MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 2-2.seq
 Deletion 2-2
 Length 46155
 Fasta Format

>2-2
TTCCATATTCAACGAACGCAGAGGATCAACCTTTACCCGTTGTGCTTTCTGCACGGGTGA
CGGTATAGAACAACCCACTAGCACCATAAGCGCCATTGCCGGAAAGAAAGCGTTCATCAT
CATTAAATTACCGTCTGGTTTGCAGGTGAGTCTTATTATTTATATCGGTATAGTGGCTGA
TATCTTACGAATTTCCTTAAGCCTCTATAAGCTGTAGTGATAAAACTCAGATTATTCCAG
TGCGCCAACCAAATGATTTATCGGTCAGACTTTTTTTAACCAGATACAGAGACACAGATG
CAGCCCAAAATTTACTGGATTGATAACCTGCGAGGGATAGCGTGTTTAATGGTGGTGATG
ATTCACACCACTACCTGGTATGTGACCAATGCTCATAGTGTTAGCCCCGTCACATGGGAT
ATCGCCAATGTTCTGAATTCTGCCTCTCGTGTCAGCGTGCCGCTATTTTTCATGATTTCC
GGCTATCTCTTTTTTGGCGAACGCAGCGCCCAGCCGCGCCATTTCTTGCGTATCGGCTTA
TGTCTGATTTTTTATAGCGCAATCGCACTGCTCTACATTGCGCTGTTTACCTCCATCAAT
ATGGAGTTAGCGCTGAAAAACCTGCTGCAAAAGCCAGTGTTTTACCACTTGTGGTTTTTC
TTCGCGATTGCGGTGATTTATCTGGTTTCACCGCTGATTCAGGTGAAGAACGTCGGCGGA
AAAATGTTGCTGGTGCTAATGGCGGTGATTGGCATTATCGCTAACCCAAACACAGTGCCG
CAGAAAATTGACGGTTTTGAATGGCTGCCAATTAACTTATATATCAATGGCGATACTTTT
TACTACATTCTGTATGGCATGTTGGGCCGCGCTATAGGGATGATGGACACACAGCATAAA
GCACTGTCGTGGGTGAGCGCCGCGCTGTTTGCGACGGGGGTTTTTATTATCTCTCGCGGG
ACATTATATGAATTGCAGTGGCGCGGAAATTTTGCCGATACCTGGTATCTTTACTGTGGG
CCGATGGTTTTTATCTGCGCAATCGCGCTATTGACTCTGGTTAAAAACACGCTGGATACG
CGTACCATTCGCGGACTTGGCTTAATCTCCCGCCATTCATTGGGTATATACGGATTCCAC
GCCTTGATTATCCATGCGCTGCGCACCCGGGGAATTGAGCTTAAAAATTGGCCAATACTG
GATATTATTTGGATCTTTTGCGCGACGTTGGCAGCGAGTTTGTTACTTTCTATGCTGGTA
CAACGAATCGACAGAAACAGATTAGTGAGTTAAGTAAAAGCCCGGTCACATTGGACTGAC
CGGGCTTACGTGAGTTATTCGCTGTATTCTTCCTGGGTAACCTGTGTTTCTTTTGGTGGG
TTTATTCCGGCATCACGAATATTTTTCTGCACCGCTACTGCACCAAACAAGCTTAAGAAG
AAAGCCAGTCCATAAAAACCTTTTTCGCTGAGTAATAATGTCGCATTCCACAGACCTACC
ATCAGTAATGCAACAGAGATAATAAAGACAGTCAGGCAGGTCATATAATAAATGGAAGTG
GTCGGTATGCCTTCATACTTGTCCCGAACGGTCTTTTGATAAGACGCCGCAGAAAACAGT
CCTAATACCAGTACGGCAAAATAATATCCTTTTTCATTTAACTGCATCTCTGCATTCCAT
AGCCCTAACAGATAGGTAACGATACCACCAACGAGAGCTATCCATGACACAATACTAAAG
GCCGGTGAATAGGTTGATATTTTGTTGTCCATCACAGTATTCCTTTCATTCCTGAATATG
TAAGAGCTTTATGTTGCTCATGCCGAGCGAAACAAACGCATTTGACCAAACAAGCAGACA
AAAAAGGCGATGGGATAGATCACCATTTCATAAGTATTGATAGGTGCGTTTAAAACACCG
ATAAACAAGAGACCGATAGTGATTAACGCAACTAACTGGCAGATATGGGTAAAAAAATCA
TCCAGTTGCCCGAGTTTTTCTGCGCGAAGATATGCATAGTTGCCAAAAGTTGCTGTCATT
AACACGCCAAGAAAATAGCCTTTTCCACTTAACAATGGGCATGAGATCCATAGCCCAACC
AGATAAACCAGCGCCCCGACAACAAATAATAGTTTTGCCACAGTCTTTGAGGTTTTCATA
ACGATCTCCATATCTACCAGCGATACATTACGAGTAACCAACGAAAGACAAAACTGAAAA
ATGCCATTAACAAATGATTTTCAGAATAAATTCATACTAAATATTAATTAATTACTGAGA
TATATAGATGTGAATTATCCCCCACCCGGTCAGGCAGGGGATAACGTTTACGCCATTAAT
GGCAGAAGTTGCTGATAGAGGCGACGGAACGTTTCTCGTCGTGGCTGATAAGCGGCATAA
CGCTGCGCATCTGGTAGATGCGACTGTTCTAACGGTAGTTGCGGCAACAATTCAATGAGC
GATTTCTCTGGATTCGCCGCGATCTGCGCCAGCCTTGCTGCGCCCAGTGCTGGCCCCACA
TCCCCCCCCGTACGGTAATCGAGCTGCTGACCGCTGATATCCGCCAGCATCTGACGCCAG
TACTCACTACGCGCCCCGCCCCCAATCAACGTAACACTTTGCGGTTTAATACCGCAGGCA
TGCACGACATCCATGCCATCTGCCAGCGCATAACCCACGCCTTCCAGCACTGCTCGCGCC
AGTTCATTGGGGCCATGTTGATGAGTCAAACCAAAGAAAACCCCCTTCGCCTGGGGATTA
TTGTGTGGCGTACGCTCGCCGGAAAGATAAGGCAGAAACCAAACTGGCTCGGCACTTTCA
TCAGCCTGTTGAGCTGCAGCGATTAAAGCTGGGACATTGCTCAGGCCGGTTAATTTCGCG
GCCCAATCCAGACACGACGCTGCACTCAGCATCACAGACATTAAATGCCAACGTTGCGGT
AGCGCATGGCAAAAGCTATGTACGGCGCTTTCTGGCTTGCTTAAGAACCCTTCGCTGACA
GCAAAATAGACCCCCGACGTCCCCAGCGATAACATTGCCTGATTAGCATCAACCATTCCC
ACACCAACTGCACCAGCTGCATTGTCGCCACCGCCTGCGACAACTGGCACCGTCGCCATA
CCCCACGCTTTCGCAACTTCAGGTAACAAAGCACCAGTAATTTCGCTGCCTTCGTATAAT
GCGGGCATCTGGTCACGAGATAAGTCGCAAGCCTGCAGCATGACGTCACTCCAGTCACGC
TTTGCGACATCCAGCCACATGGTGCCAGCTGCGTCAGACATATCGCTGGCAAACTCCCCC
GTCATACGCAGACGCAAGTAATCTTTCGGTAATAATACTTTGTCGATTTGACGGAATATC
TCCGGCTCATGCCGCTGAACCCATAGCAATTTAGGCGCAGTAAATCCGGGCATCATCAGG
TTGCCGGTAATCACCCGCGATTGCGGAACTCGCGCTTCCAGCAAAGTGCACTCTTGCGCA
CAGCGCCCGTCGTTCCACAAAATGGCAGGGCGTAACACCCGTTGCTGAGCATCCAGCAAG
GTTGCTCCGTGCATCTGGCCGGCAATACCCAATGCTTTAACGTCCTGCAGAGAATGCTGA
TCGCCCAGAGCTTTCATTGCGCGATCAGTTGCCTGCCACCACTGTTCCGGGTCTTGTTCC
GACCAGAGTGGATGCGGGCGCGAAACGGTCAGCTTTTCCGTTTGCGCAGCAACCACCTCA
CCCTGCTCGTTGAGCAAAATAACTTTTACGCCCGAGGTGCCAAGATCTATCCCGATATAC
ATATCGATCGTTCCTTAAAAAAATGCCCGGTATCGCTACCGATAACCGGGCCAACGGACT
GCACAGTTAGCCGTTATTTGTCGAACAGATAATGGTTTACCAGATTTTCCAGTTGTTCCT
GGCGACCACTCTGATGCACCGGAGACAAATGATGTTCCTGAGCATATTTGGCTAAATCTG
CCAGTGACATTTGGCCTTTCAGGATTTGCTGGCCCAATTCGCTATTCCAGCCGGAATAAC
GCTGCGCGATGCGTTTATCCAGCTCGCCATCTTCAATCATGCGCGCTGCAATTTTCAGCG
CCAGTGCCATCGTATCCATCGCGCCGATATGACCGTAAAACAGATCATATTTATCAGTAC
TTTGACGACGTACTTTGGCATCGAAGTTCAGACCACCGGTGGTGAAACCGCCTGCTTTGA
GAATTTCATACATCACCAGCGCATTCTCTTCCACACTGTTCGGGAACTGGTCGGTGTCCC
AGCCCAGTTGCGCATCGCCACGGTTGGCGTCGACAGAACCGAACAGGCCAAGCGCAATGG
CGGTGGCTATTTCATGATGGAAAGAGTGACCTGCCAGCGTCGCGTGGTTAGCTTCAATGT
TCAGTTTAATCTCTTTTTCCAGACCAAACTGTTTCAGGAAGCCATAGACCGTCGCGGCAT
CGTAATCATATTGATGTTTGGTCGGTTCTTGCGGTTTCGGTTCGATAAGCAACGTGCCCT
GGAAACCGATTTTATGTTTATGCTCAACCACCATCTGCATAAAGCGGCCCAGTTGTTCAC
GCTCCTGACGCAAGTCGGTATTTAACAGCGTTTCGTAACCTTCACGACCGCCCCACAGGA
CATAGTTTTCACCGCCCAATTTATGGGTTGCTTCCATCGCTGTAACAACTTGCGTTGCCG
CCCAGCTGAAGACTTCAGGATCTGGGTTCGTCGCCGCACCCGCGCCGTAGCGAGGGTTTG
TAAAGCAGTTGGCCGTTCCCCACAGCAGCTTCACGCCGCTCTCTTCTTGCTTGCCTGCCA
GGACATCAACCATTTGCGCAAAATTATTGATGTACTCTTTTAACGACGCGCCCTCAGGGG
AAACATCCACATCGTGGAAGCAATAAAATGGCACATGTAACTTGTGGAAAAACTCAAATG
CGACATCTGCTTTACGCTTCGCCAACGCCAGTGCCTCACCAGGCTGCTGCCACGGACGAT
TAAACGCCCCCACACCAAACATATCCGCCCCGTTCCAGCAGAAGGTGTGCCAGTAGCAGG
CGGCAAAACGCAAGTGCTCTTCCATACGCTTACCCAACACCAGTTCGTCGGGATTGTAGT
GACGGAATGCTAACGGGTTTGAGGATTTTGAGCCTTCATAACGAACGCGATCGAGCTGGT
CAAAATAGGCTTGCATATTGAACTCCATAATCAGGTAATGCCGCGGGTGATGGATGATGT
CGTAATATTGGGCACTCCCTTTCAGTTGCTCAATTATGTTATTTCACACTGCTATTGAGA
TAATTCACAAGTGTGCGCTCGCTCGCAAAATAAAATGGAATGATGAAACTGGGTAATTCC
TCGAAGAGAAAAATGCAATAAGTACAATTGCGCAACAAAAGTAAGATCTCGGTCATAAAT
CAAGAAATAAACCAAAAATCGTAATCGAAAGATAAAAATCTGTAATTGTTTTCCCCTGTT
TAGTTGCTAAAAATTGGTTACGTTTATCGCGGTGATTGTTACTTATTAAAACTGTCCTCT
AACTACAGAAGGCCCTACACCATGAAAATAAAGAACATTCTACTCACCCTTTGCACCTCA
CTCCTGCTTACCAACGTTGCTGCACACGCCAAAGAAGTCAAAATAGGTATGGCGATTGAT
GATCTCCGTCTTGAACGCTGGCAAAAAGATCGAGATATCTTTGTGAAAAAGGCAGAATCT
