MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download 9-1.seq
 Deletion 9-1
 Length 125568
 Fasta Format

>9-1
GCTTCGCTCACTATACATCCTTGGCTGCAGGTTTAGTTGTACACCACTCCTAAATTTAAT
GTGTTGGCAATGTGTTCAATAAAGCTCGAACAAATTAGCTCATTATGATCGGTTAATACT
TCAACTTCTGGTTGCATGATTGTTTGTCCGTAAAAAGATAACGCGCCTGCCGGGTAGTAG
CAGGCGCATTACGCAATAGGTAAACAAGGGAGGAAGTTCAGAAATGTAAATCGGGAAGGT
TGTACGCAATGTTCATCGTACTACGTTGTTACGGCTTTGCCGCAACAAGCCAGTTGCCTG
CCGCGCTCGCAGAATGTCTGCAGCCCGGAGATAAGGAGATTGTTCCTGCCAGCTAAATCC
CTTCCTGTCGATACGAACCAGCTCGTATTTTTCTACCAGAAAATTCACGGCATCGGCTAG
GGTGATACCGGCATCGATGTGTTCCTTAATCACAGCCTCATTGCAGAATGGCGTGTCGTT
TATTGTCAGACCATAGTGCTGTTCCAGCAGACGTGTCAGTAACATTTGCCAGACAGCCAC
GGGTGACAGGCAGGGCTTCACCGCCCGCTGAGTTATTGCAGGTAAAGTTTTCATGTTTGC
TCTCGTGTAGGTAATTAACGCTGAGTGGGGTAAATGGCGATGTATACGTAGCCGCAACTG
CCAAGGGTGTCGGCTTCGCAGGTTAAATCGTTGTGGTACAGGGTAACGCAGTGGGCATGG
TGGGGGCTGAGTTCACCGGTGGTCAGCATCGATTCCATCTGGAGGATAAAGTGCGGGAAT
GTTTCATCCAGCTTCCGGCATTCGATGTCACTGAACTTGCCGGTGATGCTGGCCCGGTCA
GCCAGATAATGCAGTCGGTTGCCTTCCTGCACCAGACGGGCTCCCAGGCGCAGTGTAATC
TCCCGCTGCAGGCCCCTGGTAGGGTTGCTCATTACAGTTCTCCACTATTGTCAGTTCAGG
GTGATGCTCATCAGGCAGGTATAGGGCCCATTGCGGTCCTGGCGGCGTTCGGCGTATACC
GCGAGGACTCCGGCGATATCCGGAACGTCCCTGCCGGTGTAATGACAGACGCTACCGTGC
CACTGGTATTTGCCGGTGCAGTAGCGAAAGATTCGGGACTCAGGATGCTGGCGGTATATC
GTCATTGCCCTGCGTTTACTGATAATTTTCATGTAATACCTCAAAGCAGACCGTGTTCTG
CGAACGAATAGATTTGCCTGCCACCGACAATCAGATGGTCAGGGACACGGATATCCACCA
GCTGAAGCACCTGAACCAGTCGCTGCGTGAGGGTTTTGTCGGCCTGGCTAGGTGTCGTCT
CGCCGGAAGGATGGTTATGCGCGAGTATCACCGCCGCCGCGTTGAAGTGCAGAGCACGTT
TGACCACCTCCCGGGGATGCACCTCGGTGCGGTTAATCGTGCCGGTGAAGAGCGTTTCAT
GGGCAATCAACTGATTCTGGTTGTCCAGATACAACACCCGGAACTCTTCCCGCTCAAGCG
CGGCCATATGCAGTCGCAGCCATTCACGTACGGCGTGGGTAGAGGTGAAGGCTACGCCGG
GCTCATGCAGGTGGCGGTCCAGAGCCCTGAGCGCCCGCTGAATGAGACGCCGGTCCTGTG
GCGTCATCTCGCCGGGTAAAAAGGAAAGCTGTTTCATCTGTTGCTCCTTCGGTCAGTCGA
TAATACGCAGAATGGCGTGAGCCTCTGGATGTTGCATGGCATACTCCCGCAGGCGGTAAT
AGTGTGCGGTCATCGCGTCACATTCTGTACGGCAGGCATGGTGGCTATACGCAATCAGGC
AGACAGCAATACCTGCTGCTTCTGCACTCATTTGGGCATCGTTACCGTTCAGGCAGTTAA
ACAGACGCCATGTCTCATCGTTGTCAGGCTCGGGGGACATAAATGCGCCGCCATTGCTGA
GGGTGTAGAACGACCAGATACCACCGCTGTAGCCCTCACAGAAGCGGTCCATCCAGGCGA
AGATATGCGGCTCCAGGAGTAGCCACTGCGGGATAGCGCCAAAGTACTGTGGCCAGAAAT
CGATACGCTGTTCATCGGGGACCGGCGTGACGGTCAGTTCAAATTCGGGTTGGTTAGCGG
GTGCGAGGTCGTGCTGCGTCTGTGTTGTCATGGGTATGTCTCCGTCAATAAAAACGCCAG
CGGCGATGGCTGGCGTATGGGGATATAAAGTGTGTTCGGGGAGGTGAATGCGGGTAAATG
CTTCGCGATCAGCGGGTGGCCGTGTCTGTACGGATGCCTGAGGTGCGGATATAGCGGTTA
