MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 21.seq
 Deletion 21
 Length 42636
 Fasta Format

>21
ATACGCAGTAGCCTGACGACGCACCGCATCACGGTCGCCGCTGAAGCATTCCCGCCGGGT
AATGCCTTCACCGCGGGCAGTGGCAAAAGCAAACCAGACGGTGCCGACAGGCTTCTCTTC
ACTGCCGCCATCCGGCCCGGCGATACCACTAATAGACACGGCATAATCAGCACGAGCCGC
TTTCAGTGCGCCTATCGCCATTTCCACCACGACGGGTTCACTCACCGCGCCATGCTGCGC
CAGCGTCTCTTCGCGTACGCCGATCATCTGCGCTTTGGCTTCGTTACTGTAGGTGACAAA
TCCGCGTTCAAACCAGGCGGAGCTACCGGCAATATCGGTAATCACTTTCGCTACCCAACC
ACCGGTACAAGACTCGGCAGTTGTTACGGTTGCGCCACGGGCTTTCAGCGCCTGCCCAAC
CTGTTCACTTAACTGCATCAGTTCACTGTCAGTCATCACAACCTCTGTCAGTCAAAAATT
TATGCCGGACAAGATAGCACTTTCGTCAGGAAGATGGTGTTGGCGTTGCAATTTTACGAG
GAGGATTCAGAAAAAAGCTGATTAGCCAGAGGGAAGCTCACGCCCCCCTCTTGTAAATAG
CTACTGTACTCGCGCCAGCGCCACGGCTTGTCCTAACTGCCAGACCGCCATTGCGTAATG
GGTGCTGTGGTTGTAACGGGTGATGGTGTAGAAGTTCGGCAGACCGTACCAGTACTGGTA
GCCGGTGCCAACATCCAGACGCAGCAGGCTGGCTTGTTGATGGTTGCCCAGCGGCTGCTG
TGGCGTTAAACCTGCGGCGGCAAGCTGCGAAATGCTGTACTTAGTTTTGAAGCCATTTGG
CAAGCCTGGAGCCTGACCGTTTGCCATTACCGCGACCTGATCGCCTTTCACCCAGCCGTG
CGCTTTGAAATAGTTCGCCACGCTACCGATCGCATCAACCGGATCCCACAGGTTGATATG
CCCGTCGCCGCTGAAATCTACCGCATATTGTTTGTAAGACGACGGCATAAACTGTCCGTA
GCCCATCGCCCCGGCAAAGGAACCTTTCAGATTGAGCGGATCGTCCTGCTCGTCGCGCGC
CATCAACAGGAAGGTTTCCAGCTCGCCAGAGAAATACTCCGCGCGGCGTGGGTAGTTAAA
TGACAGCGTTGCCAGCGCATCGAGGATGCGAGTTTTCCCCATCACGCGCCCCCAGCGGGT
TTCAACGCCGATAATCCCGACGATAATTTCCGGCGGTACTCCATACACCTGCCACGCGCG
ATTCAACGCATCTTCATACTGATTCCAGAAAACCACACCGTTCTGCACGTTGTCCGGCGT
AATAAATTTTTTGCGATAACGGAGCCATGCGCCGTTCGGACCTGATGGCGGTTTCACCGA
TGTGGTTGGTGCCTGGTTATCCATCAGCCGCAGTACCGAATCCAGACGCTTCGCCTGGGA
GAGAATTTCCTGCAACTGCTGACGATCGAAACCGTGTTTGTTCACCATTTTGTCGATGAA
CTGCTGGGCATTCGGGTTATTAGCGAAATCGCCGCCCATCTGCATCACATTGTGCTGCGG
CTCAAGCAGGAAGCCGCCAGACGGCGTTCCGGTGGTCGTATCAGTCTCAGTAGGTTTTGG
CTTGCTGCTACAGGCGGCAAGCAACACAAAAAGGGGAAGCAATGTTACATAACGACGCTT
GAACATGAGGGGTCCATTTAACAGATTCAACCAGGGGCAAGTATGGTAAAGCATCACGCC
CCGCACAAGGAAGCGGTAGTCACTGCCCGATACGGACTTTACATAACTCAACTCATTCCC
CTCGCTATCCTTTTATTCAAACTTTCAAATTAAAATATTTATCTTTCATTTTGCGATCAA
AATAACACTTTTAAATCTTTCAATCTGATTAGATTAGGTTGCCGTTTGGTAATAAAACAA
TAAATCCTGAAGGAGAGAACAATGATAGAAACCATTACTCATGGTGCAGAGTGGTTTATC
GGGCTGTTCCAAAAGGGCGGAGAGGTGTTTACCGGGATGGTGACCGGCATTCTTCCGCTG
TTGATTAGCCTGCTGGTTATCATGAACGCACTGATTAATTTTATCGGTCAGCATCGTATT
GAACGTTTTGCTCAACGTTGCGCCGGTAACCCTGTTTCCCGTTACCTACTGTTACCGTGC
ATTGGCACGTTTGTCTTTTGCAATCCGATGACCCTAAGCCTGGGTCGCTTTATGCCGGAA
AAGTACAAACCCAGCTACTACGCGGCGGCCTCTTATAGCTGCCACTCAATGAATGGCCTC
TTCCCCCATATCAACCCTGGCGAACTGTTTGTTTATCTTGGCATTGCCAGCGGTCTGACA
ACGCTGAACCTGCCACTTGGCCCACTGGCGGTGAGTTATCTGCTGGTTGGTCTGGTCACC
AATTTCTTCCGCGGCTGGGTGACCGATCTGACCACCGCCATTTTTGAGAAAAAGATGGGC
ATTCAACTTGAACAAAAAGTTCACCTGGCAGGAGCAACATCATGACGCATATTCGGATCG
AAAAAGGAACGGGTGGCTGGGGCGGCCCGCTTGAGCTGAAAGCCACGCCGGGAAAAAAAA
TCGTCTATATCACCGCCGGTACCCGGCCTGCGATTGTTGACAAACTGGCACAGCTTACTG
GCTGGCAGGCTATTGACGGATTTAAAGAAGGTGAACCCGCGGAGGCGGAAATTGGTGTCG
CGGTAATCGACTGTGGCGGCACATTACGCTGCGGCATCTATCCGAAACGACGTATTCCCA
CCATTAATATCCACTCGACGGGCAAGTCCGGTCCGCTGGCGCAGTACATTGTGGAAGATA
TTTATGTCTCTGGCGTAAAAGAAGAAAACATCACTGTAGTAGGTGATGCGACACCACAAC
CCTCTTCCGTGGGCCGTGACTATGACACCAGTAAGAAAATCACCGAACAAAGCGATGGTT
TACTGGCGAAGGTGGGAATGGGCATGGGGTCCACCGTTGCGGTGCTGTTTCAATCTGGTC
GTGACACCATCGACACTGTATTAAAAACCATTCTGCCGTTTATGGCATTCGTCTCGGCGC
TCATTGGCATCATTATGGCTTCTGGCCTTGGTGACTGGATTGCCCACGGTCTTGCTCCGC
TGGCGAGCCATCCACTGGGTCTGGTCATGCTGGCGCTCATCTGTTCCTTCCCACTGCTTT
CACCTTTCCTCGGCCCAGGCGCAGTTATCGCACAGGTTATCGGCGTATTGATTGGCGTGC
AGATTGGTCTCGGCAATATTCCGCCGCATCTGGCTTTACCGGCACTGTTTGCCATCAACG
CGCAGGCGGCCTGCGACTTCATCCCGGTCGGTTTGTCGCTGGCGGAAGCCCGTCAGGACA
CGGTTCGCGTCGGTGTCCCTTCTGTACTGGTGAGCCGCTTTTTAACCGGCGCGCCGACTG
TACTGATCGCCTGGTTTGTCTCCGGTTTTATCTATCAATAGAGGCTGAAACATGACCGTT
ATTTATCAGACCACCATCACCCGTATCGGCGCGAGTGCCATTGACGCCCTCAGTGACCAG
ATGCTCATCACCTTTCGTGAAGGCGCGCCTGCGGACCTCGAAGAGTATTGCTTCATTCAT
TGCCACGGCGAGTTGAAAGGTGCACTCCATCCCGGTTTGCAATTTTCACTCGGGCAGCAT
CGCTATCCGGTGACCGCTGTTGGCAGCGTGGCGGAAGACAACCTTCGCGAACTGGGTCAT
GTCACCCTGCGCTTCGATGGTTTAAACGAAGCGGAATTTCCGGGCACTGTCCATGTGGCA
GGCCCTGTCCCCGACGATATCGCGCCGGGATCGGTTTTGAAGTTTGAATCTGTTAAGGAG
TAAAAAATGAATCAGGTTGCCGTTGTCATCGGTGGTGGGCAAACCTTAGGCGCGTTCCTG
TGCCACGGTCTGGCTGCCGAGGGGTATCGCGTCGCGGTTGTCGATATTCAGAGCGACAAA
GCCGCAAATGTGGCACAAGAAATTAACGCCGAATATGGTGAAAGTATGGCGTACGGTTTT
GGTGCTGACGCCACTAGCGAGCAAAGCGTTCTGGCGCTCTCTCGTGGGGTAGATGAAATC
TTTGGTCGCGTGGATTTGCTGGTCTACAGCGCCGGAATAGCAAAAGCAGCCTTTATCAGC
GACTTCCAGCTCGGCGATTTTGACCGTTCGCTACAGGTGAATCTGGTGGGTTATTTCCTG
TGTGCGCGTGAATTTTCGCGTTTGATGATCCGCGACGGGATTCAGGGGCGCATTATTCAG
ATCAACTCGAAATCCGGCAAAGTGGGCAGCAAACACAACTCTGGCTACAGCGCAGCGAAA
TTTGGTGGCGTCGGGCTGACTCAATCACTGGCGCTGGATCTGGCGGAGTACGGCATTACG
GTGCATTCACTGATGCTCGGTAACCTGCTGAAATCGCCGATGTTCCAGTCACTGTTGCCA
CAATACGCGACCAAGCTGGGTATCAAACCGGATCAAGTCGAGCAGTATTACATCGACAAA
GTACCGCTCAAACGCGGCTGCGATTATCAAGATGTGCTGAATATGCTGCTGTTCTACGCC
AGTCCTAAGGCGTCGTACTGCACCGGACAGTCGATCAATGTCACCGGCGGTCAGGTGATG
TTCTGATCAACAGCGGAGATCCATTAAGGATCTCCGTGAGACTATAGAATGCCTGATGCG
CTACGCTCATCAGGCATACAGGACTTCCGCCACTACATTAAGGAAAAGTTATGGTATCCG
CACTCATCACCGTCGCCGTTATCGCCTGGTGTGCGCAACTGGCCTTAGGCGGCTGGCAAA
TTTCTCGTTTTAACCGTGCCTTCGACACACTATGCCAGCAAGGGCGGGTTGGCGTGGGCC
GTTCCAGCGGGCGCTTTAAACCGCGGGTCGTGGTCGCCATCGCGCTGGACGATCAGCAGC
GCATCGTCGACACCTTGTTTATGAAAGGACTGACCGTCTTCGCCCGACCGCAAAAAATTC
CCGCAATTACCGGTATGCATGCGGGTGATTTACAGCCCGATGTGATCTTTCCCCATGATC
CACTATCACAGAATGCTCTATCATTGGCGCTTAAACTGAAACGTGGATAATTTCGTTGTG
AATGTTACTTGCTTGCGAAGTTATCATTTTGAAACCTAAATCAGGTAATCACGCCCATGA
AACCTCGTCAGCGTCAGGCCGCCATTCTGGAGTATCTGCAAAAGCAGGGTAAATGCTCGG