CTCGGCGCGAAAGTATTTGTACAGTCTGCAAATGGCAATGAAGAAACACAAATGTCGCAG
ATTGAAAACATGATAAACCGGGGTGTCGATGTTCTTGTCATTATTCCGTATAACGGTCAG
GTATTAAGTAACGTTGTAAAAGAAGCCAAACAAGAAGGCATTAAAGTATTAGCTTACGAC
CGTATGATTAACGATGCGGATATCGATTTTTATATTTCTTTCGATAACGAAAAAGTCGGT
GAACTGCAGGCAAAAGCCCTGGTCGATATTGTTCCGCAAGGTAATTACTTCCTGATGGGC
GGCTCGCCGGTAGATAACAACGCCAAGCTGTTCCGCGCCGGACAAATGAAAGTGTTAAAA
CCTTACGTTGATTCCGGAAAAATTAAAGTCGTTGGTGACCAATGGGTTGATGGCTGGTTA
CCGGAAAACGCATTGAAAATTATGGAAAACGCGCTAACCGCCAATAATAACAAAATTGAT
GCTGTAGTTGCCTCAAACGATGCCACCGCAGGTGGGGCAATTCAGGCATTAAGCGCGCAA
GGTTTATCAGGGAAAGTAGCAATCTCCGGCCAGGATGCGGATCTCGCAGGTATTAAACGT
ATTGCTGCCGGTACGCAAACTATGACGGTGTATAAACCTATTACGTTGTTGGCAAATACT
GCCGCAGAAATTGCCGTTGAGTTGGGCAATGGTCAGGAACCAAAAGCAGATACCACACTG
AATAATGGCCTGAAAGATGTCCCCTCCCGCCTCCTGACACCGATCGATGTGAATAAAAAC
AACATCAAAGATACGGTAATTAAAGACGGATTCCACAAAGAGAGCGAGCTGTAAGCGTTA
CGCCCCAGCGCGGAGCGGGGGCGTGATTTCTCTCCATGCCGCGTGAATGAATTGGCTTAG
GTGGAGTCGTTATGCCTTATCTACTTGAAATGAAGAACATTACCAAAACCTTCGGCAGTG
TGAAGGCGATTGATAACGTCTGCTTGCGGTTGAATGCTGGCGAAATCGTCTCACTTTGTG
GGGAAAATGGGTCTGGTAAATCAACGCTGATGAAAGTGCTGTGTGGTATTTATCCCCATG
GCTCCTACGAAGGCGAAATTATTTTTGCGGGAGAAGAGATTCAGGCGAGTCACATCCGCG
ATACCGAACGCAAAGGTATCGCCATCATTCATCAGGAATTGGCCCTGGTGAAAGAATTGA
CCGTGCTGGAAAATATCTTCCTGGGTAACGAAATAACCCACAATGGCATTATGGATTATG
ACCTGATGACGCTACGCTGTCAGAAGCTGCTCGCACAGGTCAGTTTATCCATTTCACCTG
ATACCCGCGTTGGCGATTTAGGGCTTGGGCAACAACAACTGGTTGAAATTGCCAAGGCAC
TTAATAAACAGGTGCGCTTGTTAATTCTCGATGAACCGACAGCCTCATTAACTGAGCAGG
AAACGTCGATTTTACTGGATATTATTCGCGATCTACAACAGCACGGTATCGCCTGTATTT
ATATTTCGCACAAACTCAACGAAGTCAAAGCGATTTCCGATACGATTTGCGTTATTCGCG
ACGGACAGCACATTGGTACGCGTGATGCTGCCGGAATGAGTGAAGACGATATTATCACCA
TGATGGTCGGGCGAGAGTTAACCGCGCTTTACCCTAATGAACCACATACCACCGGAGATG
AAATATTACGTATTGAACATCTGACGGCATGGCATCCGGTTAATCGTCATATTAAACGAG
TTAATGATGTCTCGTTTTCCCTGAAACGTGGCGAAATATTGGGTATTGCCGGACTCGTTG
GTGCCGGACGTACCGAGACCATTCAGTGCCTGTTTGGTGTGTGGCCCGGACAATGGGAAG
GAAAAATTTATATTGATGGCAAACAGGTAGATATTCGTAACTGTCAGCAAGCCATCGCCC
AGGGGATTGCGATGGTCCCCGAAGACAGAAAGCGCGACGGCATCGTTCCGGTAATGGCGG
TTGGTAAAAATATTACCCTCGCCGCACTCAATAAATTTACCGGTGGCATTAGCCAGCTTG
ATGACGCGGCAGAGCAAAAATGTATTCTGGAATCAATCCAGCAACTCAAAGTTAAAACGT
CGTCCCCCGACCTTGCTATTGGACGTTTGAGCGGCGGCAATCAGCAAAAAGCGATCCTCG
CTCGCTGTCTGTTACTTAACCCGCGCATTCTCATTCTTGATGAACCCACCAGGGGTATCG
ATATTGGCGCGAAATACGAGATCTACAAATTAATTAACCAACTCGTCCAGCAGGGTATTG
CCGTTATTGTCATCTCTTCCGAATTACCTGAAGTGCTCGGCCTTAGCGATCGTGTACTGG
TGATGCATGAAGGGAAACTAAAAGCCAACCTGATAAATCATAACCTGACTCAGGAGCAGG
TGATGGAAGCCGCATTGAGGAGCGAACATCATGTCGAAAAGCAATCCGTCTGAAGTGAAA
TTGGCCGTACCGACATCCGGTGGCTTCTCCGGGCTGAAATCACTGAATTTGCAGGTCTTC
GTGATGATTGCAGCTATCATCGCAATCATGCTGTTCTTTACCTGGACCACCGATGGTGCC
TACTTAAGCGCCCGTAACGTCTCCAACCTGTTACGCCAGACCGCGATTACCGGCATCCTC
GCGGTAGGAATGGTGTTCGTCATAATTTCTGCTGAAATCGACCTTTCCGTCGGCTCAATG
ATGGGGCTGTTAGGTGGCGTCGCGGCGATTTGTGACGTCTGGTTAGGCTGGCCTTTGCCA
CTTACCATCATTGTGACGCTGGTTCTGGGACTGCTTCTCGGTGCCTGGAACGGATGGTGG
GTCGCGTACCGTAAAGTCCCTTCATTTATTGTCACCCTCGCGGGCATGTTGGCATTTCGC
GGCATACTCATTGGCATCACCAACGGCACGACTGTATCCCCCACCAGCGCCGCGATGTCA
CAAATTGGGCAAAGCTATCTCCCCGCCAGTACCGGCTTCATCATTGGCGCGCTTGGCTTA
ATGGCTTTTGTTGGTTGGCAATGGCGCGGAAGAATGCGCCGTCAGGCTTTGGGTTTACAG
TCTCCGGCCTCTACCGCAGTAGTCGGTCGCCAGGCTTTAACCGCTATCATCGTATTAGGC
GCAATCTGGCTGTTGAATGATTACCGTGGCGTTCCCACTCCTGTTCTGCTGCTGACGTTG
CTGTTACTCGGCGGAATGTTTATGGCAACGCGGACGGCATTTGGACGACGCATTTATGCC
ATCGGCGGCAATCTGGAAGCAGCACGTCTCTCCGGGATTAACGTTGAACGCACCAAACTT
GCCGTGTTCGCGATTAACGGATTAATGGTAGCCATCGCCGGATTAATCCTTAGTTCTCGA
CTTGGCGCTGGTTCACCTTCTGCGGGAAATATCGCCGAACTGGACGCAATTGCAGCATGC
GTGATTGGCGGCACCAGCCTGGCTGGCGGTGTGGGAAGCGTTGCCGGAGCAGTAATGGGG
GCATTTATCATGGCTTCACTGGATAACGGCATGAGTATGATGGATGTACCGACCTTCTGG
CAGTATATCGTTAAAGGTGCGATTCTGTTGCTGGCAGTATGGATGGACTCCGCAACCAAA
CGCCGTTCTTGATTTTGATAAAAATTTTCTCAAAGCCGGTTACGTATTACCGGTTTTGAG
TTTTTGCATGATTCAGCAGGAAAAGAACCATGTTTACTAAACGTCACCGCATCACATTAC
TGTTCAATGCCAATAAAGCCTATGACCGGCAGGTAGTAGAAGGCGTAGGGGAATATTTAC
AGGCGTCACAATCGGAATGGGATATTTTCATTGAAGAAGATTTCCGCGCCCGCATTGATA
AAATCAAGGACTGGTTAGGAGATGGCGTCATTGCCGACTTCGACGACAAACAGATCGAGC
AAGCGCTGGCTGATGTCGACGTCCCCATTGTTGGGGTTGGCGGCTCGTATCACCTTGCAG
AAAGTTACCCACCCGTTCATTACATTGCCACCGATAACTATGCGCTGGTTGAAAGCGCAT
TTTTGCATTTAAAAGAGAAAGGCGTTAACCGCTTTGCTTTTTATGGTCTTCCGGAATCAA
GCGGCAAACGTTGGGCCACTGAGCGCGAATATGCATTTCGTCAGCTTGTCGCCGAAGAAA
AGTATCGCGGAGTGGTTTATCAGGGGTTAGAAACCGCGCCAGAGAACTGGCAACACGCGC
AAAATCGGCTGGCAGACTGGCTACAAACGCTACCACCGCAAACCGGGATTATTGCCGTTA
CTGACGCCCGAGCGCGGCATATTCTGCAAGTATGTGAACATCTACATATTCCCGTACCGG
AAAAATTATGCGTGATTGGCATCGATAACGAAGAACTGACCCGCTATCTGTCGCGTGTCG
CCCTTTCTTCGGTCGCTCAGGGCGCGCGGCAAATGGGCTATCAGGCGGCAAAACTGTTGC
ATCGATTATTAGATAAAGAAGAAATGCCGCTACAGCGAATTTTGGTCCCACCAGTTCGCG
TCATTGAACGGCGCTCAACAGATTATCGCTCGCTGACCGATCCCGCCGTTATTCAGGCCA
TGCATTACATTCGTAATCACGCCTGTAAAGGGATTAAAGTGGATCAGGTACTGGATGCGG
TCGGGATCTCGCGCTCCAATCTTGAGAAGCGTTTTAAAGAAGAGGTGGGTGAAACCATCC
ATGCCATGATTCATGCCGAGAAGCTGGAGAAAGCGCGCAGTCTGCTGATTTCAACCACCT
TGTCGATCAATGAGATATCGCAAATGTGCGGTTATCCATCGCTGCAATATTTCTACTCTG
TTTTTAAAAAAGCATATGACACGACGCCAAAAGAGTATCGCGATGTAAATAGCGAGGTCA
TGTTGTAGCGATGATGAGAATTGTCGGCGTCACATCAGGTAACGCTGCGTGGTTGTCGGA
TGCGGCGTGAACGCCTTATCCGACCTACCCGCCAGGCATGATAAAACGCACCAACAACGC
TTCAGGCTCGTAGCTCAACTGCCTGAGACAAAGTAAAAAGCCTTATCCGACTGACAAGTC
GGATAAGGCTCAAGGAAATGCAATTACATATGCGCCGCGATTAACCGTTGGTTATCCTGG
TACATTGCGAACAGGTAGTTGTTATAACTCTTCCCTTTGGTCGAGTAGCCCTTCAGCTTG
TGAATCATCGCTGTGGCAGTCACTTCCTGATCCGCTTTACGCAGCTGCGCACGCGATTTA
CGGAACGAAGAGTAAGCCGGGTGCGTATTCAGGTTAGTGACATAGGCGCTCACCGATTCT
TTGACAGAACTAAACTGTGAGTACCCTTTCACTTTACCTGGCGCATTGGTACAACGTCCT
TTCATGCATTTCATGCCGAACAGGTTGTTGTTGTTGCGCGCCAGCTTCGACGTTCCCCAA
CCGCTTTCTGCTGCAGCCATCGTCGCCACCATACTGGTGGGGATAATGTCTACGCGTTCA
AGCAAGGTATTCCACGGGATTTTTCGCGTATTACCGGACCACTTCACCTTGTAGCGTTTG
GCGATGTCTTTCAGACGCGCACGCTCAGCAGGTGACCATTGGCCCTGATACTGTTTTGAA
ATGAGCCAGTTACGTTCCGCAGTAATGGCCGCATTTTGGCTGGTAATGTAAGGCATTACG
GTCCGGAGAAACGCCTTTTTCCTTGGTGTTCCGGAAGGGTATTTTCGCAAATCAGGAAGT
GAACTACTCTTTGCACTATTGCGAGAATACTCTTGTTTACTGCTTACCTGTTTATTACTA
GCTTTAGTTAAGTGGGACTTTTGACTCGCTGTTGTTGTGTGCGTCTTCGCTAACACCTCA