AGACCTTCACCGGCATCCGGCTCAAAGTTCCATGCCCGCCAGACCATCCGGCCTTCAGTA
TCACGAACCACCAGACGGAAGTGACTGCCCTGGTCGTCTTCGAGTGTGATATTGCTGTAC
GTGGTAGTGACCGCTTGCGCTTGTCTCCGGGTGAAAGGCCCCGGTGGCAGCAACACGGAT
TGGGTCATTTTCGGGCTCCTGATAAAAGAAAACCCCGGCAGCCTGCTAGCTGTCGGGGTG
AATTTGCTGGGGAAGATACTACTATCAGTCGTTGCTGCAGTCTCCGAGAGTGGACAGAAC
TTTCTCAGCGTTCTTCCGGTCCGCAGTGAAGGTCCCTGCTTTGTGGTCATTGACGTAGAC
GTCGAACTGCCCGGCCTCAGAGATATTGCTGATGAAGTCAAACCAGGCGTTATCGCCGTT
ACGCCAGCCCAGGCTGGACGGAATAATGTACTGCTGGTGATCCATCACTACGGTGATAGT
AGTGTCGTCATCGTGCGAACTGACCATCTTGTCATCGGCAAGGGTAAGAAAGACTGAATG
CTGATAGAAACCATTCTGGTCCGGGTTCCCTGTGCAGTTGATGGTAAACGTCTTTCCGCT
GGCTTCGGTCACGCTGTATTCCGTATTGCCCTGACCGTAACCCTGCTGCCAGAACCCCGG
GATAGCAGAGGCATTAAAGCTCGCGAGCAGTACACCCGCCAGCATAAACCGACTTAGTGA
AAGTATTGTCATTCTTGTCTCCTTTGTCGTTGTTTTATTCCTGATTGTCAGGGTTCGAGG
GTATCAGTAGCTGCCCCATCAGTTTGCCGTCATGGGCGTACTCAAAGTATTTTTCTTTGG
TATACGGGTCCGTCACCTCCTGGTATTCCAGTTTGATGTTATCGGCAATACACAGCGCAT
TCATCAGTGGCTGGACGGTTTTTTCCTGCATATCCACGAGGTAGTAGTAACTGCCATCCT
CGCAGCCATCGGGCGACTGGCGGGTACGTAAAACCTGCAAGGTGGGACCGGATAAGTAGT
CAACCTGTGACCATTCTTCGCTGACATCATCCTGGTGGCTGACCACATCACTGAAACGCG
GTGGGGTGAGGTCCTTAAATTTACTGATGGCCTTCAGGTCATCACTTCTGTCATCGCATG
CGATGAGAAACAGAGTGGTGGCAACCAGCGCCAGCAGAGGCAGTGTTTTACGTTTCATTA
TTTTTTTCCTGAAATCAGACGAACCACTTTGGCAAAGACATAAATGCCCACGAAAATACC
CACCGGCACGCCGACGAACGGTGTCAGCGCGACACTGGCAGCACCGGCTGCGCCACCTCC
CGTCAGCAGTGCGGCAACAGTGGCAAGGGTCAGGGCCGCGAGACTGTCGGACACCCCGGT
TTTGTTCAGAATGATGACGATGACAACAATGGCGATAATGGCAATATCCGGACTGATACT
CCAGGTCCAGATACATCAGCCGCTCACGAAAATCACGCCGCAGCGTGCGCACCGACACAC
CAAACTCAGCGGCAAGCTTACGCACACTCAGCGTTTCCCCTGCCACCAGACGGCTGATTA
TCAGTGACAGCCTGACAGCCAGCCGGTCATGGCGGCGTTCTGCCTGTGTCATGAGACGTT
CTCCGTGAAAGTTAACTGACTGAAAATGATGTGATTACTTTAAAGAGGGGGTCGGACAGG
GTATGGACACCACAGAAACTATTTTTCATTTCTGCAAAAGCCAGAGGCAGCGGGGGTTAC
AGGCCTTCCCTCGGTGAGTGAGGACCGTCAGCACGGTGCGATGCGGACAGGTGGTGTCCG
ATATTAACAAAGCAGCAACATTAAACGGTCACTGCAGTTGCGTGAGCAGGGCTTCCGCCA
TCACCCACAGTGCCCGGTTAAGTTTCACGTCCCCGTCGATACCGCGAACGGCACGGGTAT
GTGACCGTCCTCCTTTGGCATTACGGCCACTGAGCCCGCCCTTAATCAGGTTCTCCTGAA
TACGCTGGTACGTGGTCCACAGGTCATTGCTCTCATCCTGCCAGCGGCGAGGGGAGAGGA
TCTGCGATTCAGTCACCGGCTGGTGGTCTTCACCAAAGCGGTATGTGAGGGCGGCTTTTG
CCAGTGCCTGCTGTGCCGGGGGTGGCAACAGCAACGACTGCATGGCATCCCGTTTCTCCT
CCACCCGGTCAAAAATCCCCAGCACCTCATACGCGCCTTCAATCACCTGACTCACCACGT
CCCCCTTGTGTGGCACCCGCACCTCGCCAAACGACTCACCGCAGACGAGCCCGTTCTGAC
AAACCGCACGAAATAGTCCCGGCAACATCTGATACGAACTGGTTCCATCGTGAGAGTTGA
GTAGAATAATTTCCGGCACCTGTTTACCGGTGATCTGCCCTTCCCGCCGCAGACGCAGCA