TTGAAGAATTGGCGCAATACTTTGACACCACAGGCACAACCATTCGCAAAGATCTGGTCA
TTCTGGAACATGCCGGAACCGTCATTCGTACTTATGGCGGAGTGGTGTTGAATAAAGAGG
AATCCGATCCGCCTATCGATCATAAAACACTCATCAACACCCACAAGAAAGAGCTGATTG
CAGAAGCTGCCGTTAGTTTTATCCATGATGGCGATTCGATCATTCTTGATGCTGGCAGTA
CCGTTTTGCAGATGGTTCCCCTGCTCTCGCGCTTTAATAACATCACGGTGATGACCAACA
GCCTGCATATCGTCAATGCGCTATCCGAACTGGATAACGAACAAACTATCCTGATGCCAG
GCGGAACGTTTCGCAAAAAATCGGCCTCATTTCACGGGCAACTGGCAGAGAATGCCTTCG
AGCATTTCACCTTCGATAAATTGTTTATGGGCACCGACGGCATCGATCTCAATGCGGGCG
TAACCACCTTTAACGAGGTTTATACCGTCAGTAAGGCAATGTGCAATGCCGCGCGCGAAG
TGATTTTGATGGCGGACTCATCAAAGTTTGGCCGTAAAAGCCCCAACGTAGTTTGCAGTC
TTGAAAGCGTCGATAAGCTGATTACCGACGCAGGTATCGATCCGGCGTTTCGTCAGGCGC
TGGAAGAGAAAGGGATCGATGTGATCATAACCGGAGAGAGCAATGAGTGAAGCACTACTG
AACGCGGGACGTCAGACGTTAATGCTGGAGTTGCAGGAAGCAAGCCGTTTACCGGAACGT
CTGGGCGATGATTTTGTTCGCGCCGCCAATATCATCCTGCACTGTGAAGGCAAAGTGGTG
GTTTCGGGAATTGGCAAATCGGGCCACATTGGTAAGAAAATCGCCGCAACGCTTGCCAGT
ACCGGCACTCCGGCTTTTTTTGTCCATCCGGCAGAAGCGCTGCACGGCGATCTGGGGATG
ATCGAAAGCCGCGATGTGATGCTGTTTATCTCTTACTCCGGTGGCGCGAAGGAACTGGAT
CTGATTATTCCGCGTCTGGAAGATAAATCTATCGCGCTGCTGGCGATGACCGGCAAACCG
ACGTCACCGCTGGGCCTGGCGGCAAAAGCGGTGCTGGATATCTCCGTAGAACGCGAAGCC
TGCCCGATGCACCTTGCGCCGACCTCCAGCACCGTCAATACCCTGATGATGGGTGACGCG
CTGGCGATGGCGGTCATGCAGGCGCGCGGATTTAATGAAGAAGATTTTGCCCGCTCCCAC
CCAGCCGGGGCACTGGGCGCTCGCTTGCTGAATAAAGTGCATCATCTGATGCGCCGTGAC
GATGCCATCCCACAGGTGGCGTTAACCGCCAGCGTGATGGATGCGATGCTGGAACTCAGC
CGCACCGGTCTGGGGCTGGTGGCGGTATGTGACGCTCAACAACAGGTACAAGGCGTCTTT
ACCGACGGCGATTTACGTCGCTGGCTGGTTGGCGGCGGCGCACTCACCACGCCAGTCAAT
GAAGCGATGACGGTCGGCGGCACCACGTTGCAATCGCAAAGTCGCGCCATCGACGCCAAA
GAGATCCTGATGAAGCGCAAAATCACTGCCGCACCGGTGGTGGATGAAAACGGCAAACTC
ACCGGCGCAATAAACCTGCAGGATTTCTATCAGGCCGGGATTATTTAATCCTTCAATCCC
AGACGTTTCGCCAGCCGATGCAGGTTGGCGACGTCGGTTTCCAGCATCCGCGCGCAGGCA
GCCCAGTTGTGATGATTTTGTGCCAGTGCCTGACGAATAGTTTCACGCTGGAACGCTTCT
GTCGCTTCACGCAGGTTTTGCTTAACAACGGGCACCGCCGCCACTTCTGGCGTCGGCAAC
GTCACCTCAGGAAAAGCAAAATGTTGCGCCTCAAGAATCACTTCATCGCCGCTGCGGGTG
GCTCTCGCCAGAACTACCGCCCGATGAATAGCATGTTCCAGTTCGCGCACGTTTCCCGGA
AAACTGTAGTGTTGCAGTAAATTTCGCGCTCCGGCACTTAATACCACGCGGGAGAGCCCC
TGCCGCAAACGACACTGCTCGCAGAAATACCCCGCCAGCAGAATGACATCATCGCCCCGC
TCACGCAGCGGCGGCACCGAAAGTGGAAACACGCTCAGGCGATGAAACAAATCGGCGCGG
AATCGCCCTGCCAGCACCTCTTCGCGTAAATCGCGGTTAGTCGCCGCCAGCACGCGCACA
TCGACCCGCAAACAACGGTCATCGCCAACGCGCTGAATATCGCCATACTGCAACACCCTC
AGCAGCTTGGCCTGCAATGCCAACGACAACTCGCCGATCTCATCCAGAAACAGCGTGCCG
TTATCCGCCATTTCAAACTTCCCGCTGCGATTACTGATAGCGCCAGTAAACGCTCCTTTC
ACATGCCCGAACAACTCACTTTCCGCCACACTTTCCGGCAGTGCAGCACAGTTGAGATAG
ACCAGCGGATTCACCGCCCGTGGCGAGGCTTCATGAATCGCTTTCGCCACCAGCTCCTTA
CCGGTTCCAGTCTCACCGCTGATCAGGACGTTGAGATCGGACGCCGCCACAATCTCAATC
TCTTTTTTCAGTTGCGTCATGCCAGGGGACAAGCCAATCATCTGCGTCTGTTTCACCGCT
TCAAACGGCGTGGCATCGCCTGGCAGCATATTCTGGCTTTCCAGTTGTTCAATCAGCAAC
GCATTGCTTAACGCTCCCGCCGCCAGCGCAGCAATCAGCCGTAGCTCTTCGTCGCTGAAA
ACATCGAACTGATCGGGCTGCATCCCGTCGAGCGTCAGTGCGCCGATCAGGTTTTGCCCG
GCAAACAATGGCAGACCAACGCAGGCGTGAACCTTCAGACTCTCCTGCCCAGGAATCAAA
CCGTCATAGGGATCGGGCAATTCGCTGTCTGCGGGAAAGCGCACCACATCCCCGGCGCGG
GCAATCGCTTCCAGCCGTGGATGCCCTTCCAGCGCAAAGCGTCTACCGAGTACATCCTTT
GCCAGACCGTCGATGGCAAGCGGAATAAACTGCCGCGAATCGTAACGTAGCAACGCAGAC
GCATCGCACTCCAGCACCTGACGTAGCGTGGTGATCAGGCGCTGAAAACGATCCTGGTGA
CCAATCCCACGCTGCAATTCGATGGCGATATTCGCCAGCACATCAACGGAAAAACTCATC
TTTGCCTCACTGTCAATTTGACTATAGATATTGTCATATCGACCATTTGATTGATAGTCA
TTTTGACTACTCATTAATGGGCATAATTTTATTTATAGAGTAAAAACAATCAGATAAAAA
ACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGG
TTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAG
TGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAGCAGCTACAATAGCTACC
TCATCCGCGAAGAAAAAAACGTGCTGATCGACACCGTCGACCATAAATTCAGCCGCGAAT
TTGTGCAGAACCTGCGTAATGAAATCGATCTGGCGGATATCGATTACATCGTGATTAACC
ATGCAGAAGAGGACCACGCTGGGGCGCTGACCGAACTGATGGCACAAATTCCCGATACGC
CGATCTACTGTACAGCCAACGCTATCGACTCGATAAATGGTCATCACCATCATCCGGAGT
GGAATTTTAATGTGGTGAAAACTGGCGACACGCTGGATATCGGCAACGGCAAACAGCTCA
TTTTTGTCGAAACACCAATGCTGCACTGGCCGGACAGCATGATGACTTACCTGACAGGCG
ACGCGGTGCTGTTCAGTAACGATGCTTTCGGTCAACACTACTGCGACGAGCATCTGTTCA
ACGATGAAGTGGATCAGACGGAGCTTTTCGAGCAGTGCCAGCGTTACTACGCCAATATCC
TGACGCCGTTCAGCCGCCTGGTAACACCGAAAATTACCGAGATCCTGGGCTTTAACTTAC
CAGTCGATATGATAGCCACTTCCCACGGCGTGGTATGGCGCGATAACCCGACGCAAATTG
TCGAGCTGTACCTGAAATGGGCGGCTGATTATCAGGAAGACAGAATCACCATTTTCTACG
ACACCATGTCGAATAACACCCGCATGATGGCTGACGCTATCGCCCAGGGGATTGCGGAAA
CCGACCCACGCGTGGCGGTGAAAATTTTCAACGTCGCCCGAAGCGATAAAAACGAAATCC
TGACTAATGTCTTCCGCTCAAAAGGCGTGCTGGTCGGCACTTCGACGATGAATAACGTGA
TGATGCCGAAAATCGCCGGGCTGGTGGAGGAGATGACTGGTTTACGCTTCCGTAACAAAC
GCGCCAGTGCTTTCGGCTCTCACGGCTGGAGCGGCGGTGCGGTGGATCGTCTTTCCACGC
GCCTGCAGGATGCGGGTTTCGAAATGTCGCTTAGCCTGAAAGCGAAATGGCGACCAGACC
AGGACGCTCTGAAGTTATGCCGTGAACACGGTCGCGAAATCGCCCGTCAGTGGGCGCTCG
CGCCGCTGCCGCAGAGCACGGTGAATACGGTAGTTAAAGAAGAAACCTCTGCCACCACGA
CGGCTGACCTCGGCCCACGGATGCAGTGCAGCGTCTGCCAGTGGATTTACGATCCGGCAA
AAGGCGAGCCAATGCAGGACGTTGCGCCAGGAACGCCGTGGAGTGAAGTCCCGGATAACT
TCCTCTGCCCGGAATGCTCCCTCGGCAAAGACGTCTTTGAAGAACTGGCATCGGAGGCAA
AATGAGTAACGGCATTGTGATCATCGGTTCGGGCTTCGCCGCCCGCCAACTGGTGAAAAA
TATTCGCAAACAGGACGCCACTATTCCATTAACCCTGATTGCCGCCGACAGCATGGATGA
GTACAACAAACCTGACCTCAGCCATGTTATCAGTCAGGGGCAACGTGCCGATGACCTTAC
CCGCCAGACGGCGGGTGAATTTGCCGAGCAGTTTAATCTGCACCTGTTTCCACAAACCTG
GGTGACGGATATCGATGCCGAAGCCCGTGTGGTGAAAAGCCAGAATAATCAGTGGCAATA
CGACAAGCTAGTACTGGCAACCGGTGCCAGTGCCTTTGTCCCGCCTGTGCCTGGGCGTGA
GTTAATGCTGACGTTAAATAGTCAGCAAGAGTATCGCGCCTGTGAAACGCAACTGCGGGA
TGCCCGACGCGTGTTGATTGTTGGCGGTGGTTTGATTGGTAGCGAACTGGCGATGGATTT
TTGTCGTGCAGGCAAAGCGGTCACGCTAATCGACAACGCTGCCAGTATTCTGGCGTCGTT