CTCGAAAACACCAGAGTGAGTAACATAAGAATCATCGCCCCATATCGTCGTATGGGAGTC
AAAATCATCAGGTCTCCTGGTCGGATTTAATCATTCCAACACCTTATATTTTTCACAAAT
TTGAGAGTTGAATCTCAAATCATATCAAAAATAGCTGTCAAGAGCACCCCAAGGAATAGT
CCAAATCTGAAACTATGTCACGTGTTAACGATTCAGATTGGCGCTAAATCGCAGAAAATG
TGGGGGTTATCGCAAAATTCAGCCGTTTTTTGCGCGAGATCGCTCACCCTTGCTTCTCAT
CCTGTGGACTTACCGCTCAGGGATGAGTTTTGTTTGGCTTATCGCTGGCAAACTGTCTGA
AATCGCAGCAATAAGGACTCATCCGCCATGAAACTCGCCGCCTGTTTTCTGACACTCCTT
CCTGGCTTCGCCGTTGCCGCCAGCTGGACTTCTCCGGGGTTTCCCGCCTTTAGCGAACAG
GGGACAGGAACATTTGTCAGCCACGCGCAGTTGCCCAAAGGTACGCGTCCACTAACGCTA
AATTTTGACCAACAGTGCTGGCAGCCTGCGGATGCGATAAAACTCAATCAGATGCTTTCC
CTGCAACCTTGTAGCAACACGCCGCCTCAATGGCGATTGTTCAGGGACGGCGAATATACG
CTGCAAATAGACACCCGCTCCGGTACGCCAACATTGATGATTTCCATCCAGAACGCCGCC
GAACCGGTAGCAAGCCTGGTCCGTGAATGCCCGAAATGGGATGGATTACCGCTCACAGTG
GATGTCAGCGCCACTTTCCCGGAAGGAGCCGCCGTACGGGATTATTACAGCCAGCAAATT
GCGATAGTGAAGAACGGTCAAATAATGTTACAACCCGCTGCCACCAGCAACGGTTTACTC
CTGCTGGAACGGGCAGAAACTGACACATCCGCCCCTTTCGACTGGCATAACGCCACGGTT
TACTTTGTGCTGACAGATCGTTTCGAAAACGGCGATCCCAGTAATGACCAGAGTTACGGA
CGTCATAAAGACGGTATGGCGGAAATTGGCACTTTTCACGGCGGCGATTTACGCGGCCTG
ACCAACAAACTGGATTACCTCCAGCAGTTGGGCGTTAATGCTTTATGGATAAGCGCCCCA
TTTGAGCAAATTCACGGCTGGGTCGGCGGCGGTACAAAAGGCGATTTCCCGCATTATGCC
TACCACGGTTATTACACACAGGACTGGACGAATCTTGATGCCAATATGGGCAACGAAGCC
GATCTACGGACGCTGGTTGATAGCGCACATCAGCGCGGTATTCGTATTCTCTTTGATGTC
GTGATGAACCACACCGGCTATGCCACGCTGGCGGATATGCAGGAGTATCAGTTTGGCGCG
TTATATCTTTCTGGTGACGAAGTGAAAAAATCGCTGGGTGAACGCTGGAGCGACTGGAAA
CCTGCCGCCGGGCAAACCTGGCATAGCTTTAACGATTACATTAATTTCAGCGACAAAACA
GGCTGGGATAAATGGTGGGGAAAAAACTGGATCAGAACGGATATCGGCGATTACGACAAT
CCTGGATTCGACGATCTCACTATGTCGCTAGCCTTTTTGCCGGATATCAAAACCGAATCA
ACTACCGCTTCTGGTCTGCCGGTGTTCTATAAAAACAAAATGGATACCCACGCCAAAGCC
ATTGACGGCTATACGCCGCGCGATTACTTAACCCACTGGTTAAGTCAGTGGGTCCGCGAC
TATGGGATTGATGGTTTTCGGGTCGATACCGCCAAACATGTTGAGTTGCCCGCCTGGCAG
CAACTGAAAACCGAAGCCAGCGCCGCGCTTCGCGAATGGAAAAAAGCTAACCCCGACAAA
GCATTAGATGACAAACCTTTCTGGATGACCGGTGAAGCCTGGGGCCACGGCGTGATGCAA
AGTGACTACTATCGCCACGGCTTCGATGCGATGATCAATTTCGATTATCAGGAGCAGGCG
GCGAAAGCAGTCGACTGTCTGGCGCAGATGGATACGACCTGGCAGCAAATGGCGGAGAAA
TTGCAGGGTTTCAACGTGTTGAGCTACCTCTCGTCGCATGATACCCGCCTGTTCCGTGAA
GGGGGCGACAAAGCAGCAGAGTTATTACTATTAGCGCCAGGCGCGGTACAAATCTTTTAT
GGTGATGAATCCTCGCGTCCGTTCGGTCCTACAGGTTCTGATCCGCTGCAAGGTACACGT
TCGGATATGAACTGGCAGGATGTTAGCGGTAAATCTGCCGCCAGCGTCGCGCACTGGCAG
AAAATCAGCCAGTTCCGCGCCCGCCATCCCGCAATTGGCGCGGGCAAACAAACGACACTT
TTGCTGAAGCAGGGCTACGGCTTTGTTCGTGAGCATGGCGACGATAAAGTGCTGGTCGTC
TGGGCAGGGCAACAGTAACTTTTCCGGCTTCCCGTTCGTCAGTACCTCGGGAAGCCGCCA
ACCAGGATAAAATGTCAGCCCTAATCAGCGTTGCAGGATAAAGCACCGCTCACTCTTCAA
CAGACCGATTTGCACCCCAGCAAATGTAGCGTTATTGTTACCTTCCTTGCTACAGAGTTC
GACAGATATCCCGCTATGACATTCTCCCTTTTTGGTGACAAATTTACCCGCCACTCCGGC
ATTACGCTGTTGATGGAAGATCTGAACGACGGTTTACGCACGCCTGGCGCGATTATGCTC
GGCGGCGGTAATCCGGCGCAGATCCCGGAAATGCAGGACTACTTCCAGACGCTACTGACC
GACATGCTGGAAAGTGGCAAAGCGACTGATGCACTGTGTAACTACGACGGTCCACAGGGG
AAAACGGAGCTACTCACACTGCTTGCCGGAATGCTGCGCGAGAAGTTGGGTTGGGATATC
GAACCACAGAATATTGCACTAACAAACGGCAGCCAGAGCGCGTTTTTCTACTTATTTAAC
CTGTTTGCCGGACGCCGTGCCGATGGTCGGGTCAAAAAAGTGCTGTTCCCGCTTGCACCG
GAATACATTGGCTATGCTGACGCCGGACTGGAAGAAGATCTGTTTGTCTCTGCGCGTCCG
AATATTGAACTGCTGCCGGAAGGCCAGTTTAAATACCACGTCGATTTTGAGCATCTGCAT
ATTGGCGAAGAAACCGGGATGATTTGCGTCTCCCGGCCGACGAATCCAACAGGCAATGTG
ATTACTGACGAAGAGTTGCTGAAGCTTGACGCGCTGGCGAATCAACACGGCATTCCGCTG
GTGATTGATAACGCTTATGGCGTCCCGTTCCCGGGTATCATCTTCAGTGAAGCGCGCCCG
CTATGGAATCCGAATATCGTGCTGTGCATGAGTCTTTCCAAGCTGGGTCTACCTGGCTCC
CGCTGCGGCATTATCATCGCCAATGAAAAAATCATCACCGCCATCACCAATATGAACGGC
ATTATCAGCCTGGCACCTGGCGGTATTGGTCCGGCGATGATGTGTGAAATGATTAAGCGT
AACGATCTGCTGCGCCTGTCTGAAACAGTCATCAAACCGTTTTACTACCAGCGTGTTCAG
GAAACTATCGCCATCATTCGCCGCTATTTACCGGAAAATCGCTGCCTGATTCATAAACCG
GAAGGAGCCATTTTCCTCTGGCTATGGTTTAAGGATTTGCCCATTACGACCAAGCAGCTC
TATCAGCGCCTGAAAGCACGCGGCGTGCTGATGGTGCCGGGGCACAACTTCTTCCCAGGG
CTGGATAAACCGTGGCCGCATACGCATCAATGTATGCGCATGAACTACGTACCAGAGCCG
GAGAAAATTGAGGCGGGGGTGAAGATTCTGGCGGAAGAGATAGAAAGAGCCTGGGCTGAA
AGTCACTAAAAATTGCCTGATGCGCTACGCTTATCAGGCCTACATGATTTCTGCAATATA
TTGAATTTGGAAGAATTTGTAGGCCGGATAAGGCGTTTACGCCGCATCTGGCATAAACAA
AGCGCACTGTTCCGGCGTTGAGAAACGCCGGAAAACGTTTCAAACAGGCTGCTGCCGTAG
CCGATGCCGCTGCACTTTCTCGACATCCATGCACTGCAACGCCTTTGTCGGGCAGGCTTC
AACACAGGCCGGTCCCGTCTCCCGATGCCAGCACAGATCGCACTTAATCGCCCTCGCCTT
TTTGCGCGAAGAAACGACCTCCATCGCACCAAACGGGCAAGCCAGCATACAGCTTTTACA
GCCAATGCAACGTGTTTGTTCAACGAAAATATGCCCATGTTCGCGGCTTATCGCGTCAAC
AGGGCAGACATTCGCGCACGGTGCATCTTCACACTGATGACAGGCTACTGCCGTGGTCCA
GCAGTGGTCTTTAATGACACGAATACGGGAAATAAACTCGTCTGGTGACAACGCAGCGCA
ATCCTGATTCTCATGATGCGACACTGCGCAAGCCACTTCACAGGTACGGCAACCGATACA
TTTCGTCGCATCCGCAATAATAAACCGGTTCATGATCACTCCTTTGCACTAAAACAGCAG
AGTGCCAGAGAGCGCGTCCCTACTGCTTTGATCCAACGAAGGAAATGTTAAAGTTTTGGC
ACTTGTCCAAAGCGTTATGTGATCGCGCCCAGGTCATCCCTGACAGTAAATCCCAGTTCA
TTAGAAATAGCCTGCGCGGTTTCACGCAGTGGTTTCAGGAGATTTTTCTCTCCCACCTGT
TTCAGACGTGATGTCGAAAGCGAAATCGACACGGCGTACGGCACCCGCCCATGAATATCA
AACACCGGAACAGCAATACAGGAGACGCCGAGTTCGTTTTCTTCTCTGTCCATCGCCGCT
CCGCTTTCACGAATGTGCGCCAGTTCGTCGAACATCGCGGGCAGCTCGGTAATGGTATTG
CGGGTTAACGGCTGGATCTCATGCTGATGGCTTTCCCAGTATGACTTCACGTAGTCCGGG
TGACCAAACGCCATGTAGATCTTGCCCATTGCGGAACAGTAGAGCGGCATATGCTGGCCA
ATATAGGCACGGGTTCGCAGCATCCCGGTTGTGGGTTCCAGCTTATAAATCAAAATAGCG
TGATCGTCTTCGCGGCTGGAGAAGTTAATGGTTTCACCAGTGGCGATGTTCAGTGCCTCA
AGATGCGGAGCGGCGATATGAATGATATTCAGCGAAGACAGCGCCTTCTGCCCGACGGCA
ATAAATTTGGTGGTCAGGCGATAACTCCCTGCGGCAGGCGCGGTGGTCACATAGCCGCAG
GACTGTAATCCCTGCAATAAGCGATGGACGGTACTCTTATTTAAACCAGCCAGCTCCGAA
AGATGCGCCAACGGACAACCGTTTGGATAGTTGCTCAAAATCTCAATCAGCATCAACCCG
CGAAACAGACTCTGGCTTCCGGCTGGACGCTCTTTTTCCTGCGCCATCTCGTTCTCTTTT
TTTCCCATCACTTCTTTCCCCATTTTGTCGCGTCCTGATGGTAGCGCAAAGTGTGCCGTA
GTTCACGATCTCGACAGATAATTTATAACCAATTGATTTTTATGTCTTTTGAAATTCATC
AATCAGATTGCCTTGTTAAAAAGTGATCGATATATTTGAAATCAAGTTTCGCATATTGAA
ATTTTAAGCCAAAAAAGCGATCAAAAAAACAAGGAAGCCTGGGATGAAAGTGACATTTGA
GCAGTTAAAAGCAGCCTTTAATCGGGTCTTAATTTCACGCGGCGTTGACAGCGAAACGGC
TGACGCCTGTGCAGAGATGTTCGCCCGCACCACCGAATCCGGCGTTTATTCTCACGGCGT
