCCGTTTGGCGCAACAATCATTG
ATACCCCCTATGTTTCCGCTCAACTCATAACATATTGATATACATTTATAATTTTCATGA
ATATTTATATTTAGAATTCATAATTATGAATTATATTAAATAGATTAGAAACATTTTGAT
ATCTTTTAAATACATTTGTTACATGTAATCCTTAAAATAAAATGAACTTCATAGAATAGT
ATCCAAATGTGCTTTTTTTTGGATAACGGCACTTATTGATATATTCATGAAGATTATAAT
CACAAGGGAATACATAATGAAAAGAAAAGTTCTGGCAATGCTGGTCCCGGCGTTATTAGT
TGCTGGCGCAGCAAATGCGGCTGAAGTCTATAATAAAGATGGTAATAAACTGGATTTGTA
CGGAAAAGTAGTGGGTCTGCACTACTTCTCTGATGATTCTGGCAGCGATGGCGACATGTC
ATATGCCCGTATCGGTTTCAAAGGTGAAACTCAGATCGCTGATCAATTCACTGGTTATGG
TCAGTGGGAATTTAACATTGGCGCAAACGGTCCTGAAAGCGACAAGGGTAATACCGCAAC
GCGTCTGGCATTTGCAGGTTTAGGCTTTGGTCAGAATGGTACTTTCGACTATGGTCGTAA
CTACGGTGTCGTATATGACGTAGAAGCATGGACCGATATGCTGCCAGAATTTGGTGGCGA
TACCTATGCTGGCGCTGACAACTTCATGAACGGTCGTGCTAATGGTGTTGCAACCTACCG
TAACAATGGCTTCTTTGGTTAGGTCGATGGCTTGAACTTTGCTTTGCAATATCAGGGTAA
TAATGAAAGTGGTGGACCATTCGGGCAGGAAGGTTCCGGTAGTGGTGATGGCCGTAGCCT
TTCCAAAGAAAATGGTGATGGTTTCGGTATGTCAACATCCTACGACTTCGACTTCGGTTT
AAGTCTGGGTGCTGCATATCAAACTCTGATCGTTCAGATCGTCAGGTTGGAGTTGGTTTA
AATGATCGTAACCATAGCAACAGAAATGCTGGTGGTGAAACCGCTGAAGCATGGACTGTT
GGTGCAAAATATGATGCTAATAATGTGTATTTAGCAGCTATGTACGCTGAAACTCGCAAT
ATGACCCCATATGGTGGTGGCGAGTTTGATAATGGTGAATCAAGATCAGCCATCGCTAAC
AAAACCCAAAACTTTGAAGTTGTTGCTCAGTATCAGTTCGACTTTGGCCTGCGCCCGTCC
ATCGCTTACCTGCAATCTAAAGGTAAGGATTTAGGCGGTTGGGCTCATGACGGCAACGGC
GACCCACGTTACACCAATAAAGATCTGGTTAAATACGTTGATATTGGTGCGACCTACTAC
TTCAACAAAAACATGTCCACCTATGTTGATTACAAAATCAACCTGCTGGACAACGACGAT
GACTTCTACGAAGCAAACGGCATCGCTACCGATGATATCGTTGCTGTGGGCTTAGTCTAC
CAGTTCTAATCAGTCAACTCGCTGCGGCGTGTTACTGTAAAACTGAACACTAGCCTGAGT
TCGTCCCTCATCGAACTCAGGCTTTTTTATTGGCATTTCATCTCCATCTGCGGCACACGC
AATTGCCGAAGCATATCGATACAGCACCTTACCCTGCCCCTCCTGGCACAATAACATCAA
CCAGCTACTCTTCAAGCTAACACCCAAATGCATTTCTTTATGAATTAATCCGTAACAAAC
ACGCTTCCCATATAGAAATATTTGCAAAAATAGTGCATGAAATAAGCTTTTTCTCTACCA
ATCCGGGATATAAATATTCATCAGCACCACAATATTCCACAGCACTAAATCTCTCCCCGC
CACCCCGTACCTCTGATAATGGTCTAAAATCATTGAAGCCACTTGCGACGACGTTGCTCA
ATAAGGAAAATTTGGCGTGAATAATATTCAACACCAGTGCAGCATCATCATTACATACTT
ACAGCCGCCGACTACCGCTTTCGATATATTGACTCAATTTTCCAGCCTGGTTAAAAATAG
CGACCAGCTCAGTCGCAAATATAGTGACTACCCTAACTAAGCAACAATAAGGAATACACT
ATGACTGTTCAAACAAGTAAAAATCCGCAGGTCGATATTGCTGAAGATAATGCATTCTTC
CCTTCAGAATATTCGCTTAGCCAATATACCAGTCCTGTCTCTGATCTTGATGGCGTGGAC
TATCCAAAACCTTATCGCGGTAAACATAAAATTCTGGTGATCGCCGCGGACGAACGTTAT
TTGCCGACCGATAACGGAAAACTGTTCTCGACCGGTAACCATCCGATTGAAACGTTGCTG
CCGTTGTATCATCTCCATGCTGCAGGTTTCGAATTCGAAGTGGCGACCATTTCCGGTCTG
ATGACCAAGTTTGAATACTGGGCTATGCCGCACAAAGATGAAAAAGTAATGCCATTCTTT
GAGCAGCATAAATCGTTGTTCCGCAATCCGAAGAAACTCGCGGATGTTGTTGCCAGCCTC
AACGCTGATAGCGAATATGCAGCAATCTTTGTTCCTGGTGGTCATGGCGCACTTATTGGT
TTACCTGAAAGCCAGGACGTGGCTGCCGCTTTACAGTGGGCAATCAAAAATGACCGTTTT
GTTATCTCCCTTTGCCACGGCCCGGCGGCTTTTCTGGCGCTTCGCCACGGCGATAACCCA
CTGAATGGTTATTCCATTTGCGCATTCCCAGACGCCGCAGACAAACAAACGCCAGAGATT
GGCTATATGCCGGGTCATCTCACCTGGTACTTCGGCGAAGAACTGAAGAAAATGGGCATG
AATATCATTAATGACGACATCACCGGGCGAGTACATAAGGACCGTAAACTTCTCACCGGC