AATGCCACCGGAAGTAAGCAGCCGCTTGCAGCATCGGTTGACGGAGATGGGCGTTCATCT
GCTGTTGAAATCTCAGTTACAGGGGCTGGAAAAAACGGATTCTGGCATTCAGGCAACGCT
GGACCGCCAGCGCAATATCGAAGTGGATGCGGTAATTGCCGCCACCGGACTGCGCCCGGA
AACCGCCCTGGCACGACGCGCCGGGCTGACGATTAATCGCGGCGTTTGCGTCGATAGTTA
TCTGCAAACCAGTAATACCGATATTTACGCGCTGGGCGATTGCGCGGAAATTAACGGTCA
GGTATTGCCGTTCCTCCAGCCGATTCAACTTAGCGCGATGGTGCTGGCAAAAAATCTTCT
CGGCAATAACACGCCGCTGAAACTCCCGGCGATGCTGGTGAAAATCAAAACGCCGGAATT
ACCGCTGCATCTGGCAGGCGAAACCCAGCGTCAGGATTTACGCTGGCAAATTAATACCGA
ACGCCAGGGAATGGTGGCGCGCGGCGTTGACGATGCTGACCAGCTTCGCGCCTTTGTGGT
CAGTGAGGATCGGATGAAAGAGGCATTTGGATTGTTGAAAACATTGCCGATGTAGGTGGG
CTACTGTGCCTAAAATGTCGGATGCGACGCTGGCGCGTCTTATCCGACCTACGGGGACGC
ATGTGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCAATGGTGTCCAAATGCAACACG
TTTTATCCGTTCTGGACTTCACCCGCTAACCAACGCGCCGCAGCAATAACCCCCTGCCCC
AGAGACAAACCGCCATCACCCGCCGGTAAACTCTGTGGAAAGAGCAATGTGAAATCAGCG
AGATAATGCGCCAGACGTGCACGCAGCAAACGGTTATGAATAACCCCGCCGCTAAATACC
AGCGTAGTGATACCACGCATCGTGGCCTGCTCACGCATCAACGCGGCAAAACCCTGCGCC
AGCGCATCATGAAACGCCCACGCGCGTTGATTAACCGGTGCCTGCCAGTTCAGCCACTGC
TGCCAGAAAGTGGCGAGATCCAGTTGATTGTCCACCCGCGGCATTGTCACCGGATGCGTC
ACTCCGTGGCATGAGGCTGCGAGCGCCTCCAGAGCACAAGCCGCTTCACCTTCATAACTT
AACGTGGCTGGCGCACAGCCCAGTGCCGCCGCCACTGCATCGAAAAAACGCCCACACGAT
GACGCCAGCGGCGCGTTAATTCCACGCTCAATGGCCCGCGCCAGCACGCTCCAGTTTTGC
TGTTGCACACTTGCTGTTTCAGAGTAATTCTGCCACTCCGGCACAAAGCGCAGGCACTGC
GCCAGCAGGTTTCGCCACGGCTGCTTCGCTGCCAAATCGCCACCCGGAAGCGCCACTGCA
GGCAAGCCGCCCAGGTGCTCACATTCGCGATAGTTCACCCGCAGGCACTCGCCGCCCCAC
AAAGCGCCGTTCTCCCCCATACCGATACCGTCGAGCGTCAAAGCAATGACATCACCGCCA
TCCAGCGGCCACTGATGCTCTGCCAGACACGCCGCTGCATGGGCATGATGATGCAGTACC
GTTTGCGTCGGCAGATTCATTTCACGCGCCCACTGGCTGGAGACATAGCCCGGATGCGCG
TCATGCACAACGTATTGCGGGGTAAAATCGTAGATGTTTTGCATCAGGCGTAACGCTTCG
CGCCACTGCATCTGGATGCCATCGTCACTTAAATCGCCCAGATGCTGACTCAACACCGCT
TGTTCACCGCGCACCAGGCAGAAGGTATTTTTCAGATCCGCGCCGAGACACAGCACAGGC
GGAACATTTTTAAAGCCCGGAGGCAAAGCCAGCGCATCCGGCACATACCCCCGCGAACGG
CGCAGCATTTCGCCGCTTTCGCGCACCACCGAATCATCCATCCGCTGCACGATGTCGCGG
TTATGTATCAAGAATCCGTCGGCAATGCCCTGCAAATCCGCCAGCGCCTGTTCGTTGCTG
ATAGCTGGTGGTTTACCGCTCAGGTTGCCGGAGGTCATCACCAGCGGGCATTGCAGTTCC
TGTAACAGCAAATGCTGGAGCGGGTTCGCAGGCAACATTACCCCGACTTCGTTAAGGTCA
GGGGCGATATCATCACAAAGCTCAGGAACGTATTTTTTATCCACCAGCACAATCGGCGCG
GCGGGCGTGGTAAGCAACTGGCGCGCAGCGTCTGGTAAACCGTCAGCCACTGGCAACATG
ACCGCCAGCGGTTTCGCCGGGCGATGTTTGCGCGCCCGAAGTGTCGCCACCGCGTTACTG
TTACGTGCATCGCAGGCAAGATGAAATCCGCCAATCCCTTTGATGGCGACAATTTTGCCC
ATTTTTAACTGTGCGATAGCTGCCTGTAATGCCGCCTCTTGTTCCGCATGTTCACCATGA
CTTACCCATTCAAGATGCGGGCCACACTCCGGGCAGGCCACCGGCTGGGCGTGGAAGCGA
CGATCGAGCGGGTCACGGTACTCTTTGTCACAGGCCGGACATAGCGGAAACGCCGCCATC
ACGGTAAACGGGCGGTCGTAAGGCATGGCGCGAATAATGGTGAAACGCGGGCCGCAGTGG
GTACAGTTGATAAACGGATAACGATAACGCCGTTCGCCTGGGGTATTCATTTCGGCAAGG
CAAGCAGGGCAAGTAGCGGCATCGGGAACAATTTGCGTATTCATGGTGCCGCCTGTGCTC
TGGCGTATAGTGAACTCGGTGGGCAGTTGTGACCAGATAAACGGCTCACGCTCGACGCTA
TCAATACGCGCCAGCGGCGGGCAGTGCTGATACAATTGAACAAGAAACGTTTCCGGGTCT
TCCCGCAGCCGGACTTCTACGCCATCGCCGTCATTACAGACATCGCCGTGAAGATTTAAT
TGCTGTGCCAGCTGCCAGACAAACGGACGAAAACCGACGCCCTGCACTTTGCCACGAATA
CGCAGTTGGACACCGCAAGATGTGTTTTTTGCCATTGAGTTATTCCCGCCATCATGAATT
GCGTAACCCGCCCTGCCGGACACGACAGCGTCGCATCCGGCAGTCACAGGTCGGCGATAC
CGCCCGCTCCGTATTCTACGAATATTTCCGGGAATTCCTTTGATGCCAGAACAGTTCTGT
AAGATTTTTAGAACATCAGCGCCGTACGGCGGCGTTTTTCTGCGCTCAGTTGTTCAAGTT
TATTACGATCGACACAAATCAGCGCATGAGTCGGGCAAGCCGCCATACACGCCGGGCCGT
CTTCACGATGGTTGCACAGGTCGCATTTATTGGCTTCGGCTTTGTCAGCCCGTACATTCA
GACCCGCGCCGCTGTTGCGGATCACCGGACGTACCACCACTTCCATCGCACCATACGGGC
AAGCCACAACGCAGGTTTTGCAACCAATGCAACGTTCCTGCATCACATGAACAAACCCTT
TATCACGGCTGATAGCACCATTCGGGCAGACGTTAGCGCACGGTGCATCTTCACACTGAC
GGCAAACTGTCGCCGTGGAAATGTTCACACCTTTAATGACATGGATACGCGGTAAAAAAG
TTTCCGGGGTCAGCGATGCACAGTCCTGATTTTCCTGATGAGAAACCACGCACGCTACTT
CACAGGTACGGCAACCAATACATTTACTCGCGTCAGCAATGATGAAACGGTTCATCAAAT
TCTCCAGCAATGACAGTTAATGCGCCGATACATTCACAAATCATGCCAGTTTTTAATTTA
CTGTTATTTAAGGAAATTAATTTCTGTAATGCAGGAAAAACGATGTCATCGACACTAGTG
ACGATGACATGTGATGACAATGTTTATCGCGAAGGAGCAATGAGTGAGTCGCGGCGGATC
AGTTTTCCGCTGAAGGTTTTCGGCGGTGAGAAATCCCCGCCATCGAGCATAAAAATCAGC
CGTCCAATAATTTCCTGAATCATCTCAGTCACCGGAATTTTTACGCTGGAGAGCGCCGGA
ACGGTGTAGGGGGCAATAGCGATATCATCGAATCCGATAACTGACACCTGCTCTGGCACC
GCTACGCCGCGCTCGTGTAACGCTTTCATCGCACCTATCGCCATATCGTCGTTACTGGCA
ACTAACGCGCTAAATTTAGCCCCACGTTCGAGCAACATTTCTACCCCTTCGGCCCCGCTG
GCAGGCGTCCATTTACCGTTAGCGATAAGTTTTTCATTGAGCGCAATACCATGCTGCGCC
AGCGCGTCTTTATACCCGGCAAGACGTTCAATGCTGGTGGGGGAATCCATCGAGCCGGTA
AGGAAAGCAATCTCCTGATGCCCGGCGTTTATCAACTCTGCCACGGCGTTAAAACTGGTC
TGTTTATGATCGCACCAGACGCTATGGCTGCTGTTTTTGCGCAGGCGGCGATTAAGCACC
ATTATCGGCTGACTGTGCGCGTCAATGATGTCATCGATCTCATCCACGCTTAAAAAACGC
GGGTAAATCATGATCGCGTCGCAGCGCAGATCCAGCAGATACTGAATCGCCTGGCGCTCT
TCTTCTGCGCTGTGTTTACCATCTGCCAATAGCAACTGCCGCCCTTTCTCTTCCGCCATT
CGCGCGGCATGAAAGAGTAATTCACTAAAATAAATGCCGTGGTAAAGCGTGTTGGTCACT
ACCAGCCCCAGCGTCTGAGTACTCTTCGCCGACAGATTGCGCGCCAGCAAGTTTGGACGG
TAACCGCTCTCTTCTACCGCCTGAAACACGCGATCTTTAGTCTCCTGGCTGACGTAGCCA
TTACCTGAAAGCACGCGGGAAACGGTCGCTTTTGAAACCCCGGCGCGCTTCGCCACTTCC
AGCATCGTCGTCATCATTTTCATCCCTTTACACGCAATCAACGCAGTGTACTGCACCGTT
TGCCGATTGTCCTTGCACAATCGGCGGGAAAAATATTCAGGTGACCGGTTTCACAAATAT
AAAAAATGAACAATTCACTCTCTTGCTTATTTAGTGACAACTATTCATGATTTTGTGAAA
CCGGTTTCTTAATTCCGTTTCAGCATCGGCATTTTTCCGTCACGTCGACTGATAACAACT
ACATCTACCCTACTGATAACAGGATAAAATCCGATGGCCAAAAATTATGCGGCGCTGGCA
CGCTCGGTGATAGCGGCACTGGGCGGCGTTGATAACATCTCGGCGGTCACGCACTGTATG
ACGCGGTTGCGCTTTGTTATCAAAGATGATGCACTTATCGACAGCCCGACGTTAAAAACC
ATCCCCGGCGTGCTCGGCGTGGTACGTAGTGACAACCAGTGTCAGGTGATTATCGGCAAT
ACCGTTTCACAAGCCTTTCAGGAAGTCGTCAGCCTGCTGCCGGGAGATATGCAGCCCGCA
