MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 22.seq
 Deletion 22
 Length 57798
 Fasta Format

>22
TTGATCCTCAGGAACATCAGAAAGAACAGGTGAGGAATTCTCAAGAGGCCAAAACCAATA
CCTTCTTGTTAGTTGCCGAGCGTTGGTGGAATGTGAAGAAAACCAGCGTAACAGAGGACT
ATGCCGACGATATCTGGCGCTCGCTTGAGAGAGATATTTTCCCGGCAATCGGTGATATCA
GTATCACTGAGATTAAGGCTCATACTCTGGTTAAAGCAGTTCAGCCGGTTCAGGCCAGAG
GTGCATTAGAGACTGTTCGCCGCCTTTGTCAGCGTATTAACGAAGTCATGATTTATGCGC
AGAACACAGGCCTGATTGATGCTGTTCCTAGTGTAAATATCGGAAAAGCTTTCGAGAAAC
CGCAAAAGAAAAACATGCCAAGCATCCGGCCGGATCAACTTCCGCAGCTAATGCACACCA
TGCGTACGGCAAGTATCAGCATGTCCACAAGATGCCTGTTCATGTGGCAACTTCTAACCA
TCACCCGCCCTGCCGAAGCTGCTGAGGCTCGATGGGATGAGATCGATTTCAATGCTAGCG
AATGGAAAATTCCTGCAGCTCGAATGAAGATGAACCGGGACCATACGGTTCCACTATCTG
ATGGGGCTCTTGCTATTCTGGAAATGATGAAGCCTCTCAGTGGTGGCCGAGAATTTATCT
TTCCTAGCCGTATCAAGCCCAACCAACCAATGAATAGCCAAACAGTGAATGCAGCACTCA
AGCGTGCTGGCTTAGGAGGTGTACTTGTTTCACACGGCTTGCGTTCTATCGCCAGTACGG
CACTCAATGAGGAAGGATTTCCACCTGATGTCATTGAAGCAGCGCTTGCTCATGTAGACA
AAAATGAGGTGCGTCGCGCTTATAACCGCAGTGATTATCTTGAGCAACGTCGTCCGATGA
TGCAATGGTGGGCTGATCTCGTAAAAGCAGCAGATAGTGGTAGCATCGTTTTAACTCATT
TGAGCAAAATTCGTCTTGTCGGATAAAATATTTATCAGCCCAGCTCTCTGGGCTGATATT
TCTAAAAGATCGCACTAAATAGCTACGCGGAATAGTGCTCTACTTTCGTTTAGCCCTTTC
AGAGGTAAGACATTAGGGCAATTTCACTGTATGACTGCGCAGTCATCGAGTCTGTGGGGT
GTTGCTCCTTTTGCAACGTATCACTTGTCAATAAATAGAAAGTGTAGATGTATTAGGCGC
AGCTATTTAGTCTATATGGCAAGTAGTAATTATTTACTTCTTTTTTTTCTACGAACAGCG
CTATCGAAAGCTTGTTTTACATCTTCATTTTTTAAAGACCATTGATTTAAAATAGTATCA
ACCAAAGCATCTTGACTCATTGTTGCTACACGATATTTTTTATTTTGATTATTTATCTCA
AACTCTGACATTTGAATAAAATCCCATAGCGGTTCGATAAGTTCATTAACTGCTACAACC
TTATTTTTCCACCCATCATTCGGAACAGAGTCATTAATTAGCTCAACCAACTTCAGTTGA
ATGATATGGTACACTTCCGCTTTGCTTTTGCCACCCTTCTTTCCTGCACTCCGCCTGACT
TCTGATAATTTTTTTTGATTACAAACAGAGATGTTAAACCAAGTCATACCTATGCACTTA
TCAAATAACTCCGCAGCCCGATGAAATGCTTTAAAGGCAACGTTTTCATTTTCAGACATG
ATAGATTTTCCCCAGAAAAAAGAGATTGAGGCGAACATAAGGTGTGCCTTGAAAATGTCA
TTAATGGAAAATGGCTCGATAACAAGAGGTAAAAACGTTTCCTTGGTAAGGTTTGAACTT
AGATTTTTCCAGCATTCTTGAGCTGGATCATATAATTCAGTGTATTCTTCCTTTATCTCC
AGTTGCCCATTCACTGTATGGTGCCTTGTTTCCCATGGTACATCGCAGGAATATAACCTC
ACACGAGTACCTATTTTCTCAGAGCTCCAGAATTGCTCTCGCATTCTGCCTAGCTCAATC
CGTATTTCCGGATGATCTTCCTCTAGAACATCAGTATCCACCGCCCATTCGCATTCGGAC
ATGTGATAGGCGAGATCACGTCGTTTTCTACAAATTTGTTCATAAAAATCATTCAGAGAA
ATCATAAAACCACCATAAATCAATGTATTAGAGGTTGTAAAAATTGTATTTTTGGTACAT
GGGTTTTTTGCCTTAAAGATACCCATTAATCTCTCTGCAACCAAAGTGAACCAATGAGAG
GCAACAAGAATGAACAATCGATCGGCCGTTAGAATACTACGGTTACCAGCGGTTATCCAA
AAAACAGGTATGGCACGGGCCACCATCTATGACTGGTTGAACCCCAAATCACCACGATAC
GATGCCACCTTTCCCAAAAAGCGAATGCTCGGCGTGAAATCTGTCGGATGGATTGAGGCC
GAGATTGATGAGTGGTTATCACAACGCTGTAAACTTATTTGAGGGTGTTACATGAATTCA
TACTCAATTGCTGTCATCGGAGTGTAAACATCCTGCTATTTCCGCCATTAATAGCGGAAT
AGCCATATTTGCTAAACAATTTCTTAATTTAATTAAATAAGAGGCATTGCATGTTCAATG
GTCGTCCTTTCCCTGTAGATGCATTTCCTAAAATTATCAGGAATGCAATTTATGAAGTGG
AACAGCATACGCAGGCCCCTCAAGGTTTGATTGCTGCTTCTGCTCTTGGGGTAATTTCTC
TTGCCTGTCAGAACCGGATTGATGTTTGCCGATTGAATAATCTACGTGGCCCGGTATCAC
TTTTCTTAATGACTCTGGCTGAATCAGGTGAACGTAAGAGTACGGTTGATAAACTGCTGA
TGAAGCCATTATATCAACTGGAAGAGGATTTATTTGAAAAATACACCCACGATCTTACCG
CATGGAGAAATGATGAAGCAATTTTTAATATTGAAAAAAAAGCACTGATGTCAAAACTTA
AATCAGATATTCGACGTAACAAAGATCACTTGGCAACAAATGAAAGACTTAAAGAACTAC
TTACGACAAACCCGAAAGCTCCAGTGAGATTCAAATTTTTATTTAACGATGCCACACCTG
CAGCTATTAAAGCTCATCTCTGTGGGCACTGGCGATCAGTCGGCATCATGTCTGATGAAG
CTGGGATCATTTTTAATGGTTACACACTTAACGAGCTGCCGTTTATCAATAAGATGTGGG
ATGGTTCAATATTTACGGTGGAAAGGAAAAACGAGCCCGAGAAATTAATTAGAGATGCAA
GAATAACACTGTCGCTGATGGTCCAGCCTAATGTTTTTAAGGGTTATATCGACAGGAAAG
GAGATATGGCAAAGGGGATTGGATTTTTTGCACGGTGCCTCATGTGCCAGCCTGCTTCAA
CACAAGGTAACAGAAAAATTTCCAACCCAATTTTTTCAAATGAACATTTGCCGGTATTTC
ACCAACGTCTTATGGAAATTGTTAATGAGAGCATCATTAAAATTAATGAAAATAATCGCA
TCTGCCTCCGATTCTCTGCAGAAGCAGAAAGACATTGGATCGAATTCTACAACCAGGTCG
AGTCAGAAATGAGAATGATTGGCCTTCTTTATGATTTTAAGGATTATGCTTCTAAAATGG
CGGAGAACATGGCGAGGCTTGCTGCCTTACTTCATTACTTCAGCGGTGATGGAGGCGATA
TATCTGTTACCGCAGTAAAAGCAGCAGTGGAGATAGTGGCTTGGTATATTGAAGAATACA
TCCGCTTGTTCTCTAAAAAAGAAGAGTTTTCTTTAGATGTTTCAGAAGCAGATGAGCTTT
ATTGTTGGATAAAAGATTACTGCACGCAAAAATTTTCTTCCTGCATCAAGAAAAATATTA
TCTTACAATTTGGGCCAAATAAATTTAGAAATCGTGACAAGGCAAATGAATTAATTAGAA
TCTTAATTTCACAAAACAAAATATTTATATCTTCATGGGGTAAAACAAAAATAATAAACA
TAACTCATTGTGTTTTTTGATTTTAATGACAATCTAAAAGGACTTAATTTAAGAGTAAAA
ACAAACTCTAAACCCAGTTCGGATAAAAGCTTGTCATCTTGATAGGTAATATATAGGTAC
ATAGACACATCAGAACGATCACTTACTCCAATATCATTGGCCAGGATACTATATGACATA
CGATAGTGAATTCGGATCACATGTATCCCTATATCGGGATAGAATCAAACAGGTTATTGA
TGACTCCCTAAACGAACATCTTAACTCAATGATTCTACGTGTTGATCTGCATGACCCAAT
TGATACAGAAAATATGGATAACCCATTCTTTCAACCCAGGGTTGACTCTGGTGCTATATC
TCGCTTTACCAGTGCGTTAAAAGCAAAGCTTAAACATGATAAGCATATTAAAACTCAACG
GAAAGACTGGCCTGATAGTCGACATTCCACTTTACGTTACGCATGGGTCAGAGAATATAC
CAAAAATAGAAAGCGGCATTACCATTTGATACTGTGTTTCAATCAGGATGCTTATTATCA
TTTAGGTGATTACGACTTAAACCGTAACACGTTACGTACAATGATAACGACAGCTTGGTA
CAGTGCACTTGGCATCCCTATAGATAGCTCGGGGAAGTTAGTTAATTACCCGCCAAATGG
CAAATACCTTCTCAATCGTAAAAGGGACAACTTTGAGCAGACTTATAGCGATTTGATGAA
TAGGGTGGATTACATGACCAAAGTAAGGACTAAAATAGTCGGTGACGGAGACCGTAATTT
CGGCTGCAGTCGCGGGTAATTTATTTTTTACAACAATGGCCTTTCTTATGGCTGGAAAGG
CCTGATTTGTTTGTATTAAGATATCGGTAATCTTTTGATGGTTGGAAGCCCGTCCTGGTA
GACGACCTAGCCTACCGAAGATGTGAGTTATTCAAAAATGTCGCTTTCCCGCGTTCCGTA
GACAAACGTACCTAAATCAATGTCGTCTAATACCGAGCGCGCGCCTGATAAACATCTGAT
CAACGTACCCAATCGATCTACTCCAAATGTCCTGAGTATCCCGAAGATACTGGCTCAACT
CATCCACATCAGCCTCGTCGGAAAATTCCAGCAAGTCTACCAGTCGGTGTAACGTCTGAA
TGGGAATGCCAATCTCTTCTAAGGCATTGACACCTGGTGGTAGATGGAAACTTTCGAACG
CCAATTTGACATGTGTGTAATCGACTTTGCTGCGTATACCACGCTTTACAGCGTGGTGTT
TAACTACATCCTCCATCAAGCTGAGCACCTTAGGTAGGGTATAGCCGAAGGTATTGGTTA
TGAGCTTCAAATCATTGTTGAGGGCAATGGAAAGAGTACGTTTCTCCCCTTCAGAAATCC
ACTGTCGTGCATAATCGATCTGATTTTTCAGATATTCCGAATAACTTTCAGCACTTAAAT
AGCCGGCAAGTTTTGCGATCATGACATCCGTAGGCTTAACAGGGACCCCATTGCGACTGA
ACGTATGGGGAACCAGTCTGGCAATGATCTTTGCAAAGGTCTTGAGGAAGTTTGTCGCGG
GAGTCCAGTGAAACACTAACGAGGAAAATTCGTTATCGTCCATCATCTCGAACATGCTTT
GCAGCATTTCGAACTGCTCGACACGGAAGTACGAATGCTTCTTCACAAGGTCGATGGAAA
CACGGTCGTTTATGAAAACCTCATCAAAGCGATCCTGTGAAAACTCGGACAAGTGGTCTG
GTTGAACGCTGGCTAACAGGTTGATTGGGGTATCAATGCCCTGAATACCGAGCGGAATAT
CCACCTCTTGATTGAGATTGTCTTCCGGGATTTCCTCCAGGCAAAAGATTTTGCCGACGA
AGTGAACGCCCATGCGCCCGGCGCGACCTTTGATGTTCCCATGGGTGAATTTGTCAATGC
TGCGAGTTCCATCGCGGTTGTCGTAGATCACAACGTTCTTAGCGATAGTGTTGACTCCTT
CAATGATCGTGGAGGTGCAGAGCAAAAAGCGCAGTTTTCCAGCATTGAATTGGTCGGCAG
TGTATTGCTGCAGTGCCCTCGGTAGCGCGCCAAAATGCAAGCCAATACCGTTTCTAAGGG
CGACTGTGTAATCCCAGTCGGCATCGAACTCTTCGCTGACCCAGTCGACATGGGGATTCT
CAGTCGGAGTGCCATGCCCAAGCCTGATCAGCTCGCGCGCCACCAGGCCCGCAACAGTTG
GTGACTTGCAATAAATGATCGTTGCGTCGACACATGCGTGCGCGATTTCCCCCAGCGCTT
TGAGCTTGGCTTTGTCGTCATTCGCTTTGATGCCGAACGTCTTAACATCTAGCGCGACTG
TATTGAAGTCGGTAGAAACGAAAGTATGCGGATATCCAAGTTTTTCGAGACCGCGAATGC
TGTTAACGAACGGTCCCGTCAGGTAAAACTGCCTGGAGACCTTAAGCAGTTTGCTTAACG
CAATGTTGAGCTCGATGACTCGTTCGTCTTGATGATCAATGTCCCCGCTTTTCAGTTGTC
GGAACGCCAACTTGTAAAACTCGTCAATGACGAAGAGGTCAATGTCGACGATGTCGTCAC
GCTCGTTCACTCGCTCCTGAGTTAACACATAAACAGCCTGATCGGAATGGCACACTTGGG
AACTGTGGTGGATGATCTGATATCGGTCACCGAATCGCTCTTGCAGTCGGCGACGGGTTT
CGTCGGCAAGAGCCACGGTTGGAACAACCAGAACAAGCCGTTTCAAAGTTCCCATGCCGA
GCAATGAATCGACGATTGCACTTTTGCCCATGCTTGTAGGTGCACTCAGCACCACGTTTT
GACCAGACTTGAGCAGATCGAATATGTGGAACTGCATTGAGTGGAAAACATAACCATCCG
AGAATGGCGTCCGGTATAGCTCAAGCACCCTCAGGTCATCCGGTGTCAGGCTGGTGAACT
CCTTTTTGAGATACGGGAACAAACCTGATTTTCTCACCATATTTTTCAAAATTGTGGTGT
GCTCGGAAAACCGCTCGCGCGAATCGAGAGCTCGCACGATCAAGTCCCGTCCCAAGTCAT
ACGAAACAGGGTTAGACAACAGCTTGTTAACCGCAAACAGATAATTGAACGATGAGAAGT
CCTCACCCTGCAGGCTATGTTTCGCCTGTTCATAGATCTCTGTCATACGACCTCTCTCAC