GACAGTCCTTTTGCAGCGAATGCGTTGGGTAAACTGGCGGCGCAGGAAATGCTGGCAGCT
TACGCGGGTTAATCCCTGTTACGTTTGAATGTAAGCGCATAATCAATCGCGGCCGCGTTA
GTACTCACGACGTGGCTGCGTTTTTTCACGGTTAATTTATGGCGTACTGAAGCCCTATGT
TAATTTCTTTGCGGTAACGTAATCCGGAACACATTATGCTTATTGAGATAGTGATACGTA
GCACTTCCCCCATGCAATTCGGCAATCGCTTTGACTAAAGAAAGGCCTAGTCCCTGACCT
ACGGAATGACGCGAATTATCTCCCCGCCAAAATCTACGGAAGAGTTTTTCAGGCTCATTA
ATTTTCGTTCCAGGGCTGGCGATATCAATATTAAGATAGCTGTTGGTATCAAGAAAACTG
GTTATATGAATACGCGATTTTTCTGGCGAATATCTAATGGCATTAACAATAAGATTCGAT
AACATTCGTTGTAGTAAAATTTTATCCGCAAAGATTTGCTGATTGCACTCGACCTTAAAG
CAAATCTCTTTCTCGTCTGAAAGGTATTCAAGATAGTCCAACAAATTTTCGACTTCCTTA
TTGAGAGAAAGCGAGTCCAGTTTCACCAAAACATTGTTTTTATCTGCCCTGGCAAGAAAC
AGTATGTTCTCTGTTAACCGCGAAATATTTTCCAGCTCTTCAATGTTTCCGGCAATTGTT
TTTTGATATTCAGCGATACTTCTGGTTTGACTGAGCGTAACCTGATTCTGACCCAGTAAT
GCATTAATTGGCGTTCTAAGTTCATGAGCGAGATCGTCAGCAAACTGACTTAGACGCTCA
AAATCTTTGACTAAAGCATGATGCATTTTATTCAACGCCTGCCCAAGAGGTTTTAGTTCT
CTCGGTAATGCGCTAACCTCAACAGGCTCTCGGCTATCGTTATAATTCAGCGCTTCCGTT
ACACCACTCAACTTTTTGATCTCTCGTAATCCCGTTCTGATTAACAGCGGACTTAATACT
GAGCAAAGTACAATGGCGACAATGCAAATTATAATGCTATTAATTTTATACTGTTCAAGC
ATGTTATGTCTGGCTGAAGCCAATTTAGCCACAGTAACCGTTAATGATGGCGAAACTTCA
TCAATATTAATTCGTAAAGCATCTATCTCTGTATCATTAATAATGCTTCTGTAAATGCCA
GCTGCGCTGATTGTCTCACTAGCAGGTATGTTATTTAACATGCCATCACTGACATTTGTC
CGGTTAACAATTTTATTGATGCTATCACCATGAATAATCAAGATATCCTGACTAACATCC
ATCATCCGGTTAAAGTACACAGGTAACGTATCTGGATTTACCCCATCAATTAACAACTGC
TTGATCTGCGCTGTCCGGTTAATGAGTGTTGTATCATCGCGCCATTTCAACTCACTTGCC
AGGCCATTATAGAGAGTCCAGACAATTCCGGCGCCAGCAACAGACAGTAGCAATATAAAA
AGCAAGGTTAAACGGACGGTTATAGATAGTCTTTTCATTATTTTTTTACCGCTACGAATG
AATAGCCCATCCCCCGGATTGTGGCAATTAGCTTTTCAGGAAAAGGATCATCAACTTTTG
CGCGGAGCCTGCGAATGGCGACGTCCACCGTATTGGTATCACTATCAAAGTTGATTCCCC
AAATTTCACTCGCAATAACCGTTCTGGGTATAATTTCGCCAGCTCTGGAGGCCAGTAGCC
AAAGTAACTGAAACTCCTTGCGCGTCAGTGTAATACTGATATTGTCCCTGCTCACACTAT
GACTAACAGAGTCCATTCTTAAGCCGCTGATTTCTAATGTTGAATTCAAAGCGTGATGTT
GCCTTAATTGTGCCCGAACCCTTGCCAGCAACTCAGAAAATGAAAAAGGTTTTACCAGAT
AATCATTTGCCCCACTGTCCAGCCCTCTGACTCTGTCATCGACAGAATCCCTTGCAGTAA
GGCAAATAACAGGGGTTTGCTTTGCTGTTCTTAACGTTTGTAAGATCTGCCAGCCATCCA
TACCCGGAAGCATAATATCCAGAATGATCAATGCATAATCATCCTTCAGCGCAAGATAAA
GCCCATCTCTGCCATCAGAAACGGCATCGATGACATAACCCGCTTCGGAAAGCCCCTGCG
TTACCCATTCCTGGGTCCTTTGATTATCTTCAATAAGTAGAATCTTCATGAAAATAATAT
GCCATAAATCATATGTTATAGAAACAGCCTGGTTCATTACAAAATTGTAATGCTGCTGTA
AGGTTACCCTGGACGCTTTTTCGCTATCCTCAAAACTCATTCACATGACAAGGATATAAA
CATGTTAAAGCGTTATTTAGTACTCTCGGTAGCAACGGCAGCATTTTCATTACCTTCTTT
GGTTAATGCCGCACAACAAAACATTCTTAGCGTGCACATTTTGAACCAGCAAACAGGAAA
ACCCGCTGCTGACGTGACAGTCACTCTTGAAAAGAAGGCGGATAACGGCTGGTTACAACT
TAATACCGCCAAAACAGATAAGGATGGACGAATTAAGGCACTGTGGCCCGAGCAAACTGC
AACTACGGGCGATTACCGTGTCGTATTTAAAACCGGGGACTATTTCAAGAAACAAAATCT
TGAAAGTTTCTTCCCTGAGATCCCCGTTGAATTTCATATTAATAAAGTGAACGAGCATTA
TCATGTGCCTTTATTACTTAGCCAATATGGGTATTCAACCTATCGTGGCAGTTAATGCAT
AAATATGTAAAAGCAGATCTCTGCTACTGTTAGGGAGGACACTCCCTGACAGATTAACAG
TAAACGGCTCTTGCTGGCTAACGACAAAAAAGTGTGATGGCTTATGAAAAAGAATCAATT