CAGCCCGTGGGTAAACCCAAACTCACGCTACGTCGCATTGGTGCGGGGATCCTCGATGCG
CTGATCGGCACCATGTCACCGCTGATCCCGGCGATTATCGGCGGATCGATGGTCAAACTG
CTGGCAATGATCCTCGAGATGAGCGGCGTGCTGACAAAAGGATCGCCGACCTTAACCATT
CTGAATGTGATTGGTGACGGTGCTTTCTTCTTCCTGCCGCTGATGGTCGCGGCATCTGCC
GCCATCAAATTTAAAACCAATATGTCGCTGGCGATTGCCATCGCGGGTGTGCTGGTACAT
CCGAGTTTTATTGAACTGATGGCGAAAGCGGCCCAGGGTGAACATGTCGAATTTGCCCTG
ATTCCGGTCACCGCGGTGAAATACACCTACACGGTGATCCCGGCGCTGGTGATGACCTGG
TGCCTGTCATATATCGAACGCTGGGTGGACAGCATTACACCGGCGGTGACCAAAAACTTC
CTCAAACCAATGCTGATTGTGTTGATTGCCGCACCGCTGGCAATCCTGCTGATTGGCCCG
ATTGGTATCTGGATCGGTAGCGCCATTTCGGCGCTGGTTTACACCATTCATGGTTATCTG
GGCTGGCTTTCAGTCGCCATTATGGGCGCGCTGTGGCCTCTGCTGGTAATGACCGGGATG
CACCGCGTCTTTACGCCAACCATCATTCAGACCATTGCCGAAACCGGCAAAGAAGGGATG
GTCATGCCGTCAGAGATCGGCGCTAACCTGTCGCTGGGCGGTTCATCACTGGCAGTGGCG
TGGAAAACGAAAAACCCGGAACTGCGTCAGACGGCGCTGGCTGCGGCGGCATCAGCCATT
ATGGCGGGGATTTCCGAACCGGCGTTATATGGCGTGGCGATCCGCCTGAAACGTCCGCTT
ATCGCCAGTCTTATCAGCGGTTTTATTTGCGGCGCGGTTGCCGGTATGGCGGGGCTTGCC
AGCCACTCAATGGCAGCGCCGGGGCTATTTACCAGCGTGCAGTTCTTCGATCCGGCGAAT
CCAATGAGCATCGTCTGGGTGTTCGCGGTCATGGCGCTGGCGGTGGTGCTGTCGTTTATC
CTCACACTGTTGCTCGGCTTTGAGGATATTCCTGTTGAGGAAGCGGCTGCCCAGGCGCGA
AAGTATCAGAGCGTACAACCGACCGTCGCCAAAGAAGTAAGTCTTAATTGAGGATGAAAA
TGTCAGTATTTCCAGAAAGTTTTTTATGGGGCGGCGCGCTTGCCGCCAACCAGTCTGAAG
GTGCGTTCCGTGAAGGTGACAAAGGTCTGACCACTGTCGATATGATCCCACACGGCGAGC
ATCGAATGGCGGTGAAACTGGGGCTGGAAAAACGTTTTCAGTTGCGAGATGACGAGTTTT
ATCCCAGCCATGAGGCGACGGATTTTTATCATCGTTATAAAGAAGATATCGCCCTGATGG
CAGAGATGGGATTCAAGGTTTTCCGTACCTCAATTGCCTGGAGCCGTCTCTTTCCGCAGG
GCGATGAAATCACGCCCAATCAGCAGGGCATTGCTTTTTATCGTTCTGTCTTTGAAGAGT
GTAAAAAGTACGGTATCGAACCGCTGGTCACGTTGTGCCACTTCGATGTGCCGATGCATC
TGGTCACCGAATATGGCTCCTGGCGTAACCGCAAGCTGGTGGAGTTTTTCAGCCGCTACG
CCAGAACCTGCTTTGAAGCATTTGATGGTCTGGTGAAATACTGGCTAACCTTCAATGAAA
TCAACATTATGTTGCATAGCCCGTTCTCCGGCGCGGGTCTGGTGTTTGAAGAAGGTGAAA
ATCAGGATCAGGTGAAATATCAGGCCGCGCATCACCAGCTGGTTGCCAGTGCGCTAGCCA
CCAAAATCGCCCATGAGGTTAACCCGCAAAATCAGGTGGGCTGTATGCTGGCGGGCGGTA
ACTTCTACCCTTACAGTTGCAAGCCGGAAGATGTCTGGGCGGCGCTGGAGAAAGACCGGG
AAAACCTGTTTTTTATCGATGTGCAGGCGCGGGGCACGTATCCGGCTTACTCTGCCCGCG
TATTCCGCGAAAAAGGGGTAACCATCAACAAAGCACCGGGCGATGATGAAATCCTGAAAA
ACACCGTCGATTTTGTCTCTTTCAGCTATTACGCCTCGCGCTGCGCCTCGGCGGAGATGA
ACGCCAACAACAGCAGTGCGGCGAACGTGGTGAAATCGCTGCGTAATCCGTATCTACAGG
TGAGCGACTGGGGCTGGGGAATTGATCCACTCGGTCTGCGTATCACCATGAATATGATGT
ACGATCGTTATCAGAAGCCGCTGTTTCTGGTGGAAAACGGCCTGGGCGCAAAAGATGAAT
TTGCTGCCAATGGCGAGATTAACGACGACTATCGCATCAGCTACTTACGCGAACATATCC
GCGCAATGGGCGAAGCGATTGCAGACGGCATTCCGCTGATGGGCTACACCACATGGGGCT
GTATTGATTTAGTTTCCGCCTCTACGGGTGAAATGAGCAAACGCTACGGCTTTGTCTTTG
TTGACCGTGACGACGCAGGCAACGGTACGCTGACGCGCACGCGTAAGAAATCATTCTGGT
GGTATAAAAAAGTGATTGCCAGTAATGGGGAAGATTTAGAGTAGGTAACAGTGCCGGATG
CGGCGTGAACGCCTTATCCGGCCTACATGTCGCACGAACCATGAAGGCCCGATAAGCGCA
GCGCATCGGGCAATTTAGCATTTGGCATCAGAGCTGGTTCACCCCATCAAGAACATCCCT
GTCCTGATTCCTTAATGAAAAACTACTCTTCTTCCACCGCTAACTGCGCGAAGCCGCCAT
TTCCTTCCCAGCCTTCCAGTCGTTGATAAACGGTTTCTACCGCATCTTTAATCGGCTGGG
TCATCGGGTAGTAAAAGCCGACGATATCCGGCTGAATGCCGAGGAAAATCACTTCGCCAA
TATCTTCTTTCAACTGGTCGATAAGGTAATTCAACGGCATGTTATGGGTAGTCATCATAA
ACATCTCGGCGATATCATCCGGGTCGATGATGCGGATCTCGCCGGGGTTTAGCCCCATAT
CCGTGGCGTCGACAATCAGCAGTCGTGTCGGGCGCAGTTCACGGATAGCGACGATGTCGT
TTTCCGGTGCGCTACCGCCGTCAATCACCACCCAGTTACCTTTCGGCGCGGCGGCGCACT
TTTCCGCCAGCAGCGGACCTGCGCCATCATCGCCCATCATGCTATTGCCAACACAGAGTA
AAACGTCAGTCACGCAGTCTCCTCACCATCAAATAGATGGCGTTTTCCTGATGAATATCA
TGCAGCATACTTAACAGCATTGTACTCCATTCCTGCTGCTGCGAAGTTTGCGCTGCCCGG
GCTTTATCGAATGCGTTGGCCAGCATCGGCACATGGTTAATGTCGATGACGATCTCACCA
TATTTCGGCACGCCTTCCATTTTGCGGCGGGCTTCACTGCCTGCCTCCAGAGTGGCAATC
CATGCCAGATATTCATCCCACGGGCAGGTGAGCGCCGCTTCCAGGCAATCGATAACCCCA
AGGTGGTGACCAATCGCCAGGCTGTAATAGACCACCTGCTGCGCCTCGGCGGGCGTGGCA
TCGTTCTCATCAATAAATTTACGGCTCAGTTGACTGAACACCACCTTTTCACTCATCGGA
TACGCGCCTCTTCAACAACATGATTCAGATGGCTGACAATCTCGTTCAGACGCGGATCGT
TTTCCGCTTCCAGCCAGCGTGCAACCTGTTCTTCGCCCTGCCCTAACTGTGTAAGGTAAT
CATCGGCAATCTGACGACCGTAACGATAACCCGCCAGGCGACGTGCTTCGCGATCCACTT
TCACGCGCAGCGGCTGCACCATATCACCATGCAGGATCTCCGCCGGTTGTTCATCCAGTT
CACCCGGCCCACGGGCGTGAATTTTCTGCTCCAGCAGGCCGAGCGCCATTGCAAAGCCGT
ACAGCGTGGCGGCAGGCGTTGGCGGGCAGCCAGGGATATAAACATCCACAGGGACAATTT
TATCCGTACCGCCCCACACGCAGTAGAGATCGTGGAAGATCCCGCCACTGTTACCGCAGG
CACCGTAGGAGATACAAATTTTCGGGTCCGGCGCGGACTGCCACGCACGCAGCGCAGGGG
ATCGCATTGCACGGGTGACCGCGCCGGTAAACAGTAAAATATCCGCATGACGCGGTGAAG
GAACGACTTTAATGCCGAAGCGTTCTGCATCAAACAGCGGCGAAAGCGTGGCGAAAATTT
CGATTTCGCAACCGTTGCAGCCGCCGCAGTCCACGCGGTAAACATAGGCAGAACGTTTGA
TTTTTTTCAGTAACGACGCCTTCATGCTGGCGATGGATTCATCCACCGTCATGGGGACCG
GAATGCCGTTGGCGTCACGGGGGCCTAATAAATTGCTCATCAGATGGCCTCTTTCATATG
GCGAGTCAGTTCAATACGGTCGGACGGCACCAGGCATTTCTGGCGCTTACATTCCGGGCA
AGTCTCAAAGCTTTCGCGGTGGTTTTCCGCGCGGCTGTCGCCGTTGTGCTTAAGCAGCGC
AATGGCGTAGTCGATCTCTTTCTGGACGGCGAAAGGACGATTGCAGACGCGGCAGTTGCA
CAGCGCGAAGCGGGACTGTTGCAGGAAGTCTTCTTTCTTCCACACCGCCAGTTCGTACTC
TTGCGACAGTTTGATCGCCGCCGTCGGGCAGACTTCTTCGCAGCGTCCACAGAAGATGCA
GTGCCCAAGATTAAACTCCCAGGCAAGCTCTCCTGTGGCGAGGTCAGTTTCAACCGTTAA
GGCGTTTGACGGGCAGGCATTGACGCAGGCCGCGCAGCCGATGCACTGCTGCGGGTTCTG
CTCTGGCTTACCACGGAAGTTTTTATCAACCGCAATCGGCTCCAGCGGATAAGACGAGGT
CGCCGTGCCGGTTTTGATGACTTTTTTGATAAAGGTAAACATGGCGATTCCTTATTTCAG
CGGCGAGTTTTTACGCTCAATGCTGTAACGCTCGAGTTCTTTGTACGGCACCACTTTGCT
CTTCTTCTTACGCACATCGACCACGGTCATGCGGTCGGTACAGGAGTAGCAAGGGTCGAG
GCTACCGATAATCAGCGGCGCATCGGAAACGGTGTTGCCGCGCAGCATGTAGCGCAGGGT
CGGCCAGTTCGCGTAGGTCGCGGCACGGCAGCGCCAGCGGTACAGCTTCTGGTTGTCGCC
GGTCATGCTCCAGTGGATATCATCGCCGCGCGGCGCTTCGGCAAAGCCCAGCGCAAAGCG
GTGCGGAATGTAGGTAAAGCCTTCCACCATCAGTGGGCCACCCGGCAGGTTATCCAGACC
