MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 2-1.seq
 Deletion 2-1
 Length 99306
 Fasta Format

>2-1
TGGTGAACGATCAACAAAGGGCCACTAGCACACCTGATTCCTCTCTAAATACCCTATCCG
AACCTTCTCTTTTGTAACGTTCTAAATATATTCCTAAAAATCTTCAATTCATTGTGACCA
CAAGTTTTTCTTCGCTTTTTCGTATGAAGATACTGTCATTAAAATAATAGAAAAGGATTT
TACGATGAGCGGAAAACCGGCGGCGCGTCAGGGTGACATGACGCAGTATGGCGGTAGCAT
TGTTCAGGGTTCAGCCGGGGTACGTATTGGTGCCCCCACCGGCGTGGCCTGTTCGGTGTG
CCCCGGCGGAGTGACGTCCGGCCATCCGGTCAATCCCCTGCTCGGTGCAAAGGTCCTTCC
CGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATCCTCTCCCGCACCTACAG
CAGTTACCGGACAAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCC
TGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAG
AAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACT
GTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTG
GCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCC
GCAGGGGCCGTGGTGGCTGCTCGGTTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCT
GCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCAC
ACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGA
TGGTGCCTGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGC
CCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGG
TTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGA
CCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCACG
CGGCGAACTGGCGGTGGTGTATGACCGTAGTGGCAAACAGGTGCGCAGCTTTACTTACGA
TGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGGCCGGAAATCCGTTA
CCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGCTACAC
GTATCAGTATGAGAAAGACCGCATCACCATCACCGACAGCCTGGACCGCCGTGAAGTGCT
GCACACGCAGGGCGAAGCCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAG
CGTCACGCAGAGTCAGTTTGACGCCGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGG
CAGGACAACAGAGTACAGCCCGGATGTGGTGACGGGCCTCATCACGCGCATAACCACGCC
GGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAACCAGTTAACGTCAGCCACCGG
GCCTGACGGGCTGGAATTGCGCCGGGAATATGATGAATTGGGCCGTCTGATTCAGGAAAC
TGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTG
CGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTT
GCTGAGCTTCACCGACTGTTCCGGTTATGTAACCCGTTATGACCATGACCGCTTCGGGCA
GATGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGG
ACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACATCGC
CGGTGACCTGACCGCCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGC
GTGGGGAAAGGCCGTCCGTACCACGCAGGGCGGGCTGACGCGCAGTATGGAATACGATGC
TGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGA
TGTACTTGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCA
CGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGTCTGGTCACCCACTGGCACTA
TGACGAAGCAGACCGCCTCACGCACCGCACCGTGAAGGGTGAAACCGCAGAGCGGTGGCA
GTATGACGAACGTGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGGC
GGTGCATTACAGGTATGATGAGAAAGGCCGGCTGACCGGTGAGCGTCAGACGGTGCATCA
CCCGCAGACGGAAGCACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCGCAGGG
GCTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAG
CGGTTACCTGGCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCG
CCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCC
TGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTG
GAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTA
CAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCAT
CCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAG
CACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTA
TGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCAC
GGATGATGAGCGGACTCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACAC
GCGGACACAATATGAAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCG
CAGGGTGGCAAAACGGGTGTGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTC
ACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGGCTGACCACGATACAGAA
CGACAGGAGCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGT
CGAAACTGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATGCCCTTCA
GCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCT
CGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCT
GGCATCGTGCGGCCTGACCGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCC
GGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTCATCAG
CACGGAAGGGGCAACAGCGTGGTGCGCAGAATATGATGAATGGGGCAACCTGCTGAATGA
AGAGAACCCGCATCAGCTGCAGCAGCTTATCCGGCTGCCGGGGCAGCAGTATGATGAGGA
GTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCAC
TCAGGATCCGATTGGACTGAAGGGGGGATGGAACCTGTATGGATATCAATTGAATCCGAT
ATCAGACATCGACCCCCTGGGTTTATCTATGTGGGAGGATGCAAAATCGGGGGCATGTAC
TAATGGTCTTTGCGGCACACTATCCGCTATGATAGGTCCAGATAAATTTGATTCTATAGA
TAGCACCGCATATGACGCCTTAAATAAAATAAATAGCCAATCTATTTGCGAAGATAAAGA
GTTCGCTGGTTTAATATGTAAGGATAATAGTGGCAGATATTTCTCAACAGCACCTAACCG
AGGAGAAAGAAAAGGATCATATCCATTCAATAGCCCTTGCCCTAATGGTACTGAGAAAGT
ATCAGCTTATCATACTCATGGTGCAGATAGTCATGGAGAATATTGGGACGAAATATTTTC
AGGTAAAGATGAGAAAATAGTTAAAAGTAAAGATAACAATATCAAGTCATTTTATTTAGG
TACGCCCAGTGGTAATTTTAAAGCAATAGATAACCACGGGAAGGAAATAACAAACAGAAA
AGGATTACCTAATGTCTGCAGAGTTCATGGTAATATGTAAAAAAATATTGTTTAGGAACT
GTGTCATTGTATCTTTGTTTGTTTTTACATACAACACATGGGCGCAGTGTAATAATAATA
TTAAAATAATGCGCAAGTATGAAAGTGAAGGTAAATATACCGTTAGAAATTTGGTTAAAA
ATAAAGCTATAGCATTGGAATTAGCTGAGATATATGTTAAGAATCGTTATGGACAGGATG
CCGCAGAAGAAGAAAAACCATACGAAATCACTGAGTTAACAACAAGTTGGGTTGTTGAAG
GTACCATTCACTCAGACCAAATTGCTGGTGGGGTTTTTATTATAGAAATAGGCAAAAATG
ATGGGAGAATTCTGAATTTTGGCCACGGAAAATAAGTATGTAAGGATAATCAAACATCGT
GTGCGCTGATGGCAGAGTAGGTGGAGGACTCCAGACAGTCAAACGATAGAAAAAGATAGC
CTTTATGGAGGTTCCTGCAATGTCAAATACATACCAGAAAAGAAAGGCAAGTAAAGAGTA
TGGTTTATATAATAAATGTAAGAAACTAAATGATGATGAATTATTTCGCTTACTTGATGA
TCGCAATTCCTTGAAAAGGATTTCATCTGCCAGAGTATTACAGTTAAGAGGGGGGCAAGA
CGCTGTTAGATTGGCAATTGAATTCTGCACTGACAAAAATTATATCCGTAGAGATATCGG
AGCATTTATACTCGGGCAAATATAAATTTGCAAAAAATGCGAAGATAATGTTTTTAATAT
TTTGAACAATATGGCATTGAATGATAAGAGTGCTTGCGTTCGAGCTACGGCAATCGAGTC
AACGGCCAGGGAAAGATCATCAAAAGTTCACTTTTTGCACTAAATAATTCGCATTTTATG
TTTAAAAATTGAGATATTCCTTATTACCTGAAGCTGTTTTTTATTGCTTATACATGATCA
AATACTCCTTACCTAATTAAGGAGAACAAAATGGAACTTAAAAAATTGATGGAACATATT
TCTATTATCCCCGATTACAGACAAACCTGGAAAGTGGAACATAAATTATCGGATATTCTA
CTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAGAGGATTTT
GGGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTT
CACGATACCATTGCCAGAGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTT
ATTAACTGGATGCGTGACTGCCATTCTTCAGATGATAAAGACGTCATTGCAATTGATGGA
AAAACGCTCCGGCACTCTTATGACAAGAGTCGCCGCAGGGGAGCGATTCATGTCATTAGT
GCGTTCTCAACAATGCACAGTCTGGTCATCGGACAGATCAAGACGGATGAGAAATCTAAT
GAGATTACAGCTATCCCAGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCACA
ACTGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATACAAAAACAGGGAGGTGAT
TATTTATTCGCGGTAAAAGGAACCCAGGGGCGGCTAAATAAAGCCTTTGAGGAAAAATTT
CCGCTGAAAGAATTAAATAATCCAGAGCATGACAGTTACGCAATCAGTGAAAAGAGTCAC
GGCAGAGAAGAAATCCGTCTTCATATTGTTTGCGATGTCCCTGATGAACTTATTGATTTC
ACGTTTGAATGGAAAGGGCTGAAGAAATTATGCGTGGCAGTCTCCTTTCGGTCCATAATA
GCAGAACAAAAGAAAGAGCCAGAAATGACGGTCAGATATTATATCAGTTCTGCTGATTTA
ACCGCTGAGAAATTCGCCACAGCGATCCGAAATCACTGGCACGTGGAGAATAAGCTGCAC
TGGCGTCTGGACGTGGTAATGAATGAAGACGACTGCAAAATAAGAAGAGGAAATGCAGCA
GAATTATTTTCAGGGATACGGCACATTGCTATTAATATTTTGACGAATGATAAGGTATTC
AAGGCAGGGTTAAGACGTAAGATGCGAAAAGCAGCCATGGACAGAAACTATCTGGCGTCA
GTCCTTGCGGGGAGCGGGCTTTCGTAATCTTGCCCTGAATACAGGACTGAGTATCAAAAA
GCCGGTTAACTGAAACTGTCCAGGTTTTGGGGGTCAGTTCATAAACGCCTTATCCGGCCT
AAAAACAACTAAAATTCAATAAATTGCACCGATGCGTAGTCCCTATAAGCTTACGCATCG
GGCAATTGTATTTACGCCATTGTCCCAATCGTCTTCCTGAATCGCAGCAGCGCAATGGTG
AAAAATGCGCCGCCAATTGCCATCAGCGTCAGAAACTGCGGCCAGACGATTTCGAATCCG
GCACCCCGGTAGAGGATGGCCTGCGCGAGGCTAACAAAGTGTGTCGTCGGCATGGTCAGC
ATAATGTCCTGCACCATCTGCGGCATACTTTCGCGCGGCGTGGAACCACCGGAAAGCATT
TGCAGCGGCAGCAGCACCAGAATCACCAGCAGCCCCAGTTGCGGCATTGAACGCGCTATC
GTCCCCATAAAAATGCCGATTGACGTGGTGGCAAACAGACTGAGCGCCACGCCCAGCATA
AACAGCGGGATCGAGCCTTCAATCGGTACGCCCAGTACACCTTTCACCATCAGCACCAGC
GATAATCCCGATACCACCAGCACCACCAGCCCCATCGACCAGATCTTCGCCATCATGATC
TCAAACGGCGTTATCGGCATCACCAGTAAGTGTTCCACCGTGCCGTGTTCACGCTCGCGG
ATCAGCGCCGATCCGGTCAATACAATCGCCAGCATGGTAATGTTGTTGATGATCGCCATC
ACCCCGCCAAACCACGCGGGATCGAGGTTCGGGTTAAAGCGCATCCGGGTTTCCAGCGAT
ACCAACGGTTCGCTGTTATCACGGTAGCGCGCGACAAAGCTGTTCACTTCACCGTTGATA
ATATTCTGGATATACCCATTGCCGGTAAATGCCTGGCTCATGCGCGTGGCATCGACGTTC
ACCTGAATATCCGGCTGGCGTCCGGCGAGGACATCACGCTGAAAATTAGGCGGAATATTT
ATCGCGAAGGTATAGCGTCCGGCGTCCAGTCCGGCATCCATCTCATCGGCGGTGATCATC
TCCGGTGGCAAAAACCACGGACGATAGAAGCTGTTAACGATCCGGTTCGATAACTGCGAT
TGATCCATATCGGCAATGGCGATCGGCGCGAGGTTCAACGATCCTGGCGTAACGGTCGCT
GACGAATACACCGACACCGTAAACGAGAAGACAATCAGCGTCAGCATCGCTTTATCACCG
AGCAGACTGCGCAACTCTTTGATACCCAGATTAAAAATATTGCGTAAATGGCGCATCATC
CCTCCTGTTTTTTCAGCAGCAGGATACTTAAGCCCATCACCAGCGGGATGGCTATCAGTA
ACGGGATAAAAAGTTGCCACAAATCAGTCAGATCCAGCGCTTTCGAGAACGTCCCGCGGG
CGATAGTCAGAAAATGACTGGTCGGGTAAACCTCGCCGATCCAACGTCCAGGCCCTTCCA
GCGAAGCTACCGGATCGATCATCCCGGAAAACTGTGTCGCCGGGATCAACGTGATAATCG
CCGTTCCGAAAATGGCGGCAATCTGGCTTTTCATAAAGGTGGAGATCAGCAGCCCCATTC
CGGTGGCAATGATGATATACAGCAGCGCCGCCAGGGTGAGCGTCAGGAAACTGCCTTTAT
GCGGTACGCCAAACACAAACACCGACAGGCCGCAGAGCAGGAAAAAGTTCAGCATCCCCA
GCGCGATGTATGGCAACTGTTTACCAAGCAAAAATTCACTACGCGTGGTGGGGGTCACGT
AAAGGTTGATAATCGACCCAAGCTCTTTTTCCCGCACCACGCTAAGGGCGCTTAGCATTG
ACGGGATCATCATCAGCAGAAGCGGGATCACCGCCGGAACAATCGCTGGCAGGCTTTTTA
CGTCCGGGTTATAGCGATAGCGCGTCTCAATATTCATCAGCCCGCTTTGGCTGGCGGGTG
TCGATTGTCGGCTCGCCACATCCTGTAACCAGCTCTGGTGCATGGCCTGCACGTAACCTT
TTACCGTTTCAGCACGGCTCGGCATCGCTCCGTCGATCCAGACGCCGAGTTCCACAGGCG
TACCACGCGCGATATCGCGCCCGAAATTGGGCGGGATCTCAATCGCCACCGTGATATCGC
CCGCACGCATCCGACGATCAAGCTCGTCATAACTGGTGAGCGGCGGCTGTTCGATAAAGT
AACGGGAACCGGAGAGGTTGAGTGTCCACGCCTGGCTACTGACGGTCTGGTCGCGGTCGA
GCACCGCAAAGCGCAGGTTTTCCACATCCATACTGATGCCGTAACCCATTATCAGCATCA
GGATCACCGTTCCCATCAGCGCCAGCGTCGAACGTACTGGATCGCGTCGCAGTTCCAGCG
CTTCGCGGCGGCTGTAGCTAAACAGACGGCGCAGGCTAAATCCCTGACGCGGCGCGTGGG
TGGTGTCGTGTACCACGGGCGGCGCTTCGGCTTCGTTGCTCTGCCCTGCCGCTTCCTGCA
AATAGGCGATAAATGCCTCTTCCAGACTGGCGGCTCCGCGTTTCTCAACCAGTTCCTGCG
GTGTACCGCTGGCAAGCACTTTTCCGGCGTGCATCAGTGAGATGCGGTCGCAACGTTCCG
CTTCGTTCATAAAGTGGGTGGAGATGAAGATAGTCACTTTGTCCTGGCGCGAGAGATCGA
CCATCAACTGCCAGAACATATCCCTCGCCACCGGATCGACACCAGAAGTAGGCTCATCGA
GGATTAACATCTCCGGGCGATGAATCACCGCCACCGCCAGCGAAAGCCGCTGGCGAATGC
CGAGCGGCAATGACTCCGGCAGAATATCTTCAACGTCGTTGAGCTTAAAACGCTCGCTCA
TTTCAGCCACTCTTGCGGGAATTTCCGCTTCCGGGATGTGAAACAAACGGGCATGTAACT
CAAGGTTTTGCCGCACGGTGAGTTCGTTATAGAGCGAAAACGCCTGCGACATATAGCCCA
CCCGACGGCGGGTATCGATATCTTTTGGATCAACCGGTTGCCCGAACAGCCACGCCTCAC
CTTCGCTGGCGGGCAGCAGTCCGGTGAGCATTTTCATGGTGGTGGATTTACCGCAGCCGT
TCGAACCAAGAAAACCAAAAATCTCCCCGCGTGGAATGCGGAAATTAACGTGATCAACGG
CAACGAAGGAACCAAAACGCATGGTCAGATCGCGCGCTTCGATGGCAATCTCTGCGTTTT
CAGGTTGATACGGTGGGATCACTACCGCCTGATGCGCCTGGCGTTGCGCTTGCGGTAACA
GATTTATAAATGCTTCTTCCAGCGTAGCGCTTTGCGTTTGCTGCCGTAGCTCTTCGGCGC
TGCCAGTTGCCAGCACTTCTCCGGCATTCATCGCTACCAGCCAGTCGAAGCGTTCGGCCT
CTTCCATATAGGCGGTGGCGACCAGCACGCTCATATTGCTCTGCCGCTGGCGAATACTGT
CGATCAGATCCCAGAACTGGGAGCGGGAGAGCGGGTCAACCCCCGTTGTTGGCTCATCAA
GGATCAACAGTTCCGGGTCGTGGATTAACGCGCAGCACAGCCCAAGTTTTTGCTTCATCC
CGCCGGAGAGTTTCCCTGCCGGACGATCGCGAAACGGTGCTAACCCGGTGCTGGTCAGCA
GCTCATTGATTCGCACTTCCCGCTCCGCTTTGTCGTGACCGAACAGGCGAGCGAAAAAAT
CGACGTTTTCATACACCGACAAGGTGTGGTAGAGGTTTTTGCCCAGCCCCTGCGGCATCC
AGGCGATGCGCGGGCAGACGTCGCGGCGATGCTTCGGGTCGCGCATATCGCCGCCCAGCA
CCATCACATTGCCCTGTTCAATGACGCGGGCACCGGAAATCAACGACAACAAGCTCGACT
TCCCGACGCCGTCCGGGCCAATCAGCCCGACCATACAGCGGGCCGGAATATCGAGAGTGA
TATTGTTCAGCGCAACGGTTTTTCCATAATGCTGGCTCACGCCCGCCAGTTGCGCGACAG
GCGGGACGGGAACCAGTTCCAGATGCGTCATTGCGGCAACCTCACCACGAGGTCGTCAGG
CCACGGAAGTTCTTCATTCACCCGCACCCACGCTACGCCCGGCAAACCGGTTTTGACATA
TTCCAGATGCTGCTGGAGTAATTCCGGTGGGATACGCGCTTTGACGCGGAACATCAGTTT
CAGCCGTTCATCGCTGGTTTCGACGGTTTTTGGCGTGAACTGGGCGACACTGGCGACAAA
ACTGATGGTTGCAGGAATACGCAGATCTGGCGCGGCATCGAGGATCAGCCGGGCTTCACC
GCCCAGTTTCAGCGTGCCCGCCTGTTCGGTTGGCAGGAAGAAAGTCATATAGACGTCGCT
GAGATCGACCATATTCAGCACCCGACCGCCTGCCGCCAGCACTTCGCCTGGCTCGGCAAC
CCGATACTGCACGCGTCCGTCACGCGGGGCTTTCAGTTCGCTGTCATCGATATCTGCGGC
AATGCGCCGTTCAGTGGCTTGTGCCGCTTCGACGCGGGTTTGCGCCTGAATGATATTGGT
GCGTGCCGCTTCTATAGCCGCTTTAGAAGCCGATACCTGAGCTTTCGCCGATTCCAGCGC
AGCTCGGGCGCTCTCAGCGGCGGCGCGATCGTCATCCAGCTGTTGCGCAGAAATAGCCCC
TCGTTGGGCCAGTGAACGGGAACGCGTATGACGTTTTGCTACGGAGTCCAGTTCTGCCTG
GCGTTGATTAACCAGCGACTGTGCGGCACGAGTTTCGCTTTGTCGTTGCTCCAGCAAAGC
CTGCGCGGCAGCAACGGCGCTTTGTGCCTCTTTGATTTGCGCGATGGCTTCCAGTCGCTG
TTCCTGCAACACGCGAGTATCCATCTTCGCCAGCACTTCACCTTCGCGAACAAACTTGCC
TTCTTTCACCAGAATGGTGTCGATACGCCCGGCAATTTTGCTGGCAATATCCACTTCCGT
CGCTTCAATGCGCCCATTACTGACAGCAAAGCCTTCCGGCACACCTGCCGGGCGCAACAG
CCACCACGCCACGATAGCCGCCACCGCCAGTAACCCGACAACCCACCACGCCAGATGGCG
CTTACTCTTATCCATAATCGACCCGCCATAATCCCTGTAAGCAAACGACGCGTGTTACAA
CTGCCGCCGAACGACGTTCAGCGGATTCTTCCATCCGGGATAAGAAGGAAACGGCAAATA
CGACCAGCGCGCAGAGCATTGAGCGCCAACGGGGAAGGCTTAGTGAAAACGGGTAGTAAT
GTTGTCATCATCAGCATTCCTGGCCGTAAATGAAACACGCATACTCATAAGTGTGATCTA
TAAAACTGGCTGACAAAACGGTATCCATCCTGTTGGATAGCGTTTCACGCCTGTTCAGTT
GCAGGAACAGAGCATTCCTTTTTACGTTTTATCAACAGTCTCAACCAGATAGTAACATTA
ATATTCATGTTGTCTATGGTTCAGAGCTGTAACATTGTGCGCCTTCTAATCAAAGGCATA
AGTCCATTTCTGTTTTTTTCATGCTGGTAAGACTTCCAGGGAGTGGTTATCTCAGGCCCT
GCACCAGGGTTAATTTGGCAATTATGCATGCTGAACATTCTTCCAGCATGTTTACTGTCA