TAATCGTTTCCCTCGTTTCATTCAACAACTGGAAAACGGCGATATCATTCCTGATGCCCA
ACCCAAACGTATAACCAGCCTCGGCGCAATTGAACAGTGGGACGCCCAGCGTTCGATCGG
TAACCTGACAGCGAAAAAGATGATGGATCGCGCCATTGAACTGGCTGCCGATCACGGTAT
TGGTCTGGTGGCACTACGTAATGCCAACCACTGGATGCGCGGCGGCAGCTACGGCTGGCA
GGCGGCGGAAAAAGGCTATATTGGCATTTGCTGGACCAACTCCATCGCCGTAATGCCGCC
GTGGGGCGCAAAAGAGTGTCGCATAGGCACTAACCCGCTGATCGTCGCCATTCCTTCCAC
GCCGATCACCATGGTCGATATGTCGATGTCGATGTTCTCTTACGGCATGTTAGAAGTTAA
CCGTCTGGCAGGTCGTCAGCTCCCGGTCGATGGTGGCTTTGATGATGAGGGCAATTTGAC
CAAAGAACCTGGCGTTATCGAGAAGAATCGCCGCATTTTGCCGATGGGCTACTGGAAAGG
TTCTGGCATGTCGATTGTGCTGGATATGATCGCTACTCTCCTTTCCGACGGCGCATCCGT
TGCCGAAGTCACCCAGGACAACAGCGACGAATACGGCATTTCACAAATTTTTATTGCCAT
TGAAGTGGACAAGCTTATCGACGGTCCCACCCGCGATGCCAAGCTGCAACGCATCATGGA
TTACGTTACTAGTGCCGAGCGTGCTGACGAAAATCAGGCCATTCGCTTACCCGGCCATGA
ATTTACTACCCTGCTGGCCGAAAACCGCCGTAACGGCATCACTGTTGATGACAGCGTGTG
GGCCAAAATCCAGGCGTTATGAGGAGATAAGTCATGATTTTTGGACATATCGCGCAGCCC
AATCCGTGCCGTTTGCCCGCCGCCATTGAAAAGGCGCTCGATTTTCTGCGCGCTACCGAT
TTCAACGCCCTGGAGCCGGGCGTTGTCGAAATCGACGGCAAAAATATTTATACGCAAATT
ATCGATTTAACCACACGCGAAGCGGTGGTAAACCGTCCGGAAGTGCATCGTCGGTATATC
GATATTCAGTTTCTGGCGTGGGGCGAAGAGAAAATCGGCATTGCTATTGATACGGGAAAT
AATAAAGTCAGCGAATCACTATTAGAGCAGCGCAATATTATTTTTTATCACGACAGTGAA
CATGAATCATTTATAGAAATGATACCGGGCAGCTACGCAATTTTCTTTCCGCAGGATGTT
CACCGACCAGGTTGTATTATGCAAACAGCCTCTGAGATACGAAAAATTGTGGTTAAAGTC
GCATTAACGGCGCTGAATTAATCGAATAATCGTCTACGCCAGAACGCCTGGGTAATGTTA
TTGCTCTAACTATATTAATAATTCAGGTTGCTGCACATGCGACTTGAATTATGACAGACA
TAGCCTCAAGGAATAGCTATGAAAAAAATACTCGAAGCAATACTGGCGATTAATCTCGCC
GTACTTTCCTGTATTGTATTTATAAACATTATTTTAAGATATGGTTTTCAGACAAGCATT
TTATCTGTTGATGAATTGTCACGTTATTTATTTGTCTGGTTAACGTTTATTGGCGCGATT
GTAGCTTTTATGGATAACGCCCACGTTCAGGTCACCTTTCTGGTGGAGAAACTCTCCCCC
GCATGGCAGCGACGAGTCGCTCTGGTTACCCATTCCTTAATCTTATTTATTTGTGGCGCA
CTGGCCTGGGGCGCAACGCTAAAAACAATTCAGGACTGGAGCGATTATTCACCGATCCTC
GGTTTACCCATCGGCCTGATGTATGCCGCTTGTCTGCCCACCAGCCTCGTTATCGCATTC
TTTGAACTGCGTCATTTATATCAACTCATCACGCGTAGCAATTCTCTAACGTCGCCACCG
CAAGGAGCTTAATCATGGCTGTGCTGATTTTTCTGGGCTGTCTGTTGGGTGGTATTGCTA
TCGGTTTGCCTATTGCCTGGGCACTGTTGTTGTGCGGGGCGGCGTTAATGTTCTGGCTGG
ACATGTTTGATGTCCAGATCATGGCACAAACGCTGGTGAACGGAGCCGATAGCTTCTCCC
TGCTGGCGATTCCGTTCTTTGTGCTGGCGGGTGAAATCATGAATGCGGGCGGCTTGTCAA
AACGCATTGTTGACCTGCCGATGAAACTGGTGGGGCATAAACCAGGCGGGCTGGGCTACG
TCGGCGTGCTGGCAGCTATGATTATGGCGAGCCTTTCTGGTTCTGCCGTTGCGGATACCG
CCGCCGTTGCCGCTCTACTGGTGCCGATGATGCGCAGCGCCAACTATCCGGTCAACCGGG
CGGCGGGGCTGATTGCCTCTGGCGGCATTATCGCGCCAATTATTCCCCCTTCCATTCCGT
TTATTATCTTCGGCGTTTCCAGCGGATTATCCATCAGTAAGCTGTTTATGGCGGGCATTG
CCCCTGGCATGATGATGGGCGCAACGCTGATGCTTACCTGGTGGTGGCAGGCCAGTCGCC
TTAATTTACCCCGCCAGCAAAAAGCAACGATGCAGGAAATCTGGCACTCTTTTGTCTCCG
GTATCTGGGCGCTGTTTCTTCCAGTCATCATTATTGGCGGGTTTCGCTCCGGCCTGTTTA
CCCCTACCGAAGCCGGGGCCGTTGCTGCTTTCTATGCGCTGTTTGTCGCCACAGTTATTT
ACCGTGAAATGACCTTCGCCACACTTTGGCATGTACTCATTGGCGCGGCGAAAACCACCT
CAGTGGTTATGTTTCTGGTGGCCTCGGCACAAGTTTCCGCCTGGCTGATTACCATTGCTG
AACTGCCGATGATGGTTTCTGATTTACTGCAACCGTTGGTCGATTCACCGCGTCTGCTGT
TTATCGTCATTATGGTGGCTATCCTGATTGTCGGCATGGTCATGGATTTAACGCCGACGG
TATTAATTCTTACCCCGGTATTAATGCCTTTAGTTAAAGAGGCAGGAATCGATCCGATTT
ATTTCGGTGTCATGTTTATCATTAACTGCTCAATCGGCTTAATTACACCGCCTATCGGTA
ATGTACTTAACGTTATTTCAGGGGTGGCAAAACTCAAATTCGATGATGCAGTCAGAGGCG
TTTTCCCTTACGTCCTGGTTTTATATTCATTATTAGTCGTATTTGTTTTTATTCCCGATC
TCATCATCCTCCCTTTGAAATGGATTAATTAAAAGGAAAATATTATGAAATTACGCTCTG
TAACCTACGCATTATTCATTGCTGGCCTGGCTGCATTCAGCACATCTTCTCTGGCGGCAC
AATCTTTACGTTTCGGTTATGAAACATCACAAACCGACTCGCAACATATTGCGGCGAAAA
AATTCAATGATTTATTGCAGGAGAGAACCAAAGGCGAGCTGAAATTAAAACTGTTCCCGG
ACAGCACTCTCGGTAACGCGCAGGCGATGATCAGCGGCGTACGTGGCGGCACCATCGATA
TGGAAATGTCCGGCTCGAATAACTTTGCCGGGTTATCACCAGTGATGAACTTGCTTGATG
TCCCTTTCCTGTTCCGCGATACCGCTCACGCGCATAAAACGCTCGACGGCAAAGTCGGTG
ATGATCTGAAAGCCTCACTTGAAGGTAAAGGACTGAAAGTACTGGCCTACTGGGAAAACG
GCTGGCGCGATGTCACCAACTCGCGCGCACCGGTTAAAACCCCCGCCGACCTGAAAGGGC
TGAAAATCCGCACCAACAATAGCCCGATGAATATCGCCGCATTCAAAGTCTTTGGCGCTA
ACCCGATCCCGATGCCGTTTGCCGAAGTCTATACCGGGCTGGAAACCCGCACTATCGACG
CTCAGGAACACCCGATCAACGTCGTCTGGTCAGCAAAATTTTTCGAAGTGCAGAAGTTCC
TTTCTCTGACGCACCACGCCTATTCCCCGCTTCTGGTGGTGATCAACAAAGCGAAGTTTG
ATGGCTTAAGTCCGGAGTTCCAGCAGGCGCTAGTTTCATCTGCACAAGAAGCGGGTAACT
ATCAGCGCAAACTGGTTGCTGAAGATCAGCAAAAAATCATCGACGGCATGAAAGAAGCGG
GCGTGGAAGTCATCACCGATCTCGACCGCAAAGCCTTTAGCGACGCACTGGGGAATCAGG
TTCGCGACATGTTTGTTAAAGATGTGCCGCAGGGAGCTGATCTGCTGAAAGCCGTGGATG
AGGTGCAATAAACCATGACGCAATACTGGCTGGGGTTAGATTGTGGCGGTAGCTGGCTGA
AAGCCGGGCTGTATGACCGCGAAGGCCGGGAGGCAGGCGTGCAGCGCCTGCCGCTGTGCG
CATTAAGCCCGCAGCCAGGCTGGGCAGAGCGCGATATGGCAGAACTGTGGCAATGCTGCA
TGGCTGTCATTCGCGCCCTGCTTACTCATTCTGGTGTTAGCGGGGAACAAATTGTCGGTA
TCGGCATCTCCGCACAGGGAAAGGGCTTGTTTTTGCTGGATAAAAACGACAAACCGCTCG
GGAATGCTATTTTGTCCTCGGACCGCCGGGCGATGGAAATCGTTCGTCGCTGGCAGGAAG
ATGGCATCCCGGAAAAACTCTACCCGCTGACCCGACAAACCTTGTGGACCGGGCATCCGG
TGTCGCTGTTACGCTGGCTGAAAGAGCACGAACCAGAACGCTACGCGCAAATTGGCTGCG
TGATGATGACGCACGACTACCTGCGCTGGTGTTTAACTGGCGTCAAAGGCTGTGAAGAGA
GCAATATTTCCGAGTCCAACCTCTACAACATGAGTCTTGGGGAATATGACCCGTGCCTCA
CCGACTGGCTGGGGATCGCTGAAATCAATCACGCCCTGCCGCCTGTTGTCGGATCTGCCG
AAATCTGCGGGGAGATCACCGCTCAGACAGCCGCCCTGACCGGTCTGAAAGCGGGTACGC
CCGTTGTTGGCGGCCTGTTTGATGTGGTTTCCACCGCACTCTGCGCCGGGATCGAAGACG
AATTTACCCTCAATGCGGTGATGGGGACCTGGGCGGTGACCAGCGGCATAACCCGCGGTT
TACGTGACGGTGAAGCGCATCCGTATGTCTATGGTCGCTACGTTAACGATGGTGAATTTA
TCGTTCACGAAGCCAGCCCTACCTCTTCCGGCAACCTCGAATGGTTTACCGCACAGTGGG
GAGAAATCTCGTTTGATGAGATCAATCAGGCCGTTGCCAGCTTGCCGAAGGCTGGGGGCG
ATCTCTTTTTCCTGCCGTTCCTGTACGGCAGCAACGCCGGACTCGAGATGACCAGTGGTT
TCTACGGGATGCAGGCCATTCACACCCGCGCGCACCTGTTGCAGGCCATCTATGAAGGGG
TGGTGTTCAGCCATATGACCCACCTCAACCGAATGCGCGAACGTTTTACTGATGTTCACA
CCCTACGCGTCACTGGCGGCCCGGCGCACTCCGATGTCTGGATGCAAATGCTGGCGGACG
TCAGCGGTCTGCGTATCGAGCTGCCGCAGGTGGAAGAAACCGGCTGCTTTGGTGCGGCCC
TTGCCGCCCGCGTCGGCACCGGGGTTTATCACAACTTCAGCGAAGCCCAACGTGACTTGC
GACACCCGGTGCGCACCCTGCTGCCAGATATGACCGCCCATCAGCTTTACCAAAAAAAAT
ATCAACGTTATCAGCATCTCATTGCCGCACTTCAGGGCTTTCACGCCCGCATTAAGGAGC
ACACATTATGAGCCGACCACTTCTGCAACTGGCCCTCGACCACTCATCACTTGAAGCCGC
GCAGCGCGACGTGACGCTGTTAAAAGACAGCGTCGATATCGTCGAAGCGGGCACCATTCT