TTTAAAAGAATCAGATGTTACGGCCGAGTCGGTATTCTTTATGAAGCGTCGGCAGGTGTT
AAAAGCACTGGGCATCAGTGCAACTGCACTTTCTTTGCCTCACGCTGCGCATGCCGATCT
GCTTAGCTGGTTTAAAGGGAACGATCGCCCGCCCGCCCCCGCCGGAAAAGCGCTGGAGTT
CAGCAAGCCTGCCGCCTGGCAAAATAACCTGCCACTGACGCCAGCAGATAAAGTTTCCGG
TTATAATAACTTCTATGAATTCGGGCTGGATAAAGCCGATCCCGCCGCTAATGCTGGTAG
CCTGAAAACCGATCCATGGACACTGAAAATCAGCGGCGAAGTGGCAAAACCATTGACCCT
CGATCATGATGACTTAACCCGTCGCTTCCCGCTGGAAGAGCGTATTTATCGTATGCGCTG
CGTGGAAGCGTGGTCGATGGTGGTGCCGTGGATTGGTTTTCCGCTGCACAAATTGCTGGC
GCTTGCCGAACCTACCAGCAATGCGAAGTATGTCGCTTTCGAAACAATTTATGCACCGGA
ACAGATGCCAGGCCAGCAGGACCGCTTTATCGGCGGTGGGCTGAAATATCCTTATGTCGA
AGGATTGCGTCTCGACGAAGCAATGCATCCGCTCACACTGATGACCGTAGGTGTTTATGG
CAAGGCGTTACCGCCACAAAATGGCGCGCCGGTGCGACTGATTGTGCCGTGGAAATATGG
CTTTAAAGGGATTAAATCGATAGTCAGTATTAAGCTGACCCGCGAGCGTCCGCCAACCAC
CTGGAATCTGGCAGCGCCTGACGAATACGGTTTTTACGCCAACGTTAATCCGTATGTTGA
TCACCCGCGCTGGTCACAGGCTACCGAACGATTTATTGGTTCAGGCGGCATCCTCGATGT
ACAGCGCCAGCCAACGCTACTGTTTAATGGTTACGCCGCCCAGGTGGCATCGCTGTATCG
TGGCCTGGATTTGCGGGAGAATTTCTAAATGCGTCTGACAGCAAAACAGGTGACATGGCT
GAAAGTTTGCCTGCATCTTGCCGGATTGTTGCCGTTTCTCTGGCTGGTCTGGGCGATCAA
TCACGGTGGACTGGGTGCCGATCCGGTGAAAGATATTCAGCATTTTACTGGTCGCACTGC
ACTGAAATTTTTGCTGGCGACCTTGTTAATCACCCCTCTGGCACGCTACGCAAAACAGCC
GTTATTGATACGCACTCGCCGCCTGTTAGGATTATGGTGCTTTGCCTGGGCGACACTGCA
TTTAACAAGTTACGCATTGCTGGAGCTGGGCGTGAATAATCTGGCGTTATTAGGTAAGGA
GTTAATTACCCGGCCTTATTTAACGTTAGGTATTATCAGCTGGGTAATTTTGCTTGCTTT
AGCGTTCACTTCAACCCAGGCGATGCAGCGAAAACTCGGCAAGCACTGGCAACAGTTGCA
TAATTTCGTCTATCTTGTCGCGATTCTGGCCCCAATACATTATCTGTGGTCCGTGAAGAT
TATTTCACCGCAGCCGCTCATCTACGCTGGGCTGGCTGTACTGCTTTTAGCCTTACGGTA
TAAGAAGTTGCGTTCCCTTTTTAACCGGTTACGCAAGCAGGTTCACAACAAATTATCTGT
ATAACTTCATATTGCCGACAAAGTACGCGTTATCCCTGCCGGATGTGGCGCGAGCGCCCT
ATCCGGCATACACAGATCGCATCAGGTTATGTTTCGTTTGTCATCAACCTCAAATCACCA
AAATAATTTATTTTATTTCAATAAGATAGATAAGTAGAACTGAGAAAGCCATGCTCTCGT
TTCCTAAGAGTTGTTGCATTTTGCTATATGTTACAATATAACATTACACATCATATACAT
TAACTCTGGAGGAAACTGTTTTGGCGATTCGTCTTTACAAACTGGCTGTTGCTTTAGGTG
TCTTTATTGTTAGCGCTCCTGCCTTTTCGCATGGTCATCACTCACACGGCAAACCCTTAA
CAGAGGTCGAACAAAAAGCTGCTAATGGTGTTTTTGATGATGCCAATGTACAAAACCGAA
CGCTCAGTGACTGGGATGGAGTCTGGCAATCCGTTTATCCTTTACTGCAAAGTGGCAAAC
TTGACCCCGTCTTTCAGAAGAAAGCGGATGCAGATAAAACTAAAACATTTGCTGAAATTA
AAGATTATTATCACAAAGGTTATGCAACAGATATCGAGATGATTGGCATTGAGGACGGCA
TTGTTGAATTCCATAGAAATAATGAAACAACATCGTGTAAATATGATTACGATGGATACA
AAATACTCACCTATAAATCAGGCAAGAAAGGCGTTCGTTACTTATTCGAATGTAAAGATC
CTGAAAGCAAAGCCCCTAAATATATACAATTTAGCGATCATATAATTGCACCACGAAAAT
CATCTCATTTTCACATTTTTATGGGTAATGATTCACAGCAATCTTTATTAAATGAAATGG
AAAACTGGCCAACGTATTATCCATATCAGTTGAGTAGCGAAGAAGTGGTCGAGGAAATGA
TGTCTCATTGAGTATTCTCATGATAACGCCTCGATGCCGCTTTAGTAAGTTATCATAACT
GCCACTGGTCCATCCACAAACGCCACTGAACGCAAGCTAGCTACAGACACGCTCATCACT
ATGACGTGTCTGTATATTAATAAGCTAACCCGCATTGAGTTAACCAATAACGGATTCCAT
ACACAATACGGCCAACAGAGAAAGATACCTGTGCTCACGCCATTGCTTATATTGGCTGGT
TACAATATGCACTATCAATTTTTTAAATAACAAATTATTAAAACCACATCTGTATAAGGA
ATTTTTAAGGTTCGTGGGATAGCTTGACTGTGAAAATCACAGGAGCTACAAAAATGAACC