CGGGCGTTAAGACCTAAAACTGTCCCCGTTTCGCCTATGCGTTCTCTTCCACCATTTCCG
TTATGTGCAACAACTTGATTTATACCTAACATTTGTGAACATGCTAATAGTGCTTCAAGT
TTAGGTCTGTAATCTGTCGAAACAGAAAAATAACGATTAAAGGATCGACAAGAGATAGCC
CGGCTAGTTTTAAACTTTTTGCCATTAATTATAGCATGATGCTTTTTATTGATAATTGCC
GCTAATTCGACCGGATCGAGAGCATTGGTCATTTCATCAATAGAGACTGTTATCGGTCCT
ATAATGTAACGTTTTCGCTGATCATCAAAAGTTATCCCATGATGATTTGCCATTATTTTG
TATTTGGGGTCATAGAAACATACAGGATAATCTTTTATCCCAGAGTAGGTATCCTCATCG
AGTGGTTTCATACGCGTGAAGTTCTGCATATAGTTACCATTGCAATTCGTTTCATGATTT
CCAGCTAATACATGAACATTTTCATTGATACTCATTATGCGTTTTAACAAATCGATGATA
AATTGATCACCACAGATATTGCTAAATCGATCGCCGGTTTGGTCGCCCAGAAACGTACAT
GGCGTCACAGCGTCTTTATTAATAACTAAATAAGGCTGAAGACTTTCTAAAATAATGTCT
CTTCTGTTCAGGATACTGATTATTGTATTAACATTAGTGTTAAGTTGCTCATTAAAGTTC
TCCCTTAGCAATACGTTGAGAACTTCATCTTCTATATTAAGCAACTGGCTAAGGAAATTT
TCTCCTTCAGCCATGATTCCCAAATGTCCCGTTGCGAAAAGCGCGAACAAAACTGCACCG
ACTGAGCCATCGGTATCACCAAAATAGGTTGGTCTGGTACTTGTGGGATCAACGGGTAAA
CAATTGGAGAAATAGATTCTGTCAGCGAACTGGGGTTTTATCATTGTTTCGAATTTAATA
TCAGATACATTATATTGCGATATTTTCCAGTTCCAGATGGGTTTGTACGACTCAGTAACT
GCAACATCATTAGCATTATCATTTACTGTCATATTATTAAGTAAATAAACAATACTGCAC
CAATTAATATCGGTATTATCAAGAGAGCAACCGTAATTTTTGCTATTAATTGTCACAATA
AACTGATAATTATTATTCCTACGTAGAATATGAGCACGCATGCCCGATAGCATACTATAT
TTTTCTGAATGATCCGTTTGTATGGTAAATGAAATTTTGTCATCTTGAATAGATTGTTGG
AACCGTTCTATTTGCCAATCATCTATTTTTTCCACAACCTCACCGAGCATTGTCCTGGCA
ATACTTGATATATCATCACCTATACCATTTGCAATATACCCAAACAGTTCTTTAGTGAAG
TTGGTAACATGCTCTTGCACCATATCATTTGTTGCGATTGTCGTTGTACTGTCGTTAGTG
CCTGCCACAGTTCCAATTTTCATATTTTACCTCATATTATTTACCGCGAGGAATACATAG
TTAACATTTTATCTTATGACATACACCTCATGTTCGATGGGAAAATAATTATATTTTGCA
CAAATCATTCAGCCTCAAAGCATAATATGAAATTTCTTATCTCATAGCAGAGAAAGTCCC
TAAAGATTGTAGAGGCGTCATCAGAACATGCCTCTACAATCGATTAAGAAAACCTATGAA
ATACTGGCAGGATTAAAAAGACATACCACCGTATTCATGGAGTTTTAATGTAGTTGAAAA
CAACTAAGCCCTGAGGAATAAATTATTTTATTATTTTTATCACGTGCTTCCTTCAGGGAA
TTTAGCCCCATAATACCATTATCAAATTGTTGATTATGATCTACCCCGGGCCCATGATGC
CCATATTTTTGTCTAATGTATTTGCTGGGGTCTTCACCTTTGAGTGTCTCCCCACATATG
AAGATACGTTCACGTGCTGGTCTGAAATCAGTAGTGTTATCAAAATAATTAGCATATACA
GGTGTGGGTTTCAAAGTATTGCTTCGGATTAGATGGAATAGAGGATCATCCATGTGTTCT
TTATGTTTTTTATTAAAAATATTGGCTAATTCCTCAGGATCAGTAGGATTTTTCATCTGA
TTAAATGGAACCTGCAAAGCACCGAGACAATAACATTTTTTTCTTCATCTCTTATTATTC
CGTGATGACTGGTTAAAACTTGCCTTTCTGAGTCATAATTACAAACATCGAGCGTTTTAA
TTAAGTTATACGTATCACCGGCAGAGAGTTTATGATTTGCTAGTCGTGCAGTATAGTTAC
CATTAAAATTGATTTCATGATTTCCAGCCAGAACGACGACATTTTTATTAATACGGCTAT
CTTTATTACCCTCCATATTTCGCATAGAATTTAGCAAAGTAAGGATATATTTATCACCAA
AAATAGTACTAAATCTATCGCCTGTATGATCCCCAAGGAAGATACAAGGGGTTATCGCAT
CGTCCTTTAAAAAAACATGTTGATGCAACTCATTCAAGATCATGTCTCTCGTATTTAATA
AATCGTAGAGCACTTTATTATTTTTATGTTTGTATGCAGATGAAGCCATCTCTTCGTGTT
TTAATAATTCACATAATAAACTCCAACCCTTTTCCCTGATGCCTATATGCCCTGAAACGA
GCAATGCATAAAGTACAGCGCCTACTCTTCCATCTGTATCGCCAAAATAAGCCGTGTTGG
CATTTTGTGGGTTAATCACACCACACTGTTTATAGAAGTCTATTTTTGAAAACACAGATT
TAACATAGCTATCAAACTTTTCCTTAGTAAACGTCTCTTTAGAGACATCCCAACGCCAGT
CAGGTTTGAAATTACCACTAAGAAGAGTAAAGAAATTTCTCGCTATGATAGAAAGCCCAT
CAACTTTATAAATTATATCTGATTTATCTCCAGAGGAATTAATAAAATAATAACCGCCCT
TACACTCAACAGTAACGGTAATGGGAGACGATAATTTTAACACATGGTTATTGTCTGGTA
TAATTGTAAAGATAAACGTATCAGTAGTATTGTCGGCGAATCTATTATATTCTTGAATAT
CTATAGAAGGTTCACTATTATAAAACCATACTTTCTCCATCTGGTGACTACGATCATTTA
CCTTCCAGTGACCATGTTGCAGGAAATAGATGATATGCAGGCCAAAATCGTTATCTATTT
GCGAATCATTATCCAGTTTATCAAATTCAACTATCTTTGCACGATGTGTTTTATCAACCT
TGCCATGGTGTTGATGACTGTTAACTTTATCTGAATGCTTATCTTGATGGCTTGAAGAGA
TGTTTCTAATCTGATTGTCAATTGCTTTCATAAATAACCTGTGATATTTTTGAATTGTTT
GTAACAAAATAAATGATACTTGTCTGAAAAACAGATTTACGACGATATAAAATAATAATA
CTTATATGTTCGCTGATTTTAAGCACCGAGACTATCCGGTCTTTTACCAAATAATGAAGA
ATAATCCCTCCCTGGAAGATAATTGTAAAAAACAACAGCATAAGAATTAATCTTAGGATA
AATTTTTATTTATCATGGCCTTTTGAACGCTGAAAAGTAGCGCTCTGCAAAGTAAACCCC
GCTATAGTTATGCTATGCATTTGTCTTTAATGATATCTCGTCATTATATTAACAGGATGA
AATTATCATTAATGCATATTTCAATATTAGCAGGGATACCTGAGGAGTTTAAAGTGAACA
TATATATCGGGTGGCTTTTCAAATTAATCCCTTTGATTATGGGCTTAATTTGTATCGCGT
TAGGTGGCTTTGTGCTGGAAAGTTCAGGGCAAAGCGAGTATTTCGTCGCGGGTCATGTGC
TGATTTCTCTGGCGGCCATATGCCTGGCATTATTCACTACCGCATTTATTATCATTTCGC
AGCTCACGCGCGGCGTTAATACGTTTTACAATACATTGTTCCCCATTATTGGCTATGCGG
GGTCAATTATCACCATGATATGGGGTTGGGCACTGTTAGCAGGCAATGATGTGATGGCAG
ACGAGTTTGTCGCCGGCCATGTTATTTTCGGCGTTGGTATGATTGCCGCCTGTGTATCGA
CGGTGGCAGCGTCATCCGGTCACTTTCTGCTCATTCCCAAAAATGCAGCGGGGAGCAAGA
GCGACGGAACACCGGTACAGGCTTATTCTTCATTAATCGGTAACTGCCTCATTGCCGTTC
CCGTTTTACTCACCCTGCTCGGTTTCATTTGGTCTATTACGCTGTTACGTAGTGCTGACA
TAACTCCGCATTATGTCGCGGGTCACGTATTGCTTGGGTTAACCGCAATCTGTGCCTGTC
TAATTGGCCTTGTTGCCACAATTGTCCATCAAACACGTAATACGTTTTCAACTAAAGAAC
ACTGGCTGTGGTGTTATTGGGTTATTTTTCTCGGCTCAATCACGGTACTGCAGGGGATAT
ACGTCTTAGTCAGTTCCGATGCAAGCGCCCGACTGGCTCCCGGCATTATTCTTATTTGCC
TCGGAATGATCTGTTACAGCATATTCTCAAAAGTCTGGCTACTGGCACTGGTATGGAGAC
GTACCTGTTCGTTAGCCAACAGAATACCGATGATTCCCGTCTTCACCTGCCTGTTTTGCC
TTTTCCTGGCATCGTTTCTTGCGGAAATGGCGCAGACCGACATGGGATATTTTATTCCTT
CGCGAGTTCTGGTCGGTTTGGGAGCGGTATGCTTTACGTTGTTCTCAATCGTTTCAATAT
TAGAAGCGGGTTCTGCTAAAAAATAATTGCAACGTACCGGATAAAACCAGCGTTGACCAT
TTGCGTAACGCTGGTTTTTCTTAGGCATCATGAAATAACGCAGCATTAATGCATAGTGGT
TAAGTATAAAAAACAGCAAAGTTACTGTTTTTTTCAACCTGTTCATATTTCATAAAGATC
TGGCCACTGAGTGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGGGTT
TCAGTTCACGGGCTCATTAGAAAATAATCACAAGATAACCACTATCAAAATTAGCTCATT
TTTAATGCGACTCTAATAATTTTCATCTTTAGGAAATAGGTCAGGACGACTTTGCTGCAA
TCAAATCCTGCGCACAAGCCCACGCACTCGACCACGCCCACTGGAAGTTATAGCCCCCCA
GCCAGCCGGTGACGTCCATCACTTCGCCGATGAAGTACAGCCCAGGCACTTTGCGCGCTT
CCATCGTCCGTGAAGAGAGTTCGTTGGTGTCCACGCCGCCGAGCGTCACTTCGGCAGTGC
GATAGCCTTCAGTGCCGTTGGGTTGTACGCGCCAGTCGGTCAATGTGCTAATCAGTGCCT
GTTGGTCACGCACGTTGAGCTGTTTTAGCGAAACATCCGGGATTTGCCCGAGTTGCTGTA
AGCGTTCAACCAACCGCTTCGGTAGATGAACCGCCAGTGTGTTTTTCAGGCTTTGATTCG
GATGTGCGTTACGCTGCTCATTCAGGAAGGTTTCGAGGTCCACATCCGGTAGCAGATTGA
TGCTGACAAATTCCCCCGGTTGCCAGTAGCTTGAAATCTGCAACACCGCCGGTCCAGACA
AGCCGCGGTGGGTGAAGAGTAAGTTCTCACGGAAAACGGTGCCGTTTTCAGCGGTAATCA
CGGAAGGCACCGCCACGCCCGCCAGCACCTGTAACTCTTCGAGCAACGGTTTATGCAGAG
TGAATGGCACCAGACCCGCGCGGGTCGGCAGCACGTTGAGGCCAAATTGTTCGGCAATCT
TATAACCAAACGGCGACGCGCCCAGCCCCGGCATTGACAGCCCACCAGTCGCGATGACCA
GCTTTTCGCAACCGACAGTCATGCCGTTCAGATCAAGCGTGAAGCCTGTTTCATCCTTCG
CCACACTCAGCACTTCGCTACGCAATCTGAAGGTCACATTGCCCTTCTCGCACTCATCCA
CCAGCATGTCGACAATCTGCTGCGCGGAGTCATCGCAGAAGAGTTGCCCTAACGTTTTCT
CGTGCCAGGCGATGCCGTGTTTATTGACCAGATCAATGAAATCCCACTGGGTAAAACGTG
CGAGTGCAGACTTACAAAAATGCGGATTCTGGCTCAGATAAGCGCCTGGTTCGACATAAA
GGTTGGTAAAGTTGCAGCGCCCACCGCCAGACATAAGGATTTTGCGCCCTGGTTTTTTAC
CATTATCGATCAGCAGAACCCGGCGTCCTGCCTGACCTGCCAGCGCAGAACAGAACATAC
CCGCCGCACCAGCGCCTATAATAATGGCATCAAACCTTTCCACGTTGCGCTCCTCTTAGA
AAAAACGGGCGTGAATTGTAAAGATTCCTCAGTGGTCGCACCAGCATCAATATTACTAAA
AGGAAGTATTTGCCTGAATTATATAAGATAATTATTTTTTGAGTGAAATCCATACAGGGG
GCAAATCAAAAAAAGTCTATATTTCACTTTGCCCGCGCCGCGAAAGTCACTGATAATGCG
CCGCGTTCATGTCCTCAAAATGGCGTAACGTCCTATGCTACATTTGTTTGCTGGCCTGGA
TTTGCATACCGGGCTGTTATTATTGCTTGCACTGGCTTTTGTGCTGTTCTACGAAGCCAT
CAATGGTTTCCATGACACAGCCAACGCCGTGGCAACCGTTATCTATACCCGCGCGATGCG
TTCTCAGCTCGCCGTGGTTATGGCGGCGGTATTCAACTTTTTGGGTGTTTTGCTGGGTGG
TCTGAGTGTTGCCTATGCCATTGTGCATATGCTGCCGACGGATCTGCTGCTTAATATGGG
ATCGTCTCATGGCCTTGCCATGGTGTTCTCTATGTTGCTGGCGGCGATTATCTGGAACCT
GGGTACCTGGTACTTTGGTTTACCTGCATCCAGCTCTCATACGCTGATTGGCGCGATCAT
CGGGATTGGTTTAACCAATGCGTTGATGACCGGGACGTCAGTGGTGGATGCACTCAATAT
CCCGAAAGTATTAAGTATTTTCGGTTCTCTGATCGTTTCCCCTATTGTCGGCCTGGTGTT
TGCTGGCGGTCTGATTTTCTTGCTGCGTCGCTACTGGAGCGGCACCAAGAAACGCGCCCG
TATCCACCTGACCCCAGCGGAGCGTGAAAAGAAAGACGGCAAGAAAAAGCCGCCGTTCTG
GACGCGTATTGCGCTGATCCTTTCCGCTATCGGCGTGGCGTTTTCGCACGGCGCGAACGA
TGGTCAGAAAGGCATTGGTCTGGTTATGTTGGTATTGATTGGCGTCGCGCCAGCAGGCTT
CGTGGTGAACATGAATGCCACTGGCTACGAAATCACCCGTACCCGTGATGCCATCAACAA
CGTCGAAGCTTACTTTGAGCAGCATCCTGCGCTGCTCAAACAGGCTACCGGTGCTGATCA
GTTAGTACCGGCTCCGGAAGCTGGCGCAACGCAACCTGCGGAGTTCCACTGCCATCCGTC
GAATACCATTAACGCGCTCAACCGCCTGAAAGGTATGTTGACCACCGATGTGGAAAGCTA
CGACAAGCTGTCGCTTGATCAACGTAGCCAGATGCGCCGCATTATGCTGTGCGTTTCTGA
CACTATCGACAAAGTGGTGAAGATGCCTGGCGTGAGTGCTGACGATCAGCGCCTGTTGAA
GAAACTGAAGTCCGACATGCTTAGCACCATCGAGTATGCACCGGTGTGGATCATCATGGC
GGTCGCGCTGGCGTTAGGTATCGGTACGATGATTGGCTGGCGCCGTGTGGCAACGACTAT
CGGTGAGAAAATCGGTAAGAAAGGCATGACCTACGCTCAGGGGATGTCTGCCCAGATGAC
GGCGGCAGTGTCTATCGGCCTGGCGAGTTATACCGGGATGCCGGTTTCCACTACTCACGT
ACTCTCCTCTTCTGTCGCGGGGACGATGGTGGTAGATGGTGGCGGCTTACAGCGTAAAAC
CGTGACCAGCATTCTGATGGCCTGGGTGTTTACCCTTCCGGCTGCGGTACTGCTTTCCGG
CGGGCTGTACTGGCTCTCCTTGCAGTTCCTGTAATCGTACGCACCAAAACGAGCGGGTCA
GCTGGCCCGCTTCAGATTGTGACATAGTGCGCTTTGTTCATGCCGGATGCGGCGTGAACG
CCTTATCCGGCCTACAAAAACATGCAAATTCAATAGATTGCAGAGATTATGTAGGCCTGA
TAAGCGTAGCGCATCAGGCAATTTTGCGTTTGTAATCAGTCTCGAGCGGGTCAGTTTACT
GGCCCGCTTTTTTTATGCGTTATTATTGCTGAAGTGCTTAATGCCAAATCATCAATGCAA
TCAGGCTGACCACCACCAGACCACACAATGCGCTGGTCAGAATAAACTGCCGACGCACCC
GCTCACAGCGGCGAATAAATTCATCATCGTGATGATCGCGATAACGTTGGGCATAGATAT
ACCAAACGAGACGCACCTGTTTGTTGGGTTGGCCATGTGAGGTAAAAAAGCCCCCTCCAT
CAACATATTGATAGAGCAATGGATCGCAGTTACGCAGTACCACTAACAACGCGCGTAGTG
ATGAGAAATAGCGCGCCATGTTAACAATGCAAACGACACATAAAGCCCAAAATAATGCGA
CGGTGCTTATCATACCTCCTCCCCGGCGACCTGCCCGCGGAGTTCCACCCCGGGGCTACC
GCTCCCGATACGCTGCCAATCAGTTAACACCAGGTCCTGGAGAAACCGCTTTTGTGGTGA
CCAACATACGAGCGGCTCTATAGATAGTGTAGGAGATCAGGTTGTTTTTTTTCCAGAAGG
TTAACCACTATCAATATATTCATGTCGAAAATTTGTTTATCTAACGAGTAAGCAAGGCGG
ATTGACGGATCATCCGGGTCGCTATAAGGTAAGGATGGTCTTAACACTGAATCTTTACGG
CTGGGTTAGCCCCGCGCACGTAGTTCGCAGGACGCGGGTGACGTAACGGCACAAGAAACG
CTAGCTGGCCAGTCATCGACAACTTTATGGAAGGAGTAACACTATGGCTTATAAACACAT
TCTCATCGCGGTCGACCTCTCCCCGGAAAGCAAAGTTCTGGTAGAGAAAGCAGTCTCTAT
GGCTCGCCCCTACAATGCGAAAGTTTCTCTGATCCACGTAGATGTAAACTACTCTGACCT
ATACACCGGGCTTATTGATGTGAATCTGGGTGATATGCAGAAACGCATCTCTGAAGAGAC
ACATCATGCACTGACCGAGCTTTCCACTAATGCAGGCTACCCAATCACTGAAACCCTGAG
CGGCAGCGGCGACCTGGGCCAGGTTCTGGTCGATGCAATCAAGAAATACGATATGGATTT
GGTGGTTTGTGGTCACCACCAGGACTTCTGGAGCAAACTGATGTCTTCCGCACGTCAGCT
GATCAACACCGTTCACGTTGATATGCTGATTGTTCCGCTGCGCGACGAAGAAGAATAATC
TTCCCTCTACGACGTGTTCCTGAACGCCCGCATATGCGGGCGTTTTGCTTTTTGGCGCGC
CTTGTTACCTGATCAGCGTAAACACCTTATCTGGCCTACGGTCTGCGTACGCAATCAAAA
TCCCCAGCCAATACAACATTTAACACCATCATATTTTCCATCATTAGTGTGATCATCTGG
TTATTTTCTGTTGTAATAGTGTATTAATCTATTCACCGCATCAATATTAAGAATCTCTGA
CAGATGTAAACTTTTTCGCGCGTTATCCCTTACGCGTTCATACTTTTCAGGATGGTATTG
GAAGGTTAATAAATATGAATACAACAACACCCATGGGGATGCTGCAGCAACCTCGCCCAT
TTTTCATGATCTTTTTTGTCGAGTTATGGGAGCGATTCGGCTACTACGGCGTGCAGGGCG
TACTGGCGGTTTTCTTCGTTAAACAGCTTGGATTCTCGCAAGAGCAGGCTTTTGTCACTT
TTGGTGCTTTTGCTGCGCTGGTCTATGGCCTCATTTCCATTGGCGGCTATGTCGGCGACC
ACCTGCTGGGGACCAAACGCACCATTGTTCTTGGAGCACTTGTGCTGGCGATTGGCTACT
TCATGACCGGCATGTCGCTACTTAAGCCTGACCTGATTTTCATCGCCCTGGGGACTATCG
CTGTCGGTAACGGCCTGTTTAAAGCTAACCCAGCCAGCTTGCTTTCGAAGTGCTATCCGC
CGAAAGATCCGCGGCTTGATGGCGCATTCACCCTGTTCTATATGTCGATCAACATCGGCT
CGTTGATAGCGTTATCGCTGGCCCCTGTGATCGCTGATAGATTCGGTTATTCAGTCACCT
ACAACCTGTGCGGGGCGGGGTTAATTATCGCATTACTGGTTTACATCGCCTGTCGTGGAA
TGGTGAAAGACATTGGTTCTGAACCCGACTTCCGGCCAATGAGCTTCAGCAAACTGTTGT
ACGTGTTACTTGGCAGCGTGGTGATGATCTTCGTATGCGCATGGCTGATGCACAACGTAG
AAGTCGCCAATCTGGTGCTGATTGTTCTCTCCATCGTCGTCACCATCATCTTCTTTCGTC
AGGCATTCAAGCTGGATAAAACCGGGCGCAATAAAATGTTTGTCGCCTTTGTCCTGATGC
TCGAAGCGGTGGTGTTTTACATTCTCTACGCCCAGATGCCAACATCGCTGAACTTCTTTG
CCATCAACAACGTGCATCATGAAATTCTCGGTTTTTCCATCAACCCGGTCAGCTTCCAGG
CGCTTAACCCGTTCTGGGTGGTACTCGCCAGCCCAATACTGGCAGGCATTTACACGCATC
TGGGTAACAAAGGCAAAGACCTCTCGATGCCGATGAAATTTACTCTCGGCATGTTTATGT
GCTCACTGGGCTTTTTGACGGCGGCAGCTGCGGGAATGTGGTTTGCGGATGCACAAGGGC
TGACATCGCCATGGTTTATCGTGCTGGTGTACTTATTCCAGAGCTTAGGTGAACTGTTTA
TTAGCGCCCTTGGCCTGGCGATGATTGCTGCCCTGGTGCCGCAGCATTTGATGGGCTTTA
TTCTCGGGATGTGGTTCCTGACGCAGGCTGCCGCGTTCTTGCTGGGCGGCTATGTGGCAA
CATTTACCGCGGTGCCGGACAACATTACCGATCCGCTTGAGACGTTGCCCGTCTATACCA
ACGTGTTTGGTAAGATTGGTCTGGTCACGCTGGGCGTTGCAGTAGTGATGCTGTTGATGG
TGCCGTGGCTGAAACGCATGATTGCGACGCCGGAAAGCCATTAATTATTCTTGCAGAAAG
CAGGGTAGCGTTATCGCTACCCTGTTTTAGTTTTACACTGGCGTACCTGCATAGATATCA
AAGCGATGCCCTTTAGTGACTACCGCGTTTGGCGTGGCGACATTCGCCAGCGGTGGCGCG
TAGTCCGGGCGCTTTACCACCACGCGTTTGGTCGCCAGCAAGCGTGCAGGCTCCAGTAAT
CCATCGGCATCAAGATCCGGTCCCACCAGCGACTGAAAGACACGCATCTCTTTTTTCACT
AGCGCGCTTTTCTGCTTATGCGGGAACATCGGGTCGAGATAAACCACCTGCGGGCGCGGG
GTAATATCAGTCAGCGCCGTCAGGCTGGAGGCGTGAATTAACTGCAACCGCTCCTGCAAC
CAGCCGCCGATTTCCGCATCCGCATAACCACGCGCCAGGCCGTCGTCGAGTAGCGCGGCA
ACCACTGGATTACGCTCCAGCATCCGCACGCGGCAGCCGACTGAAGCCAGTACAAAGGCA
TCGCGCCCAAGTCCTGCAGTGGCATCCACCACATCCGGCAAATAATCGCCTTTAATGCCC
ACCGCTTTCGCCACCGCCTCACCGCGACCACCGCCGAATTTGCGTCGGTGCGCCATCGCT
CCGCCAACAAAATCAACAAAGATGCCGCCAAGTTTTGGCTCATCACGCTTGCGCAATTCC
AGATGTTCCGGCGTTAACACCAGCGCCATCAGGTTGTCTTCATCGTGCTCCAGCCCCCAG
CGGGCCGCCAGAACAGATAAGGCACCGTCTCCGGTGCCTGTTTCATCAATTAAGCAGATT
TTCACTGAATGATCAGCCCTTAATGCCGTAATGCTCCAGCATCGCATCCAGCTGCGGTTC
ACGACCACGGAAGCGTTTGAACAGATCCATCGGCTCTTCTGAACCGCCACGGCTCAGAAT
GTTGTCGAGGAACGACTGCCCGGTTTCACGGTTGAAAATGCCCTCTTCCTCAAAGCGCGA
GAAAGCATCTGCCGCCAGTACGTCAGCCCACAGGTAGCTGTAGTAACCTGCGGCATAACC
ACCGGCGAAAATATGGCTGAAAGCGTGCGGGAAACGGCCCCAGGACGGAGATGGCACCAC
GGCAACCAGTTTCTTGATTTCTGCCAGAGTTTCGAGGATTTTTGCCCCCTGATCCGGGCG
GAACTCGGCATGAAGGCGGAAATCAAACAGGCCGAACTCCAGCTGACGCAGAATAAACAG