TATGCTTTGTATGTTCACGACGACCCGGGTCACGCACGCGGGTCTGACAGGCAAAGAATG
GCTGGAAGCCTTCTCGCTGTAGGCTGTCGAGCAGGGAGATGGTGGGTATATAGGTATAAC
GCTCACTACGGGACTCGTGTTTGTCCTCACTGAATACACTGGGCACTACGCGAAACAGCT
CTTCACGGGTTAACGGACGGTCGCGACGGATAAGGTTTGCTGCGCCAAAGCGCGAAGCCA
GACGGGTCATAAGCAGACTCCTCATAACGGGAAAACAAATAAAAGGGATCCCCGTCGCAT
CGGCGACAGGGGCAGGGAAGTAACAGGGATGGGTTAAATACTCAGAAGAAGAAATCCCAG
ACGGCGCGGGCCACTGACACCACCGTGGTGCGCACGGCCTGAATGACGGCCCGCACCGGG
GCGGGTATCAGGGGAAAGGCACTGATGCTATCGAGTACGGCCCCGACGGTTTCACCAAAA
TCGCTACGAGCCTGTTCCCGGACTACCGTCGTGCGAAAGGAAGGATGGAGTTGCGACACC
ACCGGGCTGGTGGCCTCACGTGGCAGGCACTTAATCATCCGCTCGGCCATCACCTTAAGC
CCCCATTGTAGACGGACCGACACAGCACACACCGGATGGACGGGCTGGAACAGCTCATGC
AGCAGGCAGATTTTGCGGCTGATATTCTGCTTCTGCGCCGTGGACAACTGTCCCCCACCG
CTGGTAGGTTCGGCCTTATCCGACTGGCTGATAACAAACAGCACCTTATGCCGGTATACC
TCTCCAATCACCTGATGATAAAAATGTTCATCCACCGTCAGCGCCCGGTCATCGGCCTTA
ATCAGCCACAGTACCAGGTCGAGGCGAGGAAGCTGTTCGCGGTACAGCGCAGCATACTCG
GTATCGCGAGCGCCACTTTCGCCCACGCCGGGCAGATCCATCAGCGTTATATAGCGGTCG
CCGACTTGCAGGCGAAAGCGCAGTGGCTCACGTGTACAGGCCGCCACATCGCTGACCGGT
GATATATCTCCGGCAAACAGGGCATTGCACAGACTGCTCTTCCCAACACCGGTTTTACCC
ATAATGCCGATCACTGGCTCGTAGTTAGTTAACTGGTTAATTTGCTGCAGAAGCCGCTCT
GATACCCATTGCGGCAGATCAGCAAGCGATTGCTGAAACGACTTCAAACCTTCAGAATTA
TTCATCACTACTCCTCTGAAAAATAATAAAAAACGGTAGAATCGTGAGATTCCGCCGTTA
ATTGCGTATGTTCAGAGTGATGATATATATCTGAAGATTTTTTCAATCCTCTGCGCTTGA
GGCAGCTGCGCGACTGCTGGCTCAGGCAATGAATGAGTTATAATAGCAGCATTTACTAAC
AGGGATTTATTGAGAGTATGAGCCGCCGTGATACACCTTAAAATCTCAACCCAGCAAAGT
TTCGGAGCCGCGAGCAAAAGTGAGAGCCTTCACAAAATAATGCTTAGTAATAAAGTTACT
TTGAATTCAGAGCCCCGATTAATGTGAACATGATCAACGAATTTTACCCAGATTGAGTTC
ATTCAGTAGCCAGGTTTTGAACACATCAAGCGCAGAATGCATGTGTTGGTGCTGGGGGAA
AACCAAATAATGACCGATGTAATGTATTTCGCTGGTACTGTTTACAAGTGGGCATACCAG
TTTACCGCTAGCGATTTCACGTTCAGCCAGTAGTTTTGATTCAAGCACAACTCCCAAGCC
GTCAACTGCGGCAGCAATCGCCATAAAGCTACGGTCAAATCGAAGGCCATAATTATTGGG
TGGCGTCATCTTATTCGCCTCAAACCATCCTTTCCACTGGTACAACTGCACATCGCACTG
AATCAATGTCAACGCATAGAGATCCTCTGGTTTCTTTAGCCGCTCAGCCAGTTGGGGAGA
ACACAGTGGCGTAAGTTCTTCAACAGCAAGCGGGATCTTCTCATAGGGTGATGGGCGGGG
TTCACCGTAGACTATATCGAGATCAAAATCATCCTGTTCAAAACGTGCATATTCTGTGCT
GGCTGAAAGTCGCAGATCGATGCTTGGGTTCTCACGTATGAACTTACCAAGACGTGGTAA
AAGCCATTGATGGGCAAAACTCGGTGCAGTATGAAGGCGCAAAGGCCTGGATTCATCAGC
CGTCACTAATGCCAACCCCTGCTGTAATTCGTTAAATCCCCGCTGTATGTGCTCAAGCAG
TATTTCACCTTCTTTCGTCAGCGTAATTTCTCGCGTACTGCGCTGAAAAAGGCGTACATC
AAGCAAGTTTTCCAGTTTGCGGATGGCATGGCTGATCGCACTGGGTGACAGTTCCAACTC
AGAGGCGGCCAACGCAAAAGCTCCGGTACGACCAGCCGCTTCAAAGGCGCGTAACAGATT