CTGTTTAAACGAAGGGCTTGGCGCGGTGAAAGCCTTGCGCGAACAGTGCCCGGACAAAAT
CATCGTTGCTGACTGGAAGGTCGCCGACGCTGGTGAAACGCTCGCGCAACAGGCGTTTGG
CGCAGGCGCTAACTGGATGACCATCATCTGCGCCGCGCCGCTCGCGACGGTAGAAAAAGG
CCACGCAATGGCACAACGCTGCGGGGGTGAAATTCAGATAGAGCTGTTCGGTAACTGGAC
GCTGGACGACGCCCGCGACTGGCATCGTATTGGCGTGCGGCAGGCCATTTATCATCGCGG
TCGTGATGCACAGGCCAGCGGGCAACAGTGGGGCGAAGCCGATCTGGCACGCATGAAGGC
GCTTTCAGATATCGGCCTTGAGCTTTCCATTACTGGCGGGATTACCCCTGCTGACCTGCC
GCTGTTTAAAGATATCCGCGTGAAAGCGTTTATTGCCGGGCGGGCACTGGCAGGCGCGGC
AAATCCGGCGCAAGTGGCTGGCGATTTCCATGCGCAAATCGACGCTATCTGGGGAGGTGC
GCGTGCGTAATCATCAGTTAGGGATTTATGAAAAAGCGCTGGCGAAAGATCTCTCCTGGC
CGGAGCGGCTGGTGCTGGCAAAAAGCTGCGGTTTTGATTTTGTCGAAATGTCGGTGGATG
AAACCGACGAACGGCTCTCACGTCTTGACTGGAGCGCCGCACAAAGGACTTCGCTGGTTG
CCGCGATGATCGAAACAGGTGTTGGGATCCCGTCGATGTGCCTGTCCGCACATCGTCGCT
TTCCCTTTGGTAGCCGTGACGAGGCAGTGCGCGAACGGGCGCGGGAAATCATGAGTAAAG
CGATTCGCCTGGCGCGCGATCTCGGCATTCGCACCATCCAGCTGGCAGGTTATGACGTCT
ATTACGAAGACCACGACGAAGGCACCCGGCAACGTTTTGCTGAAGGGCTGGCGTGGGCAG
TCGAACAGGCGGCGGCATCACAAGTAATGCTGGCGGTGGAGATTATGGATACCGCGTTTA
TGAACTCCATCAGCAAATGGAAAAAATGGGACGAGATGCTCGCCTCACCGTGGTTCACCG
TCTACCCGGACGTCGGCAACCTCAGCGCCTGGGGCAATGATGTTCCCGCCGAACTGAAAC
TGGGCATTGACCGTATCGCCGCGATCCACCTGAAAGACACCCAGCCAGTCACCGGGCAAA
GTCCCGGACAGTTCCGCGACGTGCCGTTTGGCGAAGGCTGCGTCGATTTCGTTGGCATCT
TCAAAACGCTGCATAAACTGAACTATCGCGGTTCTTTCCTGATTGAGATGTGGACCGAAA
AAGCCAAAGAGCCGGTGCTGGAGATTATTCAGGCGCGGCGTTGGATTGAAGCGCGTATGC
AGGAGGCTGGATTTATATGTTAGAGCAACTGAAAGCCGACGTGCTGGCGGCGAATCTGGC
GCTTCCCGCTCACCATCTGGTGACGTTCACCTGGGGCAATGTCAGCGCGGTAGACGAAAC
GCGGCAATGGATGGTAATCAAACCTTCCGGCGTCGAGTACGACGTGATGACCGCCGACGA
TATGGTGGTGGTTGAGATAGCCAGCGGTAAGGTGGTGGAAGGCAGCAAAAAACCCTCTTC
CGATACACCAACGCATCTGGCGCTCTACCGTCGCTATGCCGAAATTGGCGGTATTGTGCA
TACCCACTCGCGCCACGCCACCATCTGGTCACAGGCCGGGCTGGATCTCCCCGCCTGGGG
CACCACCCACGCCGATTATTTTTACGGTGCCATCCCCTGCACGCGACAGATGACCGCAGA
GGAGATTAACGGCGAATATGAATATCAGACCGGCGAAGTGATCATTGAAACCTTCGAAGA
ACGTGGCAGGAGTCCGGCACAAATCCCGGCGGTGCTGGTGCATTCTCACGGCCCGTTCGC
ATGGGGTAAAAACGCCGCCGATGCCGTGCATAACGCCGTAGTACTCGAAGAATGCGCCTA
TATGGGTCTATTCTCGCGCCAGCTTGCGCCGCAGCTCCCTGCGATGCAAAACGAACTGCT
GGATAAGCACTACCTGCGTAAGCATGGGGCCAATGCCTATTACGGGCAGTAATCCCTCAC
GCCGGGGCTTCATCGCCCCGGCACTACGAATTGATATGTTCCTTGCTGTAACGCCGCTTC
CACGCTGCTGGCGTTAAACCAGTATGTTTCTGAAAAATCTGCCGGAAATAGCCAACGTCA
TTAAACCGTATTGCATGGAGCAGGCCGACAACGTCGAGTCACTGCATAACCTGTTGCTGC
CCGCCGATGCGCCATTTACGACATTTGAAGGCAAGGGATTGTTCAGCCATAAGATCCTGA
TTCAGACGCCAGGTTCCCGGTATGAACAGAGCAATCCAGAGCAACAACCTTTGTGGCATT
ACGACGGAGCACCAGCCGCACCGACATCCACCGGTGAATTAAAAACGCCAGCTCACCCCG
GTGACAAAGGTAAAACTCTCATTACGATCAATCATCGGGCTGTCGGTAATCTCTTCCGGC
AGCTCGCTGTATCCTGCGCTCGCCATCAATACGACGTGCTCTCCTATCGGGTATTTTGCC
GTCAGGCTGACATAGGGCACCCAGGCATCCTGCGCGGAATAACTTGCCAGACCGCTACGA
CGGGACTCACTCTCTGAAATGCCATAGTAATAGTCACTGAAATTCTCGTCATAATAGAGA
ACGCCCAGCGCAGGTGTCAGCGACAGACGACCTATCTGCATTTTGTGGAATACCGATAGC
TCCCCCACCCAGCCGTTGCTGTTATCCAGAACGTCCGCAGCTGCAGAGGCTTTCACGGTT
CCCCAACGCTCGTGGTGATACCAGGCAACCCCCGCCATAGCCGTACTATCACGCTTATCA
AGCTGTTGCATGGCATAATCGTCATTATCGGTAGGGTCAAATTCCAGCGGCATCCAGGAT
GCGGTCAGGCTAAGTTCATTTTTTTCACTTTGCGACAGAATAAAACCTAACGTGGTCTGA
CGAACATAAAAAGTATCACCTTCATAACTAATCAGCGGAATTGCCTTCGTATTTTCATTA
TAACCGCGATAAGGCGATTCATTATAAGCCGCACCAGCACCAATGGATAATTCAGAAGCA
GTTGCGCTTGCCATAAAAGGCAACGCAAATAACGCCACAATATTGCGATTAATTAACATG
TCCGGTATTCCATTTTAAAATAAGATAAAAAAGAGTCGGCATAATAATGCTTACAATTTC
TCCGGTGCAAGATTCATATTTATATAGTAATATATAAAATTATATATAATTGGGCTGTTG
CGATGACAAAATTACAACTTAAGTACCGGGAGTTAAAAATTATCTCGGTAATCGCTGCCA
GTGAAAATATCAGCCATGCCGCGACTGTACTTGGCATCGCACAGGCCAACGTCAGCAAAT
ATCTTGCTGATTTTGAATCAAAAGTGGGTTTAAAAGTCTTTGACCGAACCACCCGGCAGC
TGATGCTCACACCTTTTGGCACCGCGCTGTTACCGTACATCAACGACATGCTGGACAGAA
ACGAGCAACTTAATAATTTTATTGCAGATTATAAGCATGAGAAACGTGGTCGGGTCACCA
TCTACGCCCCAACCGGCATAATTACCTATTTATCCAAACATGTAATCGATAAAATTAAAG
ATATCGGTGATATCACCTTATCGCTAAAAACCTGCAATCTTGAGCGTAATGCCTTTTATG
AAGGCGTCGAATTTCCTGATGATTGTGATGTTTTAATCAGCTACGCTCCACCAAAAGATG
AATCGCTGGTTGCCAGTTTTATTACCCAATATGCCGTAACCGCTTATGCCAGCCAGCGCT
ATCTTGAGAAACATCCCATTAGCCGTCCTGACGAACTCGAACATCACTCCTGTATTTTGA
TCGACTCGATGATGATCGACGACGCGAATATCTGGCGCTTCAACGTCGCCGGGAGTAAAG
AGGTGCGGGATTATCGCGTGAAGGGAAATTACGTTTGCGACAACACGCAATCTGCGCTGG
AGCTGGCACGAAATCACCTGGGGATTGTGTTTGCGCCAGACAAAAGTGTGCAGAGCGACC
TGCAAGACGGCACGCTGGTGCCCTGCTTTCAGCAACCCTATGAATGGTGGCTGGATCTGG
TGGCTATCTTCCGTAAACGGGAATACCAGCCCTGGCGGGTCCAGTATGTGCTGGATGAAA
TGCTGCGTGAAATTCGCCACCAGCTTGCTCAGTCGCAGCAACTGCGGCCTGAACAAGCGG
CGGAAAGCGAAGATTAATGATCGAGATAAAGGTAATGCACCCAGCTGGTCATGCGTAATA
GCACTTTGCGCATCACCGAGACATGGCTGAAATGATCAGAGTAAACCGCCACCTGGGCGT
AAATACCGTCTGGTAAAGCGCTCAAATCAGTGTGCTCATCCAGTTCAATGGTCGCGATAA
CGCCATCTGAACCCGGCGCTGTGTTTAACGTCTGTAAGGTGCCGGTCGACTGATAAGCTC
CGCCGGGAACGGCTGGACTAATGGCTGCCAGCTTACCGCTGAATACCTTACCTGGCAGAG
CATTAAACACCACTTCCGCATCGTCGCCAGGAGCCAGTCGCAGCAAGGAGTTCTGACGGA
ACTGCGCCACGATTTGTCGTTTCTGATCGGGTATAAACACCATCACCGGACGTAGCGGCA
GCGACGCGGCATAGGTACCCGGACGAATCAGTACCTGGGTCACATAACCATCGCTCGGCG
CACGCACTATCGTCTGCTCAAGGTTATATTTTGCTTCCGCGAGCTGTGCTTTCAGGCTGG
CGATTTGAGAATGTTCACCCAACACCAGGCTATCCAGCTGGCTCTGGATCTGTTTTTGTT
CCGCCGCCGATGACTTCACGGAGGCTTCCTGCGCCAGATAATTTTGCCGCGCCACATCGA
TATCGCGTTCTGAAAACGGGTTTACTTTCGCCTGGCTGCCACGTGCGTAACGCTGATACT
CTTTAGCGAATTTATCCCGCGTGGCCTTTGCCTGCTGAGTATTCGCCGCCATCTCATCTA
ACTCTGCGCCCAACGCCCGCTGTTTATGTTCTGCGGTAACGATATCCGCCATCAGCCGAT
CCACCCGCGCCTGATAACGCGTCGGGTCCAGTCGAAATAGCACCTCACCTTTTTTAATCA
GCGTATTTTTCTTATCCGTCACTTCAATCACCACACCAGTCACCTGTGGGACAACAGGAA
TAGAAATAACCGCTTTTTGCGCTTTAAAGGTATACGGATGGTTATAGTTCATTAACAGAA
TTAGACCGCTGACAATAAATATTCCACCCAGGGCCGCTGTGGGAATGGTCCATTTATTTA
CGGGAATTTTGAAGATCTTAAACATTGCCCATGCAAAAGCCACATAGGTCAAAATAATCA
GTAAATCCATAAGTATTACTCGGCAGAAGAGGATTTGATGTCGGCGAGCTGTTTCTCCAG
CCCGGCAATGCGCTGTTGCAGTTGCATAACGGATGAATCATGGCTTTGCATTCCCCATCC
CCGCTCCGGGCGGTAAAGCGTGGCCCAAATCCACAAAAACGGCCAGATAACATGTAACGT
AAAAAGACTCACCCAACCAGCAACATGAATGGCGTCGGCATGAGGATGATTACGTTTTTT
GGCAATCAGGTAGGGAATATCATGTAAAATAATGATCCCATAGAAGATCACCAGAAATAC
AAAAATAAGCACTCCCAGTGCAAAATAGTCCAGGAACATATTTCCCTCAAAGAATATAAA
AAAGAACAATTAACGCATATTATGAAATGCCATGATGCAGTGCAATTTCCTTATTTATAT