GTAGTCGATCATGTTCAGCGCGGTATAGACTTCGTTGATACGCACTTTCAGACGGGAAAT
AACGTCGCAGCCCTGCTCGCTGTGGACTTCCATTGGCAGCAGGCCATAGCCGACAAACGG
GTGATCGGCGCGGGTATCACGGGCGTGACCGCTGGCACGGACCATCGGGCCGACGTTACT
GAAGTCGCGAGCGATTTCCGGGTCCAGACGACCAATGCCGACAGTGCGCTGTTCCATGTT
CGGAGTGCTCAGCAGCACATCCACCAGCTCCTGCACTTCACGACGCATCTGTTGTGCCAG
CTGGCGGGTCTGGATCATGTCGTCTTTCAGCAGATCGCGACGAATCCCGCCGATCAAGTT
CAGGCCGTAGGTTTTACGCGCACCGGTAAGGATCTCTGCCATTTTCATGGAGGTTTCACG
CACGCGGAAGAACTGCATAAAGCCGGAGTCGAAGCCGGTAAAGTGACAGGCCAGGCCAAG
GTTGAGCAGATGCGAGTGCAAGCGTTCTACCTCCAGCAGAATGGCGCGGATCATCTGCGC
ACGTTCTGGCACCTGAATACCCATCGCGTTTTCCACCGACGTGGTGTAGGCGGTGCTGTG
GGCAAAGCCGCAGATCCCGCACACACGGTCAGAGAGGAAGGTCACTTCGTTATAACCCAT
ACGGGTTTCCGCCAGTTTTTCCATGCCGCGATGGACGTAGAACAGACGGTAGTCGGCGTC
GATAATGTTTTCGCCATCGACGAACAGACGGAAGTGGCCCGGTTCATCAGAAGTGACGTG
CAGCGGACCAATCGGCACGACGTTGTTTTTCTTGTCGCCCAGTTCGTTGATGAACTCGTA
GGTTTCAGCATCGGTGGTCGGTGCCGGACGCTGACGATAATCCATGCTGTCTTTACGCAG
CGGATAAAGTTCATCCGGCCAGTCATCCGGCAGCACCAGACGACGTTCATCCGGCAGACC
AACCGGAATCAAACCGTACATATCGCGCACTTCACGCTCGCCCCACACCGCCGCCGGAAC
GCGCGGCGTCACGGACGGATATTCCGGTTTGTTGGCGTCAACTTCGACGCGAACCGTAAT
CCAACACTTAGTGCCCTTCTCCATCGACAGCACGTAGTAAACGGCGTAATGACCATTCAG
TTTGCGTTCGTCGTTACCAAACAGCACCGACAGCCAGCCACCCTGTTTGTAGTAAAGAAA
CTCCACCACTTCCGGCAGGTAGTTCACCTTTACGGTGACAGTCAGCTGATCTTTGGTCTG
CCAGGCGTGGTCCAGCACGACGCCCGGAAATGCCTCATTCAGCGCGGCGAGATAATGTTG
ACCTAATTTTTCTTCAGACATGCTCAAACTCTCTTTAATCACGCCGCCAGCAAGGAGACG
AACGCTAAAAATGCAAAGCCAAACCCAGCCCAGGTAATGCGCGGAGTAATATCAAGACGC
AGACGGGCCATGCTGTTTTCGAACAGCGCGATAACCAGGACGCCGACCACCAGTTTTACG
ATGGCAATCACCAGCGCCAGCAGCAGTCCACCGGCGGTGAAGGTTTCCATTTGTCCCCAC
GGAATAAACACCCCGACGAACATCTGCAACACCACCAGCTGTTTCAGGCTGATACCCCAT
TTCATGACGCCAAAGCCGCTGCCGCTGTATTCAGAGAGCGGGCCTTCCTGCAGCTCCTGC
TCGGCTTCCGCCAGGTCGAACGGCAGTTTGCCCATTTCGATAAAGGTGGCGAACGCACAG
GCACAAAGCGCCAGTACCAGCGGGATGCTCTGGCTCAGCGGCCAGTGATAAACGGTGTCG
GTGATGTTGCTGATGTTGGTGGAACCGGCAACCTGTGCGGCAACCCACAGACCAAGCAGC
AGCATCGGTTCGACCAGCACGCCAAGCATCGCTTCACGGCTCGCGCCGATAGCGGTAAAC
GGGCTACCGGTATCCAGACCAGAAATGGCAAAGAAGAAACGCGCGATGGCAAAGAGATAC
AGTAAGGTGATCAAATCACCCAGTTGCGGCAGCGGAGAACCGACGGTCACCACCGGCAGC
GCAGTAGCGATAGTCAGCATGACGCCCACCATCACATACGGCGTCAGGCGGAACACCCAG
CCGGAGGCATCCGGGCCGACGCTCTGACGCCCCAGCAGTTTGATAATGTCGCGATACTCC
TGCAACACGCCCGGCCCGCGACGGTTATGCAAGCGGGCGCGCGCCACGCGGGTTATACCG
GAGAGCAGCGGCGCAACGGCAAATAACACCAGCGCCTGAATTAACGGATATAAAACACTC
ATTCTCAGGCTCCTCGTGAAACAATAATCACCACCAGTACCGCCAGTTCAACCAGCGCCA
TCCGGCGGAACAGCAACGCACTCCCCTCGCACTGCCAGCCCGGCACCAGAGACACCGGAT
TCAGCCATTTGCGTAGTTTCAGCACCGGCGCAAACGCCTGTTTCACCGGCATGGCAAAAC
CGTGAGCGGTAATCACCATTGATTTTTCGTGGTCGTAACCGCACACCCAGGCCGCACCGC
GGGAACGCGATGGCAAACGATCGCCTTTGCAAATCGCCATAATGATGAATGGCAGCAGCG
GGCAGGCAATCAGCAGCAACGTGATCATCGGTTGAGAAACGGTGGTGTTAGCAGGCTCCA
GCGGCAGAGGTACAGCAGCAGAGAGCATCGGCAGTAGCCACGGCGCAGCAACACCGCCAA
TTACGCAGCAAATCGCCAGTGCCACTACGCTTACGCTCATCAGGAGCGGCGCACAGGTGG
CGTTTTCGGCTTCTTTGGTGCGCGGCGCGCCGAGGAACGTGACGCCATAGACTTTCGCCA
TACACATCACCGCCAGCGCACCGGTAATTGCCAGCCCCACAGCGAGCAGCGGCCCCAGCA
GACGGGCAACAAACGCGCCACTATTGCTCAGTTTGAAAAATGATTGATAGATAACCCATT
CCCCGGCAAAACCATTCAGCGGCGGCAGCGCAGCCATTGCCATCAGCCCGACTAACATGG
CGATGGAGATAACCGGCATTTTCTTGCCAATACCACCGAGTTTTTCGATATCGCGATGAC
CGGTACGGAACCAGACGCTCCCCGCCCCGAGGAACAGTACGCTTTTGAACAGGCTATGGT
TAAGCAGATGGTACAGACCACCGACCAGGCCAAGAGCAATCAGCGCCGGTTGTTCGAGCG
CGATACCCGTTACGCCAGCGCCCAGCCCCAGCAGGATGATGCCGATATTTTCCAGGGTGT
GGTAAGCCAGCAGGCGCTGGATGTTGTGCTCCACCAGCGCATACAGACCACCGACAAACG
CGGTGATCATGCCGAGCACCAGCAGCGCGATCCCCCACCACAGCGGTGCATTACCGCCCA
GCAGTGACAGGGTTAAAATGCCCAGCAGGCCAATTTTCATGACTACCGTAGAAAACAACG
CGGCAGCTGGCGCAGAGGCGTTCGCATGTGCCTGCGGCACCCAGCCGTGCAGCGGAATAA
TCCCGGCCAGCAGGCCAAAGCCAATCACTCCGAGCAGCCAGATATCGGAACCGAGCGGCA
GCTGTTGCATACGCATATCCAGCAGGCGCAGATCCAGCGTGCCGTAACGCTGCCACAGCA
GCCAGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTTTGC
CCTCTTTGCTGTTGCTGGTGAGGAACACCGCGCACAGGGCCATGATTTCGGCCATTACCA
CGAACATGCCGAGGTTGCTGGCAATGACGGCGCAGACGGCGGCAGCCATCAACATATTGA
TCTGCAAGCCGTTGCACTTCACCTGCGCGTGGCGATGCCAGTCAATGTTGTAGAGGCTGA
CAAACAGACCGCACAGACCGAGCGTAATCAGCCAAATCGCGTTAAGCGGAGAGATTTGCA
CATCGTAGCTTACCAGCGACAGCGCACCGCTCACGCCAACCGCGCCAGTCAGTACAGTGA
AGCCCGCGGCTGCCGTATACAGACTACCAACCGCGCCGCCAATTCCAGCTATCCAGCCAC
TTAACGCTTTTTGAAAAGAAAAGAGAAATGCCAGAACAGCGGCGGCGACAAACCACGCCA
CGCCGCTATTGATCAGGGAAATTGCGCTCATTTAGCCTCTCCACTTTGAGCCTGCTGAAA
CAAGGTGAGATCGCCAAAGTCCGTGTTAAAGGTCAGCTCACGCTTACGTTTGCTGACGCG
GGCGATATCGGTGTTATCCACCAGATGCAGGGCTTTAGTCGGGCACATCCGCACGCAGGC
CGGACCTTGTTCATCAAAGCTACAAAGGTCACATTTGACGGCGATCGCGCGAATACCTGG
CACCCAGTCAAGCAATGTGCTGACACGCGCCGGAGCAGGCGGTGCCGGTGGCGCTTTCGG
GGTATTGGCGTTTGCCGGAATATCCAGCGGACGGCTGCCGGAAAATTCAATTGCGCCAAA
CGGGCAGGCGATGCCGCACAGCTTGCAGCTTACGCACAGGCTTTCATTCAACTGCACGGC
CCCATCGACGCGGGTGATGGCGTTAACCGGGCAGACCACCGCGCAGGGTGCATCTTCACA
GTGGTGACAGAGCTGCGGCGCAGATTCTTTTTCATTCAGCATCACTCTCAGGCGCGGCAT
TGATTGCAGGCCGTGCTGGCGATGCGTCTCTGAACAGGCGGCCTCACAAGTGTGGCAGCC
GATACAGAGCGTGGAGTCAGCAATTACAAAACGATTCACCAGGCATTCCTCAGGTGATTG
TCATTTTTGACGAAAACATGCCGATGAAATGTCATTTTCGACACTCATCGACACGCCCAT
CCCCAAACAGGCGTAACGCCTGCAAAACGGGCAAAGCCTCAGCTCATGCTGCCGGGCTTT
GTCCCTTTACCAGTTGGCTTAAATTCACCGGCACATTGTTTTCAATAGCGGTGTATAAGC
TGTCGTAAACGCCAGCGATTTTTTCGAGATAGTGTTCCAGAACCTGTTCGCGATCGCGGA
TGTTGACCTTGCCATCAATCATGCCGTCAATGCTCAGTTGCGCCTGCGCAATCCGCTGTT
TGTCTTCGCCATCTTTTGTTTCGACGTAATACTCGATGGTGTGGCTGTTAAAGCCATCCG
CCAGGGTGACGTAAATGCGAAAATGTTCAAAAAGGACGAAACAGAGTTCTTTGTCCGGCG
CGCAGCTCATGGCGTGATGCAGGCGCGCTTTCGATAACGTGATCCCCTGAACCAGCGAAT
TGCAGTAGATGTGCCACTGGTCCTGTAGGCGACGATGCCGCTGTGCGATGTAATCGGCTT
TCTCGCTTATTTCCCAAATAGTCATTGTCAGGTTACCCGTTTAACAGAGATGCCAGCTTT