GATTCTCAAAAACTCAAATTTATTTACATTGGATAACGCTGCTTTTCGTTGCAATAACCT
ATGCCGCGATGGAACTCCGTGGCTGGTTTCCTAAAGGTAGTAGTACTTATCTGCTGATGC
GAGAAACACATTACAATGCGGGTATATTCGTTTGGGTGTTAATGTTTTCACGCCTGATTA
TAAAACACCGTTATAGTGATCCTTCTATTGTGCCACCGCCACCTGCCTGGCAAATGAAAG
CGGCTTCGCTAATGCACATCATGCTTTATATAACCTTCCTTGCACTTCCTCTGCTGGGGA
TTGCTTTGATGGCTTACAGTGGAAAATCGTGGAGTTTCCTTGGTTTCAATGTGTCTCCCT
TTGTTACCCCAAACAGCGAAATTAAAGCACTGATAAAAAATATTCACGAAACCTGGGCAA
ATATAGGCTACTTTTTAATCGCAGCTCACGCTGGCGCAGCACTCTTTCATCACTACATTC
AGAAAGATAATACTCTGTTACGAATGATGCCTCGCCGCAAATAAGTCGATCCCCTTACAA
GGAAATGTGAACCATGGACATCAACGCGTCATAAATGTTTACGCAAGTGCACAATGCACC
CTTTCCACTATCAACAAGGAGGAGCAGAAACTGTGTAAATCGTACAATGGTAAGACTTAT
CAAAAATACAGGTTAATTTTGGTATTTAAACCTTTTTTACTTGTTAGTATGATACAAAGG
CTTTCAAAAAAGCTGCGAAATTCAACAACTCTTGGAAATTATGGACTTTGTCCCGCGGCT
TTAATCTGACGGCCGCGTTCCTTTTTTGACTCAATTATTGAACCCTTCTCTACGCAACTT
CAGTTCCCACCACCAACTTTGCGGCAGTTTCATAGGATGAATGTCTAAAAGAATAATGGT
GAGCGATAAGAAAACGACTGAATAACTGCACATTTTCGCTCGAAAGCTTCCTGTCAGATC
CATAGCGAATCAAGTGCTGAATGTCACAGTATCGAACAGAAAACAGTGACGATCTAACCC
TTCAAGAATATTCTACGATTGTTCTGTTTAGGAAAAGCAAGGCGGGAAGTCGGGAGATAA
GTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTC
CGGTTTTCGAGACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGTTCAGATGGTTGCCAT
GATGCCAGGAAATTTGGCATTTTAACAGTCCCTGTCCGTGCAATTTTGTTCAAGTGACGA
GTTTGCGAGCAAAACGATGATTAAGTGGCCCTGGAAAGTACAAGAATCAGCACATCAAAC
TGCCCTTCCCTGGCAGGAAGCACTATCGATCCCCCTTTTAACGTGTCTGACGGAACAGGA
ACAAAGCAAATTAGTCACTCTTGCCGAACGTTTTTTACAGCAAAAGCGGCTTGTTCCTTT
ACAGGGCTTTGAACTGGATTCATTAAGAAGCTGCCGGATAGCACTTCTATTTTGCCTACC
CGTTCTGGAGTTAGGACTGGAATGGCTGGATGGTTTTCATGAAGTCTTAATTTATCCTGC
GCCATTTGTGGTCGATGATGAATGGGAAGACGATATCGGTCTGGTGCATAACCAACGTAT
TGTTCAGTCAGGTCAGAGCTGGCAGCAAGGGCCTATCGTTTTGAACTGGTTGGATATACA
AGATTCTTTTGATGCTTCTGGTTTTAACCTGATTATTCATGAAGTCGCTCATAAGCTGGA
CACCCGTAACGGCGATCGCGCCAGCGGAGTTCCCTTTATTCCGTTGCGTGAGGTTGCTGG
CTGGGAACACGATCTTCATGCTGCAATGAACAACATTCAGGAAGAAATCGAATTGGTTGG
CGAGAATGCGGCGAGCATTGATGCTTATGCAGCCAGCGATCCTGCTGAATGTTTTGCCGT
ACTTTCTGAATATTTCTTTAGCGCCCCAGAACTTTTTGCTCCTCGTTTCCCTTCATTGTG
GCAACGTTTCTGCCAATTTTATCAACAAGATCCTTTGCAGAGACTGCATCACGCTAATGA
TACAGACTCGTTTTCGGCGACGAATGTTCATTAATTAACAACTTTGCAGATTAATTAACC
AATTGAAATGACTTATGAAATTTAGTGTTGACAGACAAGGTACCGCTAAGTAATATTCGC
CCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATG
TCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTCTAAAAATTCGCTTTTTTAGCGCAAT
GTCACTGACCTTAGTTGAACATTGTTTTTTAACGGATAGCGGGTTTTTAACATCTTAAGC
GCCCTCGACCTTTATGGTTGAGGGCGTTTTGCTATGAACGCCATCACCATTTTCCCCTCG
ATTATAAAACTTGAGTTATTCAGTAGTCTCCCCTCTTGCAACTCACACCCAAAACTGCCT
AACGAAAAGTTATTAATTTTCAATCATATTGCTATCAGTATTTACATTTTTTCGCTGTGC
TAGAAAGGGCGCATTTATGTTAGCTCGTTCAGGGAAGGTAAGCATGGCTACGAAGAAGAG
AAGTGGAGAAGAAATAAATGACCGACAAATATTATGCGGGATGGGAATTAAACTACGCCG
CTTAACTGCGGGTATCTGTCTGATAACTCAACTTGCGTTCCCTATGGCTGCGGCAGCACA
AGGTGTGGTAAACGCCGCAACCCAACAACCAGTTCCTGCACAAATTGCCATTGCAAATGC
CAATACGGTGCCCTACACCCTTGGAGCGTTGGAATCGGCCCAAAGCGTTGCCGAACGTTT