CTTCTCATCAACTAATTGGGTTAACCGCTCAAGACTCGGGGCTGGATAAATGAATACGTG
GATGCAAAGATTCGCAAACGGCGAATCCTCGATGAGGTCAGCCGCGAATTTTTCGAACAG
CACCGCTGTTTCTTTCTCCAGGTCATCCTCGAACCCCGGCGTTTCAGGCTCGGTTAGTAG
ATTAGAGTCGTAGCCCACGAACAGAACAAACGTGAAACGATCGAGGTGAGCATCGAAAGG
TTGGCTGCCATCAAGAATTTCGTCAATGTCGTGGCGAAGCAGGTAGTTATCGTCTTTAAT
GTCGAGGATTTTTTTGCGCGCGGTATCGATGCAATCCGAAATGTCCTCGTACAACTGATC
CCGTATCTCCGGCAATCTGACGGCAATGTTAATATCAGTCACCAACTCGCTGAAGCCAAT
CCAAAGCTGATCACCTTCTGGATCGCGGCGAACGATATGCACGTTTTCAAGAATTTTTTC
GGCCCCTGCTTTTTCCACGTATAGCATGCAAGGAATAGGCTGGCTTTCGTGGTGCTGCCG
GATCGTTGCGTGCAACAGCACTCGACCCAAAAATTCGCTGACGTCATGGAGCGATTTGAA
GACGGAATTCTTTAGTCGTTCTCGCTTTTCAATGAATGTCAGTTTATGAATATCAGACAT
TTCTTTTGGTCGGAGAAAAACCTCATCCAACCATTGACAGACGTTATCCGCGATGTGCTT
GTAGCGGTATTTCTTAAGTGAGTACTGCTGATGTAGAACCTGGCCTTTACGCTTAGCGCA
GACCGAAGCCATAGGCGCTCTAAATGGCGTAAGGATGTGGGGTAAGTCCCGTTTGACGTA
GATTTTGCGGCCTGACCGAGATTGGTCATCTTCGACACGCTGCTTGAACCACTCAAGTAG
GTCTGGTCGTAAGTAGGACTTGTCATCAGCACTGTGAATGCGTCGAGAATGCTCGCCCTT
GCGCGTCACAGTATCAAGGATGCGGCACCAAATGTCTTCGGCGACGGTTTCGGAACTGAG
AATGACCCCATGTAGATCTTGGGAGGCCAGCCGTATGTTCTTGATCCCTAGAAGTTCCAG
TTCGCGCAGGGATGAAAACACTTCCCATGTAGCCGCATCGATCCAATCTGAAACGCTTAT
ACCTGAGTCTGTTAAAAAATTGTCTGTGCGTTTGTTGAGGTCATCGATGAGTTCCTGTCG
ACCTGGCTTATCTAGTCGGGCGTTTGGGCTGATCGTCAAGTACTCAAGGGTTTTGTTGAC
CTTTTCCTCTGTGACGATGGAGTACCTACGTCCAAGGGACAGGTCAGACTCACACTGCAT
TGATTTGTGCAAAATTGAACTGCAGGGGATCGTCTTTTTATCAGCACCTTTTGAATTCTG
AACGATGTCCGAAATGTTCCAACGTGTTTTGCCGGTGCTTTTTACCTGAACGAAGTCGAT
GTATCCATCAGATACAATGTCGATATCGTCTGTGACCTCGCAGCGCACACTGCGGATAGT
CTTGTCACGAAGCATTCGGGTGACATGGTAAGCGGCTACGCAGTCCTGAAATAAGAAACC
GTGCTTGGCGGCTACTCCGCCTGAATCGTTCGACTCCATTTAGACATCCGTGACAATTTT
GCGAAAATTAAGGAGATGTTATGACACAGTCCAATCGGATCACTGCATCATCACCAGTGA
TCTAAATACTTCACAGCCATTCTCGGTCGCAGGTATCAAGCTTTTCAGGATTCCACAAAT
ATTGTAACCCTGACGTCTAATTTGGTTATATAACATACTGCCCCAACTAACGTAAGGTAG
GCACAGCCTTAATCAAGGTTTTGGTTTTCAAATAGTTCAGAGCTGAGACCGCCAACCGCA
CTATGGCACTATGGCACTATGGCACTATGGCACTATGGCACTATGGCACCGCCAGCGATT
GTAATCACACTTGATATTATAAAACACAGTTGCACGCATTATTTCCTGGTTGGTAGGGTC
ATATCTCGATGCTCTTTGAGCAATGTCAACATCGCGTGTTCATGGCTTTCTATATTGTTG
ATGCCTTGCCCATCCGGACCCCACTCCTTATAGCTCATCATGATGGCTTGTTTTGGGCTC
TCTGCTCGTTCTGTTTCGACGTAGAATTTTTTCTTGTCTGCTGGCGAATAATTACTAAGT
ATCGAGTTGCTGCTTGGTGAGATCAGGAAGAGGTTACCGAAACGATGGACATCATCCCCC
ATTTTGTGGACTGCCCCCCCGGTAGACGATCCTGCCCTATAGTTGGAGTGCCCCCTATTC
AGGTGGCTAAATTTAGCAAATCAATACACTTCAGGGGGGTATTATTGTAGAGTTTCCCCA
TATGTTTCTATGGGATCCAGGAAATGACAATCAGGAGTTACAAAAACTTAAATCTGGTCA
GGGCAAATATCGAGACTGAATCCAGACAATTCATTGAAAATAAAAACTATTCAATCCAAT
CAATTGGTCCTATGCCAGGGTCAAGGGCTGGGCTTCGGGTCGTATTTACCAGACCAGGGG
TTAACTTGGCAACTGTGGACATTTTTTATAACGGGGACGGTTCGACTACAATTCAATATC
TCACTGGAGCCAATCGTTCTCTGGGCCAAGAGTTAGCGGATCATCTTTTTGAAACCATCA
ATCCTGCTGAATTTGAGCAGGTAAATATGGTACTGCAAGGATTTGTAGAGACAAGCGTTC
TACCTGTACTTGAGCTATCAGCAGATGAATCGCATATAGAGTTCAGAGAACACTCTCGTA
ACGCTCATACCGTAGTGTGGAAAATTATTTCCACCAGCTATCAGGACGAATTGACTGTGA
GCCTGCATATCACAACAGGTAAGCTCCAGATTCAGGGCCGACCGCTGTCATGTTACAGAG
TTTTCACGTTTAACTTGGCAGCCCTGCTTGATTTACAGGGTTTGGAGAAAGTGCTAATCC
GCCAGGAGGATGGTAAAGCTAATATTGTTCAACAGGAGGTTGCCCGCACTTACTTGCAGA
CTGTAATGGCCGATGCTTACCCGCATCTCCACGTGACTGCCGAAAAATTGCTCGTTTCAG
GGCTATGTGTTAAACTCGCCGCCCCTGATTTGCCTGACTACTGTATGTTACTTTATCCTG
AACTACGCACCATTGAAGGTGTCTTAAAAAGTAAGATGAGTGGGTTAGGCATGCCAGTAC
AGCAGCCGGCAGGTTTTGGAACTTACTTTGATAAACCTGCTGCTCATTACATTCTGAAAC
CGCAATTTGCAGCTACTCTTAGACCGGAACAGATTAACATCATCAGCACAGCCTATACTT
TTTTTAATGTGGAACGTCATTCTCTGTTCCACATGGAAACTGTGGTCGATGCCAGCCGTA
TGATTTCTGATATGGCCCGGTTGATGGGTAAAGCCACTAGAGCGTGGGGAATAATCAAGG
ACTTATATATTGTTTGAAATCACCGGAATTAACGTCTCAGGGGCTCTAAAAGCTGTCGTT
ATGGCGACCGGCTTCGAGAACCCTTTGTCCTCAGTTAATGAAATTGAGACGAAACTTTCT
GCCCTACTGGGTAGTGAGACCACTGGTGAAATCCTTTTTGACCTCTTGTGCGCTAACGGT
CCAGAGTGGAACCGCTTCGTTACGCTGGAAATGAAATATGGCCGGATCATGCTGGATACG
GCCAAAATTATTGATGAGCAGGACGTTCCGACACATATCCTGAGCAAACTGACTTTTACT
TTACGTAATCATCCTGAGTACCTAGAAGCCTCTGTTTTGTCTCCCGATGATGTACGCCAA
GTCCTGTCAATGGATTTTTGAAACTCTTCTTTCTAAACGAACCAGTATAGAATTCGCCCT
TTTGGCATGATATTAACTTGTCCAATATGATCAAATAGCATTAACCCCCCCTCACAACGT
CCTGCATAGGGAACACGTTTTCCCCTGTGCACCCACGACTAAATTTCCCCCCCTTTAAAC
TTCTCAATAATGTCACCAATTTTCTGGAAATCCTATGATGCCTTTCCCGGTAAATGGTGC
TGTGAGTTCAGAAAGATTCTGCAATCTATGTGCATTGAAAAAATCTTCAGATAGATATCA
TTCTCCTGAACAATCCGATGAACGGCAGAACCTCGCGGTTCTGCCGTTTTTGTTTTACTT
TTCAGAGGAGTGGTGATGAAAAATTTTGAAGTTCTGCAGCCACTACAGAACTCCCTTTCC
GGTCTACCGCTATGGGTATCTGAACGTATATTGCAGCAGATAAATCAGTTAACCCACTAC
GAGCCAGTGATCGGCATCATGGGTAAAACTGGGGCGGGAAAGAGTAGCCTTTGCAATGCC
CTGTTTGCCGGTGAAGTATCGCCGGTCAGCGATGTAGCGGCCTGTACACGTGATCCTTTA
CGCTTTCGCCTGCAGATTGGAGAACACTTTATGACCATCGTGGATCTGCCCGGCGTGGGC
GAAAGTGGCGTTCGCGATACCGAGTATGCTGCGCTGTACCGCGAACAACTTCCCCGGCTC
GACCTGATTCTGTGGCTGATTAAGGCTGATGATCGGGCACTGGCGACTGATGAGCATTTT
TACCGTCAGGTGATTGGCGAAGCATACCGGCATAAGATGCTGTTTGTTATCAGCCAGTCA
GACAAAGCTGAACCCACCAGCGGTGGAAATATCCTTTCCACAGAGCAGAAACAAAATATC
AGCCGCAAAATCTGCCTGCTGCATGAGCTATTCCAGCCCGTGCATCCGGTGTGTGCCGTG
TCGGTTCGCCTGCAGTGGGGACTAAGGGTGATGGCAGAGCGGATGATTAAGTGTCTGCCG
CGTGAGGCCAGCAGCCCGGTAGTAGCGCTACTGCAACATCCCTTTCGAACAACGGTAGCC
CGGGAGCAGGCACGTGACGATTTCGGTGAAACCGTAGGTGCCATACTCGATACGGTAAGC
ACCTTTCCCCTTATTCCCGCCCCGGTGCGGACCATTATTCAGGCCGTGCGTTCCTCGGTG
GTGTCAGTGGCCCGCGCTGTCTGGGATTTCTTCTTCTGAGTGTTTAATTCTGCCCTATTA
TTCTCCGAGCCCTGTCGCAAGTGCGGCAGGGCTTTCTTTATTTGTTTTACCCATACTGAG
GAGTCTGCTTATGACCCGTCTGGCTTCGCGCTTTGGCGCTGCAAATCTTATTCGCCGTGA
CCGTCCGTTAACCCGTGAAGAGTTATTTCGCGTGGTGCCCAGCGTATTCAGTGAGGATAA
ACACGAATCCCGCAGTGAACGCTACACGTATATACCCACAATTTCCCTGCTGGACAGCCT
GCAGCGGGAAGGCTTCCAGCCATTCTTTGCCTGTCAGACACGGGTACGTGACCCCCGTCG
TCGTGAGCATACTAAGCATATGCTGCGCCTACGTCGGGAGGGGCAAATTACCGGTAAACA
GGTTCCGGAAATTATCCTGCTTAACTCTCACGATGGCACCAGTTCGTACCAGATGCTGCC
GGGCATGTTCAGGGCGGTGTGCCAGAACGGTCTGGTCTGCGGCGAGTCGTTTGGCGAGGT
GCGGGTGCCACACAAGGGGGATGTGGTGAGTCAGGTTATTGAGGGGGCGTATGAAGTGCT
GGGGATTTTTGAGCGTGTGGAAGAAAAGAGGGATGCCATGCAGTCGTTGCTTTTACCGCC
ACCTGTGCAGCAGGCACTGGCAAAAGCAGCGCTTACGTATCGCTTTGGTGAGGACCACCA
GCCGGTTACTGAATCGCAGATACTCTCCCCACGCCGCTGGCAGGATGAGAGCAATGACCT
TTGGACCACCTATCAGCGGATTCAAGAAAACCTGATTAAGGGCGGACTCAGTGGGCGTAA
TGCTAAAGGCGGACGAACTCATACTCGTGCCGTGCGTGGCATTGACGGGGATGTGAAGCT
TAACCGTGCGCTGTGGGTGATGGCAGAAACACTGCTCACGCAACTGCAGTAGACGTTTCA
TGTTGCCACGTTGTTAATATCGGACACCACCTGTCCGCATCGCTATGTGCTCGTGTGCCT
CAATCCCCCGGTTATAGCTTTTAACCCCCGTTACATCTGGCTTTTGCAGAAATAAAAAAT
AGTTTCTGCGTTGTCCATACCCTGTCCGCCCCCCTCTTTAAAGTAATCACATCATTTTCA
GTCAGTTAACTTTCCTGGAGAATCTCTCATGACACAGGCAGAACGCCGCCATGACCGGCT
GGCTGTCAGGCTGTCACTGATAATCAGCCGTCTGGTTGCGGGTGAAACGTTGAGCGTGCG
CAAACTGGCGGCTGAGTTTGGCGTGTCAGTGCGCACGCTGCGGCGTGATTTTCGTGAACG
ACTGATGTATCTGGACCTGGAGTATCAGTCCGGATACTGCCGCTTACGCACTGCTGGCAG
TGAGATGCAGATGGTGCCCGACGTGCTTATCTTTGCCCACCGCAGCGGGCTGGCCGGGCT
TTTTCCCGGCCTTGACCGCCGTCTGGTGAATGCACTGCTGATGTGCGATGAGTCTCCCTG
CGTGATAGCACCAGCCAATCCGGTTCCTTCGCCTTCAGGAGCATTGTCTTTCTGGAGACT
GATTCAGGCCATTACCGGGCGCAGGCGGGTGACGCTGATTGCAGAGGGGCGACGCTGTGA
GCGCCTAGCTCCCTGCCGGTTACTCATCCACCAGCAGACCTGGTATCTGGTGGCTGAACA
CGAAGGGCATATCGCCGTATTCACACTTGATGAAATCCATCTGATTCAGCCTTTGCAGGA
GACTTTTCGCCGCAATGACAGTCTGTGTCGCCTGGTTGAAGACCCGGTCTTCATTCAGGC
CTTACCCCATTTTCGCTTTATCCAGCATTCACTGCTTACGTTTGTTCCGGCCGACAGCCC
ACCGGAATAGCGCAGGCGTTGTTATCAACCCGGCAACATGGAGGAGCCCAGTGCCCGTTA
TTGCCATTATCGCCATTGTTATCATCGTCATCATTCTGAACAAAACCGGAGTGTCCGACA
GCCTCACGGCCCTGACACTTGCAACCGTTGCCGCACTACTGACGGGAGGTGGTGCAGCCG
GTGCTGCCAGTGTCGCGCTGACGCCGTTCGTCGGCGTGCCGGTGGGTATTTTTGTGGGAA
TTTATGTCTTTGCCAAAGTGGTTCGTCTGATTTCAGGGAAAAAATAATGAAACGTAAAAC
ACTACCTCTGCTGGCGCTGGTTGCCACCTCTCTGTTTCTGAGCGCCTGCGATGACAGGAG
TGATGACCTCAAAGCTATCAGTAAATTTAAGGACCTCACGCCCCCGCGCTTCAGCGATGT