CGCCGCCTGGTAGTTCTTCGCCGCCAGCATTTTATCCAGCAACTCTTTCGGCAGCGGTTC
GCCGGTTTCATAGTGACCAGAGATAAACGCCAGCGCCTCCGGCTCCCAGCACCAGTTTTC
CATAAACTGACTCGGCAGTTCGACCGCATCCCACGGCACACCGCTGATACCGGAAACACC
AGCGGTTTCGATGCGGGTCAGCATATGGTGCAGGCCGTGACCGAACTCGTGGAAGAGGGT
GATCACTTCGTCGTGAGTGAACAGCGCCGGTTTACCATTTACCGGGCGGTTGAAGTTACA
AGTCAAATACGCGACCGGTTTTTGCAAAGAACCATCAGCTTTACGCATCTGGCCTACGCA
GTCATCCATCCACGCCCCGCCGCGCTTGTTTTCACGGGCATACAGATCGAGGTAGAAGCT
ACCGCGCAGTTCGTTATTTTCGTCATACAGTTCGAAGAAACGTACATCCGGATGCCAGAC
ATCAACATCTTTACGCTCTTTAGCGGTGATGCCGTAAATACGCTTAACCACTTCAAACAG
GCCGTTAACCGCTTTGTTTTCCGGGAAGTACGGACGCAGCTGTTCGTCACTGATGCTGTA
GAGGTGCTGTTTTTGTTTTTCGCTGTAGTAAGCGATATCCCACGGCTGCAACTCATCGAC
GCCAAATTCGGCTTTGGCAAAGGCACGCAATTGCGCCAGCTCTTTTTCGCCTTGTGGACG
CGCGCGTTTTGCCAGATCGGTTAAGAAATCCAGCACCTGCTGCGGGTTTTCTGCCATTTT
AGTGGCAAGGGATTTAAAGGCGTAGTTTTCAAAGCCCAGCAGTTGCGCCAGTTCGTGACG
CAGCGCGAGGATCTCTTCCATCACCTTGCTGTTATCCCATTTACCGGCGTTTGGGCCTTG
ATCGGAGGCGCGGGTGCTGTAAGCGCGATACATCTCTTCACGCAGAGCCTGGTTGTCGCA
GTAGGTCATTACCGGCAAGTAGCTTGGGATATCCAGCGTCAGCAAATAACCTTCCAGCTC
TTTCGCTTCGGCCTGGGCTTTTGCCGCAGCCAGCGCGCTTTCTGGCATCCCCGCCAGCTC
CGCTTCGTCGGTAACGAGTTTGGTCCAGCCCATTGTCGCATCGAGGACGTTGTTGCTGTA
CTGGTTGCCCAGTTCAGAAAGACGGGTCGCAATTTCGCCGTAACGCTGCTGTTTCTCTTT
CGGCAGACCTATGCCAGAGAGTTCAAAGTCGCGCAGTGCGTTATCAACCGCTTTCTTCTG
CGCCGTGTTCAGCGTGGCGTAATGATCGCCATCGCGCAGGTCGCGATACGCTTTATACAG
CCCTTCATGTTGCCCTACCCAGGTGCTGTATTCCGACAGCAGCGGCAGGGTTTGTTCGTA
GGCTTCACGCAGTTCCGGGCTATTTTTCACCGAGTTCAGGTGGCTGACCGGGGAGAAGAT
ACGCCCCAACACATCGTCCACTTCCGCCAGCGGCTGGCAGAGATTTTCCCAGGTGTACGG
TGCCCCTTGCGCTACTACGCGCTCCACGTTTTCGCGGCAGTCGTTCAATGCCTTAGTCAC
GGCTGGAACGACATGTTCCGGGAGAATTTTAGAAAACGGAGGCAATTCAAAGGGAGTCAG
TAACGGATTCGTCATTCGCGCAGTCCTGGTTAAAGAGGTTAAGGAAGCGCTCAACAGGCG
CTTTACATAATGTGTGTAGCATGGGGTTAAGTGTAGTGAATTTCAATGAGAAACGTTACG
CTTTCGCGGCGGCGGCCTCTTTTCGGTATACTGTCCTGATACGCTTTTGTGCGCCCCGAA
TACGGGCCGATTTTTACTTACCGGAACACCTTTACCCATGCTCAGTTATCGCCACAGCTT
TCACGCTGGCAACCACGCCGACGTCCTTAAACATACCGTTCAGAGCCTGATCATCGAGTC
GCTGAAAGAGAAAGATAAACCGTTTCTCTATCTCGACACCCACGCAGGGGCCGGGCGTTA
TCAGTTAGGCAGCGAACATGCCGAGCGTACCGGCGAATATCTCGAAGGCATCGCCCGTAT
CTGGCAGCAGGACGATTTGCCCGCAGAACTGGAGGCGTACATCAATGTGGTAAAACACTT
CAACCGTAGCGGTCAGTTGCGTTACTACCCCGGTTCGCCGTTGATTGCTCGCCTGCTACT
GCGTGAACAGGACAGCCTGCAACTGACCGAACTGCACCCGAGCGATTACCCGTTGTTGCG
TTCTGAATTTCAGAAAGATAGCCGTGCGCGTGTCGAAAAAGCCGACGGTTTCCAGCAGCT
TAAGGCCAAACTGCCGCCGGTTTCCCGCCGTGGTTTAATCCTTATCGACCCGCCGTATGA
AATGAAAACTGACTATCAAGCGGTGGTCAGCGGGATAGCAGAAGGTTACAAACGTTTCGC
CACTGGTATTTACGCACTGTGGTATCCGGTGGTGCTGCGTCAGCAAATTAAGCGCATGAT
CCACGATCTGGAAGCGACCGGTATTCGCAAAATTCTGCAAATTGAACTGGCGGTACTGCC
AGACAGCGATCGCCGTGGCATGACCGCTTCCGGCATGATTGTGATTAACCCGCCGTGGAA
ACTGGAACAACAGATGAATAACGTGCTGCCGTGGCTGCACAGCAAACTGGTTCCGGCAGG
CACCGGGCACGCCACCGTAAGCTGGATCGTGCCGGAGTAATTGCAGCCATTGCTGGCACC
TATTACGTCTCGCGCTACAATCGCGGTAATCAACGATAAGGACACTTTGTCATGACTAAA
CACTATGATTACATCGCCATCGGCGGCGGCAGCGGCGGTATCGCCTCCATCAACCGCGCG
GCTATGTACGGCCAGAAATGTGCGCTGATTGAAGCCAAAGAGCTGGGCGGCACCTGCGTA
AATGTTGGCTGTGTGCCGAAAAAAGTGATGTGGCACGCGGCGCAAATCCGTGAAGCGATC
CATATGTACGGCCCGGATTATGGTTTTGATACCACTATCAATAAATTCAACTGGGAAACG
TTGATCGCCAGCCGTACCGCCTATATCGACCGTATTCATACTTCCTATGAAAACGTGCTC
GGTAAAAATAACGTTGATGTAATCAAAGGCTTTGCCCGCTTCGTTGATGCCAAAACGCTG
GAGGTAAACGGCGAAACCATCACGGCCGATCATATTCTGATCGCCACAGGCGGTCGTCCG
AGCCACCCGGATATTCCGGGCGTGGAATACGGTATTGATTCTGATGGCTTCTTCGCCCTT
CCTGCTTTGCCAGAGCGCGTGGCGGTTGTTGGCGCGGGTTACATCGCCGTTGAGCTGGCG
GGCGTGATTAACGGCCTCGGCGCGAAAACGCATCTGTTTGTGCGTAAACATGCGCCGCTG
CGCAGCTTCGACCCGATGATTTCCGAAACGCTGGTCGAAGTGATGAACGCCGAAGGCCCG
CAGCTGCACACCAACGCCATCCCGAAAGCGGTAGTGAAAAATACCGATGGTAGCCTGACG
CTGGAGCTGGAAGATGGTCGCAGTGAAACGGTGGATTGCCTGATTTGGGCGATTGGTCGC
GAGCCTGCCAATGACAACATCAACCTGGAAGCCGCTGGCGTTAAAACTAACGAAAAAGGC
TATATCGTCGTCGATAAATATCAAAACACCAATATTGAAGGTATTTACGCGGTGGGCGAT
AACACGGGTGCAGTGGAGCTGACACCGGTGGCAGTTGCAGCGGGTCGCCGTCTCTCTGAA
CGCCTGTTTAATAACAAGCCGGATGAGCATCTGGATTACAGCAACATTCCGACCGTGGTC
TTCAGCCATCCGCCGATTGGTACTGTTGGTTTAACGGAACCGCAGGCGCGCGAGCAGTAT
GGCGACGATCAGGTGAAAGTGTATAAATCCTCTTTCACCGCGATGTATACCGCCGTCACC
ACTCACCGCCAGCCGTGCCGCATGAAGCTGGTGTGCGTTGGATCGGAAGAGAAGATTGTC
GGTATTCACGGCATTGGCTTTGGTATGGACGAAATGTTGCAGGGCTTCGCGGTGGCGCTG
AAGATGGGGGCAACCAAAAAAGACTTCGACAATACCGTCGCCATTCACCCAACGGCGGCA
GAAGAGTTCGTGACAATGCGTTAAATGTTAAAGGGCTAAGAGTAGTGTGCTCTTAGCCCT
TAATTACGTTTCCGCTATCAGTTCAGAAGCTGAAGCAGAAAGCGGATCAGTTCCAGCAGC
GCAATTAACGCCCCTAGAACGATGATTGCTTTATCAATCACCCGTTTTCTCCATGCGATG
GAGTGAGAATGCATCCGCTTACTCATCCACTGCCTGTCACGGCGCATGTCTCATTGTTAG
ATAAGAACTCTCTCACTCCGGCCAGAGCATCAGTTAACGGCACCACCCGTACTTCTGACC
AGGACTTTGAAAGCGTTTATGCGCATTGCCAGAGTGAAAATGCCTCAGAGCTAACTGGAT
AATCATACAGTACATGCAGGTTATAAAACCAGCACGTCCTTGCAATAGTTTCAGTATGGT
ATTAGCATTGATGCGTTAGATGATGGCTATCTCACTCCAGTCAGAGCCACCAACTCAGGG
CTGGAAAGTAAAAAACCGACGCAAAGTCGGTTTTTTTACATCCGGATTCGGACAAGGCTT
AATATGACGATGACCCAGTGAAAGTATATAAATCGTCACTGCGATATATACCGAAGTGCT
CCCTCCGCCAGCTGAAGAAATCGCTAATTCTTGCAATGTTAGCCACTGGCTAATAGTATT
GAGCTGTTAGATAAGAACTCTCTCACTCCAGCCAGAGCCACCAACTCAGGGCTGGAAAGT
AAAAAACCGACGCAAAGTCGGTTTTTTTACGTCCTGATTCAGACCTCCTTTCAAATGAAT
AGCCAACTCAAAATTCACACCTATTACCTTCCTCTGCACTTACACATTCGTTAAGTCATA
TATGTTTTTGACTTATCCGCTTCGAAGAGAGACACTACCTGCAACAATCAGGAGCGCAAT
ATGTCATTTCTGTTACCCATCCAATTGTTCAAAATTCTTGCTGATGAAACCCGTCTGGGC
ATCGTTTTACTGCTCAGCGAACTGGGAGAGTTATGCGTCTGCGATCTCTGCACTGCTCTC
GACCAGTCGCAGCCCAAGATCTCCCGCCACCTGGCATTGCTGCGTGAAAGCGGGCTATTG
CTGGACCGCAAGCAAGGTAAGTGGGTTCATTACCGCTTATCACCGCATATTCCAGCATGG
GCGGCGAAAATTATTGATGAGGCCTGGCGATGTGAACAGGAAAAGGTTCAGGCGATTGTC
CGCAACCTGGCTCGACAAAACTGTTCCGGGGACAGTAAGAACATTTGCAGTTAAAAATTT
AGCTAAACACATATGAATTTTCAGATGTGTTTTATCCGGGAGGCATTATGTTACTGGCAG
GCGCTATCTTTGTCCTGACCATCGTATTGGTTATCTGGCAGCCGAAAGGTTTAGGCATCG
GCTGGAGTGCAACGCTCGGCGCAGTACTGGCGTTAGTTACGGGCGTGGTCCATCCGGGTG
ATATTCCGGTGGTGTGGAATATCGTCTGGAACGCGACGGCTGCGTTTATCGCCGTCATTA
TCATCAGCCTGCTGCTGGATGAGTCCGGCTTTTTTGAATGGGCGGCGCTGCACGTCTCAC
GCTGGGGTAATGGTCGTGGTCGCTTGCTGTTTACCTGGATTGTCCTGCTCGGTGCTGCCG
TTGCCGCCCTGTTTGCCAATGATGGCGCGGCGCTTATTTTGACACCGATTGTCATCGCCA
TGCTGCTGGCTTTAGGGTTCAGTAAAGGCACTACGCTGGCGTTCGTGATGGCGGCCGGAT
TCATTGCCGATACCGCCAGCCTGCCGCTTATTGTCTCCAACCTGGTGAATATCGTTTCCG
CTGATTTCTTTGGCCTCGGCTTTCGCGAATACGCCTCGGTGATGGTGCCGGTGGATATCG
CCGCGATTGTTGCCACGCTGGTGATGTTACATCTCTATTTTCGCAAAGATATTCCGCAGA
ACTACGATATGGCGCTGCTGAAATCTCCCGCAGAAGCGATCAAAGATCCTGCTACGTTCA
AAACTGGCTGGGTTGTTTTACTGCTTCTGCTGGTGGGATTTTTCGTCCTGGAACCGCTCG
GCATTCCGGTGAGCGCCATTGCAGCTGTGGGCGCGCTGATATTATTTGTCGTCGCTAAAC
GCGGTCATGCGATTAATACGGGTAAAGTCCTGCGCGGTGCCCCCTGGCAGATTGTCATCT
TCTCGCTCGGCATGTATCTGGTGGTTTATGGCCTGCGCAATGCCGGATTAACGGAATATC
TTTCTGGCGTACTCAACGTGCTGGCGGATAACGGCCTGTGGGCCGCGACGCTCGGCACCG
GATTCCTCACCGCCTTCCTCTCTTCTATTATGAACAATATGCCGACGGTACTGGTTGGCG
CGTTGTCCATTGATGGCAGCACGGCATCTGGCGTTATCAAAGAAGCGATGGTTTATGCCA
ATGTGATTGGCTGCGATTTGGGACCGAAAATTACCCCAATTGGTAGCCTGGCTACGCTAC
TCTGGCTGCACGTACTTTCGCAGAAGAATATGACTATCAGCTGGGGATATTACTTCCGTA
CAGGGATTATCATGACCCTGCCTGTGCTGTTTGTGACGCTGGCTGCGCTGGCGCTACGTC
TCTCTTTCACTTTGTAATGAGATACTGATATGAGCAACATTACCATTTATCACAACCCGG
CCTGCGGCACGTCGCGTAATACGCTGGAGATGATCCGCAACAGCGGCACAGAACCGACTA
TTATCCATTATCTGGAAACTCCGCCAACGCGCGATGAACTGGTCAAACTCATTGCCGATA
TGGGGATTTCCGTACGCGCGCTGCTGCGTAAAAACGTCGAACCGTATGAGGAGCTGGGCC
TTGCGGAAGATAAATTTACTGACGATCGGTTAATCGACTTTATGCTTCAGCACCCGATTC
TGATTAATCGCCCGATTGTGGTGACGCCGCTGGGAACTCGCCTGTGCCGCCCTTCAGAAG
TGGTGCTGGAAATTCTGCCAGATGCGCAAAAAGGCGCATTCTCCAAGGAAGATGGCGAGA
AAGTGGTTGATGAAGCGGGTAAGCGCCTGAAATAAAGCGGCGATATCCCCCCCACAGGTT
GTTAGAAAAGTGCGCTTTATTTATGTCGGATGCGACGCTGGCGCGTCTTATCCGACCTAC
AAAGTTATGAAAATTCGATGAATAGTATGTTATTTGTAGGCCTGACAGGCGTAGCGCATC
AGGCGATTTTGCTATTTACACAGTACTCCCTGCGTGAGATTCCAATTATCGCGTCCAGCA
TGGTGTATCAGTGAGCTGCTTAGTTATCAGCGATACAGCGCAGTAGTTTAAAGACGTACT
GGATTATGATTTATCAGTGGTTTACACAACAAATTATTAAATAATTATAAGATACCTTAA
CCCATTTTATTATTACACATCTAAAACATCACAAAAAAAATCACTTCACACACTATCAGA
GAACATAATAACTTTTTAAAATGAGCGCATTTTGATAGTTGTTAACGATTTCCTTTACGA
TACTATCACTACCCTTTTTTTACACACAAATATTACCGGGTGGAGATAAAAGGGAAATCA
AAGGTAATTATATCAGGAAGATATAACGCATTACATTTATTGTGTGTAGAAGAAAATCCA
TTCCTGTTCTAATTATCCAATTTAAACATCTTAGCATAAAACAAATGATGAATAAGGAAT
TTTATGTCAATTGACTTTACCCCAGGTATAATAAATACATATCACGGCGATATTTATAAC
TGCACAACAAATACCGATAATGCTAAAACGCCAGACACACCGAAGTGGCCTTGCGATAAT
TGGGAAGAACAACAACCCATTAATTCCACATTCTCTGGAGAAGGATATATCTCTGATCAA
TATGATTTAGCGCAACACCAACTTCAACAAATTAATGCGTGCCACACGAACACTACATAT
ACAAATGCAGACTACTCAAAAGTTGTGGCTCAACTTGTAAGTCTTATTACTAACATTGAA
ACGATAAGTTCGACACAACTTACGCAACAGACACAATCAATACTTAATCAGATTAATAAC
ATTAGATATGAAAAAAACAAAAGTGCTGAATGTCGAATCATTGTTATCGCTAATCCTAAA
CCCGACAAGGCAATCATAACTAAAATTAGCGTAGAAGAGGGAATACCCATAACATTCAGT
GTCCAAACCATGTTTTCAGATACTAATTTTATTGCTGAACAACGAGCTGACTTACCAACT
AATATAAAAGATATTCAAAGCCTGTATCAAAAAATGACGAAGTTATATATTGAGCACAGT
GAAAATAAAAACAGGATGAAAGTCTTTGCCGGAACCAACTTTATTGATTTCAATATGACA
GGACAGAACCTGTCCGGGTTCGTTCTAACCTTGTCAAGGTTTTATTTCGAAGATCTACTT
AATATAAATTTCACTGACGCAAATTTAGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTC
GGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCT
TGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTG
AGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAA
CATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAA
CTGTCGCTTGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTA
TTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCC
GGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGC
CCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAG
CTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTT
GGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTG
ATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGAT
GGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATT
GATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCAT
GATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGA
GGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCAT
GCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGG
GTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGA
CAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGT
AAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATA
TCAGGGACTTGTTCGCACCTTCCTTAGGTGACACTATTTTTTTACATAAAGAACACCCTA
CCCCCAAATTATATAAAGATGGACAATATCTTGACAAACAAATCGAAGGTTTATTTTCAA
CATTATTAACCATTAATGACAACCTTTTACGAGCAAAAGCGGAAATTGCTTCGACAATAA
TTAAATTTTTAGAGGCCAGGATAACCAATCTTTCATACAATGACATATTAAAATATCAGC
AAGAATTCCAAAGACAATGTTATAAGCAAGTTAAAGCCTTTACGACACTCTCCCGATACA
ATAAAATTCAAACATGGGCAGAAATGTCTGAATATCAATTCGAAGTATTTCAATACGAGA
CGCTTAACCCAAAAAAAATGTCACACACGCCTTATTTAAAGAGGCCACTGCCTAATGAAA
AAGATATAAATTATGGGGTGGAAATAGAAATACCATCTGGTAAAAGAATTCGCTTATCAA
ATCATTACCAGAATATAATACCATAATATTGATTATTAGCACTTTATAATCATTGAATAA
AAATAGATTTTATGTACTTTTAAAACAATGCACTATATTATGGGGTGATGGATATTCATG
TCACGCCCCAAAATTAACTGAGTTCACCTAAACAGAAAGGATATAAACATCAGACAGGTT
TACGTTACTATCAGGCATATCACCTCAGAATCAGATGAAAACTATAAAGAAATATCTATT
ATGGTTTTAATATTTGTTGATAAGGATAGTAACATGAACATGACAAAAGGTGCACTCATC
CTCAGCCTTTCATTTTTGCTTGCCGCATGTAGTTCAATTCCGCAAAATATCAAAGGCAAT
AACCAACCTGATATTCAAAAAAGTTTTGTTGCTGTTCATAACCAGCCGGGGTTATATGTT
GGTCAACAAGCGCGCTTTGGTGGGAAGGTTATCAACGTTATCAATGGCAAAACGGATACG
TTGTTAGAAATCTCTGTATTACCGTTGGATAGCTATGCGAAGCCTGATATTGAAGCCAAC
TATCAGGGCCGACTGCTCGCCAGACAAAGCGGCTTCCTTGATCCAGTGAACTATCGTAAT
CACTTTGTTACCATCCTCGGCACCATTCAGGGTGAACAACCTGGCTTTATCAATAAAGTC
CCGTATAACTTCCTGGAAGTGAATATGCAGGGCATCCAGGTGTGGCATTTGAGAGAAGTG
GTTAATACCACCTATAACCTGTGGGATTACGGCTATGGTGCATTCTGGCCGGAACCGGGC
TGGGGTGCGCCTTACTACACCAATGCGGTGAGTCAGGTAACACCTGAGCTGGTCAAATAA
CACCACCGAAAGATGCAGATGCTTTCTCAGCATCTGCATCATGCATTACATCAAATTAAT
ACACAGTAAGCTAACTATTATTATTATAAGCCCTGTCCTGTTAATTACCTTTGGCAAACT
GATTATAAAGTTAATGTCCGCACCAGGAGTCGGTTATGTTTCTTATAATTACCAGGGATA
CGATGTTCTTCACCGCGATGAAAAACATTCTGAGTAAAGGTAATGTCGTTCATATACAGA
ACGAAGAAGAGATCGACGTAATGTTGCATCAGAATGCCTTCGTCATTATTGATACATTAA
TGAATAATGTATTTCATTCTAATTTTCTCACTCAAATTGAACGATTAAAACCTGTCCATG
TCATTATTTTCTCCCCCTTTAATATTAAACGCTGCCTGGGGAAAGTGCCGGTGACCTTTG
TTCCGCGGACTATCACTATCATTGATTTTGTCGCACTCATCAATGGCAGTTACTGCTCTG
TGCCTGAAGCGGCTGTGTCACTTTCGCGCAAGCAACATCAGGTTCTGAGCTGCATTGCGA
ATCAAATGACAACGGAAGATATTCTGGAGAAACTGAAAATATCGCTAAAAACGTTCTACT
GCCATAAACACAATATCATGATGATCCTCAATCTTAAGCGGATCAATGAGCTGGTACGCC
ATCAGCATATTGATTATCTGGTGTGAATTTCAGGCTTACGGTGAGTCTGGCTACGCTGCC
ACACAGATTAGCTAATTGAAACGCCTTTCACCCCTGCCATACCTTTTAATAATCGCAACA
GGTCTTCTATCGACGTTGTGGCATGAAGCTGGATATCAATGGCGACCACTTCATGATCTT
CATTTTCCTGCAACGAAACTAAATCAGTTTTTATTTTTTGCTGCTTAAACCAGTCGAGCA
TTGATACCGTATTACCGTTCACTAATGTCAGCTGTAAATGGTAATTTTTGTTCATCAGGC
GGAAGGTTAATTGATGGAAGACTTCCAGCACCAACAAGGTCATCACTGAACCATAAATAC
CCAGTTCGTACATACCGCTGCCAATAACCATACCTATGGCGGCGGTCACCCAGATATCCG
CTGCCGTCGTCAGACCTACAATATTTTGGTTACGAACGAGAATGTTACCTGCACCGATAA
ACCCGACGCCCGTCACCACCTGAGCAGCAATACGGCTGGGGTCGAGTCCGACGTGATCTA
AAGACAGCACGTCAGCAAAACCATATTTCGAAACAATCATAAACAGGGCGCTTCCCATGC
CAATTAATACATGTGTGCGTAACCCTGCTCCTTTGCCGCGCATTTGCCTTTCCATGCCAA
TAGCGCCACAGGCAATTGCCGCGAGTATAAGACGTATAATAAATTCTGCTGTCATATAAA
AATGCAAAAAGGAGCAGCAAGATGGCTCAACTTGCTACTCCTTTTTACTTGCACCTCATT
AATTCGGCAAGTCATTAGATGCTTGATTTTTGAAGGTATACAAATTTTTCTGCGGGTTTT