AACGACATATTGTTTTTTATATACTTTCTTAAATGTGCTGTCTGGTTTTTCAACAGGACG
AGGTTTATCATATTGAAATAGTGGAACTATTGGCCAAACTAATGAATAACTCCAGTAAAA
CATCCACAGTACAGATTAAGCGTATTAAACCTTCAATTATCTACCGTTTATTGCTGATTG
GCCTCGGATCACCAATGGTGATTTACGGCCTGGTTCGCCCGCTCACCATCGAAACGCGAG
ATTAAACTCCTGACAAAACACGCCCCAGAAACGTACTTCTGTTGGCGTAGTCTGGGTTAT
TGCGCACGTAGGTTTAAAACGTAAATTGTAACAACGTGCGCTTTGTTTATGCCGGATGCG
GCGTGTACGCCTTATCCGGCCTACGGTCAGGTTCCCGTAGGCATGATAAGACGCGTAAGC
GTCGCATCAGGCAATGAATACCCAATGCGACCAGCTTCTTATATCAGAACAGCCCCAACG
GTTTATCCGAGTAGCTCACCAGCAGGCACTTGGTTTGCTGGTAATGCTCCAGCATCATCT
TGTGGGTTTCGCGACCGATACCTGATTGTTTGTAGCCACCAAACGCCGCATGTGCCGGGT
AAGCGTGATAACAGTTGGTCCACACGCGCCCAGCCTGTATGCCGCGCCCCATCTTATAGG
CCAGATTACCGTTGCGGCTCCAGACGCCCGCGCCCAGGCCATATTGCGTATCGTTCGCCA
GCTCCAGCGCTTCTTCCATCGTTTTGAAGGTGGTCACCGCCAGCACCGGGCCAAAAATCT
CCTCCTGGAACACCCGCATATTGTTCTGACCAAACAGAATCGTCGGTTCGAGGTAGTAGC
CGTCTTTCAGTTCACCTTCCAGCAGCTTGCGCCGCCCGCCTGTGAGCACGTCAGCGCCCT
CTTTTTTACCGATATCAATGTAGTTGAGGATGGTTTCCAGTTGCCCGTGAGAAACCTGCG
CGCCCATTTGCGTCACGCTGTCGAGCGGGTTACCGCTACGAATGCTTTCGACACGGCGGA
TGGCGCGTTCCATAAAGCGTTCGTAGATAGATTCCTGCACTAAAGCACGACTCGGACAGG
TGCAAACTTCGCCCTGGTTAAAGGCAAACAGTGCAAAGCCTTCCAGCGCTTTATCGAAAA
AGGCATCTTCTTCATCCATCACATCAGCAAAGAAGATATTTGGCGACTTACCGCCCAACT
CCAGCGTCACCGGAATAATGTTTTGCGTTGCGTATTGCATAATTTGTTGGCCCACTTCCG
TTGAGCCGGTAAACGCCACTTTGGCGATGCGTTTCGAGGTCGCCAGATATTCGCCAATTA
CCCCACCTGCGCCATTGACCACGTTCACCACGCCCGGCGGCAGTAAATCACCGACAATTT
CCATTAGCAGCAGTACAGAAAGCGGGGTAAGACGTGCGGGTTTCAGCACCACACAGTTGC
CCGCCGCCAGCGCGGGAGCCATTTTCCAGCTCGCCATCAGCAGCGGGAAGTTCCACGGGA
TAATCTGCCCCACCACGCCTAACGGTTCATGGAAATGATAGGCCACGGTTTCGCTATCAA
CTTCACTGATCCCACCTTCCTGCGCCCGAATACACGAGGCGAAATAGCGGAAATGGTCAA
TCGCCAGCGGTACATCCGCAGCACTGGTTTCGCGAATGGGTTTGCCGTTATCCCAGGTTT
CAGCTGTCGCTAACAGCTCGAGGTTTTGTTCCATTCGATCGGCAATCTTAAACAGAATCG
CCGCACGATCCTGCACCGAGGTGTGCGCCCATTTATCTTTCACTTTGTGCGCAGCATCCA
GCGCCAGATCGATGTCTCGTTTGCCCGAAGACGCCACTTCGCACAGCAGCTGCCCGGTCA
CCGGCGTCAGATTCTGGTAATACTCGCCGTCGGCAGGGGCTACCCATTCGCCGCCAATAA
AGTTGTCATAGCGGGCTTTTAACTTGAGGGGGAAACCATACTCGCCGGGCTTAATCTGTG
CTGAAGGGGGATTATTGGTCATGATCGTCTCCTTGCGGTGTGAGGTATAACAAGGGTAGA
CGTGACTGGCGAAATCTTCGCCAGTCGGTAACAGCTTTACGACAGCTATCACGAATTTAC
GGGCAAGGGTTACAGAGATAGTTGAAAAAGCGGCTAACAATTTGCCAGCCGTTGTGGAAA
TGATGATTACATCGCTGCGCGATAAATCGCCACAATTTCTTCGTGAGTTGCCTGGATCGG
GTTAGTAAAGCCACAGGCATCTTTCAGGGCATTAGTCGCCAATACCGCGAAATCTTCTTC
TTTCACGTTCAGGTCGCGTAGGCCTGCCGGGATATCCACTTTCTTCGCCAGTTCACGGAT
GGCGTTAATGCAGGCTTCAGCACCTTCCGCGTCGTTTTTACCTGTCACGTTCACGCCCAT
TGCAGCGGCACAGTCACGCAGACGTGCAGCGGCGACTTTGCTGTTGAATACCTGAACGTG
CGGCAGCAAAACGGCGTTACATACACCGTGTGGCAGGTTGTAGAAACCGCCCAGCTGGTG
CGCCATCGCATGAACATAACCCAGAGAAGCATTATTGAACGCCATACCGGCGAGGAACTG
GGCATAAGCCATTGCTTCACGCGCTTTCGCATTACTGCCATCTTCAACGGCTAACGGCAG
GTTTTCGGCAATCATGGTCACGGCTTTCAGTGCACAAGCGTCAGTGATCGGCGTGGCGGC
AATAGAAACATATGCTTCGATAGCGTGCGTTAAGGCATCCATACCCGTTGCGGCGGTCAG
TGACTTCGGCATACCAATCATCAGAGAGGAGTCATTGACAGAAAGCAGCGGAGTGACATG
TTTATCAACAATCGCCATTTTGATATGACGCGCTTCGTCAGTGATGATGCAGAAACGGGT
CATTTCAGAGGCCGTACCCGCCGTGGTATTGATGGCGATCATCGGCAGCTGCGGTTTTGC
AGAGCGGTCAACGCCTTCGTAATCGCGAATATCGCCGCCATTGGCTGCCACCAGCGCAAT
ACCTTTTGCGCAGTCGTGTGGAGAACCACCGCCTAAGGAGATCACGCTATCGCAATTATT
CTCTTTAAGTAATTTCAAACCTGCGGCGACGTTTTCCGTGGTGGGGTTAGGTTGGGTGCC
ATCATAAATAACGCTAAAAATATTGCGTTCTTCCAGTGCTTTTTGCACATCGCCCGCCAT
ACCTAATTTCGTTAACATATTGTCAGTGACAATTAAGGTACGGGTAAATCCATAATCTGC
CATCATATTCATTGCATCAGTCAATGAATCAGCGCCGATGACATTCACAGAAGGAATAAA
GAACGTTGAAGCTGCCATAACACACTCCTGAAAGTGTAAAAAAGGGCGGGCAGCTTACTG
AGGATTTTCATTCGAAAATATGATCAGTATTATTGATTATCAAAATTAATCTAATAAAAA
GCACATTGTATTCATTAAACAATGTGCTTTTTTTAAATTCATAAGAATTTTGTATTAATT
TATTTTAAAACTTAATTAATCATTTCCTTATTTTTCCGGAAATAATAATGCGTCGCGCAA
TAAATGATCATTTCCACGACGACGCGTAAAGCCAATGCGGTCAAAATATTCCAGAATCTG
AATTGCCAGCTTTCGGCCTACGCCTAAGCGATCGCGGAAATCCGCCGCGCAGGTTGAACC
ACACTCCTGATCGAGATCGCGGATCATATTGGCAAACTCGACAATCCGATCGTTACGGTA
ATAACGATCTTTAACGATCGCGGTAATTATTCCTTGCTGCGCCGCCTGGCGTAGAGTCAG
GCGCATTGCCTGCTCGTCGGTTCCCGTCTCTTTTGCCAGGTCACGCACCCACCACGGTTC
GTCACCAAACAGTGGCTCTGCTTTTTGCCAGATGGCCTGCTGCTCTTCGCTGAAGCCCGC
TTTGTGATCTGGCAGATGCAGCCAGCCGTGATGGCTGTGGATGTCGCCGCTTTCGCGCAT
CTTTTCAATCAGCAACAGTACCAGCGCTTCATCTTCCATTGGCAACGCCATACGTCGCAG
ACGTTCGCGCCCAGGGCCAGGTTCATCGCGATGTTGCTCATGATAAGTCGCTAATGTGTC
GAGAATTTTCCGCTGCCAGCGGGCGGCAACCGGCGCATTCAACAAGCTATAACCAGCCTG
AATATAACCAGGCTGTTGCAGCAATTCGCGCATCCCTTCGCCGTTGAGCTGGCGCGCCCA
GGCGAAATCCGCAAGGTTAACCGCGCCGCGTTCCAGATGAACAGATAACGCATCGGCATC
GCTCTGCGCCCGTGCAAGAGACGCCAGCCATTGCAGATATTCCGGCTTACGTTTACCGCG
ACGCGGCGGGTTAAGCATCACGACGCGCGCTCCGGCCAGCGTGTTGCGGGCAGAGATATC
GCGCAATACCAGGCGGTCGTTATCTGCCAGCCATAACGGGGTGTCGAAGACCAGTTCAGC
AAGGTTATCTTCCAGCAGTGAAACGCGTCCCGTGACGTGGCTGGCGGCGTGGTGAATATG
CAGCGGCTGCCACTGGGTCAGCGGTGTATGGGTTTGAAGCTCGACAATCACCCGTGTGAA
CGGCTCTGGCGGCACATCGGCAAGCAGCCAGTCGCCACGGTTAATCTGCTCTTTTTCCGC
ATCACCCGCGATGTTAAGCGCGATACGCTGCCCGGCATTGGCGGTTTCTGTTGGCTGGTT
TTGCGCATGCAGCGCACGTACACGCATCGGTTTATTTACACCAGTCAGCCAGAGTGAATC
GCCTACCTTCACTTCCCCGCTTAACGCCGTACCGGTGACGACCAGCCCGGCACCTTTTAC
GGTAAATGCGCGGTCAATCGCGAGGCGGAAACTATGTTGGCTGGCGTGCTCGCGTTCCGG
CAACTGAAGCAGATGCTCGCGCAGGGCATCCATTCCCCGACCTTCGGTTGCTGCGGTGAT
AAACAGTTTTGCCTCAGCAAAACCGTATTCCCGCAGAACCTCCTTTACCTGGCGTTCAAC
CTCATCAACACGCGCTTCGTCCACGCGATCGGCTTTGGTCAGCGCCACTGTCAGCATCGG
GTTACCGGTCAGCTGCAAAATCGCCAGATGCTCACGGGTCTGTGCCATCACGCCGTCATC
GCACGCCACCACCAACAGCGCGTGATCGATACCACCAACGCCCGCCAGCATGTTGGAAAG
AAACTTTTCATGACCGGGAACGTCGATAAAACCAGGCACGCGACCATCCGGCTGCGGCCA
GTAGGCATAGCCGAGATCGATGGTCATGCCGCGCTTTTTTTCTTCCGGCAGACGGTCAGC
ATTTACGCCAGTAATCGCCTGCAATAAGGTTGTTTTGCCGTGGTCAACGTGTCCGGCAGT
CGCAATAATCATTTCAACAACATCTCCAAAAACCGTTGCTCATCTTCAAGGCAGCGTAAA
TCCAGCCACAATCGTCCGTCATAAATACGACCAATCACCGGCACTGGCAATTCACGCCAG
CGGGCGGCTAATGACTCAAGGTGGCTACCGCGTCCATCATGGGGTGTAAACGTTAATGCC
GCGCTCGGCAGGCGATCAACCGGCAGCGAACCACTGCCAATCTGCGAAAGACATGGCATA
ACCTGTACCGCAAACTCCGCGCCGTAATGTGCGGCAAGGGGGGCCTGTAAACGTTGTGCC
TGGATTTGAATGACCTCTGCGCTGCGGGTAAGCAGGCGCAGGGTCGGTAATTTTTCACTC
AGAGCTTCAGGGTGTAAATAAAGACGCAACGTGGCTTCCAGCGCCGCGAGGGTCATTTTA
TCCGCGCGTAATGCACGCTTCAGCGGGTGGCTTTGCAGGCGGGCGATCATCTCTTTTTTA