AAGCATTTTTTGTGCCAACTTTTAATTTATTGTTATTAAAGAGATTTTTAAGCTAAAGAT
GAATTTCGTCGCCGTGTCGACGTGTCATTTCGACATCATCGACATTATTCACCGCAGGGA
TAATCAACACTGGCACAATTATTGCTTGTAGCTGGCAATAGTTAATGGGAGGCGATATGC
ACGAAATAACCCTCTGCCAACGGGCACTGGAATTGATCGAACAGCAGGCCGCAAAACACG
GCGCAAAACGCGTAACTGGGGTCTGGCTCAAAATTGGCGCATTTTCTTGTGTCGAAACCA
GCTCTCTTGCCTTTTGTTTTGATCTGGTTTGCCGCGGCAGCGTGGCGGAAGGTTGTAAAC
TGCACCTCGAAGAACAAGAGGCCGAATGCTGGTGTGAAACATGCCAACAGTATGTGACGC
TACTGACCCAGCGCGTCCGCCGCTGTCCACAGTGTCATGGTGACATGCTGCAGATTGTGG
CAGACGACGGTTTACAGATTCGGCGGATAGAAATAGACCAGGAGTGAGCGATGTGTACAA
CATGCGGTTGCGGTGAAGGCAACCTGTATATCGAGGGTGATGAACATAACCCTCATTCCG
CGTTTCGTAGCGCGCCATTTGCCCCGGCGGCACGCCCGAAGATGAAAATCACCGGCATTA
AAGCGCCTGAATTTACCCCCAGCCAGACTGAAGAAGGCGACCTGCATTACGGTCATGGCG
AAGCGGGCACTCACGCACCGGGCATGAGCCAGCGTCGGATGCTGGAAGTCGAAATTGACG
TGCTGGACAAAAATAACCGTCTGGCTGAACGCAACCGCGCGCGCTTTGCTGCCCGCAAGC
AACTGGTGCTCAACCTGGTTTCCAGCCCTGGTTCCGGTAAAACCACCCTGCTGACGGAAA
CCCTAATGCGCCTGAAAGACAGCGTTCCGTGCGCAGTTATTGAAGGCGACCAGCAAACCG
TGAACGATGCCGCACGCATTCGCGCTACCGGCACACCAGCGATTCAGGTGAACACCGGTA
AAGGCTGCCATCTTGACGCACAGATGATTGCCGACGCCGCACCGCGTCTGCCACTGGACG
ATAACGGTATTCTGTTTATCGAAAACGTTGGCAACCTCGTATGCCCGGCCAGCTTCGATC
TCGGTGAAAAACACAAAGTGGCGGTGCTTTCCGTTACCGAAGGTGAAGACAAACCACTGA
AATATCCGCATATGTTTGCCGCCGCCTCGCTGATGCTGCTCAACAAAGTTGACCTGTTGC
CGTATCTCAACTTTGACGTTGAAAAGTGCATCGCCTGCGCCCGCGAAGTCAATCCAGAAA
TTGAAATCATCCTTATTTCCGCCACCAGCGGCGAAGGGATGGACCAGTGGCTGAACTGGC
TGGAGACACAGCGATGTGCATAGGCGTTCCCGGCCAGATCCGCACCATTGACGGCAACCA
GGCGAAAGTCGACGTCTGCGGCATTCAGCGCGATGTCGATTTAACGTTAGTCGGCAGCTG
CGATGAAAACGGTCAGCCGCGCGTGGGCCAGTGGGTACTGGTACACGTTGGCTTTGCCAT
GAGCGTAATTAATGAAGCCGAAGCACGCGACACTCTCGACGCCTTACAAAACATGTTTGA
CGTTGAGCCGGATGTCGGCGCGCTGTTGTATGGCGAGGAAAAATAATGCGTTTTGTTGAT
GAATATCGCGCGCCGGAACAGGTGATGCAGTTAATTGAGCATCTGCGCGAACGTGCTTCA
CATCTCTCTTACACCGCCGAACGCCCTCTGCGGATTATGGAAGTGTGTGGCGGTCATACC
CACGCTATCTTTAAATTCGGCCTCGACCAGTTACTGCCGGAAAACGTTGAGTTTATCCAC
GGTCCGGGGTGCCCGGTGTGCGTACTGCCGATGGGTAGAATCGACACCTGCGTGGAGATT
GCCAGCCATCCGGAAGTCATCTTCTGTACCTTTGGCGACGCCATGCGCGTGCCGGGGAAA
CAGGGATCGCTGTTGCAGGCAAAAGCACGCGGTGCCGATGTGCGCATCGTTTACTCGCCG
ATGGATGCGTTGAAACTGGCGCAGGAGAATCCAACCCGCAAAGTGGTGTTCTTCGGCTTA
GGTTTTGAAACCACTATGCCGACCACCGCTATCACTCTGCAACAGGCGAAAGCGCGTGAT
GTGCAGAATTTTTACTTCTTCTGCCAGCACATTACGCTTATCCCGACGTTGCGCAGTTTG
CTGGAACAGCCGGATAACGGTATCGATGCGTTCCTCGCGCCGGGTCACGTCAGTATGGTT
ATCGGCACCGACGCCTATAATTTTATCGCCAGCGATTTTCATCGTCCGCTGGTGGTTGCT
GGATTCGAACCCCTTGATCTACTACAAGGCGTGGTCATGCTGGTGCAGCAGAAAATAGCG
GCCCACAGCAAGGTAGAGAATCAGTATCGTCGAGTGGTACCGGATGCCGGTAACCTGCTG
GCGCAACAGGCGATTGCCGATGTGTTCTGTGTCAACGGCGACAGCGAATGGCGCGGCTTA
GGCGTGATTGAATCTTCTGGCGTGCACCTGACGCCGGATTATCAACGATTCGATGCCGAA
GCACATTTCCGCCCGGCACCGCAGCAGGTCTGCGATGACCCGCGCGCGCGTTGTGGTGAG
GTATTAACGGGCAAATGTAAGCCGCATCAATGCCCGCTGTTTGGTAACACCTGTAATCCT
CAAACCGCGTTTGGTGCGCTGATGGTTTCCTCCGAAGGAGCGTGCGCCGCGTGGTATCAG
TATCGTCAGCAGGAGAGTGAAGCGTGAATAATATCCAACTCGCCCACGGTAGCGGCGGCC
AGGCGATGCAGCAATTAATCAACAGCCTGTTTATGGAAGCCTTTGCCAACCCGTGGCTGG
CAGAGCAGGAAGATCAGGCACGTCTTGATCTGGCGCAGCTGGTAGCGGAAGGCGACCGTC
TGGCGTTCTCCACCGACAGTTACGTTATTGACCCGCTGTTCTTCCCTGGCGGTAATATCG
GCAAGCTGGCGATTTGCGGCACAGCCAATGACGTTGCGGTCAGTGGCGCTATTCCGCGCT
ATCTCTCCTGTGGCTTTATCCTCGAAGAAGGATTGCCGATGGAGACACTGAAAGCCGTAG
TGACCAGCATGGCAGAAACCGCCCGCGCGGCAGGCATTGCCATCGTTACTGGCGATACTA
AAGTGGTGCAGCGCGGCGCGGTAGATAAACTGTTTATCAACACCGCTGGCATGGGCGCAA
TTCCGGCGAATATTCACTGGGGCGCACAGACGCTAACCGCAGGCGATGTATTGCTGGTGA
GCGGTACACTCGGCGACCACGGGGCGACTATCCTTAACCTGCGTGAGCAGCTGGGGCTGG
ATGGCGAACTGGTCAGCGACTGCGCGGTGCTGACGCCGCTTATTCAGACGCTGCGTGACA
TTCCCGGCGTGAAAGCGCTGCGTGATGCCACCCGTGGTGGTGTAAACGCGGTGGTTCATG
AGTTCGCGGCAGCCTGCGGTTGTGGTATTGAACTTTCAGAAGCGGCACTGCCTGTTAAAC
CTGCCGTGCGTGGCGTTTGCGAATTGCTGGGACTGGACGCCCTGAACTTTGCCAACGAAG
GCAAACTAGTAATAGCTGTTGAACGCAACGCGGCAGAGCAAGTGCTGGCAGCGTTACATT
CCCATCCACTGGGGAAAGACGCGGCGCTGATTGGTGAAGTGGTGGAACGTAAAGGTGTTC
GTCTTGCCGGTCTGTATGGCGTGAAACGAACCCTCGATTTACCACACGCCGAACCGCTTC
CGCGTATATGCTAATAAAATTCTAAATCTCCTATAGTTAGTCAATGACCTTTTGCACCGC
TTTGCGGTGCTTTCCTGGAAGAACAAAATGTCATATACACCGATGAGTGATCTCGGACAA
CAAGGGTTGTTCGACATCACTCGGACACTATTGCAGCAGCCCGATCTGGCCTCGCTGTGT
GAGGCTCTTTCGCAACTGGTAAAGCGTTCTGCGCTCGCCGACAACGCGGCTATTGTGTTG
TGGCAAGCGCAGACTCAACGTGCGTCTTATTACGCGTCGCGTGAAAAAGACACCCCCATT
AAATATGAAGACGAAACTGTTCTGGCACACGGTCCGGTACGCAGCATTTTGTCGCGCCCT
GATACGCTGCATTGCAGTTACGAAGAATTTTGTGAAACCTGGCCGCAGCTGGACGCAGGT
GGGCTATACCCAAAATTTGGTCACTATTGCCTGATGCCACTGGCGGCGGAAGGGCATATT
TTTGGTGGCTGTGAATTTATTCGTTATGACGATCGCCCCTGGAGCGAAAAAGAGTTCAAT
CGTCTGCAAACATTTACGCAGATCGTTTCTGTCGTCACCGAACAAATCCAGAGCCGCGTC
GTTAACAATGTCGACTATGAGTTGTTATGCCGGGAACGCGATAACTTCCGCATCCTGGTC
GCCATCACCAACGCGGTGCTTTCCCGCCTGGATATGGACGAACTGGTCAGCGAAGTCGCC
AAAGAAATCCATTACTATTTCGACATTGACGATATCAGTATCGTCTTACGCAGCCACCGT
AAAAACAAACTCAACATCTACTCCACTCACTATCTTGATAAACAGCATCCCGCCCACGAA
CAGAGCGAAGTCGATGAAGCCGGAACCCTCACCGAACGCGTGTTCAAAAGTAAAGAGATG
CTGCTGATCAATCTCCACGAGCGGGACGATTTAGCCCCCTATGAACGCATGTTGTTCGAC
ACCTGGGGCAACCAGATTCAAACCTTGTGCCTGTTACCGCTGATGTCTGGCGACACCATG
CTGGGCGTGCTGAAACTGGCGCAATGCGAAGAGAAAGTGTTTACCACTACCAATCTGAAT
TTACTGCGCCAGATTGCCGAACGTGTGGCAATCGCTGTCGATAACGCCCTCGCCTATCAG
GAAATCCATCGTCTGAAAGAACGGCTGGTTGATGAAAACCTCGCCCTGACCGAGCAGCTC
AACAATGTTGATAGTGAATTTGGCGAGATTATTGGCCGCAGCGAAGCCATGTACAGCGTG
CTTAAACAAGTTGAAATGGTGGCGCAAAGTGACAGTACCGTGCTGATCCTCGGTGAAACT
GGCACGGGTAAAGAGCTGATTGCCCGTGCGATCCATAATCTCAGTGGGCGTAATAATCGC
CGCATGGTCAAAATGAACTGCGCGGCGATGCCTGCCGGATTGCTGGAAAGCGATCTGTTT
GGTCATGAGCGTGGGGCTTTTACCGGTGCCAGCGCCCAGCGTATCGGTCGTTTTGAACTG
GCGGATAAAAGCTCCCTGTTCCTCGACGAAGTGGGCGATATGCCACTGGAGTTACAGCCG