GGTCAGCCGTCAGGATGATGTCAGCGAAGAATGGTCACAGGTTGGCTTCTCATCCGGTCT
CACCCTGCAGGTCTTACGTACCCGTGAGTCGCCCGATGGTTGCGAGGGTGGCAGTTACTA
CTATCTGGTAGATATGGAGGAGAAAACCGTCCAGCCGCTGATGAATGCGCTTTGTATTGC
CGACAATATCAAACTGGAATACCACGAAGTTACGGACCCGTATACGAAAGAAAAATACTT
CGAATATTCCCATGACGGCAAACTGATGGGACGGCTGCTGATACCGTCAAACCCTGATAA
CCGGGAATAAAAACAACGAGAAAGGAGACATAAATGAAAATACGTTCACTAAGCCGGTTT
GTACTGGCAAGTACAATGTTCGCCAGCTTTACAGCCTCTGCGGTCCCCGGACTCTGGCAA
CAGGGGTACGGTCAGGGCAATGCGGAATACAGTGTGACGGATGCCAGCGGAAAGATGTTT
ACCATCAACTGCACGGGAAATCCGGACCAGAACGGTATTTACCAGCACTCGGTTTTTCTG
ATCCTCGCCGGGGATAAAACGGTCAGCTCGCATGATGACAGTACCGGCATCACAGTGGTG
ATGGACCATAAGCAATATGCCATTCCCTCAACCCTTGGCTGGCGTAACGGAGATAATGCC
TGGTTCAGCTTCATCATGGATATCCGTAAGGCCCGGCAGTTCGACGTCTACGTCAATGAC
CAGAAAGTTGGATCGTTTAACCCTGATGTTCGGAATGCACAAAAGGTCCTGCCAACATTA
GCGGACTGCACTAACGACTGACGGCTGCGCCTTCCCTACCATAACAACCCTGATTGCCTC
CGGCGGTCGGGGGTTTCTTTTTTCTCCTTAATCTCCAGAGGTAGGCCACGTACTTTCGAA
CGATGAGCGCAGTGGTCAGTTTTTTTCAGATATATTTATCTTTTTTTGGCTGTAAGCTCC
GCTGTGAGCGCAGGCTGTGTTAAAACTCCTGATCACTTTTTGGTCTAAGCGATGGTTTCA
TATGATCAACCATTCTTGATAAACCCATGAGACGGACTAACTTTTTCATTAAAATTAAAA
AGATATGAATGAATACTGCGGATATCAACATGGCCAATCACATTCAAGGACAAGGCAGGC
ATCAGGTGACATTGCTCCCTGATGCACTCGATGATTTTGTCACTGAAGATATCTGAAATA
AGTTTAATCAGTTCATCACGGGTCGGTGGCATATCGAGATAATTAATTATTGTCGGTTCG
TTGCCGTTGTTATGAAGCATCTCCAGCGTGTTGCGTGAGGTGCCACAGGCCGGGTTGTGA
TAGATGGTAATGTTGCTCATATCAGTATCTAATTACAAAGTGACAGAGAGCCGCCACGCC
AGCGCGGCCAGAGTGACAAACAGCACCGGCACAGTCATGACAATGCCGGTACGGAAGTAA
TATCCCCAAGTGATTGTCATATTTTTCTGGGCAAGCACATGCAGCCACAGCAGAGTTGCC
AGACTGCCAATCGGGGTGATTTTCGGGCCTAAATCACAGCCAATCACATTGGCATAAATC
ATTGCCTCTTTGACGACGCCAGTCGCCGTACTCCCGTCAATCGACAGCGCACCAATCAGC
ACCGTCGGCATATTGTTCATCACTGATGAGAGAAATGCCGTCAAGAAGCCGGTGCCGAAC
GTCGCTGCCCATAACCCCTTGTCTGCCAGCAGATTCAGCACGCCAGACAGGTACTCCGTG
AACCCTGCATTGCGCAGGCCATAGACCACGATGTACATGCCCAGTGAGAAAATAACGATC
TGCCATGGCGCACCGCGCAGGACTTTTCCGGTGTTGATCGAATGACCTCTTTTCGCCACC
ACAAACAGCACTGCTGCGCCAGCGGCCGCTATCGCACTGACCAGGATTCCCTGCGGCTCC
AGAAAGAAGAAACCGACAAGCAGCAATAACAGGACAATCCAGCCCGCCCTGAAGGTTGCC
AGATCCTTGATCGCACTGGCAGGCGTCTTCAGCAGCGAAACTTAATACGTTGCCGGAATA
ACTCTGCGAAAGAAGAGATACAGCATAATCAGCGTGGCCGCAATCGCTGCCGCATCCACG
GAGATCATAACGGAGGCGTACTGCGCAAAGCTCAGACCGAAGAAGTCCGCCGAGACGATA
TTCACCAGGTTAGAAACAATGAGCGGCAGGCTGGCCGTATCTGCAATAAATCCTGCAGCC
ATGACAAAGGCCAGTGTCGTGCCCTGGCTGAACCCAGTGCGATCAGCATCGCAATCACAA
TCGGCGTCAGGATCAGCGCGGCGCCGTCATTGGCAAACAACGCATCAACAGCGGCACCGA
GCAAGACTTTCCAGGTGAACAGCGCTCTAGGTAGGAACTTTGTCGTTGATAGAGTCTTCA
GCCATCAACACTGTATCGAGTAATGAAATTGGTTGCTAGAAAGTCGATGATTTGTTGCGT
ATGATTAAAAATCAACCTTAAAGGCTTTATACATGGATTTGCTATGGCTTTTGTATCAGA
AAGAGAAATTGTAAGAAAGATATTTAGCAAAAAAATTGACTTTACGATCTTGGCATTTTT
CTATATTTCCTCTATTTTTTTTCTTCTTTGTAGTGGCGTTCTCTTTCAATATTTTACCGC
TGCCTTCACAAAAGGTAATTGTTATGAATGCTCAATGAAACTTGATTACATAAAACAATT
TTATTTTTCACTGGAAACCGCATGGTACCTCATATCTGCTGTTGCAGTATTTATTGCATC
TGTTTTTATACAGCATAGAATTAAAGCTTATTTAACATTATTAGCTATTACATGGATTGT
ACTAACAATAACAGATGTGGCGTTAATACACGCCTTAGACAATATAGCCATGAATAATAT
TTTGTTAAATATACTATATAATCTTTTTGGGGCGATTTTATTGTCACTGTTTATGTGTTT
ATCAAATTCCCTCCTTTTCCACCTTAATAAGATAAAACATATTCCAATGATTTTATCGGC
AATGATTCCATTAGTTTCCGCAATAATAATAGCCATACTCATAACCGCTGTTATATATTT
ATTGTTTGCCCGGCAGGCGGTAGAGATTGAGATGGATATATCTGAAGGTTCAGACATCGC
ATATGTAGGTGTAAAAGATAATGAGGAATCATTTGGGTTTTTAAATGATAAAAAAACAGA
CACACCAACGTATCTGGATGTAATCAAAAATGGTAGTTTGATATATAATGATACACAGGG
TTTAAGTGGTGCTGATATTTATATTGTCTCCGGTTGTTATGCCCTTCCAGATTTACTTCG
CAATGTACCGCTTGATGCTAAAAAATCTTTTCTGAATGTAAAAAAGCTAGAAATCACACA
GAAACTTCCAATGATGGGGTTCATACAAGGTGAATCCGCTGATGTGATGCCTAAAGCAGC
ATCCAGGTTAAGTTTGAGCAAGCAAGATGATAAATTTATGCTAGCCTCAAGTGTTACTGA
CTCTCAAATAAAATTTAAATCAAACAATGCACAATTGATGGTTGCTTTCGCATTTATGCC
AATAACAACGAATGGTATTTTACATGATTATACATACGATATAATAATAAATGATAAAAA
ATATAAAATTGAAAATCATGTTGCACCTCTATCTAGGCTTGATAAAAATAAGAAGATGAA
GTGTGAATACCAGCAAATATCGGATTTAACAAATACGTATAACATTAATGCAAATTACTT
AACGGGTTTTTTACTTGTCCTAAAACCAGATGATATTATTAATTACAACAATAGCCCTTC
CGTACTACTCAAGACTGATTTTGCGTTCTATAAAAAAACATACCAGAAGCTTGATAAAAT
ATATGATGACATAAGCAATGGAAAATTATCTTCACTGAGAGCAACAGGTATCTCCCAGTT
TAGTATCAACGGGAAACATTTGTCGTTAAGGCCAGAATCGGAGATTATTATTTCTGAAGG
GAGTTTGTATGGACTAGTTAATAAAAGCAAAAAAATCAAAATATATGGCACAGCAGATCT
TGTTTTTGTTGATAACAAGATAATGAACCTTCGTAAAATAACTTATTTGCAATCTAAGCT
AGAAATTTTTGGTTCTTCTATTATGGATATATTAAAGTATATATTTGGTTTAGGTCTGCT
AGCAATTTCTATAAAATTCATTCATTCTTACTTTAAGAATGATGTGAATGAAAATTTATT
CTTGTAACGCATTTGGCTCCAATTGGAGCCTTTTTATGACTATTTATTAAAATATCCTAA
GTTAAGCCTGTTTTTAAAGCAGGCTTGAGCGTGAAGCGGACACTCATACCTGCTTTAAAG
TGGCGTTTTTGTCGTTACCCATACCTATATTTTCTGTTGTTTAACTGCCAGAACTGAGCG
GTTGAAAAGCCAGAAATATGCCGAGCCAGCGGCATGGAAGCGCCAGCAGCTGTTGAATGG
AGTACTGTAGGCAAATGGTGCCGTAACCGGCTTTCGTACTGAAAGGTTCTGTCTATCCCA
TCCCTTCTCTTGTATCTAACATTTAGTTGTGAATAGCTACTGTAAATGCCCCTACAAAAT
GAACCATTATTTTTAGAGGGCGTCTGGCACTCCAACTTCCGCTTTTGGCACAGAACGGCC
TATCAGCAATATAAAAGCATTCAGATATATATCATTTCTACAAACATACCCGATTAACGG
CAGAATCTCAGGATTCTGCCGCTTTTTTATTATTTTTCAGGGGAGTAGTAATGAGCAACT
CTGAAGGTTGGTAGTCATTTTAGCAAACGCTTTCTGGTCTGCCGCAGTGGGCATCGGCTG
ATTGCGTAGCAGGGCCACTGGTATCTGCCGGTATCACCGACATTAACATTGAAGACGACC
AGGGCATTCACGTCCGCCTGATAGTTCGTGATGCCGAAGGTCGGATGGTTGGCGGGCATG
GAACTTTGAACCGGACGCCGGTGAAGGTTTTAACCGCTATATCCACAGGTCAGGCATCCG
CACCGACACCTTCCCCCGCTGACTCCGAATCATTTACCAGCAACATTTCACCTTCCCAAA
CGCGCTTTATTACCTCATACGCCAGCCATCGCCGCTGGCGTTTTTTATTCACGGAGACAT
ACCCATGACAACACAGACACAGTACGACCTCGTACCCGCTAACGGATCCGAATTTGAGTT
GAGCGTAACGCAGGTACCCGATGAACAGCATATCCGCTTCTGGCCGCAGCACTTTGGCAC
CATCCCGCAGTGGATAACGCTGGAACCGCGCATTTTCGCCTGGATGGACCGCTTCTGTGA
TGAGTACTGCGGGGGTATCTGGTCCTTTTACACGCTCAGCAATGGCGGAGCGTTTATGGC
TCCTGATGCTGACGGTGACGATAAATGGCATTTGCTCAACGGCATGAATGGCAATGGTGC
GGAAATGAGCGCGGAAGCCGCAGGTATCGCTGTCTGCCTGATTGAATATAGCCATCACGC
CTGCCTCACCGAATGCGATGCCATGACGGAGCACTATTACCGCCTGCGGGATTACGCTCT
GCAGCACCCTGAATCCAGCGCCATTATGCGCATTATTGATTAAGGATACTCATGATGGAA
CAGTCACTCATCCCACAGACACCGGTACTTCCACTGACCGCACAACGCACGGTAAAACGC
GCCTTAACGCTGCTTGACCGACACCTGCGCGAAACAGGCGTGGCATTCACCTCCACTCAG
GCTGCTCGTGACTGGCTGAAGCTGAAAATGGCGGGGCTGGAGCGTGAAGAATTTATGATG
CTGTATCTGAACCAGCAGAACCAGTTGATTGCCCACGAAACCCTGTTTGCCGGTTCTATT
AGCAGTACCGAGGTACATCCCCGTGAGGTGGTCAAACGCGCCCTGTATTTCAATGCAGCA
GCAGTGATACTGGCGCATAACCACCCCTCCGGCGACACTACTCCCAGCCAGGCAGATAAG
ACTATAACGCAGCGTCTGGTGCAGGCGCTTCAGCTCGTTGATATCCGTGTCCCTGACCAT
CTGATTGTTGGTGGCAGGCAAATCTATTCGTTCGCAGAACACGGTCTGCTTTGAGGTATT
ACATGAGAATTATCAGTAAACGCCGGGCAATGACGATATACCGCCAGCATCCTGAGTCCC
GAATCTTTCGCTACTGCACCGGAAAATATCAGTGGCACGGTAGCGTCTGTCATTACACCG
GCAGGGATGTTCCGGATATCACAGGAGTCCTGGCTGTGTACGCCGAACGCCGCAGGACCG
CAGCGGACCGTATGCTTGACTGATGAGTATCACCCTGAACTGACAATAAAGAGGTTATGA
ATGAGCAACACCACATGGGGCCTGCAGCGAGATATCACGCCGCGCCTGGGAGCACGTCTG
GTGCAGGAGGGCAACCAGCTGCACTATCTGGCTGACCGGGCCAGTATCACCGGTAAGTTT
AGTGACGCCGAATGTCCTAAGCTGGATGTGGTATTTCCACATTTTATCAGCCAGATAGAG
TCGATGCTGACCACTGGTGAACTGAATCCCCGCCATGCCCAATGCGTCACCCTGTACCAC
AACGGTTTTACCTGCGAAGCCGATACTCTTGGTAGTTGCGGCTACGTATACATCGCTGTT
TACCCCACTCAACGCTAACTAATTTCACGAGAGCAAGCATGAACACTCTACCTGCTACAA
TTTCGCAGGCGGCGAAGCCCTGCCTGTCGCCAGTGGCTGTCTGGCAAATGCTACTGACAC
GCCTGCTGGAACAACACTATGGCCTGACACTGAACGACACGCCGTTCAGTGATGAAACTG
TTATTAAGGAACATATCGATGCTGGTATCACTCTGGCCGATGCAGTCAATTTTCTGGTGG
AAAAGTACGAACTGGTACGTATCGATCACAGAGGATTTTCGTGGCAACAACAGTCTCCAT
ATATTTCCGTAGTAGATATTCTGCGAGCAAGGCGCTCTACCGGCTTGCTAAAAACTAATG
TGAAATAAACGCTTAAATACAGAGCAGACTGAAGGAAAGCAAAATGCTAATCTCATAGAC
GAAGAGACTCCCGCTGTAACCTCCCCTCCCCCGAAAAAACCTGACATTTTCTTTTAGGAC
CAACAATGGGACCAAAATGAAAATTGAACTGAAGATTACAATCAATTTAACAACAAGTTA
CACAACCAATTCAGACTCCGCCAGCCCACCAATCATGATTGGACGGTGTAAGGACAACAC