CCAACAATAATTCCTGCCTGCGGCCCGCCTAACAACTTGTCGCCGGAGAAACTCACCAGA
CTGACGCCCGCCGCAATCAACTCCTGCGGCATTGGCTCTTTCGGCAAACCGTACTGGCTA
AGATCGACCAGCGAGCCACTGCCTAAATCAGTCACTACGGGAACATCCAGCTCTTTGCCG
AGCGCCACCAGTTCCGCTTCATCTATCGCTTTGGTGAACCCCTGAATGCTGTAGTTACTG
GTATGTACTTTCATCAACAGTGCGGTATTTTCATTCACCGCCTGACGATAATCATTCGCG
TGCGTGCGGTTGGTGGTCCCTACTTCGTGTAGGGTGCAGCCTGCCTGACGCATAACATCG
GGAATACGAAACGCGCCGCCAATCTCCACCAGTTCGCCGCGAGATACCACCACCTCTTTT
CCGCTGGCAGTGGCCGCCAACATCAATAACACCGCCGCCGCATTGTTATTGACGATACAG
GCATCTTCCGCCCCCGTAATACGGCACAGCAGCTGCGCCAGCGCCCGATCGCGATGTCCG
CGTCCGGCGTCGTCCAGATCATACTCGAGGGTCACTGGCGAACGCATAGCCTGCGCAACG
GCTTCCACCGCGGCTTCCGCCTGTAAAGCTCGCCCAAGGTTGGTATGCAGCACGGTTCCC
GTCAGGTTGATCACCGGACGCAGCGCGCTCTGCGCTTCTTTCGTCAACCGGGCATCGACT
TCTTGCGCCCAGTTTTCACACCACGCAGGCAGCGTCTGGCTGCCACGAATCACTTCTCGC
GCTTCGTCGAGCATCTGACGCAACAATTCCACCACGCGGGTGTGACCATAAGTATCACGC
AAAGAAAGGAAGGAGCTATCGCGCAATAAGCGATCAATAGCCGGAAGTTGACTATAGAGG
GAACGCGTTTCGGTTGTCATAGGAAACCTGGCTGATCAAGGCCCTCTCACACGGAGAAGG
GCGTTTAACATAACCACGGATTGTAACGTGAGATGGGTCAGGAGGACATATCGCGCATCA
AGCCTTTGGCGGTTCGGTGCGAGCAAAACTTTCGCGGCTAAACAGGTTTTCGACCAGTTT
GACTAAGTGTGGGCGGTCGACACACCAACCTGGCGCAACGCGGCGGAAATTGAGATATCC
GACGGCACAGGCAATGGCGATAGTCGCCAGATTGACCGTATCGGTTTTGAGTGTGCCATC
GACCAGATATCCTTCCAGCACATCCAGACTGCGGTTGATTTTCTCCCGCTGGCGTAACAA
TTCATCTTCAGACTGCTGCGCCGCTGGACGCGCCTGTTCACGCACCGATACCAGCCCGGC
ATCCATAATGCCATCCGCCAGTGCCTCAATTTTGCGCACCCGCAACGACTCCAGCGGATC
GCGCGGCAACATCGCCGGAGCGACATTCATTAATTCAATATATTCAGCGATGATCGGCGA
ATCAAACCAGCATTCGCCCTCTTCGGTCACCAGCACCGGCACTTTTCCTAACGGGTTAAA
TTGCGCCACGCCGTTGTCCGCGTTATAGGGCAGTTCATTAATAAATTCGAAAGTTATGCC
CTTTTCTAACAACAGAATAGAAAGTTTGCGTACAAACGGGCTGGTGTAGCTACCGACGAG
TTTCATGCCGAGTCCTTTGTGCGAGGAAAAATATCAGTATGGCCTGGTGATGGGAAAAAG
GGCAGAAAATGTTGATGGTTTGTTACTTCCAAATAAATCACATATTTATCATGGTGATAT
AAATATTTTCCTAATTATTTCACTCTGATGGATATCTCACTTCAGGCTTTCTTATAAATC
TGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGAAATGAGCG
GAAAACCGGCAGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTTCAGGGTT
CAGCCGGGGTGCGCATTGGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGAG
TGACGTCCGGCCATCCGGTCAATCCCCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCG
ACATCGCCCTGCCCGGCCCGCTGCCGTTCATCCTCTCCCGCACCTACAGCAGTTACCGGA
CAAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCC
GCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATT
TTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGC
GCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGC
CGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGT
GGTGGCTGCTCGGTTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGC
TGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCC
ACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCTGGC
GTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGG
CCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAAT
ATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACC
CGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCACGCGGCGAACTGG
CGGTGGTGTATGACCGTAGTGGCAAACAGGTGCGCAGCTTTACTTACGATGATAAATACC
GGGGCCGGATGGTGGCGCACCGTCACACGGGCCGGCCGGAAATCCGTTACCGTTACGACA
GCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGCTACACGTATCAGTATG
AGAAAGACCGCATCACCATCACCGACAGCCTGGACCGCCGTGAAGTGCTGCACACGCAGG
GCGAAGCCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTCACGCAGA
GTCAGTTTGACGCCGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAG
AGTACAGCCCGGATGTGGTGACGGGCCTCATCACGCGCATAACCACGCCGGATGGCAGGG
CATCGGCGTTTTACTATAACCACCACAACCAGTTAACGTCAGCCACCGGGCCTGACGGGC
TGGAATTGCGCCGGGAATATGATGAATTGGGCCGTCTGATTCAGGAAACTGCCCCTGACG
GCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAG
ATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCA
CCGACTGTTCCGGTTATGTAACCCGTTATGACCATGACCGCTTCGGGCAGATGACGGCGG
TGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTG
CCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACATCGCCGGTGACCTGA
CCGCCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAGG
CCGTCCGTACCACGCAGGGCGGGCTAACGCGCAGTATGGAATACGATGCTGCCGGACGGG
TCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTTGACC
GGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCG
GCAAACTTATCCGCAGCGAGGATGAGGGTCTGGTCACCCACTGGCACTATGACGAAGCAG
ACCGCCTCACGCACCGCACCGTGAAGGGTGAAACCGCAGAGCGGTGGCAGTATGACGAAC
GTGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGGCGGTGCATTACA
GGTATGATGAGAAAGGCCGGCTGACCGGTGAGCGTCAGACGGTGCATCACCCGCAGACGG
AAGCACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCGCAGGGGCTGGCGAACC
GCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGTTACCTGG
CAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGG
AAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGT
TACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACG
GCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCG
GCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATGCCA
CAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCACCCTCAGCA
TGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACG
GCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGC
GGACTCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAAT
ATGAAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
AACGGGTGTGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGC
AAGTGACCTGGTACGGCTGGGACGGCGACCGGCTGACCACAATACAGAACGACAGAACCC
GCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGAGTTGAAACCGCCA
CCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATGCGCTTCAGCAGTCCGGCG
GCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGG
AAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCG
GCCTGACCGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAA
TCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCAAGGAAGGGA
CAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGC
ATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGT
ATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGGTATATCACTCAGGATCCGA
TTGGGCTGAAGGGGGGATGGAATTTTTATCAGTATCCGTTGAATCCAGTTACGAATACAG
ATCCTCTGGGGTTAGAAGTTTTTCCTAGACCATTCCCCTTGCCAATTCCATGGCCCAAAA