TAGAGGTGCTTTTGCTAAGAGCTTCATTCATGAATCCTTTTCACTAGGGATGAAGTGGTT
TACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAACACAGGTGTCA
TAATGAAAAAAAGAAATTTCAGCGCAGAGTTTAAACGCGAATCCGCTCAACTGGTCGTTG
ACCAGAACTACACCGTGGCAGATGCAGCCAGCGCTATGGATGTCGGCCTTTCCACAATGA
CGCGATGGGTGAAACAATTACGTGATGAACGGCAGGGCAAAACACCAAAAGCCTCCCCCA
TTACCCCGGAACAAATTGAAATCCGTGAGCTCAGGAAAAAGCTACAACGTATTGAAATGG
AAAATGAAATATTAAAAAAGGCTACTGTAGATTCAATTGGTCAACGCAACAGTTATGTGA
AAACATGGGGTTGCGGAGGTTTTTTGAATGAGACGAACATTTACAGCAGAGGAAAAAGCC
TCTGTTTTTGAACTATGGAAGAACGGAACAGGCTTCAGTGAAATAGCGAATATCCTGGGT
TCAAAACCCGGAACGATCTTCACTATGTTAAGGGATACTGGCGGCATAAAACCCCATGAG
CGTAAGCGGGCTGTAGCTCACCTGACACTGTCTGAGCGCGAGGAGATACGAGCTGGTTTG
TCAGCCAAAATGAGCATTCGTGCGATAGCTACTGCGCTGAATCGCAGTCCTTCGACGATC
TCACGTGAAGTTCAGCGTAATCGGGGCAGACGCTATTACAAAGCTGTTGATGCTAATAAC
CGAGCCAACAGAATGGCGAAAAGGCCAAAACCGTGCTTACTGGATCAAAATTTACCATTG
CGAAAGCTTGTTCTGGAAAAGCTGGAGATGAAATGGTCTCCAGAGCAAATATCAGGATGG
TTAAGGCGAACAAAACCACGTCAAAAAACGCTGCGAATATCACCTGAGACAATTTATAAA
ACGCTGTACTTTCGTAGCCGTGAAGCGCTACACCACCTGAATATACAGCATCTGCGACGG
TCGCATAGCCTTCGCCATGGCAGGCGTCATACCCGCAAAGGCGAAAGAGGTACGATTAAC
ATAGTGAACGGAACACCAATTCACGAACGTTCCCGAAATATCGATAACAGACGCTCTCTG
GGGCATTGGGAGGGCGATTTAGTCTCAGGTACAAAAAACTCTCATATAGCCACACTTGTA
GACCGAAAATCACGTTATACGATCATCGTTAGACTCAGGGGCAAAGATTCTGTCTCAGTA
AATCAGGCTCTTACCGACAAATTCCTGAGTTTACCGTCAGAACTCAGAAAATCACTGACA
TGGGACAGAGGAATGGAACTGGCCAGACATCTAGAATTTACTGTCAGCACCGGCGTTAAA
GTTTACTTCTGCGATCCTCAGAGTCCTTGGCAGCGGGGAACAAATGAGAATACAAATGGG
CTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCAACATGAACTA
GATCTGGTTGCTGCTCAGCTAAACAACAGACCGAGAAAGACACTGAAGTTCAAAACACCG
AAAGAGATAATTGAAAGGGGTGTTGCATTGACAGATTGAATCTACAACCGCGCTCTTGAT
GTCAGACTCCCTGAACAGTTCTCGATAATCGGGAAACTCAGGGCGCGTTATCCTGTGGCC
ACTCTCTGCCATGTGTTCGGGGTTCATCGCAGCAGCTACAAATACTGGAAAAACCGTCCT
GAAAAGCCAGACGGCAGACGGGCTGTATTACGCAGTCAGGTACTTGAACTGCATGGCATC
AGCCACGGCTCTGCCGGAGCAAGAAGCATCGCCACAATGGCAACCCAGAGAGGATACCAG
ATGGGGCGCTGGCTTGCTGGCAGACTCATGAAAGAGCTGGGGCTGGTCAGTTGCCAGCAG
CCGACTCACCGGTATAAGCGTGGCGGTCATGAGCACGTTGCTATCCCGAATCATCTTGAG
CGACAGTTCGCCGTAACGGAACCAAATCAGGTGTGGTGCGGTGATGTGACCTATAGTGTG
CCCGGAGTTCAGGGCGGGCATGGATGCTTAAATGAACCGCGAGTCTGTCTGGAATATTGA
ACCGGTAACTCACGATGAGAAACCCAACAATCCCACCGGGTGTGACGGTGGAGAACCTGA
GCGGCAGTGACCTGCGGCATGCCCGCAGGGTGATGTAACCCGCTGACAACGGGGATTGAG
GCGAGATCACTAAGCCGAGATGATCCTCAAGGTTAAGTACTGAAAGGTTGAAGAACATGA
ACCCGTTAATCCGCCTCTGTGGGTTGAAAACGTCACCACGGCCTACGTGATCTGACAGGC