CAACAAAAACAGGAAGTTAGAAGTCTCAGCAAAACACCGACCAGACGGTGAGGAGACATA
AAAGGATACGCAAAGGAGCCGCGGCTCCTGGTAACATGAAAGCCCACAGATGTGGGCTTT
TTCGTTGATGGTCAGAACGACCAGTTCACACCAGCTACCGCGTTCCACGGGGATTCCACA
CCGGCACTATGGCTATACCCCACCCCAAGATGCCCGCTTAACGTACTGCTGAATGAGGCT
TTAATACCTGCCTGGTATATTCCACGTCTGCCCGACAAATAATTGACGAAATTACCGTCA
CTATTCACTTTCACCCGGTTATCATCGACAAATTCTTTGCGCACAGCCGCCTTCAGCCAC
GGCTCAACTTCCATACCGTTCCCCAGACGCATGTTGTAACTCAGCGTTGCGCCCAGTTCA
CGATATATACTGCGGGTATCGACTGATTTCGATTTCATGCCATTGGATAAATGATATTCG
GGGTTATCAGCGGTGAACCCCGTTAACGATGCATACGGCGTCAGGTTCCAGTTACCATCG
GTAAATCGCATCCCGGTTTCAATGTGACCGCCCAGCCCGTTGCTGTGGTAACTGCCATTG
GCGGCTCCACCGCTGCTCATTTTACCTGCTACGTTACTTTTAAAACGGTTCAGCTTCACG
ACACCGTCCAGATAGAAACCACTTTCATGTTCCCAACTGGCATAGCCGCCCAGAGAATAA
CTGCCCACACTGCCATGTCCTCCGCGATCAAAACCGATATGTGAATGGGAATAGCCCATA
AAAGCGCCTAGCGTGGTAATTCCTTCAGGAATATCATTACGGCTGTCGATCCCCACTGTC
ATTCCGGTCAGCGTCTGCTCAAACCCGGCACCCGCATCGGTGGTGACATTATTACGGGTG
TTATACGTCGCCCCCCAGACATTATTGTTGTGTGGACTCGCTTTCATTATGTTCAACCGC
TCGCGAATACTGTTTAGCTCAGCATCAAATACCAACGGTAATGTTGCTGCCATATTGAGT
ACGGCTGCCGTAGAAGGCGTAATGCGTTTCTCCGGAACGGGTGTCGGCGTTGGATCGGGA
GTAGGGTCTGGTTTTGGATTTGGGTCTGGCTTTGGATCGGGTTTTGGGTCTGGCTTTGGA
TTTGGGATGGGGTCCGGGTTGGGTTTGACATCATTGGTCAGGTTCCAGTTGCTGTTGCCG
TCACTTTTCAGGACATACTCATAGGTCCCAAGATCAACGAAACCGCCGGTATTGCCCAGC
GTAAACGAAGCATCCCCTCCCCCTGTTTTCACCAGCGTCATCGCGTCGTCAGACTGTGGG
CTGACGCCGGTATCCTGAACAAAGATTTTAAAATTACCAGTGGCGTTGTTGTTGACGACC
AGTTGATCGCCCCGGGAGCCTGCAACGTTGGTATGCAGGTAGAAATTACCGCTACCGGAA
AGTTCATTGGTTGTCAGCGTATTGTAGATACCGTTAGTTGTGGCAGGCGCTGCTGTTTGT
GCTGACAAATAAACATCACCGTCGTTGAGTAGCAAACTGTTTACTCTATATTCGCAGTTG
CTGGTACCTGCACAGGAATTATTGCTGTTAAGCCAGACACTGCCCCGGCTGGCAGCCGTC
AGGTCGGCAAGCGTGGTATCGACGCCATTTCCCAGAGTCAATGTCGCGCTATCGGTAATC
CGGACCGCCCCTTCGAGTTTAACTGGCGTAACATTATCCCGTGGCGTCATTAACGACAGG
CTTCCTGTCGCGCCACTGACCGATGCATCCGCCAGCGTACCTGCGTAGACGATTGCCGTA
CCGCCAGCGACCTGGAGATCTTCTGCCCGGGCCAGAGCCTGAAACTCATCTTTTGACCGC
CCAAGGGTATATTGCCCGCCAGAGTTAACCTTTGTGGCGGAGTCCTGACCCAGGTTTTGC
ATTGCCCCACCCTTGCCAACCGTGGAGTCGCGAGCTTCGGTACCTGCTAATACCAATAAA
TTACCGCCATTTTCCAGCAACATATTGGTCGCTAAATTGCCGGAAATGGAAAAAGTACCG
TACTGGTGAGTACCGCTGATTTCAATACCGTTAGCCGTGCTCGTCTGGAGAGCGGCACCG
CTGTTCTGGACGATATCTGTCGCTTTGCCATTATCGTTGACTGTCAGCGTACCGCCTTCA
TTGATCTTTGTTTTTATTGCCTCTCCGTTAGCTGAAACTGTTTGTATTCCGCCGTCGTTA
ATTGTTGTCTCATTCGCCACACCCTCGACAATTTGTTCACCGCCGGTGAGCGTCGTGCCT
GTCGCAGTGGCTTTTGTTTTGACGATCTCCCGTCCGCCCATATTGACCTGTGTTTTGTCA
GAAGAGGTGTCTGACTCCACGGTTAACACGCCGCCATTTGCCAGCAGGATATTGTTCGCC
GCACCCTGCTCGATGCTGAACGCGACGCCATCCGCGCGTGTTCCTGTGACCCGCGTCGCC
CTGGTGGTTGCAACCAAAGCGCCCTGGCTACTCTGCTGTATCCCCGTTGCGCTGCCTTTC
TCCCGCACATCGAGTGTGCCGCCGTCATTAAGCACCGAGTTTTCAGCCAGGCCGCCCTCA
TTAACTACCTGTGAACCCCCATTAATAATGGAACCTTCCGCTGTCCCGTTTGCCATAATT
TGTTGTAGGCCAGAGACGATATCGGTATTGATTGCCTTACCATAATTCTGAACGGTTTGC
GTGCCACCATTGATGTGTGTTTTCTCTGTTGACCCACCATCAACAATTTGTTCACCACTT
TCGATATTTGCTTCAGTGGCTAAACCATATACCGTTTGCTTGCCACCTTTGATATTTGCT
TTATCAGAAGTGGCACTGGCATATATTGTTTGGGTGCCAGCACTATTGAGTACAGTGCCA
ACATCTTTTCCATAAACATCCATTTTGCCGTTGGCATTAATAATCGTGTCAACTGCGCGG
GAACCAGTGACGACTGTTAATGAGCCAGCGTTTTCCAGCACTACATTTTTAGCTTCTGAA
TTCCTGATGTAGAAAGCATCACCATAACTGTTGGTTCCTTCGATAAGTGTTCCGGAGGTC
GTGGAAGCAATTAATGCGCCGCCGGATTGTTGCTCAACATGCTTAGCCTCACCACCGTCC
TGAACCTCCAGAACGCCGCCATTATTAAGTCTGGTGCTATCTGTTTTAGCCTCCTTCTGG
ACAATCAGCTTACCGCCAGTATCAATGGTAGTATTTTTCGCCGAGGTTTTAGCCACTACC
GTCAGTTCGCCGGTATTTTCCAGCACAACATAATTAGCCTCCCCTCCGGTAATAGTGAAG
TGAGAGAGCTTGTTGTATCCTTCGATATCAGTCCCTGCACCCGTGTTGGCAACTAAAGCA
CTGCCCGTCTCCTGGTTAACCCCATGTGCAATACCGCCGGTATAGACAATCAGCGAGCCT
CCGGCGCTAATATTGCTGCCAATTGCCGTACCATCTTTCTCAACAACCTGCCGGCTCCCG
GAGGATATAATTGTTGTGTCAGCTTTCCCGCCGCTTTTGATATTTTGCGTTCCGCTGTTG
ATATTGGTGCCTGTGGCTATGCCATAATTATTAATATTCTGTGTGCCACCATTAATTATG
GTATTTGTCGCGTTTCCTGCAACATCCATAACCCCGCCATTATCTATTCGGGTCGCATCA
GCTTTAGCATTGGTTAAAACTGACATTGTTCCTTTATCTTTAATAATCGTCTTGTTTGCC
GAACCATATGCGTTTATGTCTAAATGACCACCGTTTTCCAGCAACACATTGTCTGCCACG
TGATTGTGGATGGAGAATGCACCTTCACTATTCGTACCGCTCACCGTCGTACCGTTAGTG
TTAGTTTTTAAAATTGCACCATCGTGCTGGGTAACATTTGTTGCCGTACCACCCCTAACA
TCAAGCACGCCACCAGAATAAACTTCAATAACATCCGAGGTGCTGGTGTTATCAACAATT
TGCGTGCCACCAGAATAGATATGCGTATTTTTTGCCGTTGACTTACTATTCAGAGACTGA
GTTCCGCCTTCAATCGTCGTGTCCAGCGCACGGCTCTCATATACTCTTTGCTCACCGCCA
TTTTTAATGGTTGTTGTTTCTACTGTGCTCTGTTCAACATACTGTCGACCACCATTTATG
GTTGTGTTCGTTGCCAGACTTCCTTGTACTACGTCCTGAGAGCCAGACTTATTTATCGTT
GTACCATCAGCATGCCCTTGAACTTTTACTATCTGGCTACCACCATCAATGAGTATTCCA
TTCGCACTCCCTCCCTCTACGCGTGAAGCACCGCCCTTAATTGTCGTTCCATTGCTGATA
CCCCCTTTATAAACGTCCTGATTGCCACTCTCGATTGTCGTACCTGTGGAAATACCCCCG
TCATGAATTGACTGTCTGCCACCGTTAATGGTTGTATTATTAGCCTGCCCCACAAAATTG
TTATGACTTCCTATATCTTGATATCCACCAGATTCAATAAGACTTCCATTAGATACCCCG
CCATGAACATTCTGCTGGCCATGGTTGATAATATGAGTGTTATTTGTTGTACCTCGTTCA
TCCACTTTTTGGTTGCCATCTACAGTCTCATCGTTTACCACACCAATAACATTAGTAGTG
AAGGCAGCCATCCCGGGCGGGGCATATATCAAGGCAGATATCAATAAGGAAAGTACTGAG
CGGCGACAATAATAGGGACTGGTCCTGTTCATAAATTTCATCCTCTGAAAAGTGAATACT
GAGTAGCGTTTAAGCGACCTTAGCTTTGCTGCAACATCAGCCCACAGGCACCAGACCAGG
GGATTCATCCTGAAGAGACAGCGCAAGTGTATTGTGTTCACCGCTCATCAAAGACATCAT
GATGAAATGATGATATTCCGCATAAGAATGAGGCATTTTTTAAACGCAGTGCGCTGAAGT
GTGGTTGGATAAAAAAGTCAATCCATTCAGGAAATACGGGCGTATTCTTTTCTTTCGACA
ATGAGGCCGTTGGCAAAATAAAATGATTTACATAATCGTTTCTGATGAATATCTTCTGCT
CACATAAAAATCACACAATAACTTTGAGATCGCAGATTGTTTTACTTTTACAGCATTCGT
CCCCCCATTGTTGGGCAAATATAGATTGGGCCAGAGCACGAAAGTTAATACCACGTTCGC
ACAGCTCCTCCAACAGCACGACAAGATGCCACATACTGCGCCCCAGTCGGTTCAGTTTAC
AGACTAGCAGTGCGTTCCCTGCCGATGATGTCCTGACCAGTTTTTTCAGTCCGGACCTCC
TGCCACGGTTTTACGTTGAAGTGGTAACCCTGAGCACGCAGTTCTTCAGTCAGGCGTGGT
GCACCGTAACGCTGTTATTGCTGGGTAAGATCAAAAAACTTTCAGGCAGCTAAGGAAAGT
TGAACCAGACATTAGATGAAATATTTCAACCAATTACAGCACCAATTCAGTCACTGCCAG
CCCACCAAATAAATCAAGGGGTTACATGAAAACGTAGCCCCTTTTTCTTTGGTAGTGACA
CTAAAATGGATGTAGTGTGAAGAATAATCCCGTTTACTCAATCAATAATACATATTGTTT
CAATCTACGTTATTATCTCTTTGTAAAAATTGCCATTTATTAATCATTGAAAACTGCTTT
TAGAACTTGATACAACGGGACTAGTCACAACAGGACTATTCTCAACGGGATCATCCTCAG
AGGAACTATCATCAAAGTCATCATCCATAAATAAAATATCATCGAATGGTGCCACGCCCG
TGATGAGTTTTATTTTATTATTACGATCAGTCAATACTCCACTTAAACCGTTTTCGCTCA
CAGGTTTTAATGATTTTTCATTACTCTTGTTGTAAGCAGGCGCATTAAAAATACACGGAG
TATCAACATCAAACAATGACGTTCCCCAGTTCACATATTGAATATCATAGTTACTGAAGT
TCTGTCCAGAAAAGAAGCACCCCTTAAAATCCAATCCACGTAAATTATATAAACCACCCT
CTTCTTTTTGGAGAGTAATGTTAATTTTGGCTATCTCCCGGACATCATCGCCATTTTTGT
ATTTGAATACCGTTTCAAGATGTTCTCCAGACAGCTTGACTTCAGGAAATAATTTGAAAT
CAAAGCCTATATTATTATGTGTCAACGTAGATGAACAAAAAATGGAAAAAGCTTGCAGTG
CTGAATTATAGCTATCGATTTTATCTTGAGGCTGAGCTCTTGGTAAAAACTTATAGCAAC
ACTCATAAAAATTAAACAGAAGCTCTGAAGACCTTGTATTTTTATCAAATAATACCCCCT
TGAACTCATTCACAAACGCATCTTTTTTTTCTTGAATATCTATGGGGTGTTCCTTTGACT
CTGACAAAGATGAAATCTCATCTATTTTGTTTTCATATGAATTACGTGATTCCATACAGA
CATTTGGCGGCGTTTCTAAAATAACACTACGCGTACTACTTGGCTTAAGTAAACCAACAT
GAAAATCACTTTTTCTTATATTATCGAAAAGGTTCTATTCATTTCTTTTAGCGCATTCAA
AAAACTGATCGGCATTATTTTTATTCGATAATTTTTTAGTTTCAGAAAACACATTTTCAT
TGTTTTCCAGCTTTAGTTTAATGAGAAGATTTTCCCAGACCTGCTTGCTTAAACATATTA
CGTCAGGCTCACCAGAACTAACTAACTCGTGATTATTATTAAAGTGTACGTTGAATACCT
TTAAGTTATTTTCACCAACTTCATATTTAATACGTTTTAATTGTTCTCCAGCTCCCATAA
TGACAAAGGCGTTGCCTTCTTGATATATACATTCAGACATCATTTTTTGTAAAGTTTCAA
GAGCACCGCGATACGTCTCTGATGCAGCTTCCTTACAAATTAATTTTAAAATACTATGAG
CTAGTAGCTCCATGTGTTTAGAAGATTTATTTTCATTATAACTTCCACTACCCAAAACTG
CGCTAGCGTTAAATCCGTTGCTTTTACTAACTAACATTGTCTATTCCTCAATTAATGTCT
ACATGGCTATTTTTAATGTTATTACTGTTTGTCACTATAAAAAAACGCTCATTTGAGACA
ATTACTGACATTAACTGCTTCACTTGCTACGCATGGAACTTTTAATTAAATTAGCACAGG
AATGTTAAATTTAATAAACAAAAGGTTATTTCGCTGTATGATAAAAAAAACCGTTATAAT
TTATTAGTGAAAATCGTTTTTCAAGTGTTAGAAATTTATATCTCAATAGCGTTGGTTAAT