CGGTATTTCGGTGGCTGAGTTACGCAAACTCAACCAGTTTCGTACGTTTGCTCGAGGTTT
TGATAATGTCCGCCAGGGTGATGAACTGGATGTCCCGGCACAAGTTAGTGAAAAAAAATT
AACCCCGCCGCCGGGTAATAGCAGTGACAACCTCGAGCAACAGATAGCCAGTACTTCACA
GCAAATCGGGTCTCTGCTCGCCGAAGATATGAACAGCGAGCAAGCGGCAAATATGGCGCG
TGGATGGGCCTCTTCTCAGGCTTCAGGCGCAATGACAGACTGGTTAAGCCGCTTCGGTAC
CGCAAGAATCACGCTGGGCGTGGATGAAGATTTTAGCCTGAAGAACTCCCAGTTCGATTT
TCTCCATCCGTGGTATGAAACGCCTGATAATCTCTTTTTCAGTCAGCATACTCTCCATCG
TACTGACGAGCGTACGCAGATTAACAACGGCTTAGGTTGGCGTCATTTCACTCCCACATG
GATGTCGGGCATCAACTTCTTTTTCGACCACGATCTTAGCCGTTACCACTCCCGCGCCGG
CATTGGCGCGGAGTACTGGCGCGACTATCTAAAATTAAGCAGTAACGGCTATTTGCGACT
GACCAACTGGCGCAGCGCACCTGAACTGGACAACGATTATGAAGCACGCCCGGCCAATGG
CTGGGATGTACGCGCAGAAAGCTGGCTACCCGCCTGGCCGCACCTTGGCGGTAAACTGGT
CTATGAACAGTATTATGGCGATGAAGTGGCCCTGTTCGATAAAGACGATCGGCAAAGTAA
TCCTCATGCCATAACCGCTGGACTTAACTATACCCCCTTCCCGCTGATGACCTTCAGCGC
GGAGCAACGCCAGGGTAAACAGGGCGAAAATGACACCCGTTTTGCCGTCGATTTTACCTG
GCAACCTGGCAGCGCAATGCAGAAACAGCTTGACCCGAATGAAGTCGCTGCACGGCGTAG
CCTTGCAGGCAGCCGTTATGATCTGGTGGATCGCAACAACAATATCGTTCTGGAATATCG
CAAAAAAGAACTGGTTCGCCTGACCCTGACAGACCCCGTGACAGGGAAGTCAGGAGAAGT
GAAATCACTGGTTTCGTCGCTACAAACCAAATATGCCCTGAAAGGCTATAACGTCGAAGC
CACCGCACTGGAAGCTGCCGGTGGCAAAGTGGTCACAACGGGTAAAGATATTCTGGTTAC
CCTGCCGGCTTACCGGTTCACCAGTACGCCAGAAACCGATAACACCTGGCCGATTGAAGT
CACCGCCGAAGATGTCAAAGGCAATTTGTCGAATCGTGAACAGAGCATGGTGGTCGTTCA
GGCACCTACGCTAAGCCAGAAAGATTCCTCGGTATCGTTAAGTACCCAAACATTGAACGC
GGATTCCCATTCAACCGCCACACTGACTTTTATTGCGCATGATGCAGCAGGTAATCCTGT
TGTCGGGCTGGTGCTCTCGACGCGTCACGAAGGTGTTCAGGACATCACCCTTTCTGACTG
GAAAGATAATGGTGACGGAAGCTATACCCAGATCCTGACCACAGGAGCGATGTCTGGCAC
GCTGACGCTGATGCCACAGCTGAATGGTGTGGATGCGGCTAAAGCCCCCGCCGTGGTGAA
TATCATTTCTGTTTCGTCATCCCGAACTCACTCGTCAATTAAGATTGATAAGGACCGTTA
TCTCTCCGGCAATCCTATCGAGGTGACGGTAGAACTGAGAGATGAAAATGACAAACCTGT
TAAGGAACAAAAACAGCAACTGAATAACGCAGTCAGCATCGACAACGTGAAACCAGGAGT
CACTACAGACTGGAAAGAAACCGCAGATGGCGTCTATAAGGCGACCTATACCGCCTATAC
CAAAGGCAGTGGACTTACTGCGAAGCTATTAATGCAAAACTGGAATGAAGATTTGCATAC
CGCTGGATTTATCATCGACGCCAACCCGCAGTCAGCGAAAATTGCGACATTATCTGCCAG
CAATAATGGTGTGCTCGCCAATGAGAATGCAGCAAACACCGTCTCGGTCAATGTCGCTGA
TGAAGGAAGCAACCCAATCAATGATCATACCGTCACGTTTGCGGTATTAAGCGGATCGGC
AACTTCCTTCAACAATCAAAACACCGCAAAAACGGATGTTAATGGTCTGGCGACTTTTGA
TCTGAAAAGTAGTAAGCAGGAAGACAACACGGTTGAAGTCACCCTTGAAAATGGCGTGAA
ACAAACGTTAATCGTCAGTTTTGTCGGCGACTCGAGTACTGCGCAGGTTGATCTGCAGAA
GTCGAAAAATGAAGTGGTTGCTGACGGCAATGACAGCGTCACAATGACCGCGACCGTCCG
GGATGCAAAAGGCAACCTGCTCAATGACGTCATGGTCACTTTCAATGTTAATTCAGCAGA
GGCGAAACTGAGCCAAACCGAAGTGAATAGCCACGACGGGATCGCCACAGCTACGCTGAC
CAGTTTGAAAAATGGTGATTATAGGGTTACGGCCTCTGTGAGCTCTGGTTCCCAGGCTAA
TCAACAGGTGAATTTTATCGGTGATCAAAGTACTGCTGCCCTGACCCTCAGTGTGCCTTC
AGGTGATATCACCGTCACCAACACAGCTCCGCAATATATGACTGCAACCTTGCAGGATAA
AAATGGCAACCCACTAAAAGATAAAGAAATCACCTTCTCTGTGCCAAACGACGTCGCAAG
TAAGTTCTCGATTAGCAACGGAGGAAAAGGCATGACGGATAGTAACGGGGTTGCAATCGC
CTCCCTGACCGGCACGTTAGCGGGCACGCATATGATCATGGCTCGTCTGGCTAACAGCAA
TGTCAGCGATGCACAGCCAATGACGTTTGTGGCGGATAAAGACAGAGCGGTTGTCGTTTT