TCTTACAGTATTCGATCACTTTAGGAATTTGAGTGAGATCGGTTTCATTTAAAGTAACGG
TATCGCCACCTTTATATACTGTTTCTTCATGCAGCATCCACCATGCAACCGGGGTCATTG
CTTTTGGATTCAGATCAATAAATTCCTGGCAGGTCATATCTTTAGCGGATTCATTGGCTG
CCAACGCAGATTGTGCGTTCACCAGTGACAAAGCCGCTACAGCGCCCATAAAAATAAACG
CTTTACGGAGAGATGAAATATTCATTTTGTAACCCATTCAATATAGAGATTATATATGAA
CAGGAGGAATAGCTGCTTTTAAAGAAGATATTCCGGCCTGTTCAATATGCAAGGAAGTAC
GATGTAACGCATTCCCGGAATTACATATCTTTCTTAATTTTGTCCCATTCGCCTTTAACT
TTATCTTTAAAGTTGGCTTGTTTATCCTGAGTACAAGCCTGAACGATAGCTGGGGTTACG
GTTGCAATACCCTGAACATCTAAAACCGCATCTTCTGGTTTATCTTTGTTGTTCAGCGCT
TCAGCAAAACCAACTGCAGTTGGCTGGAAGGATTCGTCCACAGCCAGGAAATCTTCACAG
GTCCAGGAGTTGACCGGTTTTTTGTTATCAGCTGCTTTTTGCGCATCCGCTGCATTGCTC
ACAACTGGCAGAAGAAGCAGACCACCAAGAATAACGCCTAATACTTTTTTCATCGTAATA
TCCTCAACTATAAAGTGAAAGAGCCGTCACGAATCAATTTCGACACTGAGGTTATAACCT
GGTTTTCTGTATATGTCATGTTGATGGAAAATATCAAAATCAGATATTTTTATTTCAATA
CAATGAGTTACAGATGCATCAGATACTGCAATTAGGAAATTTTTATTAAATCGACTGCAT
TCTTAGACGCGTTTTTGGCATAGATTGATAGCAGGGGATTTTCTTCTTAATTTTATAGGG
TGGTTCTATGTTATATATAGATAAGGCAACAATTTTGAAGTTTGATCTGGAGATGCTTAA
AAAACATCGCAGAGCAATCCAGTTTATTGCCGTGCTGCTGTTTATCGTCGGGTTGCTGTG
TATCAGTTTCCCGTTCGTCTCTGGCGATATTTTAAGCACAGTAGTGGGTGCATTATTAAT
CTGCTCGGGTATTGCGCTTATTGTCGGGTTATTCAGCAACCGCAGTCATAATTTCTGGCC
GGTATTATCCGGTTTCCTCGTCGCAGTCGCCTATTTATTGATCGGCTATTTCTTCATCCG
CGCACCGGAGCTGGGCATTTTTGCCATTGCGGCATTTATTGCCGGTTTGTTCTGTGTTGC
AGGGGTTATTCGCCTGATGAGTTGGTATCGTCAGCGTTCAATGAAAGGCAGCTGGCTACA
GCTCGTTATTGGTGTGCTGGATATCGTCATTGCCTGGATATTCCTTGGTGCAACGCCGAT
GGTGTCTGTAACGCTGGTTTCCACACTGGTGGGAATTGAACTGATATTTAGCGCCGCCAG
CCTGTTCAGCTTCGCCAGTTTGTTCGTTAAGCAGCAATAATTACCCCGGTTGTCACCCGG
ATCATAGTCACTTGATGTGACTATGATCCGATTAATACTCTCTCCGCTACGCAGTGTTGT
AGATCAATTGCGCACTATCATTGAAATAATTACCTGCTAGTGATTATTTCAACCTACTGA
ATTTCATCTAATTTTTTTCACTCTATGGCAAATTAGCCATTTCAAACATTATCATGGCTG
ATATTTTCCGTAGTCAGGTTTAATGTTTTAAAAGTGCTGTGGGAAAGTGAACAAAGAGTT
CCGTAAGCGTTGATGCTATGGGCGGTTAAATAAGTAATCCGGGTTCATTTTTTTGCAACT
GGCGTTGATTACATTGCATAAATATCCGTGTCTCCAGACGCTATATAAAAACCTGAAGAC
ATGAATGCGTTATTTACTCAGGTAATTTCAATGCGTTAAAAGAAAGCTGGCAATCCAATT
GCCAGCTTAAGTCGAAACAAGGAGACTCGATATTTAAATCGGATTACATTTTAACTTTAG
TAATATTCTTCAGAGATCACAAACTGGTTATTGATAACTTATTCTTGGGCAGTAATCCGC
AAACGTTAACTTTTTGTTTGCTATTTACAAGCTGATAACAACCAGGAATCTTACTTAGGA
TCAATATATGGAGTGCGTGATGGATAAATCTGAAGTATTGATTAGTGTTAATAGACGTAT
TAGTTCACGAAGGGTAAAGTTCTTATAGGCGTTTACTATATTGAACAACGATTCGGACAA
GGATGTAAATAATGAAAAGGATGACATATTCGAAACGATAACGGCTAAGGAGCAAGTTAT
GATTTTTCTCATGACGAAAGATTCTTTTCTTTTACAGGGCTTTTGGCAGTTGAAAGATAA
TCACGAAATGATAAAAATCAATTCCCTGTCAGAGATCAAAAAAGTAGGCAATAAACCCTT
CAAGGTTATCATTGATACCTATCACAATCATATCCTTGATGAAGAAGCGATTAAATTTCT
GGAGAAATTAGATGCCGAGAGAATTATTGTTTTGGCACCTTATCACATCAGTAAACTAAA
AGCTAAAGCGCCTATTTATTTTGTTAGCCGCAAAGAAAGTATCAAAAATCTTCTTGAGAT
TACTTATGGTAAACACTTGCCCCATAAGAATTCACAATTATGTTTTTCACATAATCAGTT
CAAAATTATGCAACTGATTCTGAAAAATAAAAATGAAAGCAATATCACGTCGACGCTCAA
TATTTCGCAACAAACATTAAAGATTCAGAAATTCAACATTATGTACAAGCTGAAACTAAG
ACGTATGAGCGACATCGTCACCCTGGGTATCACATCTTATTTTTAGTCAGGACATAAGCA
ACTGAAATTGATGGCTGGCATGACGAGGGATGCAGATGCTGATTTCATTACCCCCGGTGA
TTACTAAAGGAGAGGCTAAAACGACTTTATTCCCCTGGTATGTGTATCCACCAGTAGAAC
CCTTCGTTGCCCGAATGCTGGCAGGAACTGTTGGCAGAACGGCAACATTTTTTTTGTCGT
TGACCTCACCATGTCGATCACTGTGCCTGTATCCCACCTTACTGGCTGACAACCCCACTA
TGCCGCTGGTCTGTAAATCCCTCATATCTCTCCTCGCGCGCAATTTAAAGAACCGTTATT
TCTCAAGAATTTTCAGGGACTAAAATGAACAGAAGAAGAAAGCTGTTAATACCGTTGTTA
TTCTGCGGCGCGATGCTCACCGCCTGCGATGACAAATCGGCGGAAAACGCCGCCGCCATG
ACGCCTGAGGTCGGTGTCGTCACACTCTCCCCCGGTTCGGTCAATGTGTTGAGCGAATTG
CCCGGTAGAACCGTTCCTTATGAAGTTGCCGAGATACGTCCCCAGGTGGGCGGTATTATC
ATTAAACGCAACTTTATCGAAGGCGATAAAGTGAACCAGGGCGATTCGCTGTATCAGATT
GATCCTGCACCTTTACAGGCCGAGCTAAACTCCGCCAAAGGCTCGCTGGCGAAAGCGCTC
TCTACCGCCAGCAATGCCCGCATCACCTTTAACCGCCAGGCATCGTTGCTGAAGACCAAC
TACGTTAGCCGTCAGGATTACGACACCGCGCGCACCCAGTTGAATGAAGCAGAAGCCAAT
GTCACCGTCGCCAAAGCGGCTGTTGAACAGGCGACGATCAATCTGCAATACGCGAATGTC
ACCTCGCCGATTACGGGCGTCAGCGGGAAATCGTCGGTGACCGTCGGCGCACTCGTTACC
GCTAATCAGGCAGATTCGCTGGTTACCGTACAACGTCTGGACCCGATTTATGTCGATCTC
ACGCAGTCGGTGCAAGATTTCTTACGCATGAAAGAAGAGGTCGCCAGTGGGCAAATCAAA
CAGGTTCAGGGCAGTACGCCAGTACAGCTCAATCTGGAAAATGGTAAACGCTACAGCCAG
ACCGGCACGCTGAAATTCTCCGACCCGACAGTGGATGAAACCACGGGCTCCGTGACGTTA
CGGGCGATTTTCCCCAACCCAAATGGTGACTTGCTGCCTGGCATGTACGTCACGGCATTA
GTGGATGAAGGTAGCCGCCAGAATGTATTACTGGTGCCGCAGGAAGGCGTCACCCACAAC
GCCCAGGGTAAAGCAACGGCGCTCATTCTGGATAAAGACGATGTCGTGCAGCTACGCGAA
ATTGAAGCCAGCAAAGCCATCGGCGACCAGTGGGTCGTCACCTCTGGCTTGCAGGCTGGC
GATCGGGTGATCGTTTCCGGTTTGCAACGCATTCGTCCGGGTATCAAAGCACGAGCAATT
TCCTCCAGCCAGGAAAACGCCAGCACCGAATCGAAACAATAACGTTGCAGGCTTAAGGGG
ACTTTCATGGCTAACTATTTTATTGATCGCCCGGTTTTTGCCTGGGTACTTGCCATTATT
ATGATGCTTGCAGGTGGTCTGGCGATCATGAACTTACCGGTTGCGCAGTATCCGCAGATT
GCGCCACCGACCATTACCGTCAGCGCTACCTATCCAGGTGCCGATGCGCAAACGGTAGAA
GACTCGGTCACTCAGGTGATTGAGCAAAATATGAATGGGCTTGATGGCCTGATGTACATG
TCTTCAACCAGTGATGCGGCGGGCAATGCCTCTATCACTCTGACCTTCGAGACTGGGACA
TCTCCTGATATCGCACAGGTTCAAGTGCAAAATAAACTGCAACTCGCTATGCCTTCATTA
CCTGAAGCAGTGCAGCAGCAGGGGATTAGCGTCGATAAGTCGAGCAGTAATATCCTGATG
GTAGCGGCGTTTATTTCTGATAACGGCAGCCTCAACCAGTACGATATCGCGGACTATGTA
GCGTCTAATATCAAAGACCCGCTAAGCCGTACCGCGGGCGTTGGTAGCGTACAACTCTTT
GGTTCCGAGTATGCCATGCGTATCTGGCTGGACCCGCAAAAACTCAATAAATATAACCTG
GTACCTTCCGATGTTATTTCCCAGATTAAGGTGCAAAACAACCAGATTTCCGGTGGTCAA
CTGGGTGGCATGCCACAGGCGGCAGACCAGCAGCTAAACGCCTCGATCATTGTGCAGACG
CGTCTGCAAACGCCGGAAGAATTTGGCAAAATCCTGTTGAAAGTTCAGCAAGATGGTTCG
CAAGTGCTGCTGCGTGATGTCGCTCGCGTCGAACTTGGGGCGGAAGATTATTCCACCGTG
GCACGCTATAACGGCAAACCTGCTGCCGGGATCGCCATCAAACTGGCTGCCGGAGCAAAC
GCCCTGGATACCTCGCGGGCAGTCAAAGAGGAACTGAACCGCTTATCAGCCTATTTCCCG
GCAAGTCTGAAGACGGTTTATCCTTACGACACCACGCCGTTTATCGAAATTTCTATTCAG
GAAGTTTTCAAAACACTGGTTGAGGCTATCATCCTAGTCTTCCTGGTCATGTATCTGTTT
TTGCAGAATTTCCGTGCCACAATCATCCCGACGATTGCCGTACCGGTGGTTATTCTCGGG
ACGTTTGCGATCTTGTCGGCGGTCGGTTTCACCATCAACACGTTGACTATGTTCGGGATG
GTGCTGGCGATAGGGTTACTGGTGGATGACGCCATCGTGGTGGTGGAGAACGTCGAGCGT
GTCATTGCGGAAGATAAGCTACCGCCGAAGGAAGCGACGCATAAATCGATGGGGCAGATC
CAACGTGCGCTGGTCGGTATTGCCGTTGTTCTTTCCGCAGTGTTTATGCCGATGGCCTTT
ATGAGCGGTGCAACCGGGGAGATCTACCGCCAGTTCTCCATCACGCTGATCTCCTCCATG
CTGCTTTCAGTATTTGTGGCAATGAGCCTGACCCCTGCCCTGTGCGCCACCATTCTGAAA
GCCGCGCCGGAAGGCGGTCACAAACCTAACGCCCTGTTCGCACGCTTCAACACGCTGTTT
GAAAAATCAACTCAACACTATACCGATAGCACCCGCTCGCTGTTGCGTTGTACCGGTCGC
TACATGGTGGTCTACCTGCTGATTTGCGCCGGGATGGCGGTGCTGTTCCTGCGCACGCCG
ACCTCTTTCTTACCAGAAGAGGATCAGGGGGTATTTATGACCACCGCGCAGTTACCTTCC
GGTGCCACCATGGTTAACACCACGAAAGTGCTGCAACAGGTGACGGATTATTATCTGACT
AAAGAGAAAGATAATGTCCAGTCGGTGTTTACCGTTGGCGGCTTTGGCTTCAGCGGTCAG
GGGCAAAACAACGGCCTGGCGTTTATCAGTCTCAAGCCGTGGTCTGAACGTGTCGGTGAG
GAAAACTCGGTTACCGCGATCATTCAGCGGGCAATGATTGCGTTAAGCAGTATCAATAAA
GCCGTCGTCTTCCCGTTCAACTTACCCGCGGTGGCTGAACTGGGTACCGCGTCAGGTTTT
GATATGGAACTGCTGGACAACGGTAACCTGGGGCACGAAAAACTAACCCAGGCGCGAAAC
GAGCTGTTATCACTGGCAGCGCAATCACCGAATCAGGTCACCGGGGTACGCCCGAACGGC
CTGGAAGATACGCCGATGTTCAAAGTGAACGTCAACGCTGCGAAAGCTGAAGCGATGGGC
GTGGCGCTGTCTGATATCAACCAGACAATTTCCACCGCCTTCGGCAGCAGCTACGTGAAC
GACTTCCTCAACCAGGGGCGGGTGAAAAAAGTGTATGTCCAGGCAGGCACGCCGTTCCGT
ATGTTGCCGGATAACATCAACCAATGGTATGTACGCAACGCCTCTGGCACGATGGCACCG
CTTTCTGCCTACTCGTCTACCGAATGGACCTATGGTTCACCGCGACTGGAACGCTACAAC
GGCATCCCGTCAATGGAGATTTTAGGTGAAGCGGCGGCCGGGAAAAGTACCGGTGACGCC
ATGAAATTTATGGCAGACCTGGTCGCTAAACTTCCGGCAGGCGTCGGCTACTCATGGACC
GGACTATCGTATCAGGAAGCGTTATCCTCAAATCAGGCTCCTGCGCTGTATGCGATTTCA
CTGGTCGTGGTGTTCCTCGCCCTCGCCGCACTCTATGAGAGCTGGTCAATTCCGTTCTCG
GTGATGTTGGTTGTTCCGTTAGGCGTCGTTGGCGCATTACTGGCCACCGATCTGCGCGGC
TTAAGTAATGACGTCTACTTCCAGGTTGGTTTGCTGACCACCATCGGGCTTTCCGCCAAA
AACGCCATCCTGATTGTCGAATTTGCCGTTGAGATGATGCAGAAAGAAGGGAAAACGCCG
ATAGAGGCAATCATCGAAGCGGCGCGGATGCGTTTACGCCCAATCCTGATGACCTCTCTG
GCCTTTATTCTCGGCGTGCTGCCGCTGGTTATCAGTCATGGTGCCGGTTCTGGCGCGCAA
AACGCGGTAGGTACCGGCGTGATGGGCGGGATGTTTGCCGCAACAGTGCTGGCAATTTAC
TTCGTTCCGGTCTTTTTCGTTGTAGTGGAACATCTCTTTGCCCGCTTTAAAAAAGCGTAA
CGTGTAAATGAGAGTAAGGTTGAACATGAAGGTTCAGCCTTACTCTTTCCTGCTAACCAT
TCACCACTCAACAACCAGCTAACCGTCAGGAATACCAGGCTTAGTACACAGCACTGAAAG
TAGAAACCACTCCAGCCATTCGTCATCAATTTGAACAACACAATACTGACCCACATTCCC
GTAATCGTATGAATTGTCAGCTTAATAATCCCAAACATGCCGAGTCTTTTCCTCCTGAAA
ATACCGATACCGCCTGGCAAACTGCGAAAGAGAACTAGCCGGTAGCCCGGCAGAAATCAT
CAGGGAAGAGTTTCACATGAAGCAGGTGTGAGATCCTGACCAATATTCAAATGCGAAATA
TGTCAGGAAAAGGTACCTGGCGAATGTTGCGCAAACTGATGTGGCGTTACACCATAATAT
TGTCGAAATGTGTTTATAAAGTACGATGTACTGCTATAGCCACATTTTTCCGCAATAGTA
TGCAGAGGAATTTGACGTAACTCGAGTAATCGTCTGGCCATCGACATCCTGGAGGCGAGT
AATATTTTACTGAAACAGGTATTTTCATCCTGCAACTTTTTTTTGATTAGACTCTCGCTG
GTATACATTCTTTCCGCGATATCGCGCAGATACCAACGTTTGGCGATATCAAAGCTAATA
AGGCGTTCAACTTTTCCTGAAACAGTGCTGATGCTATTGAAAAGTAAGGGGATCAGTTCT
TTCTTATGAGAAAACATCGATAAACAGGAAAGGTAGAGCATATTGCTCAGTATCGGTGAA
TTTACCCCGGATTCATTGAAGCTATCAAAAATCGCCGTCACCAGCGGCATGGGGGGTGAC
TGGTTAATTAACAAACGGTCTTTGCTGTGTAACCCTAAATTGCGTGGTAGCTGACGAATA
TTTTGTAAGTAATGGCAAACTGTCAGCTCATCGATATCCAGTCGTCGCGTATCCGGTGAA
CAAAACGCAAAATCGTCTGCCAAATTTTTCTCCAGCAGCAGAATACTCTCGTTATGCAGC
GATATTTTTTGCTGTTCATGATAAATATCGAATGAACGACGAATGAGGATCACCGAGCAG
ACATGAGTCATGATTATCCCTTATATTTCATACTGCGATTATTTCAATTTCAGTATACTA
ATGAAATGATGCCAGACTGTTTCTTAGCGCAAAAACTGCCAGATTTGGTAGGACCAAAAT
TTATCCACAAAGTAGTTTTGCATAACAGTTAATTGATAATAAGTAAATGCAGCACGAATA
TATTTTCGCACAGCGTATAGCTTATGTTTATAAAAAAATGGCTGATCTTATTTCCAGTAA
AAGTTATATTTAACTTACTGAGAGCACAAAGTTTCCCGTGCCAACAGGGAGTGTTATAAC
GGTTTATTAGTCTGGAGACGGCAGACTATCCTCTTCCCGGTCCCCTATGCCGGGTTTTTT
TTATGTCTGAGTAAAACTCTATAATCTTATTCCTTCCGCAGAACGGTCAGTGCCGTAAAA
ATTCCCTTGCGCAACAATACTTGCCGCCGAGTCACGGTTCGACAATCTCTGCGCCGATCG
CTCCTGATACTCTGTGGGCGTCATCCCATAATAATTTCGAAAGACGTAAATGAAATACGA
CACGCTGTGATATCCACAGGATACTGCAACTCGCTTAATTGAAAAACCATGTATAACAAT
AAGTTGCAAAGCACGTTGCATTCTACACTCAGTAAGCAACTGTGAATATGATGTCTCTTC
TTCGCGCAATTTTTTCTTTAACAGACTTGGACTCATCAACAGCTCGCTGGCGATTCGGGC
TAGTGTCCACTCATGGGCGATATTATTATTGATAACCGTACAAACTCGTGTTCGCATGTT
CGGTTGTAAAACGTTCAGAAGCAGCGGTATAAAGTGCTCATCCTCAAGAAAAACAGATAA
CAACGCAAAGATTAATGCTCTTTTACGTAGCATTTCTGCATAGCGAAGATTCTTATTCTG
CGATAGTTGCGCAACTTCCTGAAAAACAGGAATATCTCTACTACAGTGATGAACGAGTAA
TGAAGAAACTTTTTTATGTGCATGAAGATTTAATGCCTCCTCCTTGAGCATCGGGAGAAA
TAATGAAAGCGTGTCCCTTGACACGAATACAAAATTTTCAACACACTTATCTACTCGAAT
TTGGCTTGCATCCGCAAAAACCAGGTCACCGCCATTAAAATAGCGATATTCACCATTAAC
CATGGTGAGAATATATTTATGTCTTGCATACGCAATTAGACAATTCCCATGTAGTGATTG
CATAGTTGACTTAATATTACATAAACATATTACTGTTTATTAATGTAGCACGCCGCCCTC
TTAAGTCAAATTGATTGATAAATAAATTTAAACGAAGCGGGAGAACAGGATGATAATGTG
TGATGTTCTACGGGCAGGATGACTGGATTTATAATACAAAAACGTGTTTAAGAACACAGG
GAAATTAATAGTAAGCAAATAATCCCTTTTCGTGACATTAAAGGTAATCGCTACATTTAA
TAAACATTCATATAACATATATCTTATCAACACGATGAATAGACAGCCAATATATTATTG
CGATTAATAAGCAACCGAATGCCCAGCTGTTTTTTTAAAGGCTGGGCATTCGGTTTTTAC
AACGTTATGTTATCAGGTGTGTTTAAAGCTGTTCTGCTGGGCAATACCCTGCAGTTTCGG
GTGATCGCTGAGATATTTCAGGGAGGCTTTGTAGTCTTCCAGCAACAGTTCAGCAAAGTC
CATTTCGAAGCCGCGACGACACATAATGCGCATCACCACGATGTCGGTGGCTTCACCGCC
GAGAGTGAAGGCCGGAACCTGCCAGCCGCGCAGACGCAGACGTTCAGAGAGGTCGTACAG
GGTGTATCCCGGATCTTCACCATCTTTCAGTTTGAAGCAAACCGCCGGGATGCCTTCGTC
CGGGCGACCCGTACAGATGAACTCATACGGCCCCAGTTTGGCGATTTCATCCGCCAGATA
AGCGGCAACCTGGTAAGAGGCGTTCTGTACTTTGGTATAGCCTTCACGACCGAGGCGCAG
GAATTCATAGTACTGTGCAATTACCTGACCCGCCGGGCGGGAGAAGTTGATGGCAAAAGT
ACCAATTTGACCACCCAGGTAGTCAACGTTGAACACCAGTTCCTGCGGCAGCGCTTCTTC
GTCACGCCAGATAACCCAGCCGCAGCCCAGCGGAGCCAGACCGAATTTATGGCCTGAAGC
ACTGATCGATTTCACACGCGGCAGGCGGAAGTCCCAGACGATATCCGGGGCGACGAACGG
TGCCAGGAAGCCACCGCTGGCAGCGTCGATGTGCATGTCGATGTCGATACCGGTGTCGGC
CTGGAATTTATCCAGCGCATCGTGCAGCGGTTGTGGGAACTCATAGTTACCGGTGTAGGT
CACGCCGAAAGTCGGCACCACGCCGATGGTGTTTTCGTCACAGGCTTCAATCATGCGTTT
CGGGTCCATAAACAACTGACCGGGGCGCATAGGGATCTCACGCAGCTCCACATCCCAGTA
GCGGGCGAATTTATGCCAGCAGATTTGTACCGGACCGCACACCAGGTTTGGTTTATCCGT
TGGTTTGCCTGCAGCTTCCATACGCTTGCGCCAACGCCATTTCATCGCCATCCCGCCGAG
CATACAGGCCTCGGAAGAACCAATGGTGTTGGTGCCAACGGCCTGACCATTTTTCGGCGC
AGGCGCATGCCACAGATCGGCAACCATATTTACGCAACGCAGGTCGATGGCTGCGGATTG
CGGATATTCTTCTTTGTCGATCCAGTTTTTATTGATCGACAAATCCATCAATTTATGGAC
GTTTTCGTCGTCCCAGGTCTGGCAGAAAGTGGCCAGGTTCTGACGAGCGTTGCCATCAAG
ATATAATTCATCATTGATAATCTGAAATGCGACATCATCGCGCATTTCGTGCAGCGGAAA
TCGTTTTGACTCCGCGATAGTAGAAATGGCCTTTGCGCCAAAACGTGAATCGAGTAGTTC
TGAGCGGAAATCCGTTAACAGCTTCTGGTCCATTTCGAACTCCTTAAATTTATTTGAAGG
CAATAAAAAAGTAGGATTTATCCGCAATGGAAGCAAGGCATTACAGGCTTAATTTAAATA
ACAAAATCCTAAGCAGAAAAACGACTTTTTATAATATAAACATTTAACATGATAATATTA
AAAACAGACTTTATTATCGTAATAAAAATCGCCCAAACATTGCTGTTCGGGCGATCAAAT
TAATTATTGTTTATCCTGCATATACGGCGTGTACACCCCGTTCAGACTGTGCAGGAAAGC
TACGATATCATCCACATCCTCCTGCGGCAGCTCTTTGCCTACCTGATAGCGCAGCATCAG
TTTCACCGCCCCGTCCAGCGTCGGCACGTCACCGCGATGGAAGTACGGTGCCGTTAAAGC
AACGTTACGTAAACCGGGTACTTTCTGACGCAATTTATCACGCTCTTCTTTAGTCACATT
CATACGACCAATATCCGCCGCCGTAATTTCCCCAAAGTTAAAGTCTTTTTTCAGCCCCAA
CGGTTCAAAGGAACGTCCGCCGAGAATAATACCACCATGACAAGTTGCACATTTATTATC
TTTAAATAATTGATAGCCTTTTTTCTGTTGCGCCGTCAGCGCATTTTCATCTCCGCGCAA
CCATTTATCAAATGGGGAATCCGGCGTAATTAATGTTTTCTCAAATTCAGCAATGGCATC
AGTAATATTTTCGCCACTGAAACCTTGCGGATAGACTTCGAGGAACTGCGTTTTAAGCTG
CGGATCTTTTTCCAGCTTAGCAATAATTTCGTCCCAGGATTTCGACGCCATTTCAATCGG
GTTCAACGGCGGTCCACCAGCCTGATCCTGCAATGTTGCCGCACGACCATCCCAGAACTG
CTCAACGTTAAATACTGAGTTAAATACCGTCGGCGCGTTAATCGGCCCAACTGCGCCACC