GCCCTGCACAGCAGCAAGCAGATGATAATGCTGCAAAAGCATTGACAAAATGGTGGAACG
ATACAGCATCACAAAGAATATTTGACTCTCTAATATTGAATAATCCGGGACTAGCATTAG
ATATAACAATGATAGCTTCTCGTGGAAATGTTGCAGACACAGGGATAACTGATCGTGTCA
ATGACATAATAAATGACAGATTCTGGAGTGATGGGAAAAAACCCGACAGATGTGACGTAC
TTCAGGAACTAATTGATTGTGGTGATATTAGTGCTAAAGATGCAAAAAGCACACAGAAAG
CCTGGAATTGTCGTCACTCCAGACAGTCAAACGATAAAAAAAGATAGCCCTTGTGGAGGT
TCCTGCAATGTCAAATACATACCAGAAAAGAAAGGCAAGTAAAGAGTATGGTTTATATAA
TCAATGTAAGAAACTAAATGATGATGAATTATTTCGCTTACTTGATGATCACAATTCCTT
GAAAAGGATTTCATCTGCCAGAGTATTACAGTTAAGAGGTGGGCAAGACGCTGTTAGATT
GGCAATTGAGTTCTGCTCTGATAAAAATTATATCCGTAGAGATATCGGAGCATTTATACT
CGGGCAAATAAAAATTTGCAAAAAATGCGAAGATAATGTTTTTAATATTTTGAACAATAT
GGCATTGAATGATAAGAGCGCTTGCGTTCGAGCTACGGCAATCGAGTCAACGGCTCAGCG
ATGCAAGAAAAACCCAATTTATTCACCTAAAATAGTAGAACAATCTCAAATTACTGCTTT
TGATAAATCGACTAATGTCAGACGTGCTACAGCATTTGCTATTTCTGTTATCAATGATAA
AGCAACAATTCCACTATTGATTAATCTGTTAAAAGATCCAAATGGAGATGTCAGAAACTG
GGCCGCATTTGCAATAAATATCAATAAATATGATAATAGTGATATTAGGGATTGTTTTGT
GGAGATGCTTCAGGATAAAAATGAGGAAGTCCGTATTGAAGCAATAATCGGACTTTCCTA
CAGAAAAGATAAAAGGGTTTTATCTGTTTTATGCGATGAGTTAAAAAAAAATACTGTTTA
TGATGATATCATTGAAGCTGCGGGTGAATTAGGTGATAAAACGCTACTTCCTGTTTTAGA
TACTATGTTGTACAAGTTTGATGACAATGAAATTATAACTTCCGCTATTGATAAGCTGAA
GCGTTCATAGCGTGAGTTGCCTATGCACAGTGGGGGATTCCCGCCGGCACGGTGCAGATG
CTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGG
CTGGCATCGTGCGGCCTGACCGTGGAGCAGATGAAAAACCAGATGGACCCGGTGTACACG
CCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTCATC
AGCACGGAAGGGGCAACAGCGTGGTGCGCAGAATATGATGAATGGGGCAACCTGCTGAGT
GATGAGAACCCGCATCATCTGCAGCAGCTCATTCGCCTGCCGGGTCAGCAGTATGATGAG
GAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCTGGGGCGGTATATC
ACTCAGGATCCGATTGGACTGAAGGGGGGATGGAATTTTTATCAGTATCCGTTGAATCCG
GTCATAAATGTAGATCCGCAAGGTTTGGTTGATATAAATTTATACCCCGAAAGTGATCTT
ATCCATTCTGTAGCTGATGAGATTAATATCCCAGGCGTTTTCACAATCGGGGGGCATGGT
ACCCCCACATCTATTGAATCCGCAACGCGCAGTATCATGACAGCTAAAGATCTAGCATAT
CTAATTAAATTTGATGGGAATTATAAAGATGGGATGACAGTTTGGTTATTTTCTTGTAAT
ACAGGTAAAGGACAAAATTCATTTGCTAGCTAATTAGCTAAAGAGTTACATACAAATGTA
ATAGGACCTGACACGCTATGGACGTGGTGGGGGCGAGGAACTAATGGTAAGTTAAAAATG
GATACAGTGCTAACAGCACCAACGAACCTTAATTCAAATAAGGATCTAATGGCTATAACA
ACAAAAGACCTTGGTAATTGGATAACATATGGGCCATCTGGGCACCCCATTTCTAATATG
CAAGGTACGCCAGAAAAACCCAGTGATATAAGATAGGTTGTAGATGTATGAAAGCATGCT
TGTTACTATTTTTTTATTTCTCTTTTATTTGTCAATTGCATGGTGCTGATGTGAAAATAA
AACAAAACGAAAGTATGATGGGGTCTACAGCAATGACCTATGATTTAAGTGAAGAAAAGT
TGATGAAACTGAAGTATAAATCACAACATGGTGATTCAGAGGCATCATTTCGACTATATC
AATATTACTGCTTTACTAAAAATAACATTTACAAACAATTGCGATTCTTGGAAAGATCAG
CATCTCAGGGGAATGTTACAGCGCAGTTTAATTATGGGGTCTTTTTATCAGATACAAATC
CAACATTATCAGAATATTATAATTTGAATAGAGCTATTTATTGGATGGAATTCGCTGTAA
ATAACGGTAATATTGATGCAAAGAGCAAACTTCAAGAGCTCAAAAAGCTAAAGCGAATGG
ATAGAAGGAAGAATAAGGAGAATCCGTAAAAGCAATAGTTCATCAGACTGCCGCAGCAGT
AGTATGATGATGAATCAGGGCTGTACTATAACTATTATCGGTAACATTAACCGCAGCAGG
GGCGGTATAACACTCAGGCTCCGATTGGGCTGGAAGGTAGGTGGAATTTTTATCAGTATC
CGTTGAACCCGATTTCTGGAATCGATCCCCTTGGGATTAGCCACCTGTTTATACAGCATA
ACTTTAGGTATGCTTTCGTGTGTTTCAGATATACCATGTGATGATAATTTTTATGATGTG
CTTAGTATTCCAGTCGCTTCTGGTAATAATATGCAATGTAAAAATAATCCCCGTTGTACA
CATTTATAAATAGATGGCCAATACCTCAAGGCCTATGGAGTTGGAATGTTAATGACCCGG
GAGCAAGCAATAGAAAACCTGACGGCATACGATTAGTACCGTCAGTTAATACAGGAACTT
ATAATCGCAATGGATTTTCAATACATAGTTGTTTAAACGCTTTTGGTCCGTCTTTAGGAC
CTCGATTCTGTTCCGAGGGTTGTATAACTGGTTTATCTAATGACATGCAAAAATTAAATG
AGTTAATATTTTCAGAGCCAGATAGCACATTAACAGTTACGGACTAAAAAATATGGCAAG
GTTATTAACAATTGTATTTTTTTCTCTATTTCTGCGAGTGCAGTTACTGCAAGACAATTT
CAGAGAGAGTTAGATTTGGCAGACAAAGCAATATTATGGGCACTAATATCAGCCAGTACT
AAAGAGGGACGAAAAGCGTGTTCACTAAGCTATTTTGCCTGTAAGGCCGCAGAGGCTGAA
CTCGGACTGGCATATATGGCTGCGAATGATAACAAGGAATTTCTCACATCCTTATCTAAT
ATAATGAGGTACAAAATAGATGCTGGACTTTCCGAATCCTATACATGCTATTTATTAAGT
AAGGGAAAGATCATAAGACCATATCTGAAAAATCTAAATCCACTCCAACTTGCCGCTGAT
TGCATTGAAACAGTAAATAAAATAAAAGATAAGAATAAAAAAAATCATTGATATAAATTC
AGTTAATATTTGTAGTGATGATAAAAATATAAAATTGAGAGTTAATAGTACTATTATGGC
CATTGATGATTCTATAAAGTGCATCGATGAATGATAACTTAATTTTATTTAAAAATATAT
TAATAACTCACTCTCCAGGAGTTTTTTTAACTTAGTTTTATAATGAATACGATAATTAAA
AGTGAAGAAGAAAATAGTTGTATACATATATTCCATGACCCTACATTGTGATCTATAGAT
TAAATATTTTTTAAATGTGACTGTCATCCTTCAGATAATAAAGCCATCATCGCAATAGAT
GGAAAAGCACTCCTGCTCTTTTTTGATTAGAGCCGTCGCAGGAGGAACAACTCATATCAT
CATTGCGATCTCGACGATGTATAGTCTCATCCTGCGGCAGAACAAGACGGATAAAAAATC
CAATGAGAGCACACTCATCCAGAACTTATTAACATAATGAATATTAAAGAAAAATCATCG
AAGCTAATGAAGTAATATGCAAAAATAATTAGTCCTTACAAGGAGCAAAGTTCCATAATC
TCCCCCCTCCCCCTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTAGCA
GCACTTTCCGCATCACCGAAACATGGCTGAAATGGTCGGAGTAAACCGCCACCTGGGCGT
AGATGCCGTCGGGTAAGGCATCGATATCATCGTTAGGGTCCAGTTCAATGGTTCCCAGCA
CACCGTCCGTGCCGGGCACGACCGTTAATGATTGCAATACCCCCTGCGCCTGATAAGAAC
CGCCTGGCACGACAGGTAAAATACTAGTCAGTTTGCCGTGAAACACCTGCCCAGGTAGCG
CGTTAAACACCACTTCCGCATCATCGCCAGGTTTCAGACGTAACAGCGAGTTTTGCCGAA
ATTGGGCGACAATTTGCCGTTTTTGCTCGGGGATGAAGACCATCACCGGACGCAGCGGCA
AGGCAGCTGCGTATGTACCTGGGCGGATCAGTACCTGAGTAACGTAGCCATTGCTCGGCG
CGCGAATGACAGTCTGCTCAAGGTTATATTTTGCTTCAGTAAGTTGCGCTCTTAAGCTCA
CAATCTGCGATTGCTCGCCGTTAACCATACTGTCGAGCTGGCTCTGGATCTGCGCCTGCT
CCGCCACCGAGCCTTTCACCAGCGCATCCTGCGCGAGGAAATTTTGCCGCGCATCGTCGA
TGTCACGTTCCGAGAACGGATTCACCGCCGCCTGGCTGCCTTTCAAGTAACGTTGATAAT
TTTTAAACAGACGGTCGCGCTCCGCTGAAACCTGGGTGGTGTTGGCCTGCGCTTCAGTGA
GCTGCGCACGCAGCGTCTTTATATTATGCGTCGCCGTCATCAGGTCAGCCTGAAGTCTGT
CAACTCGCGCCTGGTAACGAACCGGGTCGAGCTTAAAAAGCACCTCGCCCTTTTGAATAA
GCTGATTATTCTTGTCAGTGACTTCAGTAACAATTCCCGTCACCTGTGGCGTGATAGGGA
TCGCTATCACTGCCTTTTGCGCGGTAAAAGTGTAAGGGTGGTTGTAGTTCATCAACAAAA
TCAAACCACTCACCAGAAACACGCCTCCCAGCGCCGCCGTCGCCAGCGTCCACTGATTTA
CCGGAATGCGGAAGATTTTAAAGACCGCCCACGCCAGCGCCACGTAAGTTAAAACAATCA
ATAGATCCATAATTAGATCTCCGGGAACGTGGAATAGTCAGTCTTTTTCTCGGCGGCGAG
TTGATGCTCCAGCCGGGAAATTCGGTCAGAAAGTGCGGCGATTTCCGGGTCAGTCGCTTT
CTCCTGCGACGCAACATGTGACTGCATACCCCAGCCACGCTCCGGTTGATAGAGCGTCGC
CCAGATCCACAGAAACGGCCAGATAACATGCAGAGTAAACAGGCTCACCCAGCCCGCCGT
ATGAATAGCGTCGGCATGGGGATGGTTGCGCTTTTTGGCAATCAGATAAGGGATGTCATG
TATCGCGATGATTCCATAAAAAATCACCAGAAAGACGAAGATCAGCACTCCCAACGCGAA
ATAGTTTAGAAACAT