GCAAACATCGAAAGCGGAAATCATTGGGAATGGCGTGGATGAGACAACTCTGACAGCAAC
AGTGAAAGATCCGTCGAATCATCCGGTGGCGGGGATAACGGTAAACTTCACCATGCCACA
GGACGTTGCGGCAAACTTTACCCTTGAAAATAACGGTATTGCCATCACTCAGGCCAATGG
GGAAGCGCATGTCACGCTGAAAGGTAAAAAAGCGGGCACGCATACGGTTACCGCAACGCT
GGGTAATAACAATACCAGTGATTCGCAGCCGGTAACATTTGTGGCGGACAAAGCCTCGGC
TCAGGTTGTCCTGCAGATATCAAAAGATGAGATCACAGGTAATGGCGTCGATAGCGCAAC
GCTAACTGCAACGGTTAAAGATCAGTTCGACAATGAGGTGAATAATCTTCCGGTAACATT
CAGCTCAGCCTCTTCAGGACTCACCCTGACCCCGGGAGTAAGTAATACCAACGAGTCTGG
CATCGCGCAGGCCACTCTCGCAGGCGTTGCCTTTGGTGAGAAGACGGTTACTGCATCACT
GGCTAATAATGGTGCCAGCGACAACAAAACTGTGCATTTTATTGGCGACACAGCGGCGGC
AAAAATTATCGAGTTGGCGCCTGTCCCAGACAGCATAATCGCCGGTACCCCGCAGAACAG
CTCCGGCAGCGTCATCACCGCCACAGTCGTTGATAATAATGGCTTTCCGGTGAAAGGTGT
GACTGTGAACTTCACCAGCAACGCAGCGACAGCCGAAATGACGAACGGCGGTCAAGCCGT
GACGAACGAACAGGGTAAGGCTACCGTCACTTATACCAATACCCGCTCCTCGATAGAATC
AGGAGCGAGACCGGATACCGTTGAGGCCAGTCTGGAAAATGGTAGCTCCACGCTTAGCAC
ATCAATTAATGTCAACGCTGATGCGTCTACGGCACATCTCACCTTGCTACAGGCACTTTT
TGATACAGTCTCCGCAGGCGAGACAACCAGTCTGTATATTGAGGTGAAGGATAATTACGG
CAACGGTGTCCCCCAGCAGGAGGTAACCCTCAGCGTTTCACCAAGTGAAGGCGTGACCCC
CAGTAATAACGCTATATATACTACCAACCACGACGGCAATTTTTACGCAAGCTTTACCGC
TACAAAAGCCGGGGTTTATCAATTGACGGCAACCCTCGAAAATGGCGATTCGATGCAACA
AACAGTGACCTATGTGCCGAACGTCGCGAATGCTGAAATCACGCTGGCAGCCTCGAAGGA
TCCGGTGATTGCCGACAATAACGATCTCACGACACTAACAGCAACAGTCGCTGATACAGA
GGGCAATGCGATAGCCAACACTGAGGTAACATTTACTCTGCCGGAAGATGTGAAGGCGAA
CTTCACGCTGAGCGATGGCGGTAAAGTGATTACTGATGCTGAAGGCAAAGCGAAAGTCAC
GCTGAAAGGTACAAAAGCAGGCGCTCATACTGTTACAGCATCGATGACTGGCGGTAAGAG
TGAGCAGTTGGTGGTGAACTTTATTGCGGATACGCTCACTGCGCAGGTTAATCTTAACGT
TACCGAGGACAATTTTATCGCTAATAACGTCGGGATGACCAGGCTGCAGGCAACAGTGAC
TGATGGAAACGGCAACCCGTTAGCCAATGAGGCGGTGACATTCACGCTACCGGCAGATGT
GAGCGCAAGCTTTACTCTCGGACAAGGCGGTTCCGCCATTACTGATATCAACGGCAAGGC
TGAAGTTACACTGAGCGGTACAAAATCCGGCACCTACCCCGTGACAGTTAGCGTGAACAA
TTATGGTGTCAGTGATACGAAACAGGTGACTTTGATTGCCGATGCTGGTACCGCAAAACT
AGCCTCCTTAACCTCTGTATACTCATTCGTCGTCAGCACGACCGAGGGCGCAACCATGAC
GGCAAGCGTCACTGACGCTAACGGCAACCCGGTAGAAGGCATAAAAGTTAATTTCCGCGG
AACCTCCGTCACGCTAAGCAGCACCAGCGTTGAAACGGATGATCGGGGTTTCGCTGAAAT
TCTTGTGACAAGCACCGAGGTCGGACTGAAAACAGTTTCAGCCTCTCTGGCAGATAAACC
TACTGAAGTCATCTCGCGATTACTGAATGCCAGTGCAGATGTTAATTCTGCGACGATTAC
CAGTCTGGAGATACCGGAAGGTCAGGTAATGGTCGCACAAGACGTAGCAGTTAAAGCTCA
CGTTAACGACCAGTTTGGCAACCCGGTTGCGCATCAACCCGTGACATTCAGTGCAGAGCC
ATCCTCGCAAATGATCATCAGCCAGAATACGGTCTCTACTAATACGCAGGGTGTAGCCGA
GGTCACCATGACGCCCGAAAGAAACGGTTCGTATATGGTGAAAGCATCCCTGCCGAATGG
AGCCTCACTTGAGAAACAACTGGAGGCTATTGATGAAAAACTGACACTCACGGCGTCCAG
TCCGCTTATCGGTGTCTATGCCCCTACAGGCGCTACTCTGACGGCAACGCTAACCTCTGC
AAATGGCACTCCAGTGGAGGGTCAGGTCATCAACTTTAGCGTAACGCCAGAAGGGGCGAC
GTTAAGTGGCGGAAAAGTGAGAACTAACTCTTCAGGTCAGGCTCCAGTCGTTTTGACCAG
CAATAAAGTCGGTACATATACGGTGACTGCATCTTTCCATAACGGCGTAACAATACAGAC
ACAGACAACCGTGAAAGTCACTGGCAACTCAAGCACCGCCCATGTTGCTAGCTTTATCGC
TGATCCATCGACTATCGCCGCCACCAACACTGATTTAAGTACCTTAAAGGCAACGGTTGA
GGATGGCAGTGGTAACCTGATCGAAGGTCTCACTGTGTACTTCGCCTTAAAAAGCGGCTC