GAGCATAGCCACGCTCCTGTAACGCTCACAAAACTCATCTGCCTGCGGCGGGTGTTCTGG
TCAGTAGTAGATGTTTAAGGCGTGGCAGAGACATTTCATCCTTACTCTACGGCATTGTTC
TACATACATTGGTTGTGGTACTCACTTATCATCAGTGAGCGAACAGAGAATAGTTCAGTG
ATTTGAGTAATTAACCTGATTAAATGAAGGGGTATAATAAATGATAATACTCTGGCTTTA
TCGTTAATTACTTAATTCCACATGTAAGCAATTTGCCCGCTTGGCATAGCAGGCATTTTT
TCCAGGTACTTTTGAATGAGTACTGATGGATAAATACATTGCAGTGGCGTGCCACGTACC
AAAACACCAGCCCTCATTCGAAACCACCCACCGCACTTCTTCCTTGAAATGGCGTTAGTC
ATGAAATATAGACCGCCATCGAGTACCCCTTGTACCCTTAACTCTTCCTGATACGTAAAT
AATGATTTGGTGGCCCTTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTCGCCTGC
TCTAACCACTGAGCTAAAGGGCCTTGAGTGTGCAATAACAATACTTATAAACCACGCAAT
AAACATGATGATCATATGATGTAAATAACAGATTTTTATGCGTTCCCATTCACCTTGGGT
CGTGATTACACGCGACATAAAACCCGACACCGCCTCCATTCGCAAAGTCGATACTCGCAG
TCAACAAGCAAATGTTAATAATTAGCACTATCTATAGTTATCATCGATTCAATGATACTT
TGTAATGATTTTGTATCTAATAATATAACTTTATTACATTAGCTGAAGAGTTTTCGCATC
ATTATGATATCTGTTACTTTTCACTCCATAAAAATAAACTTCGTATAGCAATATATTCTT
TCATAGATCTTATTCTGCTAATCATTAGTTTCGTATGAGCGATTTTTGACAGTTGCCTCT
CCAGACCACATCGATAATTAATAAAACAGATTTAAGCATTATCCTTTTCCATATAAATAT
TGGATAAAAGTAGGACATCTGTTTGCAATTACTTTCACAACAATTAAACATTTTTATGTT
TCCGTATACATCATATTACTCTACCATTAGAGGAACTTTATTATGTTTTCTATAAAACCA
GGACCCAGAAATTTACCTATCGACAACCCCACATTGTTATCATGGAACATTACTGACGGG
GATCTAAATTCCAAATTAAATACATTAGAATATCTAAACTGTATAACAAATATTATTAAT
TCTTGTGGAGTTTACCCTCAAGGATTAAAAGACAGAGAAATTATATCAACTTTTCACGCA
GAAAAAGTTATTAATGATCTGTTAAAAAACGATTATAAAATTTCCCTTTCTCCAGATACA
ACTTACCGAGAGTTGAATAAAGCAGCACAGCGTAGCATTACAGCGCCAGACAGGATAGGA
GAAAGAAAAACATAGGTTTATCAACGAGATACAATGATTGAAAGAGGTGATAACAGCGGT
GTTTATCAGTATGGTCGTGCTGAACATTTCACCCACATTATATCTGACAAACCTTCCCCA
AAAGATAAATATGTTGCATATGCTATTAACATTCCTGACTATGAGCTGGCAGCCGATGTA
TATAATATTAACGTGACGTCACCTTCCGGACAGCAAGAAACATTTAAAATATTAATCAAT
CTAGAACATCTACGGCAAACACTTGAACGTAAATCTCTTACTGCTGTTCAGAAATCACAA
TGTGAAATCATCACCCCCAAAAAACCTGGCGAAGCGATTCTTCATGCTTTTAATGCCACC
TACCAGCAGATCAGAGAAAATATGTCTGAATTTGCACGTTGCCATTATGGGTATATACAA
ATCCCTCCAGTGACAACTTTCCGCGCCGACGGACCAGAAACTCCCGAAGAAGAAAAGGGT
TACTGGTTTCATGCTTATCAACCCGAAGATCTTTGTACCATCCATAATCCAATGGGAGAT
TTGCAGGATTTTATTGCATTGGTTAAAGATGCTAAAAAATTTGGTATCGATATCATTCCT
GATTATACCTTTAACTTTATGGGAATTGGGGGTAGTGGTAAAAATGACCTGGATTATCCC
TCTGCTGATATACGAGCGAAGATCAGTAAAGATATAGAAGGTGGTATCCCTGGCTATTAG
CAAGGTCAGGTTTTGATTCCATTCATTAAAGATCCAGTAACAAAAGAACGTAAACAAATC
CATCCAGAAGATATACATCTCACTGCAAAAGACTTCGAAGCAAGTAAAGATAACATCTCT
AAGGATGAATGGGAAAACCTCCATGCATTAAAAGAAAAGCGTTTAAATGGAATGCCTAAA
ACAACACCCAAAAGTGACCAGGTTATTATGTTGCAAAATCAATACGTTCGTGAAATGCGA
AAATATGGCGTACGAGGTTTACGTTATGATGCGGCAAAACACTCAAAACATGAACAAATA
GAAAGATCAATAACCCCACCGCTTAAAAATTATAATGAGCGGTTACACAATACTAACTTA
TTTAACCCAAAATATCATAAAAAAGCCGTTATGAATTACATGGAATATCTGGTAACTTGT
CAGTTGGATGAACAACAAATGTCATCACTGCTTTATGAAAGAGATGATTTAAGCGCCATT
GATTTTTCATTGCTCATGAAAACGATAAAAGCCTTTTCATTTGGTGGAGATCTTCAAACC
CTTGCATCAAAACCGGGTTCCACAATCTCAAGTATCCCATCAGAAAGACGGATATTGATT
AACATTAACCACGATTTTCCTAACAATGGTAATCTTTTCAATGACTTTCTATTTAACCAT
CAACAAGATGAACAATTAGCAATGGCATATATAGCCGCTCTGCCGTTCAGCAGGCCTTTA
GTTTACTGGGATGGCCAAGTATTAAAATCAACGACTGAAATTAAAAATTATGATGGGTCC
ACGCGTGTCGGCGGTGAGGCGTAGCTTAATAAAGGTTGCTCTACCTATCAGCAGCTCTAC
AATGAATTCCACGCATTATATATAGATAAAGCAGGAATATGGAGCGCATTTGAGGGTGTA
TCTGCAACTAAAAACGTTCTGGCCTTTAGTCGTGGGGATTCTGTGAACATTAATCACTCT
CCTCATGATGGACTAGTTATAATAAATAAAGGAAACGAAGAAGTTGAAGGTACCTGGCCT
AACAAATTGCAACCTGGAATATACAAAAACATGGGGAGTAATAGCGTTAACATTATTATT
AATAATACCCGAAAAATTATCCCCCCTGGTAAAGTATTTACGCTTAGAGGCGGAACTCTA
AATATCAATATTCCTGGGCGTAGCGCTCTTCTTTTAGGGAAAACAGGAGAACCGCCGAAC
TATCTCTATTTATAATTTAATGTTATATCTGCCCCGATAAAACGGGGCAGATAATATGTT
TAGTTTACTAACGGTCATTTTGCAGTGAAGCCATTTACTGTTTTTTATCGACCAGATAAT
CTGTTCTCTAATGTTAACTCCCCCTAACCTGTTGCTTTAGTTATTCATTTCCTGTCTCAC
TTTGCCTTAATACCCTACGTTAAATGTTACTAATTTGTTGCTTTTGATCACAATAAGAAA
ACAATATGTCGCTTTTGTGCGCATTTTTCAGAAATGTAGATATTTTTAGATTATGGCTAC
GAAATGAGCATCGCCATGTCACCCTACATCTCATAAGAGGATCGCTTCTGATGAATGCAC
TGACCGCCGTACAAAATAACGCTGTCGATTCAGGCCAGGACTATAGCGGATTCACCCTCA
CCCCGTCGGCGCAATCCCCGCGTCTGCTGGAACTCACCTTCACCGAACAGACGACCAAAC
AGTTTCTTGAGCAGGTTGCCGAGTGGCCCGTGCAGGCGCTGGAGTACAAATCGTTTCTGC
GTTTTCGGGTAGCCAAAATTCTTGACGATCTATGTGCGAACCAGCTGCAACCATTGCTGT
TGAAGACGTTGCTAAACCGCGCTGAAGGTGCGTTGTTGATCAATGCGGTGGGTGTCGATG
ATGTGAAGCAAGCGGATGAGATGGTGAAGCTGGCGACGGCGGTGGCGCATCTGATTGGCC
GTTCCAATTTCGATGCGATGAGCGGTCAGTATTACGCGCGTTTTGTAGTGAAAAATGTCG
ATAACTCAGACAGCTATCTGCGCCAGCCGCACCGCGTGATGGAGCTACACAACGACGGCA
CGTATGTCGAAGAGATAACCGATTACGTGCTGATGATGAAAATCGACGAGCAAAACATGC
AGGGCGGAAATTCGCTGCTGCTGCATCTCGATGACTGGGAACATCTCGACAACTATTTCC
GCCACCCGCTGGCGCGTCGCCCGATGCGCTTTGCCGCGCCGCCGAGTAAAAACGTCAGCA
AAGATGTTTTTCATCCGGTGTTCGACGTCGATCAACAGGGTCGCCCGGTGATGCGCTATA
TCGACCAGTTCGTCCAGCCGAAAGACTTCGAAGAAGGCGTGTGGTTGAGCGAGCTTTCCG
ACGCCATTGAAACCAGCAAAGGCATTCTTTCTGTGCCCGTTCCCGTTGGCAAATTCCTGT
TGATTAACAACCTGTTCTGGCTGCACGGTCGCGACCGCTTTACTCCGCACCCGGATCTGC
GCCGTGAACTGATGCGCCAGCGTGGCTATTTCGCTTACGCCTCTAACCACTACCAGACGC
ATCAGTAAGCGCAAAGGAATTGAGCGGATGTATGATTTTGTGATTATTGGCGGCGGCATC
ATCGGCATGTCGACCGCCATGCAACTGATTGATGTCTATCCGGACGCCCGCATTGCGTTG
CTGGAAAAAGAGTCCGCCCCGGCCTGTCACCAGACGGGCCACAACAGCGGCGTGATCCAT
GCCGGGGTCTATTACACGCCCGGCAGCCTGAAGGCGCAGTTTTGCCTGGCGGGAAACCGC
GCCACCAAAGCCTTTTGCGATCAAAACGGCATTCGCTACGACAACTGCGGCAAGATGCTG
GTTGCCACGTCCGATCTCGAAATGGAACGGATGCGCGCCTTATGGGAACGCACAGCGGCG
AACGGTATCGAGCGCGAATGGCTTAACGCCGACGAACTGCGCGAGCGCGAACCGAATATC
ACCGGGCTCGGCGGCATTTTTGTGCCGTCCAGCGGCATTGTCAGCTACCGCGACGTGACG
GCGGCGATGGCAAAAATCTTCCAGTCCAGAGGCGGTGAAATTATCTATAACGCCGAAGTC
AGCGGGCTTAATGAGCATAAAAACGGCGTGGTGATACGTACCCGTCAGGGCGGCGAATAT
GAAGCATCAACGCTGATTAGCTGTTCCGGGCTGATGGCTGACCGGCTGGTGAAAATGCTC
GGACTCGAACCGGGCTTTATCATCTGCCCGTTCCGTGGCGAGTATTTCCGCCTTGCGCCG
GAGCATAACCAGATTGTTAACCACCTGATTTACCCCATTCCCGACCCGGCAATGCCGTTT
TTGGGCGTTCATCTCACCCGCATGATCGACGGCAGCGTGACCGTCGGGCCAAACGCGGTG
CTGGCTTTCAAACGCGAAGGCTATCGCAAGCGCGACTTCTCATTTAGCGACACGCTGGAG
ATTTTGGGCTCGTCGGGGATTCGCCGGGTGCTGCAAAACCATCTACGCTCAGGACTGGGC
GAGATGAAAAACTCGCTGTGCAAAAGCGGCTATCTGCGGCTGGTGCAAAAGTATTGTCCC
CGGCTTTCGTTAAGCGATCTCCAGCCCTGGCCCGCCGGTGTGCGGGCGCAGGCGGTATCG
CCGGACGGCAAGCTGATTGACGATTTTCTGTTTGTCACCACCCCGCGCACGATCCACACC
TGCAATGCGCCCTCCCCGGCAGCGACATCAGCAATTCCTATTGGTGCGCATATTGTCAGC
AAGGTACAAACGCTGTTGGCAAGCCAGAGTAACCCCGGACGCACGCTGCGAGCGGCACGT
AGTGTGGATGCCTTACACGCCGCATTTAATCAATAACCTTTGAAAACAGGATGTAGCGAT
GAAACTTAACGACAGTAACTTATTCCGCCAGCAGGCGTTGATTAACGGGGAATGGCTGGA
CGCCAACAATGGTGAAGCCATCGACGTCACCAATCCGGCGAACGGCGACAAGCTGGGTAG
CGTGCCGAAAATGGGCGCGGATGAAACCCGCGCCGCTATCGACGCCGCCAACCGCGCCCT
GCCCGCCTGGCGCGCGCTCACCGCCAAAGAACGCGCCACCATTCTGCGCAACTGGTTCAA
TTTGATGATGGAGCATCAGGACGATTTAGCGCGCCTGATGACCCTCGAACAGGGTAAACC
ACTGGCCGAAGCGAAAGGCGAAATCAGCTACGCCGCCTCCTTTATTGAGTGGTTTGCCGA
AGAAGGCAAACGCATTTATGGCGACACCATTCCTGGTCATCAGGCCGATAAACGCCTGAT
TGTTATCAAGCAGCCGATTGGCGTCACCGCGGCTATCACGCCGTGGAACTTCCCGGCGGC
GATGATTACCCGCAAAGCCGGTCCGGCGCTGGCAGCAGGCTGCACCATGGTGCTGAAGCC
CGCCAGTCAGACGCCGTTCTCTGCGCTGGCGCTGGCGGAGCTGGCGATCCGCGCGGGCGT
TCCGGCTGGGGTATTTAACGTGGTCACCGGTTCGGCGGGCGCGGTCGGTAACGAACTGAC
CAGTAACCCGCTGGTGCGCAAACTGTCGTTTACCGGTTCGACCGAAATTGGCCGCCAGTT
AATGGAACAGTGCGCGAAAGACATCAAGAAAGTGTCGCTGGAGCTGGGCGGTAACGCGCC
GTTTATCGTCTTTGACGATGCCGACCTCGACAAAGCCGTGGAAGGCGCGCTGGCCTCGAA
ATTCCGCAACGCCGGGCAAACCTGCGTCTGCGCCAACCGCCTGTATGTGCAGGACGGCGT
GTATGACCGTTTTGCCGAAAAATTGCAGCAGGCAGTGAGCAAACTGCACATCGGCGACGG
GCTGGATAACGGCGTCACCATCGGGCCGCTGATCGATGAAAAAGCGGTAGCAAAAGTGGA
AGAGCATATTGCCGATGCGCTGGAGAAAGGCGCGCGCGTGGTTTGCGGCGGTAAAGCGCA
CGAACGCGGCGGCAACTTCTTCCAGCCGACCATTCTGGTGGACGTTCCGGCCAACGCCAA
AGTGTCGAAAGAAGAGACGTTCGGCCCCCTCGCCCCGCTGTTCCGCTTTAAAGATGAAGC