AACACCAATCGATGTTTTTCTGCCATCGACGCCCCCCGCATTCAACGCATGGCAATGAGC
GCATGAAATGGTGCTATCAGCCGATAAACGGGGATCGTGATACAGCGCAAAACCCAACGC
CACTTTTTGCGCATCGGTAGGCAGTTTTTGCGGGATGGGCTGCACCGGTTCATTGCGATG
TTCCGGAGCAGTATCATTGCTGGCGTAATATTCCGCGCGCTGTTTTGCAATCCAGGCCAG
TATTTCCGCCCGCTCTTCATCACTCACCTTACCCGCCCAGTGTAGCGCGGTATAACGCGT
TGGTGGCATAGTTTCATACTGCATCACCCATTCAATCTTATTCAAATCGCTTTGCGAAAC
GGGTTTATCAGCCAGCAGTGCCGCACGCACGGCCTCAAGGTTAAAAGATTTATATCCAAG
CTTAATGTCGTAATCCATCAACTGTTTCGCGCCAGGAATATAATAATAGGCGGGTAATTC
TGCCGAAGGCGTGTGGCAATAGTCGCATCCTTTTTCGCGGAGAAAGCCTAAAACCTTATT
ATTTTCACTGACAGCAGATGCCTGAACATCGGCCTGTTTACTGCGTTTATTATCGTGGTA
CCACACATAACCAGATAACCCTAAATAGCAAATCGCGACGCCAGCCAGGCCGATCGCGGT
AATACGTGAGACCATTTTCATTATTCTTCCCTCACGGTGGTGAGTTATTGTGACCCAGAA
AATTTTCCAGAATGCTGCAAACGTCTCTGCGAGACAAAGCCATCATAAAAAACAGGGAGA
TACGCTTTTTGATAGGAATCAATCAATTACATGAATATAAACTATCAATAAGATAGCCTG
TGCCTATTACCCAGATCAGGAATGGCATATCATGATTGCGGCGAGAGCAGGATTGAATGT
TCTGAAAATGAAAAACAACACCAAATCGGTATTTTTATAAATTCCATTGATATTAGTGCG
TTATATTTTTTGACAGGTTAATAAACGTGATCCACCGCACGCTTTGTCGCCCACCAGGCG
GAGCGAATGACTACCCTTAAAGAAAAGCCGATAATTAGCGACGAATTTCGGAGGTTGGAT
CCTTATGCTCAATCAGAAAATTCAAAACCCTAATCCAGACGAACTGATGATCGAAGTCGA
TCTCTGCTATGAGCTGGACCCGTATGAATTAAAACTGGATGAGATGATCGAGGCAGAACC
GGAACCCGAGATGATTGAAGGGCTGCCTGCCTCTGATGCGCTGACGCCTGCCGATCGCTA
TCTCGAACTGTTCGAGCATGTTCAGTCGGCGAAAATTTTCCCCGACAGTAAAACCTTTCC
CGACTGCGCACCTAAAATGGACCCGCTGGATATCTTAATCCGCTACCGTAAAGTGCGCCG
TCATCGTGATTTTGACTTGCGCAAGTTTGTTGAAAACCACTTCTGGCTGCCGGAGGTCTA
CTCCAGCGAGTATGTATCGGACCCGCAAAATTCCCTGAAAGAGCATATCGACCAGCTGTG
GCCGGTGCTAACCCGCGAACCACAGGATCACATTCCGTGGTCTTCTCTGCTGGCGCTGCC
GCAGTCATATATTGTCCCGGGCGGCCGTTTTAGCGAAACCTACTATTGGGATTCCTATTT
CACCATGCTGGGGCTGGCGGAAAGTGGTCGGGAAGATTTGCTGAAATGCATGGCCGATAA
CTTCGCCTGGATGATCGAAAACTACGGTCACATCCCCAACGGCAACCGCACCTATTATTT
GAGCCGCTCGCAACCACCGGTTTTTGCGCTGATGGTGGAGTTGTTTGAAGAAGATGGTGT
ACGCGGTGCGCGCCGCTATCTCGACCACCTTAAAATGGAATATGCCTTCTGGATGGACGG
TGCAGAATCGTTAATCCCTAATCAGGCCTATCGCCATGTTGTGCGGATGCCGGACGGATC
GCTGCTCAACCGTTACTGGGACGATCGCGACACGCCGCGTGACGAATCCTGGCTTGAGGA
CGTTGAAACCGCGAAACATTCTGGTCGCCCGCCCAACGAGGTGTACCGCGATTTACGCGC
GGGGGCGGCCTCCGGTTGGGATTACTCTTCCCGTTGGCTGCGTGATACTGGTCGTCTGGC
GAGCATTCGTACCACCCAGTTCATCCCCATCGATCTGAATGCCTTCCTGTTTAAACTGGA
GAGCGCCATCGCCAACATCTCGGCGCTGAAAGGCGAGAAAGAGACAGAAGCACTGTTCCG
CCAGAAAGCCAGTGCCCGTCGCGATGCGGTAAACCGTTACCTCTGGGATGATGAAAACGG
CATCTACCGCGATTACGACTGGCGACGCGAACAACTGGCGCTGTTTTCCGCTGCCGCCAT
TGTGCCACTCTATGTCGGTATGGCGAACCATGAACAGGCCGATCGTCTGGCAAACGCCGT
GCGCAGTCGGTTACTGACACCTGGCGGGATTCTGGCAAGCGAGTACGAAACCGGTGAACA
GTGGGATAAACCCAACGGCTGGGCACCGTTACAATGGATGGCGATTCAGGGATTTAAAAT
GTACGGCGATGACCTTCTGGGTGATGAAATCGCGCGAAGCTGGCTGAAGACGGTGAATCA
GTTCTATCTGGAACAGCACAAACTGATCGAAAAATACCATATTGCCGATGGTGTTCCCCG
CGAAGGCGGCGGTGGCGAGTATCCGTTGCAGGATGGGTTTGGCTGGACTAACGGTGTGGT
ACGCCGTTTAATTGGTTTGTACGGCGAACCATAATATTTTTACAGCCAGCCGCTAACTTC
CTGCTGGCTGTAAAATTATCCTCTTCAGGAGGAGATATTTAACATCATTGCCGCCTGGGT
GCGATTTTTCACTTCCAGACGGCGATACAGGGATTCCAGATGCGCTTTTACCGTTCCGGT
ACTGATATTCAGCGCTCTGCCGATCTCCTTATTTGATTCGCCCGCCGCTAACATGGTTAA
AATCTCCCGCTGGCGGGCGCTTAACGATTTGAGATCTTTAATGTCCTTTTCCGGCGTCGT
CCGCCAGTCTCCAGGCAGAAACATCATCCCCATCGCCGCACTATTTACCGCCAACGCAAA
TGTCTCGACGGTTGAATCACGAGGCACAATGGCCAGCACATTAAAATGGATAACTTCCTG
TAACCACCGTTTATTGCAATCCGTCGCCGTAATTAACACCTTAACCTCAGGAAATTGCAC
CACGGTTTTTTGCAGCAACCAGTAGCAAAACTCACCATCCTGATCGCCATCGAGCATAAC
TAAGGCTTCAGGGTAACTTTCCAGCTTTTGCCATAACTCGTCTGCCTGACTGGCCCCCTG
AATACTCACTCCTGGAATACGCTGCTGTAAACTGATTTTCATTCCATGAATAAATATTGA
CTGCCTGTCAAACATGACTATTTGCATAACTGAATCTCCACCTGAATACGTTAAAAAGAC
TTAAGTAGTGGAAGGGTATTACCCGCGAGAAAAAATAAGAATTCGCCATTTGGCGGTGGC
CATTCTACAGAGATGACGTGTAGAAAATAGTTACCGATATAAATAGTTACAGCTAAACGC
CTGAAATTACATGTCGAGGGCACTATTTAAAACAATTTTGAGGATTTCCTTATATTGGTG
GTTAGTACGCATGCAATTAAAAATGAAATTCCGCGACCACAAGCCAAAATAACAAACGGC
AAGGAGACAAAAATAAGCACAAATAGCCAACACGTCCTCTGTTCACTTTAAAGGGAATCG
CTGAAAAATACGCTCTGTTTAAGGGGATTCACCTTTCTCAGAAAGCTATTCCGCCCTTTT
CCTGCTGAGAAATCGCCACATTCGGCATGACAACATTGTGAAACCCGGCATTAGATGTTA
GAAAAAACAATAAACAATGCGATATGCGCGTTACTGTTTCGCTGTGAACAACAATCGGTC
AAAGAAATGGATAAAATTCACGCAATGCAGTTGTTCATCAAAGTCGCGGAGCTGGAAAGT
TTTTCCCGCGCAGCGGATTTCTTTGCTTTGCCAAAGGGAAGTGTTTCGCGCCAGATACAG
GCACTGGAACATCAACTTGGCACCCAGCTTCTCCAGCGCACCACGCGACGGGTCAAACTC
ACGCCAGAAGGCATGACCTATTATCAACGAGCAAAAGATGTGTTGAGTAATCTCAGCGAA
CTGGACGGTCTGTTTCAACAGGATGCCACCAGTATCAGCGGTAAATTACGCATCGACATC
CCGCCAGGAATCGCGAAAAGCCTGTTACTGCCGCGCCTGTCGGAATTTCTCTATCTGCAT
CCGGGAATTGAGCTGGAACTGAGTAGCCATGACCGTCCGGTAGATATTCTTCATGATGGT
TTTGATTGCGTGATACGCACTGGCGCGTTACCGGAAGATGGCGTTATCGCCCGTCCCCTC
GGCAAACTGACCATGGTCAACTGTGCCAGTCCGCACTATCTGACGCGCTTTGGTTATCCG
CAAAGCCCCGATGATCTGACTTCACACGCAATAGTGCGTTATACACCGCACCTGGGTGTA
CATCCGTTAGGTTTTGAGGTTGCCAGCGTTAATGGCGTCCAGTGGTTTAAGTCTGGCGGC
ATGTTGACGGTAAACAGTAGCGAAAACTATCTCACCGCCGGTCTTGCCGGTCTGGGGATT
ATTCAGATCCCGCGCATTGCCGTGCGCGAAGCCCTGCGTGCCGGGCGGCTTATTGAAGTA
TTACCTGGCTACCGTGCCGAGCCGCTCTCCCTTTCGCTGGTTTATCCGCAGCGTCGGGAG
CTTTCCCGGCGTGTAAACCTGTTTATGCAGTGGCTGGCTGGCGTAATGAAAGAGTACCTG
GACTGACCGACTATACTTTTTAAGAATGACCACGACAGAAGGACAAAAGAGCGGATGACG
CAGGAAAACGAGATCAAACGTCCCATCCAGGATCTGGAGCACGAGCCGATTAAGCCGTTG
GATAATAGCGAGAAAGGCAGCAAAGTTAGCCAGGCGCTGGAAACCGTCACCACCACTGCC
GAAAAAGTCCAACGCCAACCGGTTATTGCGCACCTGATTCGCGCGACAGAACGCTTTAAC
GATCGGCTGGGTAACCAGTTTGGTGCGGCTATCACCTATTTCTCATTTTTGTCGATGATA
CCAATTTTGATGGTGTCGTTTGCCGCAGGGGGCTTTGTGCTGGCCTCCCATCCGATGTTG
CTACAGGATATCTTCGACAAAATTCTGCAAAACATCAGCGATCCGACGCTAGCCGCCACG
TTGAAAAACACCATCAACACCGCCGTTCAGCAGCGTACGACTGTAGGGCTTGTCGGCCTG
GCGGTGGCACTTTATTCCGGCATCAACTGGATGGGTAACCTGCGTGAAGCGATTCGTGCC
CAGTCGCGCGATGTCTGGGAACGCTCGCCGCAAGATCAGGAGAAGTTCTGGGTAAAATAT
CTGCGAGATTTTATTTCGCTGATTGGTTTGTTGATTGCGCTGATTGTGACGCTTTCGATC
ACCTCGGTTGCCGGTTCGGCGCAGCAAATGATTATTAGCGCCCTGCACCTGAACAGCATT
GAGTGGCTGAAACCGACGTGGCGATTGATTGGCCTGGCGATTTCCATCTTCGCCAACTAT
CTGCTTTTCTTCTGGATCTTCTGGCGGTTGCCGCGCCACCGTCCGCGCAAAAAAGCCCTG
ATTCGCGGAACATTTCTGGCTGCTATTGGTTTTGAAGTGATTAAAATCGTGATGACCTAC
ACCCTGCCATCGTTGATGAAATCCCCCTCTGGCGCAGCATTTGGTTCCGTGCTGGGGCTG
ATGGCATTTTTCTACTTCTTCGCCCGTTTGACGCTGTTTTGCGCGGCGTGGATTGCCACC
GCCGAATATAAAGACGACCCGCGAATGCCGGGGAAAACGCAGCCTTAAAATAGGCCGGAT
GCGGCGTAAACGCCTTATCCGGCATACGATTTTATTCGGCCTGGCTCCCCGTAGGCCGGA
TAAGATGCGCCAGCATCGCATCCGGCTATAATGCGCACATAACCTCTTGAAACTCGTCCC
CAGAGCCTCTTCAGCCATCTATTTGGGAGCAAACAATTTCATTCCAACTCATAACCCCAG
CATATAAATCCAGTTGGTAACTTTTATTTAACCTGAAACCAGTTTTATCCACTATTTATA
AAATTATGTGAAGCATTTCATAGAAGAAAAATCACTGGCCTAAACATTATCCCCTTTTTG
CCTGATTTTTGACCATTTCCGCGATTTGTTACACATTGAAATATCACTTTTGCTGTGCGT
AATATGGCTATTCGTTAGCCAAAAAATAAGAAAAGATTATGCAAGCAACAGCCACAACAC
TCGACCACGAGCAAGAATACACGCCGATCAACTCGCGTAATAAAGTCCTTGTCGCCTCTC
TCATTGGCACAGCCATTGAGTTCTTCGACTTTTACATTTACGCCACTGCGGCCGTTATTG
TGTTTCCGCATATCTTCTTCCCGCAGGGCGATCCTACGGCAGCAACGCTACAGTCGCTCG
CCACCTTCGCCATCGCCTTCGTCGCGCGCCCCATTGGCTCTGCCGTTTTTGGTCATTTTG
GCGATCGCGTTGGGCGTAAAGCGACGCTGGTCGCCTCGTTGCTAACGATGGGGATTTCGA
CCGTGGTGATTGGTCTGCTGCCGGGCTATGCCACGATTGGTATTTTCGCCCCGCTGCTGC
TGGCGCTGGCTCGATTTGGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGCGGCGCGGCGC
TGCTGGCGACTGAAAACGCCCCACCGCGCAAACGTGCACTGTATGGCTCCTTTCCGCAGC
TGGGCGCACCGATTGGCTTCTTCTTTGCCAATGGCACTTTCTTGCTGCTTTCCTGGCTAC
TGACCGACGAGCAGTTTATGAGCTGGGGCTGGCGTGTGCCATTTATCTTCTCGGCGGTGC
TGGTCATTATCGGCCTGTATGTTCGCGTGTCGCTGCATGAGTCGCCGGTGTTTGAGAAAG
TCGCTAAAGCGAAAAAACAGGTGAAGATCCCGCTGGGTACGCTGCTGACCAAACATGTTC
GCGTAACCGTACTGGGTACGTTCATTATGCTGGCAACCTATACGCTGTTTTACATCATGA
CGGTCTACTCTATGACCTTTAGTACCGCCGCCGCGCCAGTTGGGCTTGGCCTGCCGCGTA
ACGAAGTGTTGTGGATGTTGATGATGGCAGTTATTGGTTTTGGCGTGATGGTGCCAGTCG
CTGGATTACTGGCTGATGCCTTTGGTCGCCGTAAAAGCATGGTAATCATCACCACGCTGA
TCATCCTGTTCGCGCTGTTCGCCTTTAACCCACTGCTCGGTTCTGGCAACCCGATTCTGG
TTTTTGCCTTCCTGCTGCTGGGGTTAAGTCTGATGGGTCTGACCTTCGGGCCAATGGGTG
CGCTGTTACCAGAGCTGTTTCCGACAGAAGTGCGTTACACCGGAGCATCGTTCTCTTACA
ACGTAGCGTCGATTCTCGGGGCTTCCGTTGCGCCATATATCGCAGCCTGGTTGCAGACTA
ACTACGGGCTAGGTGCGGTGGGGTTATATCTGGCGGCGATGGCTGGCTTGACGTTAATCG
CCCTGCTGCTGACCCATGAGACGCGACATCAGTCGTTGTAATAAGAGTGAAAAGCCTGAT
GCGCTACGCTTATCAGGCCTGAATTTCCATACAATATATTGAATTCGCAAGGATTTGTAG
GCCGGATAAGGCGTTCACGCCGCATCCGGCATGAACAAAGCACACTTTGCCAACAATCTA
AATCTGTTTAATTGCCGGATGTCAGACATCCGGCAATTATCATCACTTCTTCATCTGCGA
CAAAATCGTCCGACACTGATTAGCCTCCCCTTCGGAAGGTGAGATCAGTGCCAGTAACGC
CGCCGCCGGTGTTACCAGCGTTGCCAGTGCCGCAGCAACAGCACCACGGGCAATCAGCGG
TCCGGCTTTCACCCCAGCCTGCGGATTTTTAAACGTCCCCCGCACATACAGCGGCGAACG
CAGTGTGATAATCCGAATTCCTTTACTCTCCGGATCAATAGTCAAATCCAGCTGTTCCGA
AGCAAAACTTGCCGTGCCGGTAACATTAATCAACGCGTTCTCAGTATCGAAAGCAAAAAT
CTGCGGGCGCGCCACGCCGTTGGCAATATTCAGATTCGCCGCCGCGCAGTTCACCCGCAC
CTCATCATCACCAAATATCGCACCGACAATGTAGTTGCCGACATTCAGCCCAACAATCTC
CATCAGGTTGCGGCTCACCAGCCCGTCATTCATCAACAGTTTCAGGTTGCCGTTACTGTT
GCCTAAAAGTGCCGCCACCGAGTTACCGCTACCGCGTAGTTCCGCGTCACCGTTCATTTC
CCCCAGCGTCTTCTGCATCAGTTCCACATCGGGCATCAGTTCTTTCAGTTTCAGTCGACG
AGCCTGAATATCTGCCCGCCCCTGCATCGGCTTTTTATCGCCTTCCAGATGAATATTCGC
CGCAATGCTGCCGCCCGCCATGCCAAATTTCAGCGGTTGCAGGCGCAGGTCAGCATTTTT
GAGGATGATATGAGTAGAAAGATCGCTAATCGGCAGGCTACTGCCATGCTCAATGCGCCG
CCCTTTGAAGCGAACATCGGCATCCATAACGTCCCATTTATCGGTTTCGAAGCGGTCATA
AGGCAGCACTTTGCCCGCAGGCTGAACGCTTTTTTCGCCCTTCTTCTGTTCAGACCGTTT
CGACTTTTCTGCCCCTTTCCCGGAATCAACGCCAATCAACGGTCCCAGGTCCGCCAGCCG
CAATTGCCGCGACTCGACATCACCTTCCAGTTTTGGTCGTGGCTTTCCGGTGGTGTAGAC
CAGAGAACCGTGGATATCGCTATCACCAATTCGCCCATTAAAACCGCGATAATCAAAGAC
CGACGATTTTTCAGTGTCGATTTTCGCTACCAGCCGACCATCCGTTTCAAACGGCGGGGT
ATCGGGCAGCAGAACGCCCGTCAGTTCATAGAGATCACCCAGTGAATCGCCAGAAAATTT
AAGCCGTAAATCGACACCGCCCATCTTCATTGGGTCATTCACGACGCCATCAAAAGCAAC
ACGGGTGTTACCAGAGCGGAAATCAGCCTGTACCGGAAACGGCGTCCCTTCGCCACGCAG
CGCCAGCATACCGCCTATTTTTCCCGTACCCGTGAGCGGTTCACCGTTATATCGTCCCTG
CGCCTTCAGGCCAAAAACGTAATCGCCCACCTTTTCTTTATCCGCTTTACCTTTCGATCC
AGTAACTTCGCTGAACGGCAGCGGCTTGCCTAAGGGATCAACAAAAATCTCCAGATCCGC
TTTGCTTACTTTGTCATCAATGGCGATCCGCCCTTGATCGAAAAGAATATTATCCAGCCG
AAACGACCATGCCGACGGCTTTGCATTCGCGTCTTTGTTATCATCGTTGGCAAGATTAAA
CGTCCAGTTATTGTTCTTTTCAGAGAGGCGAATCAGGCGCGCGTCGGGCTTTTCGAGCTT
GATCCACGGCAGCCAGACCGTTTTGGTCAGCAGCGCCAGCGGGGCCAGCGTTGCCTCTAC
GCGTGGCAAATGCACCATCGTGACTTCGGGAATATCCGGTGGATTGCCAAGAATGATGTC
TTCCGCGTGTACATGGGGCCACGGCACCCAGCTGCGCCAGCCAGTTTCTTGTTTTTGCCG
CTCCCACACCACGCCCAGATCGCCACGGATAGCGAACGGACGATTCAACTCCGCAGAGAC
TTTCTGGTTGATAGTCGGTTTGAGTCGATTCCAGTCAAAAGTTGCAATCAAAATGATCGC
CACGACAATCAACAACAAGAAAGCCCCTGAAATCGCAGCGGTTATTTTGCCTGCCTTGCT
CATCGTTCGCTTCCTCATATTCTTCCTGTGCCAGTCCTAAAGATAGTCCAGCCAGGCGGA
AAATGAGGCAGCTTATAGCGCCAGAACCGCCGTATTCAGCGTTTCTATCGGTGCCGGGCG
TGAAAGAAACCAGCCTTGTGCGGCGAATGCGGGCGAGTTCTGAACATCACGCCACTCTTC
CGGCGTTTCTACGCCCTCGACAATCACCCCGCGACAATAGCGATTCATTAGATGTAAAAG
CTGAGAAAAGAGTGTGCGTCCTTCCGGCGACTGACGCAGCATCACAAACAGTTCTCGCGC
GATTTTGATGTAGTCATAACGCACTTCACTTAGCGCAGAGAAATTTGCCATCCCGGTACC
AAAATCATCCAGCCACAGCGGGCCAAATTCACACATCGAGGCAAAGGTTGAATCTTTCGG
CAGACGGATATGCTCCACCAGTTCGAAACGCAGCCAGGGAAGACGCTCAATCTGGCGCAG
GATTTTTGGTTGCTGACGCAGGGCGATGAGCGTAGGGCCATCAATATTGACCGATGCCAG
CAGGCCGTGCTCTATAAAGAAGTCGGCTTTTTGCGCCAGCAAATCAATCTGCTCTTTCAC
AACCTCCATCCGATGGCTGACGGTGATTTCAGTAAAATAGCGATCCGGCGGCAGGCGTTG
CGAAGGGTTCAAGGGATGCGTGACCACCGTTAATAGCTCCACGGCCATTAACCGCCCGCA
TGTTTGATAGATCGGCTGCCAGGTGTAAGCACGCTCACACTGCAACCAAAAACGCCGTTC
CTGCAAGCTCTCGATGCTTGCTTCAGGGTTGCTTATTCGCTGGATAACCTGCCTTATCAT
CAAAGATGTCCTGTGTTTAAAAGTGATGCTGCCCGGACTCGACAAAGATTATCGGCGCGT
AAGGGCAGAACTTTACCGCCTGGCCGGGGTAAATTTCCTCACTCCACAACGGAATCTTTC
AGGAATACGTTCTGGCTCAAAAAAATAATGGAACACTGTTTTAATATGGTTGACCAGCAA
ACCACCACAGCGCAAACTAACGCTAATTTTTTACAGATCAGGTTCACGACTATGTCCAAA
AAGATTGCCGTGATTGGCGAATGCATGATTGAGCTTTCCGAGAAAGGCGCGGACGTTAAG
CGCGGTTTCGGCGGCGATACCCTGAACACTTCCGTCTATATCGCCCGTCAGGTCGATCCT
GCGGCATTAACCGTTCATTACGTAACGGCGCTGGGAACGGACAGTTTTAGCCAGCAGATG
CTGGACGCCTGGCACGGCGAGAACGTTGATACTTCCCTGACCCAACGGATGGAAAACCGT
CTGCCGGGCCTTTACTACATTGAAACCGACAGCACCGGCGAGCGTACGTTCTACTACTGG
CGGAACGAAGCCGCCGCCAAATTCTGGCTGGAGAGTGAGCAGTCTGCGGCGATTTGCGAA
GAGCTGGCGAATTTCGATTATCTCTACCTGAGCGGGATTAGCCTGGCGATCTTAAGCCCG
ACCAGCCGCGAAAAGCTGCTTTCCCTGCTGCGCGAATGCCGCGCCAACGGCGGAAAAGTG
ATTTTCGACAATAACTATCGTCCGCGCCTGTGGGCCAGCAAAGAAGAGACACAGCAGGTG
TACCAACAAATGCTGGAATGCACGGATATCGCCTTCCTGACGCTGGACGACGAAGACGCG
CTGTGGGGTCAACAGCCGGTGGAAGACGTCATTGCGCGCACCCATAACGCGGGCGTGAAA
GAAGTGGTGGTGAAACGCGGGGCGGATTCTTGCCTGGTGTCCATTGCTGGCGAAGGGTTA
GTGGATGTTCCGGCGGTGAAACTGCCGAAAGAAAAAGTGATCGATACCACCGCAGCTGGC
GACTCTTTCAGTGCCGGTTATCTGGCGGTACGTCTGACAGGCGGCAGCGCGGAAGACGCG
GCGAAACGTGGGCACCTGACCGCAAGTACCGTTATTCAGTATCGCGGCGCGATTATCCCG
CGTGAGGCGATGCCAGCGTAAACGCAGCATATGCAAAAGGCTGGATAAAGTGTTACCCCT
CTATCCAGCTCATCCATAAATACCTGATGGTTGTGCTAACTCATCACCATCAGGCATTAC
TGTGCAGGTGGAATATCCGTCACTTCAGGATGTACGTCATCCGTGGCGACAGAGGTGGTC
GCAGCGGCGGTAGATGGGGCCATGATTTGATCCCAGACCGCCTGCAACGCTTTCATGTTA
AATTCCGGCTCGCCTTTCGGCTGCAGCAGTATTAACGCCATATCATTCGACAACTGTTGA
CGCAGATCCTGATTTAACATCTCTACCGTCAGGCTATTAAGGAAATCCTGCCGCAGTTTC
TGATATTGCTCCGGCGCGATATCGACAACCTGATTTTGCAACGAACGCATCCGCTGACCC
ATCAGAATATCGGTATCAGCTCGTGCATAGGCGGCAAACAGTTTCTGCAGCTCCAGTTTC
TTTTGCGCCACTAACGCATTGAACTCTTCTTCCGGCAGACCTTTATCGCGAACCTTCGCC
AGTTCACGCGCCACCAGATTAAGGTTGCTGTTCAGCTTGTCGTTTGGTGATTCGATGTTG