AAGTTGCTGCGTGTATTGCAGGAACAGGAGTTTGAACGTCTCGGCAGCAACAAAATCATT
CAGACGGACGTGCGTCTAATCGCCGCGACTAACCGCGATCTGAAAAAAATGGTCGCCGAC
CGTGAGTTCCGTAGCGATCTCTATTACCGCCTGAACGTATTCCCGATTCACCTGCCGCCA
CTACGCGAGCGTCCGGAAGATATTCCGCTGCTGGCGAAAGCCTTTACCTTCAAAATTGCC
CGTCGTCTGGGGCGCAATATCGACAGCATTCCTGCCGAGACGCTGCGCACCTTGAGCAAC
ATGGAGTGGCCGGGTAACGTACGCGAACTGGAAAACGTCATTGAGCGCGCGGTATTGCTA
ACACGCGGTAACGTGCTGCAGCTGTCATTGCCAGATATTGTTTTACCGGAACCTGAAACG
CCGCCTGCCGCAACGGTTGTCGCCCTGGAGGGCGAAGATGAATATCAGTTGATTGTGCGC
GTGCTGAAAGAAACCAACGGCGTGGTTGCCGGGCCTAAAGGCGCTGCGCAACGTCTGGGG
CTGAAACGCACGACCCTGCTGTCACGGATGAAGCGGCTGGGAATTGATAAATCGGCATTG
ATTTAACTGCAAATTGCCGGACAGATCTGCCTGTCCGGCATACTATTCATGAGGTTTTTT
CGGACGATATTTTTCCGGCAGTTCTGGCACCGGACGCTTGTCATCGATGAGATGACGCAC
GGTTAAGATCGGATGACGCCACAGCATTCTCGGCCCGGCCCAACGCATAATCTGTTTCAT
CTCTTCACGCTTTGCAGGCTGGTAACAGTGCACCGGACACTGCTTACAGGCTGGTTTCTC
TTCGCCGAACACACATTTATCCAGCCGCTTTTGCGCGTAAACAAACAACGCCTCGTAATG
CTCCGGCTCCGCTGACGCCTGCGGGCATTTCGCTTGATAAAGATCGATCATTTTTTTAAT
CGTCAGTTTTTCACGAGAGATACGCTTGCCGGACATGCTGCCTCCACCTCATTAAGATGT
ATTTATATTACATCTTAATCTTAAAGGGCACTATGACTCCAAAGAAGAAGGGTTAGCCAA
CCGATACAATTTTGCGTACTTGCTTCATAAGCATCACGCAAAAGCTGCAAAACAGCATCT
TTCCCGGAACCAGCATCAAGAACTCGCCGTTCGCTTCTTCCCCTGAAATGATTAACTCCG
GTATCATGTGCGCCTTATGTGATTACAACGAAAATAAAAACCATCACACCCCATTTAATA
TCAGGGAACCGGACATAACCCCATGAGTGCAATAGAAAATTTCGACGCCCATACGCCCAT
GATGCAGCAGTATCTCAGGCTGAAAGCCCAGCATCCCGAGATCCTGCTGTTTTACCGGAT
GGGTGATTTTTATGAACTGTTTTATGACGACGCAAAACGCGCGTCGCAACTGCTGGATAT
TTCACTGACCAAACGCGGTGCTTCGGCGGGAGAGCCGATCCCGATGGCGGGGATTCCCTA
CCATGCGGTGGAAAACTATCTCGCCAAACTGGTGAATCAGGGAGAGTCCGTTGCCATCTG
CGAACAAATTGGCGATCCGGCGACCAGCAAAGGTCCGGTTGAGCGCAAAGTTGTGCGTAT
CGTTACGCCAGGCACCATCAGCGATGAAGCCCTGTTGCAGGAGCGTCAGGACAACCTGCT
GGCGGCTATCTGGCAGGACAGCAAAGGTTTCGGCTACGCGACGCTGGATATCAGTTCCGG
GCGTTTTCGCCTGAGCGAACCGGCTGACCGCGAAACGATGGCGGCAGAACTGCAACGCAC
TAATCCTGCGGAACTGCTGTATGCAGAAGATTTTGCTGAAATGTCGTTAATTGAAGGCCG
TCGCGGCCTGCGCCGTCGCCCGCTGTGGGAGTTTGAAATCGACACCGCGCGCCAGCAGTT
GAATCTGCAATTTGGGACCCGCGATCTGGTCGGTTTTGGCGTCGAGAACGCGCCGCGCGG
ACTTTGTGCTGCCGGTTGTCTGTTGCAGTATGCGAAAGATACCCAACGTACGACTCTGCC
GCATATTCGTTCCATCACCATGGAACGTGAGCAGGACAGCATCATTATGGATGCCGCGAC
GCGTCGTAATCTGGAAATCACCCAGAACCTGGCGGGTGGTGCGGAAAATACGCTGGCTTC
TGTGCTCGACTGCACCGTCACGCCGATGGGCAGCCGTATGCTGAAACGCTGGCTGCATAT
GCCAGTGCGCGATACCCGCGTGTTGCTTGAGCGCCAGCAAACTATTGGCGCATTGCAGGA
TTTCACCGCCGGGCTACAGCCGGTACTGCGTCAGGTCGGCGACCTGGAACGTATTCTGGC
ACGTCTGGCTTTACGAACTGCTCGCCCACGCGATCTGGCCCGTATGCGCCACGCTTTCCA
GCAACTGCCGGAGCTGCGTGCGCAGTTAGAAACTGTCGATAGTGCACCGGTACAGGCGCT
ACGTGAGAAGATGGGCGAGTTTGCCGAGCTGCGCGATCTGCTGGAGCGAGCAATCATCGA
CACACCGCCGGTGCTGGTACGCGACGGTGGTGTTATCGCATCGGGCTATAACGAAGAGCT
GGATGAGTGGCGCGCGCTGGCTGACGGCGCGACCGATTATCTGGAGCGTCTGGAAGTCCG
CGAGCGTGAACGTACCGGCCTGGACACGCTGAAAGTTGGCTTTAATGCGGTGCACGGCTA
CTACATTCAAATCAGCCGTGGGCAAAGCCATCTGGCACCCATCAACTACATGCGTCGCCA
GACGCTGAAAAACGCCGAGCGCTACATCATTCCAGAGCTAAAAGAGTACGAAGATAAAGT
TCTCACCTCAAAAGGCAAAGCACTGGCACTGGAAAAACAGCTTTATGAAGAGCTGTTCGA
CCTGCTGTTGCCGCATCTGGAAGCGTTGCAACAGAGCGCGAGCGCGCTGGCGGAACTCGA
CGTGCTGGTTAACCTGGCGGAACGGGCCTATACCCTGAACTACACCTGCCCGACCTTCAT
TGATAAACCGGGCATTCGCATTACCGAAGGTCGCCATCCGGTAGTTGAACAAGTACTGAA
TGAGCCATTTATCGCCAACCCGCTGAATCTGTCGCCGCAGCGCCGCATGTTGATCATCAC
CGGTCCGAACATGGGCGGTAAAAGTACCTATATGCGCCAGACCGCACTGATTGCGCTGAT
GGCCTACATCGGCAGCTATGTACCGGCACAAAAAGTCGAGATTGGACCTATCGATCGCAT
CTTTACCCGCGTAGGCGCGGCAGATGACCTGGCGTCCGGGCGCTCAACCTTTATGGTGGA
GATGACTGAAACCGCCAATATTTTACATAACGCCACCGAATACAGTCTGGTGTTAATGGA
TGAGATCGGGCGTGGAACGTCCACCTACGATGGTCTGTCGCTGGCGTGGGCGTGCGCGGA
AAATCTGGCGAATAAGATTAAGGCATTGACGTTATTTGCTACCCACTATTTCGAGCTGAC
CCAGTTACCGGAGAAAATGGAAGGCGTCGCTAACGTGCATCTCGATGCACTGGAGCACGG
CGACACCATTGCCTTTATGCACAGCGTGCAGGATGGCGCGGCGAGCAAAAGCTACGGCCT
GGCGGTTGCAGCTCTGGCAGGCGTGCCAAAAGAGGTTATTAAGCGCGCACGGCAAAAGCT
GCGTGAGCTGGAAAGCATTTCGCCGAACGCCGCCGCTACGCAAGTGGATGGTACGCAAAT
GTCTTTGCTGTCAGTACCAGAAGAAACTTCGCCTGCGGTCGAAGCTCTGGAAAATCTTGA
TCCGGATTCACTCACCCCGCGTCAGGCGCTGGAGTGGATTTATCGCTTGAAGAGCCTGGT
GTAATAACAATTCCCGATAGTCTTTTGCTATCGGGAATATTAACGACAACTGACGAATAA
AATAAAAACACCCTGTATAATAGGAAAGCTTATTTTACAGGGTAAAACCATGCCATCTAC
ACGCTATCAAAAAATCAATGCCCATCACTATCGCCATATATGGGTCGTTGGTGATATTCA
TGGTGAATATCAGTTATTACAATCCCGCTTACATCAACTCTCTTTTTTCCCCAAAATCGA
CTTACTTATTTCTGTCGGCGATAATATTGATCGTGGACCGGAGAGTCTTGACGTCCTGCG
CCTGCTAAACCAACCCTGGTTTACGTCGGTTAAAGGCAACCACGAAGCGATGGCGCTTGA
GGCATTCGAAACTGGCGATGGCAATATGTGGCTTGCCAGCGGTGGTGACTGGTTTTTCGA
TTTAAATGATTCAGAGCAACAAGAGGCAATAGATCTGTTGCTGAAATTCCATCACCTTCC
ACATATTATTGAAATCACTAACGACAACATAAAATATGCCATCGCACATGCAGATTATCC
GGGGAGTGAATATCTCTTTGGTAAAGAAATAGCGGAGAGCGAATTACTCTGGCCTGTTGA
TCGTGTGCAGAAATCGCTTAATGGCGAGTTACAACAAATAAACGGCGCTGATTATTTTAT
ATTTGGACATATGATGTTTGATAACATTCAGACGTTCGCTAACCAGATTTATATTGATAC
CGGATCGCCGAACAGCGGGCGGCTGTCATTTTATAAAATAAAGTAGTCTCATGCTTCTTC
TGTGAAGCATGAGTAACCCGGTGTTATTGCAGGCCATTATTCATTTTTCGCTACCAGCAA
AGAGAGATCCTGCTTCACCAGCGCGCGACTGGCACTCTCCGGCAAACCGTCGTCTGTAAT
AATCTGATCAAACTCGCTTAATGGTAACGCCAGCCATGTCGCCACCTGACCATATTTCGT
CGCATCACAGACCAAAACTCGCTGGCGGCTGGCACTGGCAATCGCCCGTTTCACCGTGAC
TTTATCTTCCGCTGGCGTAGAAATCCCCCGCACACTCCATGACGATGCAGAAATAAAAGC
CTGATCAATCATCAGGCTGCGCAGCATGGTCGCAGCGGCTTCCCCGACACAGGAACGGTT
TTCCCGACACACTGCACCGCCAGTGTGAATAATTGTGCAATTACTGTTGTCGAGCAAGTA
GTCCGCAATAACGAAATCGTTTGTGACCACAGTCAGTGACTCCATGTGAATCAGATGCTG
TGCTATCGCTAACGTGGTCGTTCCCGCATCCAGATAGATACAACTTCCCGGCTGAACAAG
ACTTGCCGCCAGCTTGCCAATAGCCGCTTTTTGCGTCATTGCCAGCGCAGTTTTTACCTG
ATGAGAAGGTTCATGCGCCACGCGTCCCGGAGACTGGACGCCTCCGGACACCAGCACAAC
GGCTCCCTGCTGCTCCAGTTTTTGTAAATCCCGACGAATGGTCATATGTGACACATTCAT