CGTGCAGGAGGAACTGGCAGTGATACGTAAGCACTGCCGGTCGAAGGTGTTTTGACATGT
ATGCGAAACACCGGGGCAGCAGCGTCTATCACGCTTGCGTTGCTGACTTCTGCCAACTTG
CGGCAAGCAAGGATAAAGAGTGCGACGGGCAGCCTCCTCAGTATGCCTGAGTCCAGGCAG
GTAAACCGGGGAAGGTCAGCGACGGATGTTAAGGGGGCATGGCTCCGATGACGCGCTGGC
TGGCGGAGCTTCCGTAGTAGTCCGCGATGGGGAAAGCCCATTACATGGCGAAGGGAAGCA
GTTTGAATGTGTTTGCGACGTGAATTAACTGACCTAACGAGGTGAAGACCTTTGATAATC
AGCGAAATGCAACGCAAGCTTGCCACATGGGCAGCCACCGATCCGTCCCTACGGATTCAA
CGGCTGCTGCGTCTGATAACACAACCAGAATGGCTGGCTGAAGCGGCGCGGATCACGCTT
TCATCAAAGGGGGCCCATACCCCCGGCGTTGATGGCGTGAACAAAACAATGCTACAGGCC
AGACTGGCTGTTGAGCTGCAAATCCTCAGGGATGAATTACTCTCAGGCCACTACCAGCCC
TTGCCCGCCAGACGGGTTTACATCCCTAAAAGCAACGGCAAACTGCGACCACTGGGTATC
CCCGCGTTGCGGGATCGTATTGTTCAGCGGGCCATGCTGATGGCGATGGAGCCGATATGG
GAGAGTGATTTTCATACGCTCTCATATGGCTTCCGGCCTGAGCGCAGTGTCCACCACGCG
ATCCGCACGGTGAAATTACAGCTCACAGACTGTGGTGAAACCCGGGGACGCTGGGTGATT
GAAGGCGACCTGTCCAGTTACTTCGACACCGTACATCATCGACTGCTGATGAAGGCTGTA
CGCCGCAGGATCAGTGACGCACGTTTCATGACTCTGCTGTGGAAAACCATCAAGGCGGGA
CATATCGATGTCGGTCTCTTTCGGGCGGCCAGTGAAGGTGTGCCACAGGGCGGTGTTATA
TCGCCGCTATTATCGAACATCATGCTGAATGAGTTCGATCAATACCTGCATGAGCGCTAC
CTGAGCGGGAAAGCCAGAAAAGATCGGTGGTACTGGAATAACAGTATCCAACGGGGCCGA
AGTACGGCGGTCAGAGAAAACTGGCAGTGGAAACCCGCGGTGGCGTACTGCCGCTATGCC
GATGATTTTGTCCTCATCGTCAAAGGCACCAAAGCACAGGTGGAAGCCATCAGGGAGGAG
TGTCGGGGTGTGCTCGAAGGCAGTCTGAAACTCAGGCTGAACATGGATAAGACTAAAATC
CCCCATGTTAATGACGGCTTTATCTTTCTGGGGCACAGGCTCATTCGCAAACGCAGTCGT
TATGGCGAGATGCGAGTGGTCTCAACGATCCCGCAGGAGAAAGCCAGAAACTTCGCCGCA
TCGCTGACAGCACTGTTATGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTC
AGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAGC
CTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCTC
CCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAG
TTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCTT
GATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTATTCGATGTT
GATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTC
GGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGTA
GCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAG
GTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGAC
ACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTC
CGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATC
GACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTT
GAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGT
GCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAGGCGATTTC
GTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAAT
GCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGG
CTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAAT
CTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATG
ACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGACT
TGTTCGCACCTTCCGGAGGCGTTATGAGCTGGCGGCCCTTTTTGTATCTGATTATTAATC
CCCACCCGCTATTAAGCGCCCGGCGCGGGCATCTGCGTCTGGTGCAGGGTTGACTTTGCA
TTCTGTTAACAAACGCGGTATAACAAACCTTCTTTGGATGTTTAGATGTCCATACGTTTA
GAAGGTTATATGCAAACAACACAACAAAATGCGCCACTGAAGCGCACAATGAAAACGCGT
CACCTGATTATGCTTTCCTTGGGCGGCGTGATTGGCACAGGATTATTCTTCAATACCGGG
TACATCATTTCCACCACTGGAGCGGCGGGAACGCTGCTGGCCTATCTGATTGGTGCGCTG
GTGGTCTGGCTGGTTATGCAGTGTCTGGGCGAGCTGTCGGTCGCGATGCCGGAGACCGGA
GCGTTTCACGTTTATGCCGCGCGCTATCTTGGTCCGGCTACCGGGTATACCGTGGCCTGG
CTTTACTGGCTGACCTGGACCGTGGCGCTGGGTTCGAGCTTTACCGCCGCTGGATTCTGT
ATGCAGTACTGGTTTCCACAGGTGCCGGTATGGGTCTGGTGCGTGGTGTTCTGCGCGATT
ATTTTTGGTCTGAATGTTATCTCCACGCGCTTTTTTGCCGAAGGGGAGTTCTGGTTCTCG
CTGGTCAAAGTGGTCACTATCATCGCCTTTATCATCCTCGGTGGGGCGGCGATTTTCGGC
TTTATTCCGATGCAGGATGGCTCGCCCGCGCCGGGGCTGAGTAATATCACGGCAGAAGGC
TGGTTCCCGCACGGTGGCTTACCGATTTTGATGACTATGGTGGCAGTGAACTTTGCTTTT
TCGGGTACCGAGCTTATCGGCATTGCCGCCGGTGAAACGGAAAACCCGCGCAAAGTTATC
CCGGTAGCGATTCGTACTACCATCGCGCGACTGATTATTTTCTTTATCGGCACCGTGTTT
GTGCTGGCAGCGCTGATCCCGATGCAGCAGGTGGGCGTGGAGAAAAGCCCGTTTGTGCTG
GTATTTGAGAAAGTAGGGATCCCGTACGCCGCTGATATTTTTAACTTCGTGATCCTGACG
GCTATTCTTTCTGCAGCGAACTCCGGGTTATATGCCTCCGGGCGCATGCTGTGGTCGTTG
TCGAATGAACGTACGCTACCGGCCTGTTTTGCGCGAGTAACGAAAAACGGCGTGCCACTG
ACGGCGCTGTCGGTCAGTATGCTCGGTGGTGTGCTGGCGCTGTTTTCCAGCGTGGTGGCC
CCGGACACGGTATTTGTTGCGCTGTCGGCAATCTCCGGGTTTGCGGTGGTAGCGGTGTGG
CTGAGTATCTGCGCCTCGCATTTTGTTTTTCGTCGCCGTCATCTGCAACAAGGTAAGGCA
TTGAGTGAATTACATTATCGCGCGCCGTGGTATCCGCTGGTGCCAGTATTAGGTTTTGTG
CTGTGCCTGGTGGCCTGTGTTGGGCTGGCATTCGATCCAGCGCAGAGAATTGCGTTGTGG
TGCGGGTTACCGTTTGTTGCGTTGTGCTATGGTGCTTATTTCCTTACTCAACCCCGAAAC
GCAAAACAGGAGCCAGAACATGTCGCAGAATAATCCGTTACGCGCTCTTCTTGATAAACA
GGATATCCTGCTGCTGGATGGCGCGATGGCGACGGAGCTGGAAGCGCGAGGGTGTAACTT
AGCCGACAGCCTGTGGTCAGCCAAAGTGCTGGTAGAAAACCCGGAGCTTATCCGCGAAGT
GCATCTTGATTACTACCGGGCGGGGGCGCAATGCGCGATCACTGCCAGCTATCAGGCGAC
GCCGGCGGGCTTCGCCGCGCGAGGTCTGGATGAAGCGCAGTCGAAAGCGCTGATTGGCAA
AAGCGTGGAGCTGGCGCGTAAAGCCCGTGAAGCGTATCTGGCAGAGAACCCGCAGGCGGG
AACGCTTCTGGTGGCGGGATCCGTCGGGCCTTACGGCGCGTATCTGGCGGATGGCTCTGA
ATACCGTGGCGATTATCATTGTAGCGTTGAGGCATTTCAGGCGTTTCATCGCCCGCGCGT
GGAAGCCTTGCTGGATGCCGGGGCCGATCTGCTGGCCTGCGAAACCCTGCCGAATTTTTC
CGAGATTGAGGCGTTGGCCGAGCTGTTGACCGCATATCCGCGTGCGCGGGCGTGGTTCTC