ATGGCACACTGCGCACGCAGATACAGCACACGGCAGTCAAATCCAAGACCGATGTCTTTG
CTGTTACTGGCACTTAACGCTTGCTGAACATGCCAGAACAGCGCCTCGCGGGCCAGGTCC
GCACGCCAGTAGCGCAGCAGTGCGGCTGATTCACGAATCGGCTGCCACGGCGTATCCCAC
ATGATAGATAACCGGTCCTGACGCACCGCGTCAGTCATAATACTCACCGCTTCCGCACGC
AGCGGAGAAAGCGTCGGCACCGGAGCTGGCGTTTCACGTTTGCCTTTCAGTTCGCCAAAC
GTTTTGTTTATTTGGTCGACAACCGAGCGCGCATCCACGTTTCCCACCACCAGTAGCGTC
ATTGCATCCGGGGTGTACCATTTCTGATAGAAATCTTTAATTTTTTCCGCTTCAACGGGT
TGTTTCAGCGGATCGGCAGGATCGTGACCTAACAAGGTTGACCCTTTCAGACGATAGCGC
CACCAGCCCTCTTTAGTATCGGCAGGCCAGGTTGCCACCATGTCCTGACTTTGCAGCGCG
TGGTTGATGGTTTCTGGTGTGATGGTCAATTTGCCAGTGGCATTTGCCAGATAAGAGAGC
GCTTCTTTCAGCAAATCGTTACGGTTATTGGGCAAACTCAGATTAAACAGCGTGGTGTCA
TAAGAGACAATTACCGGCGGCATCGGGCGTTTAGGGTCGATCCCCTGCTGCCACAATGAA
CGCGCCTGTGCTGCGTCAAGGCCACCGCTTTGCGTTAGCGCAATACGAGGGATGGCGTGA
CTGTAACCGCTCTGTTGTGTACTTTCGGCGAGCGAACCGGTATTAACCAGCAGGCGAATT
TCAACACGATCGCTGGGACGCTGGGGGGTGGTCAGCACTTGCCACTGTAAACCGTTGGAA
AGCGTCCCCTGTTGCCATGCTGGATCAGGCTGGAGCGCATCTGCCTGCACATAGCCAGCA
GTGGCCATCATCAGCAAACCGCCCGCTAAAAGTCGAATTTTTGTGCCCTGCATGTGAACC
CCTGATCAACTATCCTGGTAATAAAAAAACTGCCCGTTGTCGGTCAGTCTAAATGACGTT
AAAAACACTTCGTGTTAGACCGCAAGAACATGAAAATGTCACGGAAGAAGTGAAATAAAC
CTGAACTCACCCAGGTGGTAAGTTCAGGCACAGGGGTCAATTATGCGCAAACACCCGCAC
TCGGGGAAGGGAGTGCGGGCATAAGTGATGAGATTAAGAGGATAATTCGTGCGTTTTGCC
ATCCGGCGCACGATTATTCAGCACATCGTCCAGTTTTTTGTGGTCCAGTTCTTTCACCCA
CTTAGCAACGACAATGGTCGCTACGCCGTTACCGACCAGGTTAGTCAGCGCACGAGCTTC
TGACATAAAGCGGTCGATACCGAGGATCAGCGCCAGACCCGCTACCGGCAAATGGCCCAC
CGCAGAGAGCGTCGCCGCCAGCACGATAAAGCCACTACCCGTTACCCCTGCCGCCCCTTT
AGAAGAAAGCAGCAACACGATTAACAGCGTGATTTGGTGGACGATATCCATCTGACTGTT
AGTGGCCTGGGCGATAAACACCGCCGCCATTGTCAGGTATATCGATGTGCCATCAAGGTT
AAACGAGTAGCCTGTCGGGATGACCAGCCCCACCACCGATTTACGGCAGCCGAGTTTCTC
CATCTTGTCGAGCATACGCGGCAGCGCCGACTCGGAAGATGAAGTCCCCAGTACAATCAG
CAGTTCTTCACGGATGTAGCGGATAAATTTGAAGATACTGAAACCAGTCGCTTTAGCGAT
TGAACCCAATACCAGCACCACAAACAGGATACAGGTAATGTAGAAACAGATAATCAGCTG
CCCCAGTTGCACCAGTGTGCCGACGCCGTATTTACCGATGGTAAACGCCATTGCCCCGAA
CGCACCAATAGGTGCCAGACGCATGATCATATTGATGATGCCGAAGATGACCTGCGAGAA
ACTTTCGATGACGTTAAAAATCAGTTGGCCTTTGCTGCCCAGACGGTGGAGCGCAAAACC
AAACAGTACGGCAAACAGCAGCACCTGCAGAATGTTACCGCTGGCAAATGCGCCAATGAC
GCTCGCCGGGATGACATCCATAATGAAGGCGACAATGCCCTGGTCTTTCGCCTGATCGGC
GTAAACCGCTACCGCTTTCGCATCAAGCGTTGCCGGATCGACGTTCATTCCGGCACCAGG
CTGCACGACGTTAACGATGATAAGACCAATAATCAGCGCGATGGTACTGACAATTTCAAA
GTAAAGCAGTGCGACTGCGCCGGTACGACCGACCGCCTTCATGCTTTCCATGCCCGCAAT
GCCCGTTACGACGGTACAAAAGATGACAGGAGCGATGATCATCTTAATGAGCTTAACGAA
GCCGTCGCCAAGCGGTTTCATTTGCTCGCCTATTTCAGGATAGAAATGGCCAAGGAGAAT
ACCAATGGCTATCGCTGTCAGGACCTGAAAGTAAAGGCTTTTAAACAGAGAGGTTTTCAT
AGGGTGTCCTTTAGTAAAACCACAGGTCTTGTAAGGTTATGGGGTACCTGCGGCCTTAAA
ATAACACCCAGACAACATCACAGAAATGTACCTGGATCATAATTGAAACAAAAAGGTTAA
AAAGTTTGAGCTGGCTCGCACAAACCAGCACTTTTTAAAGTTTTGTAATCAGTTTGGGGT
AGCTACTTTTCTTCCAGGTAACTCTCTTCGAAGATTTCAATAGGGAGTGGGCGAGCAAAA
AGGAAGCCCTGGGCAATACCAACGCCCGCTTTTGCCAGCCAGTCGCGTTGTGCTTCAGTC
TCCACGCCTTCGGCAATCATTTGTAAGTTCAGGCTCTGCGCCAGCATGATAATTGCAGCA
ATCATGCTGCTATCTCCCGGCAAGCCTTCAACAAACATTTTGTCGATTTTCAGTACGTCG
ATTGGCAACGATTTCATATGCTGCAGCTGACGCAGCCCTGCGTAGCCCATGCCGAAATCA
TCCAGCGCCACCCGAACTCCGGCATTGCGCAGCGGACGGAGGATTGCCACCGCAGCATGA
GGGTCGTCAATACGTCGGCTTTCTGTCACTTCCAGAATCAGTGTTCCCGGCTGAATGCGA
TAGCGGGTTAACAGTTCCAGCATATCCGCCACCATATTCGGGTGCATCAGTTGCAGCGCA
GAGAGGTTTACCGACAAGGGCAGCATAATGCCGCGCTCTTGCCAGGCTGCAAGCAATCGA
CAGGACTCTTCCAGCACCCAGTGACCGACGGTAACCATCAGCCCACAGCACTCAATGCGA
TCGATTAAGCCATCCGGCAGGTCCCAACTGCCATCCGGTTGCTGGATACGCAGTAACACT
TCCGCACTGACCAGTTTACCGCTGGTCATCTCGACCTGTGGCTGTAACCAAATAGCAAAC
TGATGATTTTCCAGTGCATTAAGGATATCGCTCTCTTCCGTCAACCGCTTCTGGGCGGCT
TCCATCTGCTGCGGATCAAAGAACTGAATCTGATTCTTGCCTTTATGGCGAGCGGTAAAT
GCCGCAGAAATAGCGCGACTGTAAAGCTGTTCGGCGGTGAGATCGCCGTAGAACATCGCC
ACGCCAATGCTACAGTGCGGACGGAGTTGAATACGTTCAATCGGCAGGCGCTCGCTCATG
ATAGTGAGCACTTGCTGACCTAAGGTGATTGCGTGCCACGGTTCCTGTACACCGTTGGCA
ATGACAGCAAAGTCATAACCGCTAATCTGCGCGAGGATCATACGTGGCGACAGTACCGAT
TTGAGTTTTTCCACCAGCGTCAGCAGCAGAATTTCTCGTTGCGCCTCTTTCAGCACGCCC
GCAGTATCACGCAGGGTTTCACAGGTGATGATCATCAGCGCGGTGGTTTGTTTACGCGCG
ACAACCTGCTCCAGCATCTCCATCAGCAAGGCTTTGTTCGGCAAATCCGACACCGGGAAG
CGCATCGCATTTTCGTTCTGTTCTTCATAATGGCGCTGCAGCAATTGCTGGTTGAGGTTG
TAACTGCGCACCAACATACCGATTTCATCGTCCTGATGCAGACGCGGTAATGCCAGTTGG
TGACCAACAAGCTCCTTGGCTGGGATGGCGTTAAGTTCGCGAGCAATATTGCGTAACGGA
TGCAAAATCAGGCGGTTAATGCACCAGCTGATGGCGACGGTCAGGATAAGCGACAAAAGT
AAGTAAATGGTCACTAACGTTGAGAGGGTGCTCATCACGAACTTATACATACGGAAGGAA
TCCGCCTGTAGTACCAGATAGGCAATTGGCTGCGGGTTTGCCGGACGTTCGAGCGAGTAA
ACGCCCAGCGAGATTTGAACCGGTAGCTCAAACAGGCGAGTAACCATTACCGGCACCGGG
CGCTCTGGAATAAAACTTTTACGCAGCGCCTGGAACTGGTTAGGCAGCACTACATCGGCA
CGGCTGACCACGCCTGCCGGTTTAATGCTGGCAAGAATAGCTTCCGCTTCGGGAATATCG
CCTTTCAAAATAGCTGAAGATAAGGGTTCGCGGACAGAGCGAGCAATGCTTTCCAGTTGC
GTAGCCGTGTTATAGCGATTCTGCTGGACCAGATGGAACAGCAAAACGGTGCAAAAAATA
AAAACGAACACCAGGACAACGGCTGCCACCATTGCCATCTGCTTGATTGTTAACGAGCGA
CTTACGCGCAAATTGTCTCCCCCCGGAAATCCCAGATTGCCGCCCGAGTATACCCGATCG
CAGCGGCATTAAGAGAGGCGCTATCTGAAAACTTACCAGTCGGCGTAAGGTATCAGCGGC
TGCGGCGGTAAATCCATGTCACCCTGCCATCCGGCGGCGGAATAACGTACGTAGAGCAGG
AAATGGCTGGGTGCGTAATCTTTCGCCTGCTGGATATCAATTGCCGTGCCAACAAACCAG
TTGGAAGTAACACGTCGTTCAAGTAATGCCCGCGCCGTGTAGCCGAAGCCCTGACTGCTG
CCGCCATCGTTGGATTGCCGCGCAGCTTCTTCCTGCCAGTCGGTCGGGATCAGATTCATC
AGCGGATAACGCGGCATGGTTTTGGTGCGTGAATGCGACCACGAGCCAGACGCACCCAGC
TCCCACGACCAGTTTTCCGTGCGCTCCCGCCACATCACCGGTATGGCAAACGACAGGTAT
TCCTGCGGACTGTAGTAACCGCCCTGACCGAGTGAGTAGCCACTCAGATCTTTGTCGTAA
TGCCAGATCATGTTGTTCAGGCCGATTGTGACGCGGCGATTGTTCTGGTTAATGACCTTA
TAGTAATAGCCCGTCATCCAGCGCACGCGCCAGTTATCTTCGACATTTTTACCGGTTAAC
TGGTCGCCACTAAGCGATGCCCAGACGCCGTTTGCTTCACCTTTATCGTAGCTCAGACTT
AGCCCCACACCGTCGGCACGTACGCCACCCCATTTTTTCCCGGTATTGCTCGGGGAGTCT
TTTTGCCCACCAAAGGCCAGCAAAGAACTGGAGATGGGCCGACGGTGGGCGTTAACGGTG
TAACCCAGCGGCCCGATATCATCGCTGTAACTGATGCCGCCGACCACATCCACCACGTTG
AAGCCCATCGGCGTGGTACCGATATCCCAGCTCCAGACGTCATTTCGCCAGCCGACCGCC
ACGCTGGCACCGGAATCCGACTGGCTGCGGTTGCCGCTACAGTCCTGTAATGTACAGGTG
CCCCAGTTGTCATCCCATTTGCCATCGGCATTAGTGGAGAAACTGCCGACGTTCATATTG
ACGAAATCACTGCGAAAGAACATCCGCCCGTCAGAATACGGCGCATCCACCTGCAACATG
GTAGTGTGCGCTTTCAGATCGGAGTAACCACCGGTGCCGCTCGAACCCCAGTAATCGTGC
TCAAGGGTGACGTTAAGATCCTGCTGGCGATAGAGGTCCGCCGCATCGCTGCGCACGCCA
CGTTTCAGCCAGTCATCTTTCTCGTCGTTACGGGTCAGTCGGGTAAAGGTGTCGTTATCC
TGCGGACGCGTCGTAGTCACACCGGATGCGACCATGGCGTCTTTGTAGGTTTCCAGCGCC
TGCGTTGGATCGCCCGCCTGCGCTTCAAACTTCGCACCATCACGCAGCACCATCGCGCTT
TCCATCGACGGTGGCTGAGATTTTGCCTGCGGGATCAACTTATTAAACGTCCGCTGCGCT
GCTGCGGTATCGCCAAGCTGCGCCTGTGCCAGCGCCACGCGCCGCTGTGTGTTCAGCGAG
GCGTTATCGGTAGCGGGCAGTTTCGCCAGCTGGCTACGTGCCGCCGCTTTGTCACCGGCA
GCAATATCCACTTCCGTCAGACCAAGAATGGCGTCGGCGTTAGCTGGCTCCCGCGTCAGG
ACATTCTGATATGCAGCGCGGGCGGCGGTGTAATCACGTCGTTGTTGCGCCCAGTCAGCC
AGCGTGAGGTCAATACGCGTGGAAGGTGGTTGCTGGCGCAGCATCGCTTCCGCTTCTGCC
TCTTTGCCGCTTTCTCGCAGGCGGTTAGCGGTTTCCAGCACCTGATCGCTTTGCAGTCGA
TTAACCAGCTCCTGAATATTGCTGTTCCACTGCGCACGCGGCAGGCTATTGATATGCGCC
AGCGCCGCTCTGTCCTGGTCATGACCAGAGAGGTACAGCCCGTAAGCGTAAACCTGCTCC
GGGTCGTTCGACTTCTGCTGCGCCAGATTGCGCATTAACGTATCGGCCTGGCTGCGTTGT
CCGGCCTGCCAGAGATCCTGCGAAAGTCGGTAAGTAATCCATACGCTGCCGGGGTCCAGC
GCCAGTCGTTGCCGCTGAAGTGCTGCCGCCTGCGCCCATTTGCCCTGGTTTTCCAGTGCC
TCTGCCTGCTGTGCCAGACGGTCGTTTTGCAGGCTGCGTTCGATATCATCAATGCTACGC
CGCTGACTGGCAGAGAGCGAGGCGATAAACGCTTCAGCTTTTTCTGGCGATTGCTGGCGG
TAAATATTTGCCAGCCCGCGCACGGCGTTAGTGTTGCCGCTGTCCATACGCAAGGTCTGC
TGATAATAACGTTCGGCGGCGGGATAATCTTTTCGCGCCATCGCCACATCGCCCAGCCCC
AGCACTGCATAACTGTCGGTGTTATCGACATTACGCGCCTGCTGGAACAGGCGTTCTGCC
CGGTCAGGATTATTGGCTTTCAGCGCAGCATCGCCCTGCTGGATCGCCAGCCAGTAGCGG
TTTACTTTCAGCAGACTGTTCCATTTGTCGTTGTTGCTGCTGTGCGGGTCCAGTGCGAGG
GCTTTTTCCAGATTCGCCACTGCATTGGCGCGATCGCCTTTCTGAGAATACGCCTGGCCC
AGCGCCCCCAGAGCTTCACTGTCTTTCGGGTTCGCCCGCACCGCCTGTTGTAGTTCGGGA
ATGGCTTTACCCGCCATACCAGAGTCCACCGCCGCTAAACCTTGCGCACGAGCGCGGAAA
GCAGGATCGGCCAGCTGTTTTTGCTGTTCTGCCAGTTGCGATTGCGCAGCCGCCACGCTA
TCGCCATCACTAAAGATCGAGAGATATTTTTTCAGCGCCGACACACTGGCATCACTGACG
GGCATGTCTTTAATCTGCCCGTACCAGATTTTAGAGGCCCCTTCGCGCCCGGCGTTCGAT
TTTGCCATCTGTTCCAGGACGGCAAAACCTTCGTCACGGCGATCGCTACTAAACAGCAAT
AGCGCCAGATTGTTTTGCAGGCCCGTATTGCCCGGTGCATCCGCATTGATGCGTTTTAAC
TGATTAATCGCTTCGCCACGGCGAGCCGGAATTTTCGCCACCGTACTCCAGTACTCGACA
GCAATGTCACCTTCCGGCGGCGCACCGTTGAACAGTTTGTTGTAACTCGCCACAGCTTCT
TCTGCATGACCGGTCGTCGCCTGCAATCGTGCCTGTTGCAGTGCCTGACGACCATCCGGC
GTGGAAAGTAGCATCGTAGTCCGCGACGATTTATACGCATTTGAACTCGGCGCTAACTGC
GACAGCCGATCGAGCTGTTTTTGCGCGCCATCAATATCGCCCTGACGTAACAAAGAACGG
AAACGGGCGGCAACGACGTCCGGGTTATTCGGATCAATAAGTTCCAGCCGATATAACGAC
TGTTGCACCAGATCTTCACGATGGGTCGCTTCGCCTAACCGAACTTGCTCCAGCAACTGT
TGCTGAGCGGTTGGTGCTGCCTCGACCATCGGCATGACGGCCAGACCGAGGGAAAGCGTG
AATATGTTTAGTGTGAATTTGCGCATTCCTGGCCCCAGTCAGGTAATAACTCACCTTTTG
TCGAGAAGCGGAAACGGTGTTGATCCCAGCCTTGTCCAAACAGGGTCAGCACATAGTTGT
AATAGGCATCGCTGCCGGGAAAGTTATCGGCCACGCGCTGGCGCTGAACGGCCTGCGCAT
CGCGGTTTTGTAAAAAGGGCAGCATGGCGGCAGAAAAACCGACTGGTCCTTTACCCTGCG
CTTTCCCCGTAGCCACATCCACTTTTTCCGGCGGATAACCGTTTTTCTCAGTGAATGTCG
CCATCGGTTTAAACCGGTTGAGCATCCGCGCTTTTTGCGGATCGCTGTCAGGCATCATGC
CTACCCACATGTAAACGCGGATAGCGTCGTAGCTGCTGATCAATGTTTTTTCGGCTTTTA
GCTGCCAGCCTTTGTCTTTCTCATAGCGCACCCAGTCTGGCGAAAAACCTTTCGGGGCGG
TTTCCAGCAATAAACGTTGATTGGTTTCGCGCAGCGTGGTCCACGGCGCGCCAAAGCGGG
TGAAATACTGCGCCAGCGTCGGCGGCAGGTAGCTGGGGTTAAAACGCCAGCTGTTATCCT
CAGCAAAACCCACTTTGCCCGGTAACAACATGGAACCCAGCCCAGGCACCGTCACCACTT
CCTCCCGCGCGATACGTTTTAGCAACGCGCTGCCGATGTCGGTATAACGCTGCTCTTTCC
ACAAACGCCCCGCCTCCAGCAACGACCAGGCCATCCAGACATCACCATCGGAGGCCGAAT
TGCTGTCCAGCACTTCCCACTTACTGTTCTCTTTCTTGCCCCACAGCCAGGCGGGCAAAC
GTTCTTTTAAAGAACCCTGAGCGAGATTGTTCTGCGTCCAGTCGAGAATATTATCGAAAG
CTGCACGGTCGTTAGCCGCCAGGGCAGAGAACATGCCGTAACTTTGCCCTTCGGAGGTGG
TGATTTTGCGCGCGTCGCTGGGGTCGATGACGCGCCCTTCCTGACTGATGTAATCCTTTT
TAAACTGCTCCCAGGCAGGCCAGGTACAGGCTGCCTGAACACTAAAGGCAGCCAGCAGCA
GCATCGTCACGATTCCACTACGCAACACATTCATCTTCAATTACTCGTTATCCGGGTTAA
GACGACGACGACTAATAATTCGCAGCAGACGCCACAGTACCCATGCCAGCAATATCACAC
TGATAGCCGCCAGCACCGCCAGCAGAATCGGATGGTTTGCCAGCGCATACCACACGCGCT
CGAACCACGGCAGATGACCTACGTAATAAACGTCGCCAACACGTAGGCTGTTGATACCGG
ACTCGCGGATCACCGCGACCGAACCGAACATGGTGGCGCGTTTGCCGCTATCGTTCACCG
CATCGTTAAGCATTTCATAACCGCGTGGGCTATCTGCCAACAGCGCAATCACGCTGCGCT
GGTCGTTATACGGCGACTGGAAGCCAATCACCGCCGCCATCGCACCGGAAGAGGTCAGCG
TTGACCGGGTTTCTGCCGCGCGATCGCTCTCGTCCGGCACAATGCCGGGGAACGGGGTCT
GGCGCATCGGTGTTTTCACCCAGCTTTCGGTCGCCTGCACCAATAGGTCGATCTGCTTAT
CGTCTTTCAGTTTGTCCGGGATACCACCGATGATCATGATGTCGGCATCTTTGCCCTGAA
TGGTGCTGCCATCATCGGTCACCGTCAGATTAATCGCCGGGAAGCCCGTCTGTGCGCCGA
TAAAACCAACAGTATTCAGCAACGTTTCCATCTGTGCTTCGTTAGGCGCTTTCGGCATCA
CGGTGATGGTTTGCGACAGATCCGCCATCCGGCTGAATGGGAAGCCCGCGTTAGCAAAGG
CGCGTAGATCCGGCATCGGGATGAAGTGGTAATACTTCGAGAAGTCGATGGTGGAGTCGT
CACCAATCACCACATGATTCTGCACCGGCTGGAAGGTAATACAGTTATCCACCGAACCGC
CCGGCATCGGGTTCATATACTCAAAGTCGAAGCGCAGCTGGTTGGTCGCGCCCAGTTTCA
GCGCCGGAATAGAGACATCTGTTTTGCCATCCAGCAAACCTTGTAATACCGGAATCCGCA
GCAGCAGGCGGTTCGCCTCCTGTTTGCTGCTCAGGTTGAAGGATTGCAGGAACTGGTTAT
TCAGGCTGATATCCATCCGCGAACTGTCTTTCACCGGCGGCATGGTGTAGCGGTAATTAA
TATCCATATCAATGCCGGTACTGCGCATCAGGTAGAGATCCGGCGGCAGGTTTAGCGAAA
CGTTAATCGCTGCTGGCTCAAGACCGCTGGATTGTAACTGTTCTTCATAGGTTTTCAGTT
CGCCAAATGTGACCGGACGATCGGTACGTACCCAGTTCGGCGCATCGTACGGCTTACGCG
GTAGCAGCGGTTTCACTTCATTCACTACCACGCTTTCACCACGGAACAGAATGTTACCCT
GAGCGATACCTTTCGCTGCCTGCAACAGGTCTTTGTCGTCACGACCAAACACCACCAGCA
GTTTGACGTAAGGATTCTGCGGATGGTTAATCATCTCAATCACCGGGGCTTTTACCGCCG
GATGATCGCGCAGGAAGTCCGGCCGTTTGTCGTTGGTTGCAAAGACAATGGCATTGCGAT
CCGGCAGTTGGTTATAGAGTACCGGGAAGTTCTGCCCACGCCAGCCAGAACGCGAACCAA
ACCACGAGGCGACAATGGCAGAGGCTTGTTGCAGCCCAACATCCGGCGCACCCGCAAAGA
CCATCGGCAAGGTGTTGGTGCGGTTATCGCTCGGGTCAAAGAATGGCACCGGGAAGTGTG
ACAGGTCATTCTTCACATTCAGGGTCTGATAGGTCAGATCCAGTCCACTGCTCCGCCCAA
CATCCAGCCAAAGCGTGGTGCTGGCCGGTTTTTCGCACACGTCCTGATAATGGCCGACAA
ACTCCAGCCGTACACGGTTGAAGTCGCTAATAAACAGTGGGTTAATGGGCATTTGCGCCA
GCGTTTTTTTACCCAACTGTTCTTTGGTCACTGGCAGCACGCCCATCAGTTCATCATTGA
GATAAACCTTTAACTGCGACTGGACAGGCAGTAACGATGGCGATGGGGTGTATTCGAGGT
TGAGCATCGCCTTCGTCACCACTTCATCGCTGCGCATACCAAACTCAATGCTGCCGTTCG
GGTTAATGCCACGTAGCACCATGCTGCCCGGCGGCGGTGCAATTTGCGCAAAGGTCAGCT
TCACATCACGCGAAGGACCGTTCTGCGCCACGACTGGCGCATCAGCGCCCTGCACGCCCG
GCATCACTTGCCCCACCTGCGGATTTTGTTCCGTCTGGGCGGCTACAGCTGGCTCAGCAT
TGATCAGTGGTTGCGTTGCTGGCGTCGCCTGCGTCATGAAAGAGGGGAACGCACTCATCC
CCATAGCCACTGCACAAATCCAGAATAGTTTTCTTTTCATCGCGTTATCATCATTGTTGA
GCCAAAGCCTGATCCGATGGTTGTGCCGTTTCGCTCCGCTCCGGGCGGCGCGGAATAAAC
GATACAACCCAGGAAACCAGAGAAGTCAGCACACGGAATATGCCCTTCACCGAAGAAGGC
GCAAACTCCGCCAGATGGCGGTAGCCACGGAAGCCGAGCTTCAGAATATCCAGCAGACTT
TCCAGCGGCTTATCTTCCGGGTAGCTGTCCTGCCAGAGCGCCCATGTATCCGCACGGGCA
AACGTACACTGCACAAAATCGATATGTTGCTGGGTGGTGAGCGGCATTAATTTCAGCCCA
ACTTCATTACCCATCACGCGCGCCACCTGGGTCGGGAAGACGTATTCCTGCTGACCGCGT
TTAAGCAACAGATTCACTTTCTGCCCTTCCAGAATCTGCGCCTGACCGTTGATCTTGATC
CCCAAACCACCGTCGGAGAAATCCTGAACGGTACACGAGAAGAGGTGACCATCTTCGCGG
GCAATTGCCGCGGGCATCGTCATCTCCACGCGGTGCGATCGGCGTACCTGTTTGCTTTCT
ACCGATACCGCAACTGCGCCGCCAAGAACAATCAGGTTGTAGAACACCCACACCATACTG
ACGACCACGGTGAGCATCTCGGTTGGCGGGCCATAGAAGTAGCGCCAGATGCCTACCGCA
ACGCCCACCAGGTTGAGCAGGACAAGGAAGATGTAGGGCCGCGAGATCACCCAGTCGACG
TACTCTTCTTCCACCAGTCCACCTTTGGCGGTGACGTTAAATTTGCCTTTGTGCGGGTTA