TGATGTGATTGCGCAAGCCAATGACACCGAGTTTGGCCTTGCCGCCTATTTCTACGCCCG
TGATTTAAGCCGCGTCTTCCGCGTGGGCGAAGCGCTGGAGTACGGCATCGTCGGCATCAA
TACCGGCATTATTTCCAATGAAGTGGCCCCGTTCGGCGGCATCAAAGCCTCGGGTCTGGG
TCGTGAAGGTTCGAAGTATGGCATCGAAGATTACTTAGAAATCAAATATATGTGCATCGG
TCTTTAACTGGAGAATGCGAATGAACAGCAATAAAGAGTTAATGCAGCGCCGCAGTCAGG
CGATTCCCCGTGGCGTTGGGCAAATTCACCCGATTTTCGCTGACCGCGCGGAAAACTGCC
GGGTGTGGGACGTTGAAGGCCGTGAGTATCTTGATTTCGCGGGCGGGATTGCGGTGCTCA
ATACCGGGCACCTGCATCCGAAGGTGGTGGCCGCGGTGGAAGCGCAGTTGAAAAAACTGT
CGCACACCTGCTTCCAGGTGCTGGCTTACGAGCCGTATCTGGAGCTGTGCGAGATTATGA
ATCAGAAGGTGCCGGGCGATTTCGCCAAGAAAACGCTGCTGGTTACGACCGGTTCCGAAG
CGGTGGAAAACGCGGTAAAAATCGCCCGCGCCGCCACCAAACGTAGCGGCACCATCGCTT
TTAGCGGCGCGTATCACGGGCGCACGCATTACACGCTGGCGCTGACCGGCAAGGTGAATC
CGTACTCTGCGGGCATGGGGCTGATGCCGGGTCATGTTTATCGCGCGCTTTATCCTTGCC
CGCTGCACGGCATAAGCGAGGATGACGCTATCGCCAGCATCCACCGGATCTTCAAAAATG
ATGCCGCGCCGGAAGATATCGCCGCCATCGTGATTGAGCCGGTTCAGGGCGAAGGCGGTT
TCTACGCCTCGTCGCCAGCCTTTATGCAGCGTTTACGCGCTCTGTGTGACGAGCACGGGA
TCATGCTGATTGCCGATGAAGTGCAGAGCGGCGCGGGGCGTACCGGCACGCTGTTTGCGA
TGGAGCAGATGGGCGTTGCGCCGGATCTTACCACCTTTGCGAAATCGATCGCGGGCGGCT
TCCCGCTGGCGGGCGTCACCGGGCGCGCGGAAGTAATGGATGCCGTCGCTCCAGGCGGTC
TGGGCGGCACCTATGCGGGTAACCCGATTGCCTGCGTGGCTGCGCTGGAAGTGTTGAAGG
TGTTTGAGCAGGAAAATCTGCTGCAAAAAGCCAACGATCTGGGGCAGAAGTTGAAAGACG
GATTGCTGGCGATAGCCGAAAAACACCCGGAGATCGGCGACGTACGCGGGCTGGGGGCGA
TGATCGCCATTGAGCTGTTTGAAGACGGCGATCACAACAAGCCGGACGCCAAACTCACCG
CCGAGATCGTGGCTCGCGCCCGCGATAAAGGCCTGATTCTTCTCTCCTGCGGCCCGTATT
ACAACGTGCTGCGCATCCTTGTACCGCTCACCATTGAAGACGCTCAGATCCGTCAGGGTC
TGGAGATCATCAGCCAGTGTTTTGATGAGGCGAAGCAGTAGCGCCGCTCCTATGCCGGAG
GCGACGCTGCGCGTCTTGTCCGGCCTACGGGGATCCAGGTCGGATAAGGCGTTTACGCCG
CATCCGACAATCTGTACGTGAACAGGAAGAAATCTATGTTGGCCGGGTAAGGCGGAGCCG
CTCTCCGGCAAAAAGAATCAATAACAATTATACGCGTGACCCGGCGCGGGAAATGTCGGG
GCGCTCTCCCAAGTGACACACTTTCGAGAGGATTCAGGATGGGGCAATCATCGCAACCAC
ATGAGTTAGGCGGCGGGCTGAAGTCACGCCACGTCACCATGTTGTCTATTGCCGGTGTTA
TCGGCGCAAGTCTGTTTGTCGGTTCCAGCGTCGCCATCGCCGAAGCGGGCCCGGCGGTAT
TACTGGCCTATCTGTTCGCCGGGCTACTGGTGGTTATGATTATGCGGATGTTGGCGGAAA
TGGCGGTTGCCACGCCCGATACCGGTTCGTTTTCCACCTATGCCGATAAAGCCATTGGTC
GCTGGGCGGGCTATACCATCGGCTGGTTGTACTGGTGGTTTTGGGTACTGGTTATCCCGC
TGGAAGCCAACATCGCCGCCATGATCCTGCACTCATGGGTTCCAGGCATTCCCATCTGGT
TATTTTCCCTCGTCATTACCCTCGCCTTAACTGGCAGTAACTTATTAAGCGTTAAAAACT
ACGGCGAATTTGAGTTCTGGCTGGCGCTGTGCAAAGTCATCGCTATCCTGGCCTTTATTT
TCCTTGGTGCAGTCGCAATTAGCGGTTTTTACCCGTATGCCGAAGTGAGCGGGATCTCAA
GATTGTGGGATAGCGGCGGCTTTATGCCCAACGGTTTCGGTGCGGTATTAAGCGCGATGT
TGATCACCATGTTCTCGTTTATGGGCGCAGAAATTGTCACCATTGCCGCCGCGGAATCCG
ACACGCCGGAAAAACATATTGTCCGCGCCACCAACTCGGTTATCTGGCGTATTTCTATCT
TCTATTTATGTTCTATTTTTGTCGTCGTGGCATTAATTCCGTGGAATATGCCCGGACTAA
AAGCCGTCGGTTCTTATCGCTCGGTACTGGAATTGCTCAATATTCCCCATGCGAAATTAA
TCATGGACTGCGTGATATTACTTTCCGTAACCAGTTGCCTGAACTCGGCGCTGTATACCG
CGTCAAGGATGCTCTACTCCTTAAGTCGTCGCGGTGATGCTCCCGCGGTAATGGGTAAAA
TCAACCGCAGTAAAACCCCGTACGTGGCGGTGTTACTCTCCACCGGCGCGGCATTCTTAA
CGGTGGTGGTGAACTATTACGCGCCTGCGAAGGTATTTAAATTTCTGATCGACAGCTCCG
GCGCTATCGCCCTGCTGGTTTATTTAGTCATCGCCGTTTCACAGTTGCGGATGCGCAAAA
TTCTGCGAGCAGAAGGAAGCGAAATTCGCTTGCGAATGTGGCTTTATCCGTGGCTCACCT
GGCTAGTCATCGGCTTTATTACCTTTGTGTTGGTAGTGATGCTATTCCGTCCGGCGCAAC
AGTTAGAAGTGATCTCCACCGGCTTATTAGCGATAGGGATTATCTGTACCGTGCCAATTA
TGGCTCGCTGGAAAAAGCTGGTATTGTGGCAAAAAACACCCGTTCATAATACGCGCTGAT
CATGATCAGGAGTCACACCATGACCATTACGTCTCTGGATGGCTATCGCTGGCTGAAGAA
CGATATTATTCGCGGTAATTTTCAACCGGATGAAAAATTACGAATGAGTTTGCTGACATC
GCGTTATGCACTTGGCGTTGGGCCGTTACGGGAAGCTCTTTCGCAACTGGTGGCGGAACG
GCTGGTCACGGTGGTGAATCAAAAAGGGTATCGGGTGGCGTCTATGTCAGAGCAGGAGCT
GCTCGATATTTTCGACGCCCGCGCCAATATGGAAGCGATGTTAGTGAGTCTGGCGATTGC
CCGCGGTGGCGATGAGTGGGAGGCAGACGTTCTCGCAAAAGCGCATCTGCTGAGTAAGCT
TGAGGCCTGTGACGCCAGCGAGAAAATGCTTGATGAGTGGGATCTGCGTCATCAGGCGTT
TCATACGGCAATTGTGGCGGGCTGTGGTTCTCACTATTTGCTGCAAATGCGTGAACGGTT
GTTTGATCTGGCGGCGCGTTATCGATTTATCTGGCTGCGGCGAACGGTGCTTTCGGTGGA
AATGCTGGAGGATAAACACGATCAGCACCAGACCCTGACTGCGGCGGTACTGGCGCGAGA
TACCGCGCGCGCCAGTGAGTTAATGCGCCAGCATTTACTGACGCCAATTCCCATTATCCA
GCAGGCGATGGCTGGCAATTAACTACTCTTCCGGAATACGCAACACTTGCCCCGGATAAA
TTTTATCCGGGCTTTTTAGCATCGGTTTATTCGCTTCGAAGATTTTATTGTACAGATTAG
CGTTACCGTAGACCTGTTTGGAAATGGCACTCAGAGTGTCGCCAGACTTAACGGTATAAA
ACTGGCTGGCAGTGGCTGGTGTCGCCGTTTTCACCTGATCATCGACACTGGCAATACCGG
AAATATTCCCCACCGCAACAAGGATTTTCTCCTTCGCCTCCTGACTCAGGCCGTCACCAG
TGACCGTCGCTTTGCCGTCGGCAATTTGAATATTCACTTTATCGGCATCCGGTATACCGG
TTTTGTTCAGATGCTCCTGCACCTTCTTCGCCTGATCGTCTTTATCGTGCTGACCTGTAA
CCGCGTCCCAGAGTTTTTCTCCGGCATCTTTCACAAAATTGAACAGACCCATAGCTACCT
CATTCGTTAACGGAAACACTCAGAAAGTGTAGCAGAGGAACGCGGCGCGTTAACGCCGCG
GGGATGAGCACAGGTTTAATCGCGGGTTTGCACCCAGAACGCGTGAATCAAACCGGGGAT
ATACCCAAGCAGTGTCAACAGAATATTAATAATGAACGCCCAACCGAACCCTTTACCGAG
CAGCACGCCGAGCGGCGGCAGAATGATGGTGATGACGATTCTCCAGAAACCCATATGTAC
TCCCTATAAGAAAATTACTCATTGTTTAAAAAGAGATTTTATCTCTTAAGCGTAGTAATT
TTAGCGGAGCCTGCCAGTTTCAGCTTACGCTTTTACTCTCATTTACGCTGCTGAGGCTGG
TATATGTTGCATTTTTAGTTTAGAGTTTACTTAATTTAGAAAATACTTAAATAAATATGA
CTGAACTCGCGCAATTACAGGCCAGTGCCGAACAGGCAGCGGCCTTATTGAAAGCAATGA
GCCACCCTAAACGATTGCTGATTCTGTGCATGCTTAGCGGTTCCCCCGGCACCAGCGCGG
GAGAGCTGACGCGCATTACCGGACTGAGTGCCTCTGCGACATCACAGCATCTCGCTCGTA
TGCGGGACGAAGGGCTTATCGACAGCCAACGGGATGCCCAACGCATTCTATATTCCATTA
AAAATGAGGCGGTAAATGCCATTATCGCCACCCTGAAAAATGTCTATTGTCCGTAAGGAG
TCACTATGGCTTTGACAACCATTTCGCCGCATGATGCACAAGAATTAATCGCACGCGGCG
CAAAGTTAATCGATATTCGTGATGCTGATGAATATCTTCGTGAACATATTCCTGAAGCAG
ATCTGGCTCCATTATCCGTGCTGGAACAGTCAGGTCTTCCGGCTAAATTACGTCACGAGC
AAATTATATTCCACTGCCAGGCAGGTAAACGCACCAGTAATAATGCCGATAAATTAGCAG
CGATTGCCGCCCCCGCAGAAATCTTTTTACTCGAAGATGGGATTGATGGCTGGAAAAAAG
CAGGATTGCCAGTAGCGGTAAATAAATCTCAACCCTTGCCGTTAATGCGCCAGGTGCAGA
TCGCTGCGGGTGGTTTAATATTAATCGGCGTTGTACTGGGTTATACCGTAAATAGCGGTT
TCTTCTTATTAAGTGGCTTTGTTGGTGCCGGGTTACTGTTTGCAGGAATCAGCGGTTTTT
GTGGAATGGCAAGGTTGTTAGATAAGATGCCGTGGAACCAACGAGCTTGAGAAGCGACGC
CGGACGCGCCCTAGCAGCGACATCCGGCCTCAGTAATTAGATCAGGAAATCGTCGAGAGA
TTTACCTTCTGCCAGCGCCTGAGCAATTGGCTTCGGTGTACGGCCCTGACCGGTCCAGGT
TTTAGTTTCACCGTTAACATCGGTGAATTTATATTTCGCCGGACGCGGCTGGCGTTTTTT
ACCAGCGCGTGGTGCAGCAGCAGAGCTATTACCCAATAACTCTTCCGGGTTAATTCCGTC
AGCTTTCATCAGCTCCAGCCAGGTGCTAATTTTTTCCTGGCGCTCTGCCAGTTCACGCTG
CTGCTGTTCTTCTTCTTCACGTCTTTCTTTAGTGACAACCCTGAATTTTTCGAGCATTTC
TTCAAGAACGTCAATGGAGAATTCGCGAGCCATCGCACGGAGGGTGCGAATGTTATTTAA
ACTTTGTAACATTACGGACATAATAAAGAAAACCTTTTAACGCCAAAACAAAAAAAGTAT
TTCGTCGCGTAGTGTAAGCGATCACTTATTATATTTCCACAAAATTTAATCTATTTACAG
TCCTGCGCGAGATTATTTCAGCTGTTATTTTCTGAAACTCTCAGAATAATTTCAAGATTA
TATATTAGCCATTTTGATGAGTAATTTAGATTATTGGTGAACAGAGCGGCGCTCTCTGCT
CGCTAATTCCGCAAGCCTGACAAAATCAAAGTGAATAAAAATGCAATATAACAGAATAAA
AGAAAACATCCATCACTGGTGCTTTCTGCTGTTAATGTACATTGTCTGGCATAAAAAATG
CTGAAAATGACCCAGCTACTACATACACCGAATTCTCTACGCTTATAGCGTTACCTCACC
CCCAAACTTTCATTAGTGATATTAAAGGTAAGGCCATATCTAATTGATTTAATTAAAAAT
AAATCATATCGGCATGTAAAAATCCACAATGTACAAAAAACGAGCCGTTACGGAATATTT
TATCTACAAAAACTGACTAAATAAAAATTTTTCACTAATTGATTAGTCATAGCCAGCGAT
ATACGCTATGCGAAAATGCAGATGGCAATGAGATCCACTGCTTTCATCTCCATTAACATC
CCATTACGCTTTTATTAAGGAGCATTAGCATGTTCTCACCGCAGTCACGCTTGCGTCATG
CAGTTGCAGATACGTTCGCGATGGTTGTTTACTGTTCTGTCGTGAACATGTGTATTGAAG
TTTTCCTCTCCGGAATGAGCTTCGAACAGTCTTTTTATTCCAGATTGGTAGCGATTCCGG
TGAACATCTTAATTGCATGGCCATACGGTATGTACCGTGATCTGTTTATGCGCGCGGCAC
GCAAAGTTAGCCCGTCGGGCTGGATAAAAAATCTGGCGGATATCCTGGCTTATGTGACGT
TCCAGTCACCGGTGTATGTGGCGATCTTGTTAGTGGTGGGCGCAGACTGGCATCAGATTA
TGGCGGCGGTCAGTTCAAACATCGTTGTTTCGATGTTGATGGGGGCGGTTTATGGCTACT
TCCTCGATTATTGCCGCCGACTGTTTAAAGTCAGCCGTTACCAGCAGGTAAAAGCCTGAC
TCTTCTTTTCGCGACTGGCATCGCCAGTCGCGTCTTTAACTGGCTTCGCCAAATAAACCA
TTCAAATAACGTTCAAGCGCAACACGCGAACTAAAGCCATGCGGGATACCGTAATGCTCG