TCTGTCCGTTAGTTCAGCAATACTGACAATGCCTTTTTCAGCTACCATCTCAAGGATGAT
TTGGCGACGCTCTACGGGTATCAACTTTTGCTCCTTCCTTTGTCCTGCTGACATTCTACG
CTATTTGCCTGCGAAACGTGCGCGGCGCAACTAACGCTTAGTTCACATAAAATAACACAC
AATGTTAATTTATGTGAATCAGATCACCATACCGTTATCTTCCAGCGCTTATATTCACAA
TATCAAACAAAATATCACTTAAATTAACAAGGAGAGCAGATGAAAACGGGATCTGAGTTT
CATGTCGGTATCGTTGGCTTAGGGTCAATGGGAATGGGAGCAGCACTGTCATATGTCCGC
GCAGGTCTTTCTACCTGGGGCGCAGACCTGAACAGCAATGCCTGCGCTACGTTGAAAGAG
GCAGGTGCTTGCGGGGTTTCTGATAACGCCGCGACGTTTGCCGAAAAACTGGACGCACTG
CTGGTGCTGGTGGTCAATGCGGCCCAGGTTAAACAGGTGCTGTTTGGTGAAACAGGCGTT
GCACAACATCTGAAACCCGGTACGGCAGTAATGGTTTCTTCCACTATCGCTAGTGCTGAT
GCGCAAGAAATTGCTACCGCTCTGGCTGGATTCGATCTGGAAATGCTGGATGCGCCAGTT
TCTGGTGGTGCAGTAAAAGCCGCTAACGGTGAAATGACTGTCATGGCCTCCGGTAGCGAT
ATTGCCTTTGAACGACTGGCACCCGTGCTGGAAGCCGTTGCCGGAAAAGTTTATCGCATA
GGTGCAGAACCGGGACTAGGTTCGACCGTAAAAATTATTCACCAGTTGTTAGCGGGCGTA
CATATTGCTGCCGGAGCCGAAGCGATGGCACTTGCAGCCCGTGCGGGGATCCCGCTGGAT
GTGATGTATGACGTCGTGACCAATGCCGCCGGAAATTCCTGGATGTTCGAAAACCGGATG
CGTCATGTGGTGGATGGCGATTACACCCCGCATTCAGCCGTCGATATTTTTGTTAAGGAT
CTTGGTCTGGTTGCCGATACAGCCAAAGCCCTGCACTTCCCGCTGCCATTGGCCTCAACA
GCATTGAATATGTTCACCAGCGCCAGTAACGCGGGTTACGGGAAAGAAGACGATAGCGCA
GTTATCAAGATTTTCTCTGGCATCACTCTACCGGGAGCGAAATCATGATCAAGATTGGCG
TTATCGCCGATGATTTTACCGGCGCGACGGATATCGCCAGTTTTCTGGTGGAAAACGGTC
TACCAACGGTACAAATTAACGGTGTTCCAACAGGTAAAATGCCGGAAGCAATCGACGCAC
TGGTGATCAGCCTGAAAACGCGCTCCTGTCCAGTGGTTGAAGCCACACAGCAATCGCTGG
CGGCTCTGAGCTGGTTGCAACAGCAAGGTTGCAAACAGATCTATTTCAAATACTGCTCTA
CTTTCGACAGTACGGCGAAAGGTAATATTGGCCCGGTTACCGATGCCTTAATGGATGCTC
TCGACACGCCGTTTACGGTCTTCTCTCCGGCCCTGCCGGTCAACGGACGTACGGTTTATC
AGGGGTATTTGTTCGTAATGAATCAACTGCTGGCCGAATCCGGGATGCGCCATCACCCGG
TAAATCCCATGACCGACAGCTATCTTCCCCGTCTGGTTGAAGCGCAATCCACAGGGCGCT
GCGGCGTCGTTTCGGCACATGTTTTCGAACAAGGTGTGGATGCCGTTCGTCAAGAGCTGG
CTCGCTTACAGCAAGAGGGCTACCGCTACGCGGTGCTTGATGCGCTGACCGAACACCATC
TGGAAATTCAGGGAGAAGCCTTGCGCGATGCCCCACTGGTAACGGGCGGTTCTGGTCTGG
CGATTGGCCTGGCCCGGCAGTGGGCGCAAGAAAACGGTAACCAGGCTCGCAAAGCAGGGC
GTCCGCTCGCTGGGCGCGGCGTAGTGCTCTCCGGTTCATGCTCTCAAATGACCAACCGCC
AGGTAGCACATTACCGTCAAATTGCACCAGCCCGTGAAGTTGATGTGGCACGCTGCCTCT
CAATTGAAACTCTGGCCGCTTATGCACACGAACTGGCAGAGTGGGTTCTGGGCCAGGAAA
GTGTACTTGCTCCACTGGTTTTTGCCACCGCCAGCACTGACGCATTGGCAGCAATTCAAC
AGCAATACGGTGCACAAAAAGCCAGTCAGGCAGTAGAAACACTGTTTTCTCAACTAGCGG
CGCGGTTAGCAGCGGAAGGCGTGACACGCTTTATTGTCGCAGGCGGTGAGACCTCCGGCG
TAGTCACACAGAGCCTGGGAATAAAAGGGTTTCATATTGGCCCAACCATTTCCCCGGCGT
GCCGTGGGTAAACGCACTGGATAAGCCTGTCTCACTCGCCCTTAAATCTGGCAACTTCGG
TGATGACGCCTTTTTTTCACGAGCCCAAAGAGAGTTTTTATCATGAGCGATTTCGCAAAA
GTAGAGCAGTCTTTGCGAGAGGAGATGACGCGGATTGCCAGTTCATTCTTTCAGCGCGGC
TATGCAACCGGTTCGGCTGGCAATCTGTCGCTGCTTTTACCTGACGGGAATTTACTGGCG
ACACCGACAGGTTCATGCCTGGGCAATCTCGATCCGCAGCGGCTTTCCAAAGTCGCCGCG
GATGGCGAATGGTTAAGTGGTGACAAACCCTCGAAAGAGGTGCTCTTTCATCTGGCGCTG
TATCGCAACAATCCGCGCTGTAAAGCGGTGGTGCATTTGCACAGCACATGGTCGACGGCG
CTTTCCTGCCTGCAAGGGCTGGACAGCAGCAACGTTATTCGTCCGTTCACACCATACGTG
GTGATGCGGATGGGAAATGTCCCGCTGGTGCCTTATTACCGACCGGGCGATAAACGCATC
GCACAGGATCTGGCGGAACTGGCAGCAGACAATCAGGCTTTTTTACTGGCAAATCATGGC
CCAGTGGTTTGCGGTGAAAGCCTGCAAGAAGCCGCCAACAATATGGAAGAGCTGGAGGAA
ACGGCAAAGCTGATTTTTATTCTCGGTGACCGCCCGATCCGTTATCTGACCGCAGGTGAA
ATTGCGGAATTAAGGAGTTAATGCAATGCCTCGTTTTGCAGCTAATTTATCCATGATGTT
CACCGAAGTGCCTTTTATTGAACGCTTCGCCGCAGCGCGAAAAGCCGGGTTCGATGCTGT
GGAATTTCTGTTTCCCTATAACTACTCCACCCTGCAAATCCAAAAGCAACTGGAGCAAAA
CCATCTGACACTGGCGCTGTTCAATACCGCTCCCGGAGATATTAATGCGGGGGAATGGGG
ATTATCCGCCCTTCCCGGACGTGAGCACGAAGCACACGCAGACATCGACCTGGCACTGGA
ATATGCATTGGCGCTCAATTGTGAACAAGTCCATGTGATGGCAGGCGTCGTGCCCGCTGG
CGAAGATGCTGAACGGTACCGGGCAGTATTTATCGATAATATCCGCTACGCTGCCGACCG
CTTTGCGCCACACGGCAAGCGAATATTAGTTGAAGCACTCAGCCCCGGCGTTAAGCCTCA
TTATCTCTTCTCCAGCCAGTATCAGGCACTGGCTATTGTTGAAGAGGTTGCGCGAGATAA
CGTGTTTATTCAACTAGATACTTTTCATGCGCAAAAAGTAGATGGCAACCTGACGCATTT
AATCCGCGACTACGCCGGGAAATATGCGCACGTACAAATTGCCGGACTACCTGATCGACA
TGAACCGGACGATGGAGAAATCAACTATCCGTGGCTGTTCCGCCTGTTCGATGAGGTGGG
ATATCAGGGCTGGATCGGTTGTGAATATAAACCTCGTGGCCTCACCGAAGAAGGGCTTGG
CTGGTTTGACGCCTGGCGCTAATTCGTTAAATCCCTAATTACAACGTACCCATACATCCC
CCCATCTACGGATGGGGTAGGTTAACTATAACTTTCAGACAGGGTTTCCCATGTCCACAA
TTACATTGTTATGCATTGCGTTAGCTGGCGTAATCATGCTGTTGCTGCTGGTCATCAAGG
CAAAGGTACAACCATTCGTTGCTTTGCTCCTCGTCAGCCTGTTAGTCGCACTTGCGGCAG
GTATACCGGCGGGCGAAGTGGGTAAAGTGATGATCGCCGGGATGGGCGGTGTGCTTGGTT
CCGTCACTATTATTATTGGTCTGGGCGCTATGCTGGGGCGTATGATCGAACACTCTGGTG
GTGCAGAGTCACTGGCTAATTATTTCAGTCGCAAGTTAGGTGACAAACGAACTATCGCTG
CGCTGACTCTGGCAGCGTTCTTCCTCGGTATTCCCGTCTTCTTTGATGTCGGCTTTATTA
TTCTTGCGCCAATCATTTACGGTTTTGCCAAGGTTGCCAAAATATCGCCACTCAAATTTG
GCCTGCCTGTCGCTGGGATCATGCTCACTGTTCACGTGGCGGTACCGCCGCATCCAGGCC
CTGTCGCCGCAGCGGGGTTACTCCACGCAGACATCGGCTGGCTAACCATCATCGGTATTG
CGATTTCTATTCCCGTAGGGGTTGTTGGCTACTTTGCAGCGAAAATAATCAATAAGCGCC
AATATGCGATGTCAGTAGAAGTACTGGAACAGATGCAACTGGCTCCGGCCAGTGAGGAAG
GCGCGACAAAATTAAGCGATAAAATAAATCCACCGGGCGTCGCGCTGGTCACCTCGCTAA
TTGTTATTCCTATCGCGATTATCATGGCGGGTACGGTTTCCGCAACACTGATGCCGCCTT
CGCATCCCCTGCTTGGTACGCTACAGCTGATCGGCTCACCAATGGTAGCTCTAATGATTG
CGCTGGTGCTGGCATTCTGGTTATTGGCTTTACGTCGCGGCTGGAGCTTACAACACACCA
GCGACATTATGGGCTCAGCGCTTCCTACTGCGGCGGTAGTGATTTTGGTTACTGGTGCTG
GAGGGGTATTTGGCAAAGTGCTGGTGGAATCGGGCGTCGGCAAAGCCCTTGCCAACATGC
TACAAATGATTGACCTGCCTCTGTTACCAGCCGCATTTATTATTTCACTGGCGCTGCGTG
CATCGCAGGGGTCAGCAACCGTAGCAATACTGACAACCGGCGGGTTACTCTCAGAAGCGG
TGATGGGATTGAATCCGATTCAGTGCGTATTGGTGACGCTGGCAGCCTGCTTTGGTGGGC
TTGGTGCGTCACATATTAATGACTCAGGGTTCTGGATTGTGACCAAATATCTGGGGTTGT
CGGTAGCAGACGGTCTGAAAACCTGGACAGTGTTAACGACCATTCTCGGTTTTACCGGAT
TCTTAATTACCTGGTGCGTATGGGCGGTAATTTGACCTTAATAAAAAGGTCCGATGGGCA
TCGGACCTTTTATTGTGCACAGAAAAGGCCAGCCTC