ATCAGCGCCACCAGCGTCGGTGGTGCGATATACCACGCCAGCACCGTTTCGTAGATTTCA
CTCCAGAAAGAGTGGCGATATTTGCCCTGGATCTTGGAGTTGGTCAGGCTGGCATGGATC
ATATGCGGCAGCACGAATAGGGCGATCATCAACGCTGGCGCATAGATGATGTAGGCATGA
AGCAGCAGGAACGCCAGCGGCGCAGTCAGGAAGATCAGCCGTGGAATGCCCGACAAGAAG
TGGAACATGGCGTTGACGTAACATAGCCGCTGAGCAAACTTCAGCCCTTTACCGGTGAGC
GGGTTATCGAGACGGAAGATTTGTACCATCCCGCGCGCCCAGCGAATACGCTGACCGATA
TGCGCCGACAGACTTTCGGTCGCCAGCCCCGCCGCCTGCGGAATACGCATATACGCGGAG
GTATAGCCACGACGGTGCAACCGCAGAGAAGTATGCGCATCTTCAGTCACGGTTTCGACA
GCAATGCCGCCAATTTCATCCAGCGGCTTACGACGAATCACCGCACAGGAACCGCAGAAG
AAAGTGGCGTCCCACATATCGTTGCCATCCTGCACCAGACCATAGAACAGCGTGCCTTCG
TTCGGCGTTTTACGGAAACGCCCCAGGTTGCGTTCAAACGGGTCCGGTGAGAAGAAGTGG
TGCGGCGTCTGCATCATCGCCAGCTGTTTTTCTTTCAGGAACCAGCCCATGGTCATTTGC
AAGAACGATCGCGTTGGTACGTGGTCGCAGTCGAAAATCGACACGAACTCGCCTTTGGCA
TATTTCAGCGCATTGTTGATGTTGCCTGCTTTCGCATGTTCATGAGTGGTGCGGGCGATA
TATTTCACCCCCACGTTTTGCGCAAACTGGCGAAACTCTTCCCTGCCGCCGTCATCAAGG
ATCCAGATATTCAGCTTATCTTTCGGCCAGTCGATACCCAGCGAGGCGTAAATGGTATTT
TTCACCACGTTGAGATCTTCGTTGTAAGTCGGGACAAAGATATCCACCGACGGCCACAGC
GACATATCTTTCGGCAATGGCACCGGCTGACGATTCAGCGGCCATACTACCTGGAAGTAG
CCGAGCACCAGCACAATCCACGCGTACGTTTCAGCGAAGAGCAGAATAAGCCCGCACACC
AGGCTGACCGGATCGTCCCAGTTCAGCGTAGAGGTGTAACGCCACCAGATATAACGGCAA
GAAACGGTCAGCGACAGCACAATCAACATTAGCGCCGAGAAGCGCCCCGGCATCCGCCGT
ACGATCAGCGCTACCCCCCACAGCAGCATCAGGAAGATAAACTGCGCCAGCGGGTTAAAC
GGCTGAGTAACGCAGATTAACGCCAGAATCAGCGAGAAGGTGACGATGATACCGAGGATC
AACCGCCGCGCCCCGGCACTCAAATGACCGAGCTCTTTTTTCTCATCCAGATGCTGTGTT
TTATGGCTAACGCGCTCAGGCAGCTCGTTCATCCATTGATGGTAACGTCCACGAATATTT
TGCAGACCTGAAAATGCCCGCCTGCGCGGTTTCGGCGTTTCTTTGCGCGATGCACCGATC
AATAACCAGCATGTTTGAATGAGATAACGGACCGGGTCCAGCGGACGCGGACGCGAGGCG
TTGATATGCGGATACAGGTTTTTATGTTCTGCGCGAATACGCTGCCAGCGCGGGTGCTCC
AGCGGAATAAAAATCCAGGCCAGGATCATCCAGAAACAGCCGAGCGTCGCGCTGAAAGCC
GACGCACCGTGACGACGATAATCGCGATAACGCCCGATAAGCCGCGCGTTGACCGGCGGG
ATAAGCAACCACCGGGTCAGGATACTCATGATGCACTCCCGACTGGCGTTTTCAGCCCGG
AGTAGTTCAACAGGCACCAGTTCGCCAGCGTCAGTATCTCTTCAGCCGCCAGCGCATCAC
TGCGATATTCACCTACTGGTTGCTTAGCCGCCAGGCATTCAGCCATCGCTTCATCACGAT
GAATGAGCATCGGCAGTAATCGGCGCTGGCTTTGCAACCAAAGCTGGTAAATATCGTCCT
GAACCTGACTGCCAATACGGAAGTCATTAATCAAAATATGTGCGCCATCCGGCAGCGCTT
GCTGATGCAGTCGGATATGGCAGTTGGCATCCACATTGACGATTGCCAGCGAGTGATCGC
ACAAACTCAGCAGCTGGTGGGTTATCTGCGAGGCATCACGCGGTAAGTCGATTAAAATCC
ACTGGTAACGCCCGCTGGCTTTTAGTTGCTGTAAGCCGGAGCAAATATCGCTCAGCCGGG
TTTGCCAGTGCTGTGGATTTTCTTGTTCTTCAATGGATAACTGACCAAAAGGCAGCAAAT
CGAGCTGCGAGGTGTAGCGCAACCCAGCGTCACGCCAGTCCTGGCCATCCAGCATCGCTC
TGGCCCAGCCCTGACGGTGGGTAAAATCAACATTAAATGACAGGCGCAACAAGTTGTCCG
GGCAGGCATCGACCACCAGGACATTTTCTCCCAACATTTGTAATGACCAGGCTAATGCGG
CGGTGATGGTTGTTGTCCCCACGCCTCCCCGCACCCCCTGCTATCCCAGTACGGCCATTC
ACCAATCCCCTACTTTTGTTGCGCAAACTCTGCCAGCAACGGCCAGCGTTTTAATGCCGC
GGCCAACTGTTCGCGTTGGGAAATATCGGCATAATCAATATCAGGCAGTGAAAATGCCTG
CTTTAACGCCACAATATCATTCTGGAAGATATAGCCTATCGCGGGATCAGGCAGAGTATC
TGGTTCATTGTTATTCATTTTGCTTGATCCCTATGAAATAACCGTACCGTTCATGAGACA
ATTCTAACCGTGAGCATTTCGCCGGTTTATTGTTTACGGCGAGACGGGAATTTGCTCACT
TTTTGACTTTCCGTTACGCAACAGAAAAAGTTAAAAACGAAAAGACTAAAATCACACGTC
TTGTGACCTTCTAAATTGATTCACATGCTAAATCTGATAAGTTTTAATTTCAATGGTAGG
TTTATTTCTTAGCTTTCGCTAGTAAACTGATAATCAGACAAAATGGTGACATGAGGGACA
TTGTGGACCCTGTATTCTCTATCGGTATCTCATCATTATGGGATGAGCTGCGACATATGC
CAGCAGGCGGCGTCTGGTGGTTTAACGTCGATCGCCATGAAGATGCTATCAGTCTGGCGA
ATCAAACAATTGCATCCCAGGCTGAAACCGCACACGTCGCGGTCATTAGCATGGACAGCG
ATCCGGCGAAAATCTTTCAATTAGATGATTCTCAAGGGCCGGAAAAAATAAAATTATTTT
CAATGCTAAATCATGAAAAAGGTCTATACTATTTGACCCGTGATTTGCAGTGTTCTATTG
ATCCCCATAATTACCTTTTTATTCTTGTTTGCGCAAATAACGCATGGCAAAACATTCCTG
CCGAGCGGCTTCGCTCATGGTTGGATAAAATGAATAAATGGAGCAGGTTAAACCATTGTT
CGCTTTTGGTAATTAATCCCGGAAATAATAACGATAAACAATTTTCATTGTTGCTTGAGG
AATACCGTTCACTTTTTGGTCTTGCCAGTTTGCGTTTTCAGGGTGACCAACATTTGCTGG
ATATTGCCTTCTGGTGCAACGAAAAAGGGGTCAGCGCCCGTCAGCAGCTTAGCGTTCAGC
AACAAAATGGTATCTGGACATTAGTTCAAAGCGAAGAGGCGGAGATCCAACCACGCAGCG
ACGAAAAACGCATTCTGAGTAATGTTGCTGTACTGGAAGGTGCGCCGCCGCTATCGGAAC
ACTGGCAACTGTTCAACAATAACGAAGTCCTGTTCAATGAAGCCCGTACCGCTCAGGCGG
CGACGGTGGTCTTTTCTTTACAGCAAAATGCGCAAATCGAGCCACTGGCCCGCAGCATTC
ATACCCTGCGTCGCCAGCGCGGTAGTGCGATGAAAATCCTCGTGCGGGAAAATACCGCTA
GCCTGCGCGCCACCGATGAACGTTTGTTATTGGCCTGCGGTGCAAATATGGTTATTCCGT
GGAATGCGCCACTCTCCCGTTGTCTGACGATGATCGAAAGCGTGCAAGGGCAGAAGTTTA
GTCGCTATGTGCCGGAAGATATCACTACCTTGCTGTCAATGACCCAGCCGCTCAAACTGC
GTGGTTTCCAGAAGTGGGATGTGTTCTGTAATGCCGTCAACAACATGATGAATAACCCTC
TATTACCTGCCCACGGTAAAGGCGTTCTGGTTGCCCTACGTCCGGTACCGGGTATCCGCG
TTGAACAAGCCCTGACGCTGTGTCGCCCTAACCGTACCGGCGATATCATGACCATTGGCG
GTAATCGGCTGGTGCTGTTTCTCTCATTCTGTCGGATTAACGATCTGGATACCGCGTTGA
ATCATATTTTCCCATTGCCTACTGGCGACATTTTCTCAAACCGTATGGTCTGGTTTGAAG
ATGATCAAATCAGTGCCGAGCTGGTGCAGATGCGCTTGCTTGCCCCAGAACAATGGGGCA
TGCCGCTGCCTTTAACGCAAAGTTCTAAACCGGTCATCAATGCCGAGCACGATGGTCGCC
ACTGGCGACGAATACCAGAACCCATGCGACTGTTAGATGATGCTGTGGAGCGCTCATCAT
GATGACCATCAGCGATATCATTGAAATTATTGTCGTTTGCGCACTGATATTTTTCCCGCT
GGGCTATCTGGCGCGGCACTCTTTGCGACGCATTCGCGACACCTTACGTTTGTTCTTTGC
TAAACCTCGTTATGTTAAACCGGCCGGGACGTTACGCCGCACGGAAAAAGCCAGGGCAAC
CAAAAAATGACTCAATTTACGCAAAATACCGCCATGCCTTCTTCCCTCTGGCAATACTGG
CGCGGCCTTTCCGGCTGGAACTTCTATTTTCTGGTTAAGTTCGGCCTGTTGTGGGCGGGA
TATCTTAACTTCCATCCGCTCCTCAATTTGGTGTTTGCCGCGTTTCTGCTGATGCCCCTT
CCGCGCTACAGCCTGCATCGCTTGCGCCACTGGATTGCCCTGCCGATCGGCTTTGCTTTG
TTCTGGCATGACACCTGGTTGCCTGGCCCGGAAAGCATAATGAGCCAGGGTTCGCAGGTG
GCGGGGTTCAGTACCGATTATTTAATCGACCTTGTCACACGCTTTATTAACTGGCAGATG
ATTGGGGCCATTTTTGTTTTATTAGTGGCCTGGTTATTCCTGTCACAATGGATTCGCATT
ACCGTTTTTGTGGTTGCCATACTGCTATGGCTGAACGTACTTACCCTGGCGGGACCAAGT
TTCTCCTTGTGGCCAGCCGGACAACCGACGACCACTGTAACAACGACGGGTGGTAACGCA
GCGGCAACCGTTGCGGCGACGGGTGGCGCACCGGTAGTGGGTGATATGCCCGCACAAACT
GCACCGCCAACAACGGCGAACCTTAACGCCTGGCTGAATAATTTCTATAACGCGGAGGCG
AAACGTAAATCGACCTTCCCGTCTTCGCTGCCCGCTGATGCTCAGCCATTTGAACTACTG
GTGATTAACATCTGTTCGCTTTCCTGGTCGGATATAGAAGCCGCCGGGTTGATGTCGCAT
CCACTGTGGTCGCATTTCGATATTGAGTTCAAGAACTTTAACTCCGCCACCTCCTACAGT
GGCCCGGCGGCGATCCGTTTACTGCGCGCCAGCTGCGGGCAGACTTCGCACACTAATCTG
TATCAACCGGCAAATAACGACTGCTATCTGTTTGATAACCTTTCGAAACTGGGCTTTACC
CAGCACCTGATGATGGGACATAACGGCCAGTTCGGCGGTTTTTTGAAAGAAGTTCGCGAA
AATGGCGGCATGCAGAGCGAATTGATGGATCAAACAAATCTGCCGGTTATTTTGCTGGGC
TTTGATGGTTCGCCGGTTTATGACGATACCGCTGTGCTTAACCGCTGGCTGGACGTTACC
GAAAAAGATAAAAACAGCCGTAGTGCCACGTTCTACAACACGCTTCCACTGCATGACGGC
AACCATTATCCGGGGGTCAGCAAAACAGCGGATTACAAAGCGCGGGCGCAGAAATTCTTT
GATGAACTGGACGCCTTCTTTACTGAACTTGAGAAATCGGGTCGTAAAGTGATGGTGGTC
GTGGTGCCGGAACACGGCGGCGCGCTGAAGGGCGACAGAATGCAGGTATCTGGCCTACGT
GATATCCCTAGCCCGTCTATCACCGACGTCCCCGTTGGGGTGAAATTCTTCGGCATGAAG
GCACCGCATCAGGGGGCACCGATTGTCATCGAACAACCGAGCAGCTTCCTGGCTATCTCC
GATCTGGTGGTTCGCGTTCTCGATGGCAAGATTTTCACCGAAGACAATGTTGACTGGAAA
AAACTCACCAGTGGGTTGCCACAAACAGCACCGGTCTCCGAGAACTCAAATGCAGTAGTT
ATTCAATACCAGGATAAACCGTACGTTCGCCTGAACGGCGGCGACTGGGTGCCTTACCCG
CAGTAAGAACGAAAAAGGCCGCAGAGTTTCCCCCCTGCGGCCTGGTCCGGGCGCAAATTG
CCATTACGGCAGCCTGACGCCCGCATGACACGTTACTTCCGCTTGTTCAGCCAGTTCACG
ATCATACTGGCAAGAATGCCAGCAATGACCGGAGCCGCTAAATCATGCCAGAAGGCCATG
CCCAGCTCTGCGAACGTCATATAGCCGCCTGTGTTGTAATGACAACGTTTCGCGGCTATT
CTTGAGTGGTCTAGAGTCAAGATTAGCCCCCGTGGTGTTGTCAGGTGCATACCTGCAACG
TGCGGGGGTTTTCTCTCTCCAGCAACCAATGCCACCAGGGATAAAGCCCCCGCAACATTG
CGCCTCACCGGAACCTTTCCGGCTTGCCGCTGATTCTACGATTGCTTTTTACTGTCAGCA
CCCGGCAATCTTCCTCATTGCGCGATGCCTTCCAGCTTAATTTCTTTATTTGCAATAGTT
GCAGTTCATATCCGGGCTGACTCCAGACTGGTAGTGAAATGCGCAATTTTGTAGAATTGC
GCCTCCTCGCGACCTCCCCAGTGAATCTGTTGCCTCATTTTTTACATACTGCGTATTCGA
CTTCTCCACCTGTTGCGCAAGAGAAACTGGGTTTATTCATTTTTGCGAGGCCGACTTCTT
TCTGGACAGGACTTTATGCAGCACAACACACTATCGAAACACAATCAGAAATTGCCGTTT
ACACGCTACGACTTCGGCTGGGTTTTATTATGCATAGGCATGGCGATTGGTGCCGGAACC
GTGCTGATGCCAGTACAAATTGGCTTGAAGGGAATTTGGGTATTTATTACCGCAGCGATC
ATTGCTTATCCTGCCACCTGGGTAGTGCAGGACATTTATTTAAAAACCCTTTCTGAAAGC
GATTCCTGTAATGACTACACCGATATTATCAGTCATTACCTGGGGAAGAACTGGGGAATT
TTCCTCGGGGTTATCTACTTTTTGATGATTATCCACGGGATTTTTATCTACTCTCTCTCC
GTGGTTTTCGACAGCGCCTCGTACCTGAAAACCTTCGGTTTAACCGATGCCGATCTTTCA
CAATCTCTACTTTATAAAGTCGCTATTTTCGCCGTACTGGTGGCGATTGCGTCTGGTGGT
GAACGATTACTGTTTAAGATTTCCGGGCCAATGGTGGTGGTCAAAGTAGGGATTATTGTC
GTGTTCGGTTTTGCGATGATCCCGCACTGGAATTTCGCCAATATAACCGCCTTCCCGCAA
GCCTCCGTCTTTTTCCGCGATGTCTTGCTTACCATTCCATTTTGCTTCTTTTCTGCAGTA
TTTATTCAGGTACTTAACCCAATGAATATTGCCTATCGTAAACGGGAAGCGGATAAAGTA
CTGGCAACCCGGCTCGCGCTGCGTACCCACCGAATTAGTTATATCACGCTCATCGCGGTG
ATCCTGTTTTTTGCCTTTTCGTTTACCTTCTCAATTAGCCACGAAGAAGCCGTTTCTGCC
TTTGAACAAAATATCTCAGCACTGGCGCTGGCCGCGCAGGTGATCCCTGGGCATATCATT
CATATCACCTCTACGGTGCTTAATATCTTTGCCGTACTGACCGCATTCTTTGGCATTTAT
CTCGGTTTCCACGAGGCCATTAAAGGCATTATTCTCAATCTGTTAAGCCGAATTATTGAT
ACCAAGAAAATTAACTCACGCGTGCTGACTCTGGCGATCTGCGCTTTTATCGTCATTACG
TTGACGATTTGGGTTTCGTTTCGTGTATCGGTGCTGGTGTTCTTTCAGTTGGGAAGCCCG
TTATATGGTATTGTGTCGTGCCTCATTCCGTTTTTCCTGATCTATAAAGTCGCACAACTG
GAAAAACTTCGCGGATTTAAAGCCTGGCTGATTCTGCTGTACGGCATTTTGCTATGCTTG
TCGCCACTGTTGAAGCTGATTGAGTAAACCGGAGCGCATGGCCCCGGTTTTGTGAGTTAA
CGCTGCGGATTTTCATCCTGATCAACAGCAAAACAAGCTACCAGTTGACCGCCGTAGTCT
TTTAGCTGCGGCTGCAACTGGGTGCAGGGGCCGAAGCGCCGACGACAGCGGGCGTTGAAG
GCGCAACCCGGCGGTGGATTCAGTGGGCTTGGTAGTTCACCGCTGAGCTTGATGCGCTCG
CGGCGATCGTCCGGGTTCAGGCGCGGCGTCGCGGAAAGTAGCGCCTGAGTGTACGGATGG
CGCGGGTTATTGAAGATTTGGTCTTTCGTTCCCTTCTCCACGCAGCGGCCCAGGTACATC
ACCATCACTTCATCAGCAATGTGCTCCACCACCGACAGGTCGTGGGAGATAAAGACATAA
GACAGCCCCAACTCCTGCTGCAAATCCATCATCAGATTCAGCACCTGCGCGCGCACTGAA
ACATCCAGCGCGGAAACCGGTTCATCGGCAATCACCACATCCGGGTCGAGCATCAGACCA
CGGGCGATGGCGATACGCTGACGCTGACCGCCGGAGAACATATGCGGATAGCGGTCATAG
TGCTCGGTTTTCAGGCCGACTTTCGCCATCATCGACAGGGCTTTTTCCCGACGCTGTTCT
TTGCTTAAGCTGGTGTTGATCAGCAGCGGCTCTTCAAGAATTTGCCCGACTTTTTTACGC
GGATTCAGCGAACCGTAAGGGTTCTGGAAGACGATCTGGATTTTCTGCCGACGCAGCTTC
TGCGCCTGCGGATCGTGCTTAAGCAGATCCTGCCCCTGGTAATACAGCTCGCCACCGGTG
GGCATTTCAATCATCGTCAGCAACCGACCGAGGGTCGATTTACCGCAGCCAGATTCGCCC
ACTACTGCCAGCGTTTTGCCACGTTCAAGGTTAAACGAAACGCCATCCAGCGCTTTAACC
AGACGTTCCGGCGCGAACATGCCTTTCTTCACCGGATAATGTTTTTTCAGGTCGATAGCC
TGCAACAGCGGTTGTTGCAGGGTGGCCTCTTGCGTACTCATAGTGTCGGCCTCCCGGCAT
CATCAAGTGGGTAATGGCATTTGGACTGACGCCCGTCAGCGAGCATATTCAGCGCCGGTT
CTTCAGCGCGACATCTGTCAGTGGCATAGGGGCAGCGCGGGTTAAGCAGGCAGCCGTTCG
GGCGGTCGTACTTGCCGGGAACGACACCTGGCAACGACGCCAGACGTTCTTTGTCCTGAG
CAAATTCTGGCAGCGCACGCAGCAATGCCTGAGTATACGGGTGACGCGGCGCATGGAAGA
TGGCGTGCGCATCACCGGTTTCCACCACCTGGCCTGCATACATCACGATGATTTTATGTG
CCGCTTCCGCCACCAGCGCCAGGTCATGGGTAATTAACACCAGCGCCATGTTCTCTTTCT
GCTGTAGCTCCAGCAGTAGTTCGATGATTTGCGCCTGAATGGTCACGTCCAGCGCGGTGG
TCGGTTCATCGGCAATCAGCAGTTTTGGCCGACAGGCAATCGCCATGGCGATCATCACGC
GCTGGCTCATGCCGCCGGAAAGCTGATGCGGGTAAACATCCAGACGCGATGCCGGATCGG
GAATACCGACCTGATTCAGCAGGTCAATCGCTCGCTGACGGCGGGTACTTTTGTTGCCGC
CCTGATGCACCTTAATCGCTTCCATAATCTGGAAACCCACGGTGTAGCACGGGTTAAGGC
TGGTCATCGGGTCCTGGAAGATCATCGCCACTTCGGCACCCACCAGGTTGCGGCGCTCTT
TTTCTGAGATACGCTGCAAATCCTGGCCGTTAAACTCCAGTTTTTCTGCCATTACGCGGC
CCGGATAATCAATCAGCCCCATAATCGCCAGTGAACTGACCGACTTACCGGAGCCGGACT
CACCCACAATCCCGACCACTTCGCCCTGTTTTACGCTGTAGCTGATGCGGTCTACGGCGC
GGAACGGCGCGCTTTCGTCGCCGAAATGCACCGATAATTTATCTACATTTAATAACGCCA
TCTCGAACCTCTTACTGCTTCAGTTTGGGATCGAGCGCGTCACGCAGACCGTCACCCATC
AGGTTAAATGCCAGCACCGTCAGCAGGATCGCCAGACCCGGGAAGGTCACGACCCACCAG
GCGCTTTGCGCGAACTGCAACACGTCGGAGAGCATGGTGCCCCACTCAGGCGTTGGCGGC
TGTGCCCCCATGCCGAGGAAACCAAGAGCAGCCATATCGAGAATGGCGTTAGAGAAACCG
AGCGACGCCTGAACAATCAGCGGCGCAAGGCAGTTCGGGAAGATGTTAATAAACATCTGA
CGCATCGCCCCGGCACCCGCCACGCGAGACGCGGTGACGTAATCGCGGTTAACTTCCACC
AGCACGGCGGCGCGGGTTAAGCGCACATAGTGCGGCAAGGCAACGAAGGTCAGTGCCAGC
GCGGCGTTACCAATCGACGGGCCGAAAATTGCCACCAGCACCAGCGCCAGCAGCAGACTT
GGCAGCGCCAGCATGATATCGACCACGCGCATAATGATGTTATCGACCAGGCCGCCAAAG
TAACCGGCGATCAGGCCGAGAATAACGCCCATAATCAGCGATAACACAACTACCAGACAG
CCAACCAGCAGCGACAGGCGCGCACCGTACATCAGGCGCGACAGCACATCACGGCCTACG
TCATCGGTGCCCAGCAAGTGCGCCATGCTGCCGCCTTCCTGCCAGGCTGGCGGGGCGAGC
AGTGCATCGCGGAACTGTTCCGCCGGGTTATAGGGTGCAATCCAGTTGGCAAAGATCGCG
ATGAACAGCACGATGACGACGTAAACCAGCCCGACGACCGCGCCTTTGTTGCGTTTAAAA
TAGTGCCAGAACTCCTGTAACGGGGTCATCGGCACCGGTGCGCTAATCACTTTATTTTCA
GTAACCTGTGACATGATGTCCCCTTACTTCTTATGACGAATACGCGGGTTCACCACGCCG
TACAGCAGATCGACCAGCAAGTTGACGAGGATAATCATCGTCGCCACCAGCAATACGCCG
CCCTGCACTACCGGATAGTCGCGGCGTTGCAGTGCGTCAATCAACCAGCGTCCCAGACCG
GGCCACGAGAAGATGGTTTCGGTCAGAATCGCCCCCGCCAGCAATGTTCCCACCTGCAGG
CCGATAACGGTCACCACCGGCAGCATCGCGTTACGCAGCGCATGGACGATAATCACCCGC
ATGCGGGTTAGCCCTTTGGCGCGCGCGGTGCGGATGTAATCCTCGCCCAGCACTTCCAGC
ATCGAGGAGCGTGTCATACGCACAATGACCGCCAGCGGAATAGTACCCAGCACAATGGCA
GGCAAGATCATATGGGCGACGGCATCGATAAAGTTGCCGTCTTCACCCCAGATGGCGGTG
TCGATTAGCATAAAACCGGTTAACGGATTGGAGTCATCGAGGAACACCATATCGCTCACG
CGACCGGAGACGGGCGTCAGGTTCCAGTGCACCGAAACCAGCATGATCAGCATCATGCCC
CACCAGAAGATAGGCATTGAATAACCTGTCAGCGCCAGGCCAACCGCTGTGTGATCGAAA
ATGGAACCGCGTTTAACCGCAGCCAGCACGCCGACCGGAATACCGACTGCCGTAGCAAAA
ATCATCGCGCAGACGCCAAGTTCCAGCGTGGCCTGGAAGCGCGGCACGAACTCTTCCCAA
ACCGGGATGCGGCTTTTCATTGAAATGCCTAGATCGCCATGCATAACGCCCCAAATGTAA
TGGAGATACTGCTGCCACATCGGTTTATCTAAGCCGAGTTCAGCCAGCAGCTGCGCGTGA
CGCTCTGGGGAGATCCCACGTTCGCCCGCCATGATCATCACCGGATCGCCCGGGATCATG
TGGACAAAGGCAAATGTGAGAAGGGTAATACCGATAAACGTGGGGATGACGAGTCCCAAA
CGTCGGAGAATAAACTGCAACATAACCCGGATTCTCTATAGTGACCCGCAGCCTGGAACT