TGTCGCTCGCCTGCTAAATAGAGCGGAAATTGCTGGTAATGATCGCAAGTTTTAATATCG
GAAGCGGGTTCAGCCAGTGTCGAACTGCGTTCTTTTAATGTTGGATGAATTACCAGAGCG
GTACGTCCCATTCGCGCTTCGCGATTAACATAGACATAATTTTCCCCACGGCGGTAACCA
TACGCTTTCTGGGTTACCACATCGACAGTAAAACCGACTTTTTCAAGTACGCGCGCCACC
TCGTCTGGTCGTAAATACATATTTGATCCTCGTTATTATCAACCGCGGGCCTACCTTACC
TGATTGCGCATTCACAACGCTTTCAGAAAAGTCCATAAAGCCGCGATGAACCTCAGTTAA
GAAAATTATGGTCTACACTGAAAATTACATCGAATTCTAATGGGGGATCATATGTTTAAC
CGACCGAACCGCAACGACGTTGATGATGGCGTGCAGGATATCCAGAATGATGTCAATCAA
TTAGCTGACAGCCTCGAATCTGTATTGAAGTCCTGGGGCAGCGACGCCAAAGGGGAAGCT
GAAGCCGCACGCAGTAAAGCTCAGGCATTGCTGAAAGAAACCAGGGCGCGAATGCATGGT
CGTACTCGCGTCCAGCAAGCCGCGCGCGATGCCGTTGGCTGCGCGGATTCTTTTGTTCGT
GAAAGACCCTGGTGTAGCGTGGGTACAGCAGCTGCGGTAGGTATTTTTATCGGCGCACTG
TTAAGCATGCGCAAATCGTAGTGCAAAAATGATAATAAATACGCGTCTTTGACCCCGAAG
CCTGTCTTCGGGGTTTCTTTTTGCCTGGTGAATCACAAAAATCCCCCTACCCCGTCACGC
TCATATCCAGGGTAATTTCGACCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTC
AACTACATCTAGTATCTCTGTATCAACAGAGAGACAACCCGACGCGTATCATCGCGCCGT
ATCTTCATTTTAAACGGAAATACGAATCATGCGCATTACTATTTACACTCGTAACGATTG
CGTTCAGTGCCACGCCACCAAACGGGCGATGGAAAACCGGGGCTTTGATTTTGAAATGAT
TAATGTCGATCGCGTTCCTGAAGCGGCAGAAGCGTTGCGTGCTCAGGGCTTTCGTCAGTT
GCCGGTAGTGATTGCTGGCGATCTTAGCTGGTCTGGTTTCCGTCCGGACATGATTAACCG
TCTGCATCCAGCGCCACACGCGGCCAGTGCATGAGCCAGCTCGTCTACTTCTCCAGCAGC
TCCGAAAACACGCAGCGTTTTATCGAACGTTTAGGTCTGCCCGCGGTGCGCATCCCGCTC
AATGAGCGGGAACGGATTCAGGTAGACGAGCCTTACATCCTGATCGTGCCCTCTTACGGC
GGCGGCGGTACGGCTGGCGCGGTGCCACGACAGGTAATTCGCTTTTTAAACGACGAGCAC
AACCGGGCGTTGCTTCGCGGCGTTATTGCTTCTGGTAATCGCAACTTTGGTGAGGCGTAT
GGCCGCGCCGGAGATGTGATTGCCCGGAAATGCGGCGTGCCGTGGCTGTACCGTTTTGAA
CTCATGGGTACGCAAAGCGATATCGAAAACGTTCGTAAAGGAGTAACCGAATTTTGGCAA
CGACAACCGCAGAATGCCTGACGCAGGAAACGATGGATTACCACGCGCTGAATGCGATGC
TTAACCTCTACGATAGCGCAGGTCGCATTCAGTTCGATAAAGACCGCCAGGCCGTTGACG
CCTTTATTGCGACGCATGTGCGTCCGAACAGTGTGACCTTCAGTAGCCAGCAGCAGCGCC
TGAACTGGCTGGTCAACGAAGGTTACTATGATGAAAGCGTTCTTAATCGCTACTCTCGCG
ACTTTGTCATTACGCTGTTTACCCACGCACACACCAGCGGTTTTCGTTTCCAGACATTCC
TCGGGGCATGGAAGTTTTACACCAGCTATACGTTGAAGACATTCGACGGTAAACGTTATC
TGGAAGATTTTGCCGATCGAGTAACGATGGTGGCGCTGACGCTGGCACAAGGCGATGAGA
CGCTGGCGTTGCAACTGACCGATGAAATGCTGTCAGGACGCTTTCAGCCAGCCACGCCAA
CATTCCTCAACTGCGGTAAGCAGCAGCGCGGCGAACTGGTTTCCTGTTTTTTGCTGCGTA
TTGAAGACAATATGGAGTCGATTGGTCGGGCGGTAAATTCCGCACTGCAGCTGTCGAAAC
GCGGCGGCGGCGTAGCATTTTTGCTGTCGAATCTGCGAGAAGCGGGCGCGCCAATTAAAC
GTATTGAAAATCAATCTTCTGGCGTAATTCCGGTGATGAAAATGCTGGAAGACGCATTTT
CCTATGCCAACCAACTCGGCGCTCGTCAGGGGGCTGGTGCAGTCTATTTACATGCTCATC
ATCCCGATATTCTGCGTTTTCTCGACACGAAACGGGAAAATGCCGACGAAAAAATCCGCA
TTAAAACACTGTCGCTTGGCGTGGTGATCCCGGATATCACTTTCCATCTGGCAAAAGAGA
ATGCGCAGATGGCGCTGTTTTCGCCTTATGACGTAGAGCGAGTTTATGGCAAGCCGTTTG
CCGATGTGGCCATCAGCCAACACTATGACGAACTGGTTGCCGATGAACGCATTCGCAAAA
AATACCTCAACGCCCGTGATTTCTTCCAGCGACTGGCAGAAATCCAGTTTGAGTCCGGCT
ATCCCTACATCATGTATGAAGACACGGTAAACCGTGCTAACCCTATCGCCGGGCGCATAA
ATATGAGTAATCTCTGCTCAGAAATTTTGCAGGTTAACAGCGCCTCAGAGTATGACGAGA
ATCTCGACTATACCCGCACAGGCCATGATATTTCCTGCAATTTAGGTTCGTTGAATATTG
CGCACACCATGGATTCCCCCGATTTTGCCCGCACGGTAGAGACTGCCGTGCGCGGTTTAA
CGGCAGTATCAGATATGAGTCATATCCGCAGCGTGCCGTCCATCGAAGCCGGAAATGCCG
CCTCGCACGCCATCGGACTGGGGCAGATGAATTTACACGGCTATCTGGCGCGAGAAGGCA
TCGCTTATGGTTCGCCGGAAGCACTGGATTTCACCAATCTCTATTTCTATGCCATCACCT
GGCATGCACTGCGTACCTCGATGTTGCTGGCACGCGAACGCGGTGAAACCTTCGCCGGGT
TCAAACAGTCACGCTATGCCAGTGGTGAATATTTTAGCCAATATCTGCAAGGGAACTGGC
AGCCGAAAACGGCGAAAGTTGGCGAACTGTTTACCCGTAGCGGTATTACGTTACCTACCC
GTGAGATGTGGGCGCAGCTGCGCGACGACGTGATGCGCTACGGCATATACAACCAGAATC
TTCAGGCGGTGCCGCCAACCGGTTCTATCTCTTATATCAACCATGCTACGTCGAGTATTC
ATCCGATTGTGGCGAAAGTAGAGATACGCAAAGAGGGCAAAACAGGACGCGTTTACTACC
CTGCCCCGTTTATGACTAACGAGAATCTGGCGCTGTATCAGGACGCTTACGAAATTGGCG
CAGAAAAGATCATCGACACCTACGCGGAAGCGACTCGCCATGTCGATCAGGGGCTGTCGC
TGACGCTTTTTTTCCCCGATACCGCCACCACTCGCGATATCAACAAAGCGCAGATTTACG
CCTGGCGCAAGGGTATCAAAACGCTCTATTACATCCGCCTGCGTCAGATGGCGCTGGAAG
GCACTGAAATTGAAGGCTGCGTCTCCTGTGCACTTTAAGGAATATCTATGAAACTCTCAC
GTATCAGCGCCATCAACTGGAACAAGATATCTGACGATAAAGATCTGGAGGTGTGGAATC
GCCTGACCAGCAATTTCTGGCTACCAGAAAAGGTGCCGCTGTCGAACGATATTCCTGCCT
GGCAGACATTAACTGTCGTAGAACAACAACTGACGATGCGCGTTTTTACTGGCCTGACGC
TGCTCGACACGCTGCAAAATGTTATCGGCGCGCCTTCTCTGATGCCCGATGCACTCACGC
CTCATGAAGAAGCGGTATTATCGAATATCAGCTTTATGGAAGCGGTTCATGCCCGCTCTT
ACAGTTCGATTTTCTCGACGCTATGCCAGACCAAAGATGTCGATGCCGCCTACGCCTGGA
GTGAAGAAAACGCACCGTTGCAGCGAAAAGCTCAGATTATTCAGCAACATTATCGCGGTG
ATGATCCGCTGAAAAAGAAAATCGCCAGTGTGTTTCTTGAATCTTTTTTGTTCTATTCCG
GTTTCTGGCTGCCGATGTATTTTTCCAGCCGCGGAAAGCTGACCAATACCGCGGACCTGA
TCCGTCTGATTATCCGCGATGAAGCAGTCCACGGTTACTACATAGGCTATAAATATCAGA
AAAACATGGAAAAGATATCTCTGGGACAACGTGAAGAGTTGAAGAGTTTCGCCTTCGATT
TGTTGCTGGAACTCTACGACAACGAGTTGCAATACACCGATGAGCTGTACGCCGAAACCC
CGTGGGCTGACGATGTGAAAGCGTTTCTCTGTTACAACGCCAATAAGGCTTTGATGAATC
TGGGCTACGAACCGTTATTTCCCGCAGAAATGGCGGAAGTGAATCCGGCAATCCTCGCCG
CGCTTTCGCCGAATGCCGATGAAAATCACGATTTCTTTTCCGGTTCAGGCTCCTCTTATG
TGATGGGGAAAGCGGTTGAAACAGAAGATGAAGACTGGAATTTCTGAGGGTGTTATTTTC
AAAAATATCACTACCCGCAGCAGGGAAATAATTCCCGCCAAATAGCTTTTTATCACGCAA
ATAATTTGTGGTGATCTACACTGATACTCTGTTGCATTATTCGCCTGAAACCACAATATT
CAGGCGTTTTTTCGCTATCTTTGACAAAAAATATCAACTTTCTCGATTTGCTCTCAGCCC
TTATATCACGGGAAATTCCGGCGATTTGCTCGCATCAATATTCATGCCACATTTGCCATC
AGGGGTTGCCTCAGATTCTCAGTATGTTAGGGTAGAAAAAAGTGACTATTTCCATTGGGT
AATATATCGACATAGACAAATAAAGGAATCTTTCTATTGCATGGCAATTAAATTAGAAAT
TAAAAATCTTTATAAAATATTTGGCGAGCATCCACAGCGAGCGTTCAAATATATCGAACA
AGGACTTTCAAAAGAACAAATTCTGGAAAAAACTGGGCTATCGCTTGGCGTAAAAGACGC
CAGTCTGGCCATTGAAGAAGGCGAGATATTTGTCATCATGGGATTATCCGGCTCGGGTAA
ATCCACAATGGTACGCCTTCTCAATCGCCTGATTGAACCCACCCGCGGGCAAGTGCTGAT
TGATGGTGTGGATATTGCCAAAATATCCGACGCCGAACTCCGTGAGGTGCGCAGAAAAAA
GATTGCGATGGTCTTCCAGTCCTTTGCCTTAATGCCGCATATGACCGTGCTGGACAATAC
TGCGTTCGGTATGGAATTGGCCGGAATTAATGCCGAAGAACGCCGGGAAAAAGCCCTTGA
TGCACTGCGTCAGGTCGGGCTGGAAAATTATGCCCACAGCTACCCGGATGAACTCTCTGG
CGGGATGCGTCAACGTGTGGGATTAGCCCGCGCGTTAGCGATTAATCCGGATATATTATT
AATGGACGAAGCCTTCTCGGCGCTCGATCCATTAATTCGCACCGAGATGCAGGATGAGCT
GGTAAAATTACAGGCGAAACATCAGCGCACCATTGTCTTTATTTCCCACGATCTTGATGA
AGCCATGCGTATTGGCGACCGAATTGCCATTATGCAAAATGGTGAAGTGGTACAGGTCGG
CACACCGGATGAAATTCTCAATAATCCGGCGAATGATTATGTCCGTACCTTCTTCCGTGG
CGTTGATATTAGTCAGGTATTCAGTGCGAAAGATATTGCCCGCCGGACACCGAATGGCTT
AATTCGTAAAACCCCTGGCTTCGGCCCACGTTCGGCACTGAAATTATTGCAGGATGAAGA
TCGCGAATATGGCTACGTTATCGAACGCGGTAATAAGTTTGTCGGCGCAGTCTCCATCGA
TTCGCTTAAAACCGCGTTAACGCAGCAGCAAGGTCTTGATGCGGCGCTGATTGATGCGCC
GTTAGCAGTCGATGCACAAACGCCTCTTAGCGAGTTGCTCTCTCATGTCGGACAGGCACC
CTGTGCGGTGCCCGTGGTCGACGAGGACCAACAGTATGTCGGCATCATTTCGAAAGGAAT
GCTGCTGCGCGCTTTAGATCGTGAGGGGGTAAATAATGGCTGATCAAAATAATCCGTGGG
ATACCACGCCAGCGGCGGACAGTGCCGCGCAATCCGCAGACGCCTGGGGTACACCGACGA
CTGCACCGACTGACGGCGGTGGTGCTGACTGGCTGACCAGTACGCCTGCGCCAAACGTCG
AGCATTTTAATATTCTCGATCCGTTCCATAAAACGCTGATCCCGCTCGACAGTTGGGTCA
CTGAAGGGATCGACTGGGTCGTTACCCATTTCCGTCCCGTCTTCCAGGGCGTGCGCGTTC
CGGTTGATTATATCCTCAACGGTTTCCAGCAATTGCTGCTGGGTATGCCCGCACCGGTGG
CGATTATCGTTTTCGCTCTCATCGCCTGGCAGATTTCCGGGGTCGGAATGGGTGTGGCGA
CGCTGGTTTCGCTGATTGCCATCGGCGCAATCGGTGCCTGGTCGCAGGCAATGGTGACTC
TGGCGCTGGTGTTAACCGCCCTGCTGTTCTGTATCGTCATCGGTTTGCCGTTGGGGATAT
GGCTGGCGAGAAGTCCGCGAGCGGCGAAAATTATTCGTCCACTGCTTGATGCCATGCAGA
CCACGCCAGCGTTTGTTTATCTGGTGCCAATCGTCATGCTATTTGGTATCGGTAACGTGC
CGGGCGTGGTGGTGACGATCATCTTTGCTCTGCCGCCGATTATCCGTCTGACCATTCTGG
GGATTAACCAGGTTCCGGCGGATCTGATTGAAGCCTCGCGCTCATTCGGTGCCAGCCCGC
GCCAGATGCTGTTCAAAGTTCAGTTACCGCTGGCGATGCCGACCATTATGGCGGGCGTTA
ACCAGACGCTGATGCTGGCCCTTTCTATGGTGGTCATCGCCTCGATGATTGCCGTCGGCG
GGTTGGGTCAGATGGTACTTCGCGGTATCGGTCGTCTGGATATGGGGCTTGCCACCGTTG
GCGGCGTCGGGATTGTGATCCTCGCCATTATCCTCGATCGTCTGACGCAGGCCGTTGGGC