TGCCACATTAACGTCATTAACAGCGGTGACCGATCAAAACGGAATCGCGACAACAAGCGT
GAAAGGAGCGATGACAGGTAGCGTCACGGTAAGCGCAGTCACGACCGCTGGTGGAATGCA
AACAGTAGATATAACGCTGGTGGCTGGCCCGGCAGACACCTCGCAGTCCGTCCTTAAGAG
CAATCGGTCATCACTGAAAGGGGACTATACCGATAGTGCTGAATTACGTCTTGTTCTGCA
CGATATATCAGGCAATCCGATCAAAGTTTCTGAAGGGATGGAATTTGTGCAATCAGGTAC
TAACGTGCCCTATATAAAAATTAGCGCAATTGATTACAGTCTAAATATCAACGGTGATTA
CAAAGCCACTGTTACAGGAGGCGGAGAGGGTATCGCAACGCTGATCCCTGTATTGAATGG
TGTTCATCAAGCTGGTCTGAGTACCACAATACAATTCACTCGCGCAGAAGACAAAATAAT
GAGCGGTACAGTATCAGTCAATGGTACTGACCTACCGACAACTACATTCCCTTCGCAGGG
GTTCACCGGGGCGTATTATCAGTTGAATAATGACAACTTTGCCCCAGGAAAAACGGCGGC
TGATTATGAGTTTTCAAGCTCTGCCTCCTGGGTCGATGTTGATGCTACCGGTAAAGTGAC
ATTTAAAAATGTCGGCAGCAATTCGGAAAGGATTACGGCGACGCCAAAATCAGGAGGCCC
TAGCTATGTATACGAAATCCGTGTGAAGAGTTGGTGGGTGAACGCCGGCGAGGCTTTCAT
GATATACAGCCTTGCTGAAAATTTTTGCAGCAGCAATGGCTACACGCTCCCCAGAGCAAA
CTATTTAAACCACTGTAGTTCCCGAGGCATCGGGTCACTGTACAGTGAATGGGGAGATAT
GGGGCATTACACGACTGACGCTGGTTTTCAATCAAATATGTATTGGTCATCTAGTCCCGC
AAACTCAAGCGAACAATACGTAGTTTCCCTGGCAACAGGTGATCAAAGCGTATTTGAAAA
GCTTGGGTTTGCTTATGCGACATGTTATAAAAACCTGTGATTTTCCGTTATAATTTCTTA
AAGAGTGTTCCATTCGGGGCACTCTTTTTTACATTCCCTCTACAGAACTAGCCCTTCTCT
CACAGAAAATGAATAAATAAAAATGCGGCACCGCCAGAATCGCGTTCGATGTGACTATGA
TCATTTTCGGTGAGTACTGCTTTGATCTAAAGGCTGGTTTTCTGTGATGATTGACCAGCC
TCAGAGTATTGATGACACCACCGTTCATAACAGATCGGCATTACTATGCATAAGTACTGT
CTCATATTCTCGCCAAAACACTTTTTAATGCCTTTGCGAATTCATCCAGACTTATATTGT
CAATTTTTTGCCCAACGACGACTGACTCCGAGACATCGGCCATTGCGGGCCATCGCGTTT
TGTAATCAGCATAAATTGCAACAACAGGGGTATTATAGGCACTTGCCATATGTAATATTG
AGGTGTCAGGAGTTATTGCGATATAAGCATCTTTTATGATTGCTGCTGAACGTTTAATCG
AGGGTGGTAAGGATAAACGGTAGACATTATTATAACAATCCACTAATGCCCTGGCTTTAT
CTTCACCTTTGGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTAAATTTTTG
CTATTAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAAT
TGAACGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCT
CACTTAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAA
ATGCCCATGTCATAGGTACGGGAGCCCGGAGTTTCTGATCCATACTGGACGCGTTCTTGC
ACAAAGGGGAGAAGCAATTCATGGTTATACCAACAACCTGAAAATTCGTTTTTGCTTTCA
ACTGACTGATAAATAACATCGTTTTCAGGTTCTTTTTACGCATCCCCTCAATGCAAAGAT
CCGGCGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTG
CGTGATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTGTTCAAGTTTAAGCGCAT
TAAAGACTTCTAAATTAATTGTCGACGTTACAATTAAAAGATGCTTAATTTTATGCAATT
CAAGCGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGATCGGGAATATGGA
TGACAACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAA
ATGCAATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTA
TAATGCAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTA
TGTTTCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCC
TGCGCTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAATCATTTG
CAGATGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAG
TTACCTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACG
CTCATCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCG
TTAGGCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACC
GCCGCACTGGTGTTTAATCGCGAGTTTTTCCCGCAAGTAAGCCCGGCGATGGGAACGCTC
GCCGCATTTGCTACCTTTGGCGTCGGATTTCTTTTCCGTCCGCTCGGCGGTGTCATTTTC
GGTCACTTTGGCGACCGACTGGGACGTAAGCGCATGTTAATGCTGACCGTCTGGATGATG
GGCATCGCGACAGCCTTGATTGGTATTCTTCCTTCATTCTCGACCATTGGGTGGTGGGCA
CCTATTTTGCTGGTGACACTGCGTGCCATTCAGGGATTTGCAGTCGGCGGCGAATGGGGA
GGCGCGGCGTTGCTTTCCGTTGAAAGTGCACCGAAAAATAAAAAAGCCTTTTACAGTAGC
GGTGTACAAGTTGGCTACGGTGTAGGTTTACTGCTTTCAACCGGACTGGTTTCATTGATC
AGTATGATGACGACTGACGAACAGTTTTTAAGCTGGGGCTGGCGCATTCCTTTCCTGTTT
AGCATCGTACTGGTACTGGGAGCATTGTGGGTGCGCAATGGCATGGAGGAGTCCGCGGAA
TTTGAACAACAGCAACATTATCAAGCTGCCGCGAAAAAACGCATCCCGGTTATCGAAGCG
CTGTTACGACATCCCGGTGCTTTCCTGAAGATTATTGCGCTACGACTGTGCGAATTGCTG
ACGATGTACATCGTTACTGCCTTTGCACTTAATTATTCAACCCAGAATATGGGGCTACCG
CGCGAACTTTTCCTTAATATTGGTTTGCTGGTAGGTGGATTAAGCTGCCTGACAATTCCC
TGTTTTGCCTGGCTTGCCGATCGTTTTGGTCGCCGTAGGGTTTATATCACAGGTACGTTA
ATCGGAACGTTGAGCGCATTTCCTTTCTTTATGGCGCTTGAAGCACAATCTATTTTCTGG
ATAGTTTTCTTCTCCATAATGCTGGCAAACATTGCGCATGACATGGTGGTGTGTGTGCAA
CAACCGATGTTTACCGAAATGTTTGGTGCCAGTTATCGCTATAGTGGCGCTGGAGTCGGT
TATCAGGTTGCCAGTGTGGTTGGCGGTGGATTTACACCTTTTATTGCCGCTGCACTCATC
ACTTACTTTGCCGGGAACTGGCATAGCGTCGCCATTTATTTGCTGGCTGGATGCCTGATT
TCCGCAATGACCGCTTTGTTGATGAAAGACAGTCAACGCGCTTGATAGCCTGGCGAAGAT
CATCCGATCTTCGCCTTACACTTTTGTTTCACATTTCTGTGACATACTATCGGATGTGCG
GTAATTGTATGGAACAGGAGACACACATGAATAATAAGGGCTCCGGTCTGACCCCAGCTC
AGGCACTGGATAAACTCGACGCGCTGTATGAGCAATCTGTAGTCGCATTACGCAACGCCA
TTGGCAACTATATTACAAGTGGCGAATTACCTGATGAAAACGCCCGCAAACAAGGTCTTT
TTGTCTATCCATCACTGACCGTAACCTGGGACGGTAGCACAACCAATCCCCCCAAAACGC
GCGCATTTGGTCGCTTTACCCACGCAGGCAGCTACACCACCACGATTACTCGCCCTACTC
TCTTTCGTTCGTATCTTAATGAACAACTTACGTTGCTGTATCAGGATTATGGTGCGCATA
TCTCAGTGCAACCCTCGCAGCATGAAATCCCTTATCCTTATGTCATCGATGGCTCTGAAT
TGACACTTGATCGCTCAATGAGCGCTGGGTTAACTCGCTACTTCCCGACAACAGAACTGG
CGCAAATTGGCGATGAAACTGCAGACGGCATTTATCATCCAACTGAATTCTCCCCGCTAT
CGCATTTTGATGCGCGCCGCGTCGATTTTTCCCTCGCACGGTTGCGCCATTATACCGGTA
CGCCAGTTGAACATTTTCAGCCGTTCGTCTTGTTTACCAACTACACACGTTATGTGGATG
AATTCGTTCGTTGGGGATGCAGCCAGATCCTCGATCCTGATAGTCCCTACATTGCCCTTT
CTTGTGCTGGCGGGAACTGGATCACCGCCGAAACCGAAGCGCCAGAAGAAGCCATTTCCG
ACCTTGCATGGAAAAAACATCAGATGCCAGCATGGCATTTAATTACCGCCGATGGTCAGG
GTATTACTCTGGTGAATATTGGCGTGGGACCGTCAAATGCTAAAACCATCTGCGATCATC
TGGCAGTGCTACGCCCGGATGTCTGGTTGATGATTGGTCACTGTGGCGGATTACGTGAAA
GTCAGGCCATTGGCGATTATGTACTTGCACACGCTTATTTACGCGATGACCACGTTCTTG
ATGCGGTTCTGCCGCCCGATATTCCTATTCCGAGCATTGCTGAAGTGCAACGTGCGCTTT
ATGACGCCACCAAGCTGGTGAGCGGCAGGCCCGGTGAGGAAGTCAAACAGCGGCTACGTA
CTGGTACTGTGGTAACCACAGATGACAGGAACTGGGAATTACGTTACTCAGCTTCTGCAC
TTCGTTTTAACTTAAGCCGGGCCGTAGCAATTGATATGGAAAGTGCAACCATTGCCGCGC
AAGGATATCGTTTCCGCGTGCCATACGGGACACTACTGTGTGTTTCAGATAAACCGTTGC
ATGGCGAGATTAAACTTCCCGGCCAGGCTAACCGTTTTTATGAAGGCGCTATTTCCGAAC
ATCTGCAAATTGGCATTCGGGCGATCGATTTGCTGCGCGCAGAAGGCGACCGACTGCATT
CGCGTAAATTACGAACCTTTAATGAGCCGCCGTTCCGATAATAAGTTCTGAACCTTCTTA
TCAGAAATAGATGTGAAGGAGTAAGTAAGACACCTGGCAAATAGCCTGCAAT