GCGTGTCTGTATTGCTCACAAATCAATTCCCGCCCTTATCGGACAGGGAATGAAGTATTG
CTGCCGGATGGCGCTGCACGCAGAGGCACAGCGCCACCGGGTATACAGATTGTTGACAAA
GTGCGCTTTGTTTATGCCGGATGCGGCGTTAACGCCTTATCCGGCCTACAAAATCGTGCA
AATTCAATACATTGCAGAATTTTCGTAGGCCTGATAAGCGGAGCGCATCAGGCATTTTTG
CCTTTGCCATCAGTCTTGTATGGCTTTTAATTATTCGATAGAGACGTTTTCGAAGTGATG
TTTGCCTAATGGATCAACCACATAGCCTTTAACTTCTTTACGTACCGGTTCAAACACGGT
GGAGTGAGCGATGATCAGTGCCGGAGCCTGATCGTGCATCACCACCTGCGCTTGTTTGTA
CAGTTCAACGCGTTTATTGTGGTCGTCGGTAGCACGCGCCGGTTGAATCAGATCTTCAAA
CGGTTTGTAGCACCATTTTGAGTAGTTGGAGCCTTGTTCAGAGGCGGCGCAGCTGAACAG
GGTGGCGAAGAAGTTATCCGGATCCCCGTTATCGCCAGTCCAGCCCATCATTACCGTCTG
GTGCTCGCCATCTTTCGCACGCTTGAGGTACTCACCCCATTCGTAGGTGACAATTTTGGC
CTGCACGCCGACTTTCGCCCAGTCTGCCTGAATCATCTCCGCCATGCGGCGAGCGTTCGG
GTTATACGGACGTTGTACCGGCATCGCCCACAGGTCGATGGAGAAACCTTTTTCCAGACC
CGCTTCTTTCAGCAAGGCTTTCGCTTTTTCAGGATCGTAGGTGTAGTCCTGAACGTCGTC
GTTATAGCCCCACATGGTTGGCGGGATCAGGTTTTTCGCTGATACGCCCGCGCCCTGATA
AACCGCTTTGATGATCGCGTCTTTGTTCACCGCGTAGGTCAGAGCCTGGCGAACTTTCAC
GTCATCGAGTGGTTTTTTCTGCACGTTATACGAGAGATAACCGACGTTCAGCCCCGGCAT
TTCCATCAGATTGATGGATTTATCCTGCTTCATGCGAGCGATATCTGCCGGGTTCGGGTA
CGGCATCACCTGGCATTCATTCTTCTGCAATTTCGCGTAACGCACGGAAGCGTCAGGGGT
AATAGAGAAAACCAGCGTATCGATCTGCGGTTTGGTGCCCCAGTAGCCATCAAACGCTTT
GTAGCGGATACGGGAATCTTTTTGATACTGCTGTAACTGGAACGGACCGGTTCCGATTGG
GTTGAGGTCCAGTTTTTCCGGTGTACCGGCTTTCATCATCGCATCAGCATATTCTTTTGA
CAGAATAGAGGCGAAGTCCATTGCCAGGTCAGCGAGGAACGGCGCTTCCGGGCGAGTCAG
CACAAACTGAACGGTGTTGTCGTCCACCTTTTTCACTTCACTGATCAGCTCTGGCAAGCC
CATGCCTTCGAAGTATTCGTAGCTGCCGCCAGAAACTTTATGGTACGGGTTTTGCGCGTT
TTTCTGACGATCGAACGAGAACACCACATCATCGGCGTTCAGTTCACGCGTCGGTTTGAA
TTCTTTATTGTCGTGCCACTTCACACCTTTACGCAGATGGAAGGTATAGGTTTTACCGTC
TTCGCTGACTTCCCACTTTTCAGCGAGGCCCGGGATCACTTCGGTGGTGCCGATTTTAAA
TTCAACCAGACGGTTATAAAGCGGGACGGAAGAGGCGTCATAGGTGGTGCCGGAGGTAAA
CAGCTGCGGGTTAAACCCTTCCGGAGATCCTTCTGAGCAATAAACCAGAGTTTTAGCCTG
AACACTTGCTGCGACGGTCATAGCCACCAGGCTGAGACCAAGCTTCAGCATCCCTGACTT
TTTCAAGGAAATACGCATTATTCTGCTCCAATTGTGATGTTTGTTGTTTTAACCCTTTGC
AGTGGGTTGTCGCTGCCTGACCTTTTTTGTTTTTTGCCCGGTCGGGTCAACGTTATGAGG
TGGGGATGCCGTACTAATTAACATCAGTGTAACAGTGCGGATCCTCCATAAAATGCCCCT
CGTGACCTACAATCTGTCAACAGAATGTGAAAACGTCAATACAGCCAACCGGGATTTACA
CCAACGGTGAGAATCCACACACAAAGATTAAAAAAACTTCAAACAGCTATTTGCAGCAGA
GAAATTTGTGCTACTCCAACATGACCAGAACAATCAGCTTAATATTTAGCAACATTTGGT
GATTAAGTTTTATGCATTTAATGAAAAAAATCTGAGGAAAAGGTGGATATCTGAGCGATT
AATACCATGAACGCTAAAACGCACAGCGGAAAATGCCAGGGCCAGCCATAAGTAACGCAA
AAAAAGATTTAAGCAAATATAAAAAAAGACAATGGTTTCTGTCACAAATCCGTTAATGGA
TAGTGAGATATGGGGCGCAAATTTGGCAGGGAAATGTGTGTCGTGTAGGTCGAATAAGGC
GGTCGCGCCGCATCCGACAATGGCCGGCACATTTGCCTGATGCGACGCTGACGCGTCTTA
TCAGGCCTACGTCGAGTCGAACCTCCCTGCCCCCGGAGGTTCTCATCCTCATGAGCTGCA
GATGCAAAAAAGCCTGCTCGTTGAGCAGGCTTTTCGAATTTGGTCGGTGATAGAGGATTA
CTCGCCACTTCGTGGCTCGCCCTGCGGGCCGTTGCTGGCGCAACGTTCTCTCGCTTCGCT
CGAGTCGAACCTCCCTGCCCCCGGAGGTTCTCATCCTCATGAGCTGCAGATGCAAAAAAG
CCTGCTCGTTGAGCAGGCTTTTCGAATTTGGTCGGTGATAGAGGATTCGAACCTCCGACC
CCTTCGTCCCGAACGAAGTGCGCTACCAGGCTGCGCCAATCACCGAATGCGGGGCGCATC
TTACTGCGCAGATACGCCCTCGTCAATCCCTTAATAGCAAAATGCCTTTTGATCGGCGAG
AAAGTCAGCAGGCCGCTTAGTTAGCCGCTGCCTCTTTTGCCTGCGGGATGTGACACCAGT
TGTTGTTTTCGTTAATTCCACCATCCGGTGAAGTATAGCCAAGACAACCCATGATGGTAT
CGTACAGCTCTACGTGACGGCGTGGCACTTTCATGTCGGCTTCTTTTTTCAGCTGCGCAA
ACGCCTGCGCATTGGCCGGATTTTCCAGATATTTATCTGACATCCAGACCATCATCGGTA
CGCGGAACTGCTCCGGCGGTGCCAGTTCACGCGGCGTGCCGTGCAGGTGCTCGCGTTCAT
TAATTGACTCACCGTGGTCAGCTGCGTAGAACACAATCGCTTTCTTATCGCGAACCTGAT
CAATCACGCTGGAGATAAAGTGATCCACATAGGTCACCGAGTTGTCATAGGAGTTGATCA
TCTGCGCTTTGGTACAGCCGCTATCAACACCAATACATTCCGGCTTCCACTGCGCGAAGC
TACGCGGATAACGCTGGGTGTAGTTAAAATGCGAACCTTTGGTATGCAGAATGATCAGAT
GCTTACCATCCGGGTTGCGCCCTAGCGATTGCTGCATTTCGTCTACCAGCAACATATCAT
CTACCGGCTTGCCACGATTACGTGGCTCCGCACCAATCTGCTCACGATAAGCAATGTTGT
CCGCCATCGTGTTGCTGTAGAACCACATTTCGCTCTGCATAGCGTAGAGGTCAGAACTGA
ATCCTAACTGCTTCAGAACCGCGAAAATGTTCTGTTCTTTTAATGTGCGCTGCGGATTAT
CTTCCGCGCCCCCCTGACGTACAAACATGCAACGCAGTGAGAGTTTGGTTGCGGTATCAC
AGGAGTAACCACGGAACGCCGCCAGATTTTTCTCCTGGGCCAGTTTCGGCGTGGTATTAC
GCTCATAGCCGAAAATACCCATATGGTCCCAACGCGTGGTTTCACCGATGATAAACACGA
CATAAGTGTCATCAACGTTTTGCGGTGCCTGATAAGTGAATTTCTTCGCCGGATTAAGCA
ATGAATTATTATCGGAAGATTCATCGACCCGCGCCCAGGCATACAGCCCCAACGCAGAAA
GCCAGTTTGATGGCAGATAAGAGTTCGCTACGACACCGCCATAACTCGGCAAATCAACGC
CGGTCGCCCTCTCCACTTTCTTCTGCTGGATATCCAGCAAACGAATCGGTGCCCAAACCA
TAATACCCGCCAGTACGACGACCGCCAGGCTGCGAATACGCTGCCCTGGGGTTCGCAGTT
GTCGGAGCAAGGTGTAGCGACAGCGGTTATTCCAGATAAGGATAAGAGGCAATGCACTAA
CGGCGATTAACCAGAGAATAAAGTTCAGACCAACAACTTCTTTTGACAGGTCGATATCGG
TGGTCATGACGGAAGCGATGATGCCATAACCAATGACCACATTAAGGAAGGTCATGTAAT
AGCTGGCACCTGCGGAAAAGAGCACCACCAGCGATGCCAGAATACGCCAGCTGCGGCGGC
CAAACAGCGAAAGAAGACGTAGTAAAAAGAAGGTCACCAGTACGGTGGCGGCCAGTTCAA
CAACAGCAGAAATGCCTTTCCAGACGGTAAAATCGTGCGCATAGCTGCCGAAGCGGCGGT
AAAAAACCGCGCCATTCATAAAAAGGCCAATATAGATTGCAAGCAAAAAGCTCAGCTTCT
GCTGTGTAATCGATTTGATGTATCTCATGCAAACAAACCCTGGACAAACAGGTGATAACA
CCCTGCTTAGTGGCTTTTCAGGCCCGGCAGGGAAAAAGTGCGGAGGTAGTCAGATAAGTA
AAATCTACACGCGCGAATAAGTAGACCACAGCAAAGGGAAAAAGTGTGGGGAAAGAGTGT
GCATGAAGCACAAATTTACAAAAATGCAAGTTTGAAAAGAGACTTTAGCGTTACAAAAAG
CAGTAAAAAGGGCCAGTTAATTGGCCCAAATTTTACGAGTCATTGTTTATACATTTCGTT
GATGCGTTTGATGCACACGGAAGCTGAAGCCCAGTAGCTCGCGGCTGAGCATTAAAGGGA
GCCATGCGCCTCACGCAACATTTTCTGCTCTGGCTGACGAATCGTCGTAGAAAGCGCCAA
TGACAGAATCAGCAGGGCGAAAATCACGTAGAAGGTCACATAGAAGCCGCCAAACAGTGA
GGCGATAATCGAACCACAAATGCTACCGATACCGAAACCGAGATAAATCACACCGTAGTT
TTTCGCCAGGTTATTGAGGCCAAAGAACTCACTGACCAGTGACGGAAAGACGGTAATAGT
GCCGCCAAAGTTAAATGCCACGCAGGCAATCGCTGCAAAGAACGTCACTGCATTCAATGG
TGCAAACAGCAGGGCCGCCATACCCACCAGCGATATCACCTGACCAATGGTAATAACACG
GATACGGGCGATTTTGTCAGACAGAATACCCAGCACCAGACGACCTGAAAGGTTGGCGAT
GGAAATAACAGTGACTGCATTGGCTGCGGAAACCACATCAAGGTGTGCCAGACTTTGGGC
GATATCTTTCGCTACCCCAATCACGTACAGGCCGCTCATGCAGGCGGTCAGGAACATTAC
CGCTAACATCCAGTACTGCGGTTTACGCATCGACTCTGCCAGCGTGTAATCTTTCTCCAC
CACACCATTGCTGGTTTTCACTTCCTGTTTTGGTGCGTCTTTCATTAACGTTGCGCCGAA
AACAATCATCAACAGCGCAATCGCTCCCCAAATCACAAAGGTTTTTTCCAGACCGACCGT
TTCCAGCAGCTGCGTGTCGATAAATTTGAAACCCAGGCTACCCAGACCATAAGAACCGAT
AGCGAACGCGGAGATCAGACCTTTACGCTCCGGGAACCACTTCACACAGTTAGAGAGCGT
CAGCAGATAACCCGCGCCATCTGCCAGTCCCACCAGCACACCGGCGCTTAACCACAGCAT
CATCAGGTTGTCAGAATGCGCTGTCAGGAAGAAGCCTAATCCCAGCAAAATGCCGGAAGC
CATGGTGACGCGTTTAACGCCAAAACGTTCCTGTAATTTGCCCGCAACAGAAGACGAAAT
TGCCAGCCCCAGACTTAACAAGCCGAAAGAGAAAGCGACCTGGCTTACCGGCGCATCCAG
CTTGGCGGAAAGCGCGCCATTAAACAGGCTCCAGGTATAAACCGACCCCAGCGCAAACTG
GGTAATGATAGTACCGATGAGTGTCAGCCAGCGGGTACGCTGATAATTTGAAGGTGTCAT
GGCAGTATTCCTGCAGTAATAAAAAGGAAAAATCTCTGCCGACAACCATAACGAAGTGCA
CTTTATGCCTGGGGAAAAACGGCATGAAATGCCATCAGAACGGAATGAAATGCCTTAGTT
CAGGAATGAATGACGCGACAATTATTCACCAAATTTATTATTTGGTAAGTTAGCACCCAC
TATCGCCACAACTATTGTTATTTAATGGTTTCAATTGTGACTGTTACGTTAAAATCTGGC
GCTAACCCCCATCGTATACAGATAGTCGCTATTATTAGTGGTATTTTCTGCCTGAGTTAG
CGCGGCATAGGCGGCAATATTTTGATTGAGCAACATATCAGCGCCTACGGTGACATCCAG
CCAGTTGCCGTTCTGGTTTGTCGCCGTCATCCGGCTCAGGCCTGATTGCGCCTTCCAGAT
ATTCTCGCCAAATTGCTGGTTATAGCTGATTTGCGCCCAGGGTCGGAGATCGCCAAGCCG
GGAGTCAACACGCCAGCCTAAGGTACTCACGCTGGCATGCCATAACGGATCGGTCAGCGT
GGTAGTACTGTCGCCAAACTCGTTATACATCGAGGTGGTTGTGCCATCGTAATGTAATGC
CGCGACCGGGCCGGTTGTAACCTGTTCATATAAAGGAAAATTCCAGCCCATACTCATACT
GCTGGTCACATCCACAGGGGTTTCTTCCGCCAGATTGACTTCCAGTCCCAGCGCCCTTTG
GCTACTTTGAATACGTTGCGACAAAATATCGTTGTAATCAGGTTGATGATCACTATCCCA
GGTGTAACGCTCTGTGGAAAGTCCGGGTTGCGTATCAACGATATATTCTTGTTGCCAGGC
GTAAGCTGTGTTGAGAAAAAAGGCACTGATTACCACGCTCGCCAGCAGGCTTAGCTGCCA
GCGACCACCGCTTTTTTTTATGATCATTAACACGACTCCAGGGAAGAGCCGAATTCGGCA
ATATTATTGTCATTGTATGAAGGATATCGGGCATAGTAGCCCTGTATTAAATATTGACTT
TTTCACCGATGCGTCAAGAAAAGCGGCTGAAATTTTTACGATCGGGTACATAGCGAGGGA
AAGTATGGAACGTTGCGGCTGGGTGAGTCAGGACCCGCTTTATATTGCCTACCATGATAA
TGAGTGGGGCGTGCCTGAAACTGACAGTAAAAAACTGTTCGAAATGATCTGCCTTGAAGG
GCAGCAGGCTGGATTATCGTGGATCACCGTCCTCAAAAAACGCGAAAACTATCGCGCCTG
CTTTCATCAGTTCGATCCGGTGAAGGTCGCAGCAATGCAGGAAGAGGATGTCGAAAGACT
GGTACAGGACGCCGGGATTATCCGCCATCGAGGGAAAATTCAGGCAATTATTGGTAATGC
GCGGGCGTACCTGCAAATGGAACAGAACGGCGAACCGTTTGTCGACTTTGTCTGGTCGTT
TGTAAATCATCAGCCACAGGTGACACAAGCCACAACGTTGAGCGAAATTCCCACATCTAC
GTCCGCCTCCGACGCCCTATCTAAGGCACTGAAAAAACGTGGTTTTAAGTTTGTCGGCAC
CACAATCTGTTACTCCTTTATGCAGGCATGTGGGCTGGTGAATGATCATGTGGTTGGCTG
CTGTTGCTATCCGGGAAATAAACCATGATTCGGGAAGCGCAACGTTCAGAACTCCCCGCG
ATCCTCGAACTGTGGCTGGAAAGTACAACCTGGGGGCATCCCTTTATAAAAGCGAATTAC
TGGCGTGACTGCATTCCGCTGGTGCGGGATGCCTATCTTGCCAACGCGCAAAACTGGGTC
TGGGAAGAAGACGGTAAGCTTCTCGGTTTTGTCAGCATTATGGAAGGCCGATTTCTGGCA
GCGATGTTTGTCGCACCGAAGGCCGTCAGGCGCGGTATTGGTAAGGCGCTGATGCAGTAT
GTGCAGCAGCGCCATCCCCACCTGATGCTGGAGGTTTATCAAAAAAATCAACCGGCGATA
AATTTTTACCAGGCACAGGGTTTTCACATTGTCGATTGCGCATGGCAGGATGAAACCCAA
CTACCCACATGGATTATGAGCTGGCCGGTGGTTCAAACGCTGTAAGTGTCAGTTCCGGAC
CGTTGTATTTTTCCAGCCATGCCAGCGCCGTATTACCCGCACAGCCATTCCCCAGCCGCG
AGCTGGGGAGATCTTTGGTCAGCACGTTCACTGCGCCGTTTTTACAAATACCGTCAGCGG
TTAAATCCAGATCCGGCCATGCCCCTTCGTGAATGCAAATCACGCCAGGTTTAATTCCCT
CGCTAATGACCGCTCCGGCAAGAATTTGCCCGCGTGCGTTCCACAACCGAACAGTATCGC
CATCTTGTATGCCGCGCTCCTGGGCATCGTCAGGATGAATGGTGACAGGCTCACGATTTG
CCACCGCGTACAATTCGCGCAGAGAACTGTAATTCAGCTGGCTGTGCAGGCGGTGCGCCG
GATGGGCAGAAAGTACCTGCAACTGTTCTGGTTCGGCATTGCCCTGCCATTCGTCCGGCT
CCAGCCACATTGGATGCCCAGGGCAATCCGGGTAACCGTAATCGGCAATACGCTGTGAGA
AGATTTCAATCTTGCCGCTGGCGGTTTTTAACGGATGCGCCAGCGGATCGCGGCAAAAAT
CAGCGAAGCGAATAAACCGCTCGCTGTCCGGGTTTTCCGGCATCTCAATTAACTGGTTGG
CTTGCCAGAACTCAGCAAATGGCGGCAATTCAACCTGCTGGCTTGCCCCGCGCTGTCGGG
CAACGTTATAAAACGTTTCCAGCCATTGCAGCTCACTTTTTCCTTCCGTAAAACGTGCAT
AACCGCCCTTCTCCCAGCGTTCACTTAACTCGGCAAAAACATCAAAATCATTACGCGCTT
CATAGCGTGGCGGCACCACTTGCTTCATCGGCACCAGATGCTGATTACTGTAATCACCGG
TCATGGTGAGATCATTACGCTCAAAAGAGGTAGTCGCAGGCAGAACGATATCCGCGTGTT
TTGCCGCCGCCGTCCAGAAGCATTCAGAGATCACCACCAGCTCCGGTTTTTGCCAGGCAC
GGATCAGGCGATTGGTATCCTGATGATGAGTAAAGTTGGCACCGCCCGCCCACCAGATAA
AACGAATATCCGGGAAATGTCGGTTCATACCGTTGTGTTGATATGCGCCACCAGGGTTTT
CCAGTGCTTCAACAATGCGGGCAACAGGGATTTTATCCACCGCATCGCAGCCACCCGGCA
AGCTGCCCTGCATGGAAGAGAGCACCGCAGAACGCCGCGTGGGGTTACCACCATTGGCAA
AATGGTAAGAAAGACCAAAACCGCCGCCGGGTGTGCCGATTTGCCCCAACATTGCTGCCA
GCGTGACGATCATCCAGTGTTTTTGCTCACCAAACTGTTGGCGCTGCATTCCCCAGCCTG
CCATCAGCATGGTGGTATTTTGGTGGAAAATAGCCGCCAGCTCGCGGATTTTCGCTGCGC
CAACACCACAAATCTCTGCTGCCCATTCGGCGGTTTTCGCTATTCCGTCACTCTCGCCCA
GCAAATAAGAGGCGAAGACGGCATAACCTGTGGTGCAACGCGCCAGAAACGCTTCGTCGT
GCCAACCATTTTCCACCAGCGTATGGGCGATCCCCAGCATCAGCGCAACATCGGTGCCCA
TGTGCGGTGCCACCCACTCCATTTTATCGCCAAAGAAATCGACGGTTTCCGATCGCATTG
GATCAATGCAGATCAGCTTTTTCCCGCTGTCACGCAGTGCAGAAAAGTAAGAAAGCCCCT
GCTCATCGGATGCATTCCACGCAATTTTCAGCGTATTGAGTGGGTTAGCACTCCACAGCA
CCACGACATCGCTATGTTCCAGCACCAGCGGCCAACTGGTCTGCTGTTGATAAACTTCAC
TACCACCCACGACATACGGCATGATCGCCTGTGCCGCGCCGGTCGAATAATCCCCCAGAT
GCCCGGTATAACCGCCTGCCAGCGCCATATAGCGTTGTAATAATGTCGAGGCCTTATGCA
GCACGCCGTTTGAACGCCAGCCGTAGGAACCAGCAAAAATCGATGCCGGACCATAAGCCT
CACGAATGCGTTTATGTTGTTGGTGAATAAGATCCAGCGCCTCATCCCAACTCACGCGAA
CAAATTCATCCTGCCCACGAATGCCTTGCGGGTTTTCCGGTGACGCAAGAAAGCCTTTTC
GCACCATTGGAAATCGTACCCGCGTATTGCTGTGAACCTGGTCGCGAACCGCGCTCTGCA
AGGAGTTTTCCATTCCTGTGGCTAACGCGCCACGCGAGCTAAACACGGTTTCGCCGTCGG
TTTCAACCAGCATGGGCCCCCAATGGGCGGCAGTCAGAACGGAATATCGTGAGGATGAGT
TGGCCAAACCGAAGACTCCTGAAAGGTTAGATGTATTGAGCAGTTAAATATTACTTACAA
ATTTCCGAGTATTCCCAGGAATAATCTTCATGTTCACGCGGCATAATCTCCCGCCACGGA
ACCCGTGGCAAAGAATAAAAAGGTTATTAAGGATTAACAATGAAGAAACGTGTTTATCTT
ATTGCCGCCGTAGTGAGTGGCGCTCTGGCGGTATCTGGCTGCACAACTAACCCTTACACC
GGCGAACGCGAAGCAGGTAAATCTGCTATCGGCGCAGGTCTGGGCTCTCTCGTGGGCGCG
GGTATTGGTGCGCTCTCTTCTTCGAAGAAAGATCGCGGTAAAGGCGCGCTGATTGGCGCA
GCAGCAGGCGCAGCTCTGGGCGGCGGCGTTGGTTATTACATGGATGTGCAGGAAGCGAAG
CTGCGCGACAAAATGCGCGGCACTGGTGTTAGCGTAACCCGCAGCGGGGATAACATTATC
CTCAATATGCCGAACAATGTGACCTTCGACAGCAGCAGCGCGACCCTGAAACCGGCGGGC
GCTAACACCCTGACCGGCGTGGCAATGGTACTGAAAGAGTATCCGAAAACGGCGGTTAAC
GTGATTGGTTATACCGACAGCACGGGTGGTCACGACCTGAACATGCGTCTCTCCCAGCAA
CGTGCGGATTCCGTTGCCAGCGCGTTGATCACCCAGGGCGTGGACGCCAGCCGCATCCGT
ACTCAGGGCCTTGGCCCGGCTAACCCAATCGCCAGCAACAGCACCGCAGAAGGTAAGGCG
CAAAACCGCCGTGTAGAAATTACCTTAAGCCCGCTGTAATCCCTTTCATGCCAGGTGATG
CAGAAATCACCTGGCATTCTTCAGTTTTCCTTCATCATATTTCAGGCTAAGGTGATCGCC
TTATCAGTGAATGGAGAGAAGCATGAAGCCGTCCGTTATCCTCTACAAAGCCTTACCTGA
TGATTTACTGCAACGCCTGCAAGAGCATTTCACCGTTCACCAGGTGGCAAACCTCAGCCC
ACAAACCGTCGAACAAAATGCAGCAATTTTTGCCGAAGCTGAAGGTTTACTGGGTTCAAA
CGAGAATGTAAATGCCGCATTGCTGGAAAAAATGCCGAAACTGCGTGCCACATCAACGAT
CTCCGTCGGCTATGACAATTTTGATGTCGATGCGCTTACCGCCCGAAAAATTCTGCTGAT
GCACACGCCAACCGTATTAACAGAAACCGTCGCCGATACGCTGATGGCGCTGGTGTTGTC
TACCGCTCGTCGGGTTGTGGAGGTAGCAGAACGGGTAAAAGCAGGCGAATGGACCGCGAG
CATAGGCCCGGACTGGTACGGCACTGACGTTCACCATAAAACACTGGGCATTGTCGGGAT
GGGACGGATCGGCATGGCGCTGGCACAACGTGCGCACTTTGGCTTCAACATGCCCATCCT
CTATAACGCGCGCCGCCACCATAAAGAAGCAGAAGAACGCTTCAACGCCCGCTACTGCGA
TTTGGATACTCTGTTACAAGAGTCAGATTTCGTTTGCCTGATCCTGCCGTTAACTGATGA
GACGCATCATCTGTTTGGCGCAGAACAATTCGCCAAAATGAAATCCTCCGCCATTTTCAT
TAATGCCGGACGTGGCCCGGTGGTTGACGAAAATGCACTGATCGCAGCATTGCAGAAAGG
CGAAATTCACGCTGCCGGGCTGGATGTCTTCGAACAAGAGCCACTGTCCGTAGATTCGCC
GTTGCTCTCAATGGCCAACGTCGTCGCAGTACCGCATATTGGATCTGCCACCCATGAGAC
GCGTTATGGCATGGCCGCCTGTGCCGTGGATAATTTGATTGATGCGTTACAAGGAAAGGT
TGAGAAGAACTGTGTGAATCCGCACGTCGCGGACTAAGCCGCGACTGCGTAGAGTAAAGC
CCGATA