GCGACTCACGCAGTCGCGGCAACCGTCGCTGGTACACCACTGGCCCTGTTGGTCTGCTGA
CCCGCCCATTCATTAAGTAACTCTGCACTTGCCCGGTGACGCCGGGCATTATCACCCTGC
CAAAAAAAGGAATAACAATGCGACATAGCGTACTTTTTGCGACAGCGTTTGCCACGCTTA
TCTCTACACAAACTTTTGCTGCCGATCTGCCGGGCAAAGGCATTACTGTTAATCCAGTTC
AGAGCACCATCACTGAAGAAACCTTCCAGACGCTGCTGGTCAGTCGTGCGCTGGAGAAAT
TAGGTTATACCGTCAACAAACCCAGCGAAGTAGATTACAACGTTGGCTACACCTCGCTTG
CTTCCGGCGATGCAACCTTCACCGCCGTGAACTGGACGCCACTGCATGACAACATGTACG
AAGCTGCCGGTGGCGATAAGAAATTTTATCGTGAAGGGGTATTTGTTAACGGCGCGGCAC
AGGGTTACCTGATCGATAAGAAAACCGCCGACCAGTACAAAATCACCAACATCGCACAAC
TGAAAGATCCGAAGATCGCCAAACTGTTCGATACCAACGGCGACGGAAAAGCGGATTTAA
CCGGTTGTAACCCTGGCTGGGGCTGCGAAGGTGCGATCAACCACCAGCTTGCCGCGTATG
AACTGACCAACACCGTGACGCATAATCAGGGGAACTACGCAGCGATGATGGCCGACACCA
TCAGTCGCTACAAAGAGGGCAAACCGGTGTTTTATTACACCTGGACGCCGTACTGGGTGA
GTAACGAACTGAAGCCGGGCAAAGATGTCGTCTGGTTGCAGGTGCCGTTCTCCGCACTGC
CGGGCGATAAAAACGCCGATACCAAACTGCCGAATGGTGCGAATTATGGCTTCCCGGTCA
GCACCATGCATATCGTTGCCAACAAAGCCTGGGCCGAGAAAAACCCGGCAGCAGCGAAAC
TGTTTGCCATTATGCAGTTGCCAGTGGCAGATATTAACGCCCAGAACGCCATTATGCATG
ACGGCAAAGCCTCAGAAGGCGATATTCAGGGACACGTTGATGGTTGGATCAAAGCCCACC
AGCAGCAGTTCGATGGCTGGGTGAATGAGGCGCTGGCAGCGCAGAAGTAATTTTTATTCG
GGCGGATAAGGCGTTTTTGCCGCATCCGCCGTTCTGTGCACAATGCCTGATGCGACGCTG
GCGCGTCTTATCATGCCTACAAACCACATCGCACATTTCAACAATCTATCTTTCATCCCA
TATTCATCAACATCCGCTATTATTGATTTCCAGCTTAATCATCACCTGATGAACAAAAAT
AATGACTAAACCTAATCATGAGCTTAGCCCGGCGCTGATCGTGCTGATGTCTATCGCCAC
CGGTCTGGCGGTAGCCAGTAACTATTACGCCCAGCCATTGCTCGACACCATCGCGCGTAA
CTTTTCCCTTTCCGCCAGTTCGGCAGGCTTTATTGTTACCGCCGCGCAGTTGGGCTATGC
CGCAGGTCTACTGTTTCTTGTTCCCCTCGGTGATATGTTTGAACGCCGCCGCCTGATTGT
CTCGATGACCTTACTGGCGGCATGTTGATTACCGCCAGCAGTCAGTCGCTGGCGATGATG
ATCCTCGGTACGGCATTAACCGGTTTATTCTCAGTCGTGGCACAAATTCTGGTTCCGCTG
GCAGCGACGCTGGCTTCACCGGATAAACGCGGCAAAGTGGTTGGCACTATTATGAGCGGT
CTGCTGTTGGGGATCTTGCTGGCACGGACAGTTGCCGGATTGCTGGCGAATCTCGGCGGC
TGGCGCACCGTCTTTTGGGTTGCTTCGGTGTTAATGGCACTGATGGCGCTGGCATTATGG
CGTGGTCTGCCACAAATGAAATCAGAAACCCACCTCAACTACCCACAGTTGTTGGGTTCC
GTTTTCAGTATGTTTATCAGCGATAAAATTCTGCGTACCCGCGCGTTGCTGGGCTGCCTG
ACCTTTGCCAATTTCAGCATTCTCTGGACCTCAATGGCCTTTTTGCTTGCCGCTCCACCT
TTTAACTACAGCGATGGTGTCATTGGTCTGTTTGGACTTGCGGGAGCTGCCGGAGCGTTG
GGCGCTCGTCCGGCGGGCGGTTTTGCCGATAAGGGCAAATCGCACCACACCACAACTTTC
GGTCTGCTGCTGCTATTACTTTCATGGCTGGCGATCTGGTTTGGTCACACTTCCGTACTG
GCGTTGATTATCGGAATCCTGGTGCTGGATCTCACCGTGCAGGGCGTGCATATCACTAAC
CAGACGGTAATTTATCGGATACATCCTGATGCGCGCAATCGCCTGACCGCAGGTTACATG
ACTAGCTACTTTATTGGCGGTGCCGCCGGTTCGCTAATTTCAGCCTCAGCCTGGCAACAT
GGCGGTTGGGCTGGCGTTTGTCTGGCTGGCGCGACGATTGCCCTGGTTAACTTACTGGTC
TGGTGGCGAGGTTTTCATCGTCAGGAAGCCGCAAATTAAGCAATCAGCAACCGTTTTCGT
GGCTTTACACTTATAAGGGTGTTAAGAAGCCCATCAGTCTGATAAGGTTAAGATATTCAT
TCAGTCTATTTATAATATTAACAATCGTTAAGCGTACACTCTATGGAAAGCCCTACTCCA
CAGCCTGCTCCTGGTTCGGCGACCTTCATGGAAGGATGCAAAGACAGTTTACCGATTGTT
ATTAGTTATATTCCGGTGGCCTTTGCGTTCGGTCTGAATGCGACCCGTCTGGGATTCTCT
CCTCTCGAAAGCGTTTTTTTCTCCTGCATCATTTATGCAGGCGCGAGCCAGTTCGTCATT
ACCGCGATGCTGGCAGCCGGGAGTAGTTTGTGGATTGCTGCACTGACCGTCATGGCAATG
GATGTTCGCCATGTGTTGTATGGCCCGTCACTGCGTAGCCGTATTATTCAGCGTCTGCAA
AAATCGAAAACCGCCCTGTGGGCGTTTGGCCTGACGGATGAGGTTTTTGCCGCCGCAACC
GCAAAACTGGTACGCAATAATCGCCGCTGGAGCGAGAACTGGATGATCGGCATTGCCTTC
AGTTCATGGTCATCGTGGGTATTTGGTACGGTAATAGGGGCATTCTCCGGCAGCGGCTTG
CTGCAAGGTTATCCCGCCGTTGAAGCTGCATTAGGTTTTATGCTTCCGGCACTCTTTATG
AGTTTCCTGCTCGCCTCTTTCCAGCGCAAACAATCTCTTTGCGTTACCGCAGCGTTAGTT
GGTGCCCTTGCAGGCGTAACGCTATTTTCTATTCCCGTCGCCATTCTGGCAGGCATTGTC
TGTGGCTGCCTCACTGCGTTAATCCAGGCATTCTGGCAAGGAGCGCCCGATGAGCTATGA
GGTTCTGCTGCTTGGGTTACTAGTTGGCGTGGCGAATTATTGCTTCCGCTATTTGCCGCT
GCGCCTGCGTGTGGGTAATGCCCGCCCAACCAAACGTGGCGCGGTAGGTATTTTGCTCGA
CACCATTGGCATCGCCTCGATATGCGCTCTGCTGGTTGTCTCTACCGCACCAGAAGTGAT
GCACGATACACGCCGTTTCGTGCCCACGCTGGTCGGCTTCGCGGTACTGGGTGCCAGTTT
CTATAAAACACGCAGCATTATCATCCCAACACTGCTTAGTGCGCTGGCCTATGGGCTCGC
CTGGAAAGTGATGGCGATTATATAACCCACAAGAATCATTTTTCTAAAACAATACATTTA
CTTTATTTGTCACTGTCGTTACTATATCGGCTGAAATTAATGAGGTCATACCCAAATGGA
TAGTTCGTTTACGCCCATTGAACAAATGCTAAAATTTCGCGCCAGCCGCCACGAAGATTT
TCCTTATCAGGAGATCCTTCTGACTCGTCTTTGCATGCACATGCAAAGCAAGCTGCTGGA
GAACCGCAATAAAATGCTGAAGGCTCAGGGGATTAACGAGACGTTGTTTATGGCGTTGAT
TACGCTGGAGTCTCAGGAAAACCACAGTATTCAGCCTTCTGAATTAAGTTGTGCTCTTGG
ATCATCCCGTACCAACGCGACGCGTATTGCCGATGAACTGGAAAAACGCGGTTGGATCGA
ACGTCGTGAAAGCGATAACGATCGCCGCTGCCTGCATCTGCAATTAACGGAAAAAGGTCA
CGAGTTTTTGCGCGAGGTTTTACCACCGCAGCATAACTGCCTGCATCAACTCTGGTCCGC
GCTCAGCACAACAGAAAAAGATCAGCTCGAGCAAATCACCCGCAAATTGCTCTCCCGTCT
CGACCAGATGGAACAAGACGGTGTGGTTCTCGAAGCGATGAGCTAACGCGTCATCTCGCT
CAAAAATCCAGATTTATAAAAGAAAAAATGACTGGCCAGCATCGCAACATGCTGGCCTTT
TTGGCAAGCAGGTCGGCTCAGCCGATGAGTTAAGAAGATCGTGGAGAACAATATGAGCGC
AAATGCGGAGACTCAAACCCCGCAGCAACCGGTAAAGAAGAGCGGCAAACGTAAGCGTCT
GCTCCTCCTTCTCACCTTGCTCTTTATAATTATTGCCGTAGCGATAGGGATTTATTGGTT
TTTGGTACTGCGTCACTTCGAAGAAACCGATGACGCATACGTGGCAGGGAATCAAATTCA
AATTATGTCTCAGGTGTCTGGCAGCGTGACGAAAGTCTGGGCCGATAACACCGATTTTGT
AAAAGAAGGCGACGTGCTGGTCACTCTCGACCCGACAGATGCTCGCCAGGCGTTTGAAAA
AGCCAAAACTGCACTGGCTTCCAGCGTTCGCCAAACCCACCAGCTGATGATTAACAGCAA
GCAGTTGCAGGCGAATATTGAGGTGCAGAAAATCGCCCTCGCGAAAGCACAAAGCGACTA
CAACCGCCGTGTGCCGCTGGGCAATGCCAACCTGATTGGTCGCGAAGAGCTGCAACACGC
CCGCGACGCCGTCACCAGTGCCCAGGCGCAACTGGACGTCGCGATTCAACAATACAATGC
CAATCAGGCGATGATTCTGGGGACTAAACTGGAAGATCAGCCAGCCGTGCAACAGGCTGC
CACCGAAGTACGTAACGCCTGGCTGGCGCTGGAGCGTACTCGTATTATCAGTCCGATGAC
CGGTTATGTCTCCCGCCGCGCGGTACAGCCTGGGGCGCAAATTAGCCCAACGACGCCGCT
GATGGCGGTCGTTCCAGCCACCAATATGTGGGTGGATGCCAACTTTAAAGAGACGCAGAT
TGCCAATATGCGTATCGGTCAGCCGGTCACTATCACCACGGATATTTACGGCGATGATGT
GAAATACACCGGTAAAGTGGTTGGTCTGGATATGGGCACAGGTAGCGCGTTCTCACTGCT
TCCAGCGCAAAATGCGACCGGTAACTGGATCAAAGTCGTTCAGCGTCTGCCTGTGCGTAT
CGAACTGGACCAGAAACAGCTGGAGCAATATCCGCTGCGTATCGGTTTGTCCACGCTGGT
GAGCGTCAATACCACTAACCGTGACGGTCAGGTACTGGCAAATAAAGTACGTTCCACTCC
GGTAGCGGTAAGCACCGCGCGTGAAATCAGCCTGGCACCTGTCAATAAACTGATCGACGA
TATCGTAAAAGCTAACGCTGGCTAATCCAGAGGTGCGTGTGATGCAACAGCAAAAACCGC
TGGAAGGCGCGCAACTGGTCATTATGACGATTGCGCTGTCACTGGCGACATTCATGCAGG
TGCTGGACTCCACCATTGCTAACGTGGCGATCCCCACTATCGCCGGGAATCTGGGCTCAT
CGCTCAGCCAGGGAACGTGGGTAATCACTTCTTTCGGGGTGGCGAATGCCATCTCGATCC
CGCTTACCGGCTGGCTGGCAAAGCGCGTCGGGGAAGTGAAACTGTTCCTTTGGTCCACCA
TCGCCTTTGCTATTGCGTCGTGGGCGTGTGGTGTCTCCAGCAGCCTGAATATGCTGATCT
TCTTCCGCGTGATTCAGGGGATTGTCGCCGGGCCGTTGATCCCGCTTTCGCAAAGTCTAT
TGCTGAATAACTACCCGCCAGCCAAACGCTCGATCGCGCTGGCGTTGTGGTCGATGACGG
TGATTGTCGCGCCAATTTGCGGCCCGATCCTCGGCGGTTATATCAGCGATAATTACCACT
GGGGCTGGATATTCTTCATCAACGTGCCGATTGGCGTGGCGGTGGTGTTGATGACACTGC
AAACTCTGCGCGGACGTGAAACCCGCACCGAACGGCGGCGGATTGATGCCGTGGGGCTGG
CACTGCTGGTTATTGGTATCGGCAGCCTGCAGATTATGCTCGACCGCGGTAAAGAGCTGG
ACTGGTTTTCATCACAGGAAATTATCATCCTTACCGTGGTGGCGGTGGTGGCTATCTGCT
TCCTGATTGTCTGGGAGCTGACCGACGATAACCCGATAGTCGATCTGTCGTTGTTTAAGT
CGCGCAACTTCACCATCGGCTGCTTGTGTATCAGCCTCGCGTATATGCTCTACTTCGGCG
CTATTGTTCTGCTGCCGCAGTTGTTGCAGGAGGTCTACGGTTACACGGCGACCTGGGCAG
GTTTGGCCTCTGCGCCGGTAGGGATTATTCCGGTGATCCTGTCGCCGATTATCGGCCGCT
TCGCGCATAAACTGGATATGCGGCGGCTGGTAACCTTCAGCTTTATTATGTATGCCGTCT
GCTTCTACTGGCGTGCCTATACCTTTGAACCAGGTATGGATTTTGGCGCGTCGGCCTGGC
CGCAGTTTATCCAGGGGTTTGCGGTGGCCTGCTTCTTTATGCCGCTGACCACCATTACGC
TGTCTGGTTTGCCACCGGAACGACTGGCGGCGGCATCGAGCCTCTCTAACTTTACGCGAA
CGCTGGCGGGGTCTATCGGCACGTCGATAACCACGACCATGTGGACCAACCGCGAGTCGA
TGCACCATGCGCAGTTGACTGAGTCGGTAAACCCGTTCAACCCGAATGCCCAGGCGATGT
ACAGTCAACTGGAAGGGCTTGGGATGACGCAACAGCAGGCATCAGGCTGGATTGCCCAGC
AGATCACCAATCAGGGGCTGATTATTTCCGCCAATGAGATCTTCTGGATGTCAGCCGGGA
TATTCCTCGTCCTGCTGGGGCTGGTGTGGTTTGCTAAACCGCCATTTGGCGCAGGTGGCG
GCGGAGGCGGTGCGCACTAAGTACAACTAAGCCAGTTCATTTGAACTGGCTTTTTTCAAT
TAATTGTGAAGATAGTTT