ATTTACCCTGCGCGACAGCGAACACCTGAGCGACGGTACGCCGCTGCGTGACGTGGTTGC
GTTGCTGGCGGGTTATCCGCAGGTGGTGGCGCTAGGCATTAACTGTATTGCGCTGGAAAA
CACCACCGCTGCGTTGCAGCATTTACACGGTTTAACGGTGCTGCCGCTGGTGGTGTATCC
GAACTCGGGCGAGCATTACGATGCCGTGAGCAAAACCTGGCATCATCACGGTGAACATTG
CGCGCAGCTGGCGGATTATCTGCCGCAGTGGCAGGCCGCTGGCGCACGGTTGATTGGCGG
GTGCTGTCGCACCACGCCTGCGGATATCGCCGCGTTAAAAGCGCGAAGCTGAGGGTTTAT
CGGGTCTACATCGTTCATTGTAGGCCTGATAAGCGCAGCGCATCAGGCATTGCCGGATGG
CGGCACAAGCGCCTTATCCGGCCTACAAAACCACAAAACGTTATGCCGCATCCGCCAGAA
CAAACATGCCGTACGGATGGATTTCAAGATAATACTGCTCGCCGACGTCCGGTTGCAGAC
GCGTAGCGTTGACCTGCAATAATATCTCCTGCCCGTGCCATTCCACCGTCACTTCATACT
GCGGCCCCATATAGGCGACATGGCGGATCACGCAGCGCTGGCTCTCTTCGCCGCGATCGC
TGAGCGTGATCGCTTCCGGGCGCACACCGACCATCCCTTCACCCTGTGTACCAAAGTGCA
GCGGGCGCGGCAGATGATAGCCGTAGATATCAACGTATCCGTCGCTGAAGGTTGCCGGGA
ACAGGTTGGCATCGCCCATAAAGCTCGCCATAAAGCGGGAGGCGGGCTGGCGGTAAAGAT
CCTGCGGTGAGCCGATCTGCATGATGTGTCCCTTGTTCATCACCAGCACAGTATCAGAAA
CCGCAAAGGCTTCGCTCTGATCGTGGGTGACGTACAGCGAGGTGATATCAAACTGCTTTT
GCAACTCGCGGATCTTGTCGCGCATGCTGCGACGCAGGTTGGCGTCGAGGTTACTCAACG
GCTCATCAAACAGCAGCACTTTCGGCTTGAGGATCAGCGCGCGGGCCAGCGCCACGCGCT
GCTGCTGCCCGCCGGAGATCTGATCGACAAAGCGGTCTTCGAATCCTTCCAGATCCACCA
TCGCCAACGCCTCTTTGACGCGGGCTTTCAGCTCTGCGCGCGGTACGCCGAGCATTTTCA
GGCCATAACCGACATTCTCTCCCAGCGACATATGCGGGAACAGGGCATAGGACTGAAACA
CCATACAGATATCGCGCTGCTGAATAGAGCGATGGGTGACGTCTTCGCCATCAATGAAAA
TTTGCCCTTCGCTCGGTTTTTCCAGCCCGGCAACCAGGCGCAAAATAGTGGTTTTGCCGC
AGCCGGACGGGCCGAGCAGCGTCACCATTTGCCCCTGCGGGATGGTGAGGTTGATATTGT
CGATTACCGTATTACTGCCAAATCGTTTAGTGACGTTGCGCAGTTCAACGAAATTTTTCT
GAGTCATAGTGCGCTCCATTACGCCTGGTTTTTGGCTTTTGAACGGGAGGTACGTGATTC
ACCGATCAGCCAGTCAAAGATGAAAATAATCGCCAGCATCACCACGATCAGAATGGAACC
GTAGGCAATCGCTACACCGTATTCGCCATCTTCCACGCGGTTGAGGATGTAAGCCGTCGC
TACGCGGGTATCCGGCGTGACGAGGAACACAATGGCGCTGACGGTGGTAATGGCGCGCAC
AAAGCTGTAAATCAGCGCCGAGAGGATCGCCGGGCGCAGCAGCGGCAGCAGGATGTGCGT
AATGGTACGCAGGGAACCGGCGCGCAGGCTGAGTGAGGCTTCATCGAGCGATTTATCGAT
TTGGCCCGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGA
CTTTGTCATGCTGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCA
GGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTA
CGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCA
CCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCAC
CGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCT
GGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGT
CACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAA
AATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCAT
GGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAG
TTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCC
GTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCAC
TGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCGAGAA
CACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCA
ACATGAACTAGATCTGGTTGCTGCTCAGCTAAACAACAGACCGAGAAAGACACTGAAGTT
CAAAACACCGAAAGAGATAATTGAAAGGGGTGTTGCATTGACAGATTGAATCTACAGCAG
CTTTTTTTAATATGTCCCGTTCGTCGGTAACCCGTTTCAGCTCTTTCTGGAGACGGCGGA
TCTCGGCCTGAGCATCTGACTGTTCTTTATTAGTGGAAGAATCCGGACCGTACTTCTTTA
TCCAGGCATAAAGGCTGTGGGTGGTGATATCGAGACGTGTTGCAACGCTGGCAACAGAAT
AACCGAGATCAACAACCTGTTTGACTGCTTCAGTTTTAAACTCTTCGGGATAACGCTTAC
CGCTCATGGGCACCTCTCTTTAAGCCATTTTAAATGACTCGGAGGTGTCTGTTAAACCCG
TGGCGATTCAAAATTGCGATATATACATACCCATGACTGCCCAGCGTATCGGCTTCACCA
GTCAGCCCGTTACGGTACAGTGTGACACAGTGCGCGTACCTGGGATTCAGCTCACAGGAG
AGCAGCATCAGCTCCAGATGTGCGACAAAATGCGGGAAGGCTTCATCCAGTTGTAGAGTC
TGCACCTCACTGAATGAGCCGGTGAATCCAGCCCGGTCAGCCAGAAAATGCAGACGATGA
CCTTCCTGCACCAGTCGTGCTCCGAAACACGGTGTGATATCTCGTTTAAGCCCCCAAGTT
TGAGTAGAGTCTTTATTCATAATTTTATTCCTGTTAAAGAAGACCATGTTCGGCGAATGA
GAATATTTGCCTGCCGCCGACAATCAGGTGGTCGGGGACATGGTGAACACTTTTTAACAT
CCTTTACCCATGGTGATCGACTTTTTCTTCAGGTCGATCACCCCCACTTTCGTGCTGTAC
CACCACACCTCGTAGCTGCCGTCTTCCTGCATCTCCTTCAGCCCGACCCGTTCTCCCCTG
AACGCCTTGCCTGCGCTCAGACTTACCCCTTTCACGCTCAGCTTTCCGCTGATATCCACT
TTCCTGACCATCACCCCTTCATCGTATTCCGGGGGCGTTGTGTTGCCGCTGTACTGCCGC
GCTGACGGCTGATACCGCGAGCCCGGTACCGCCATATCCAGCGCCTCGTGCGGGCGTTCA
AGGTTATAGACCGTCCGCCAGTGGTCGAAGGCGCGCTGCAGTTCACCGCTGTCTGCGAAC
CATTTTCCCTGCAGCACTTCCGCCTTCAGGCTGCGGTGAAAACGCTCCAGCTTCCCCTGC
GTCTGCGGATGATAAGGCCGGGAGTGCCCCACCCGGATACCCAGGCGCATCAGCCACAGC
TCCAGCGCCGTCCAGGTGCCGGTGGTGTCGCCCCACGGTGAGCCGTTATCCATGGTCATC
CGGTCCGGCAGGCCGTAACGCTCAAACACGCTGACCAGCTGCTGCTGCACGGTCTCGCGC
CGTTCATCGGTACAGTGCGCCAGGCACAGGGAAAAACGGGAGTGGTCGTCCAGCAGGGTG
AGCGGATGGCAGCGTCCACCGCCAAAAGGAAAGTGGCCCTTAAAATCCATCTGCCAGAGG
CGGTTCGGCGCGTCGTGTTCGAACCGGCCCGTGGCGGGAATGCCCGGTGAAGCGCCCGGC
AGCAGGCCATGGCGGGCCATCAGGTTATGGACGGTGCTGAAGGCGGGCATGGTGTGCCCC
TGGTCCTCGAGCCAGCGCTTAATCTTGCGGGCTCCCCAGCGTTCATGACGGTCATGGGCC
ATACGCAGCAGGGCCGTGATGTCGTCAGATGAGCGGTTCGGGGAATGGTGCGGAATGCGC
GGGCGGTCCTGAAGACCGGCGGCACCTTCCTGAGCCCAGCGCTGGAGCCACTTGTAGCCG
GTGGCAGGTGAAATGCCGAAGCGACGGCAGAGGGAACGGATGTTCGCCCCGTCCTGCGAG
GCGAACAAAACAAACTCAGTACGTAATGACATGGTATCTCTCGCATCCCAGGGCATAAGC
GACTCCATAAACGGGTTCTTATGCCTTAGTTGTAAGTGTCTACCATGTCCCCGAACAAGT
GTTCACTATGTCCCCGGACCGTACACCCCAAAGGGGAGAGGGGACTGCACCGAGCCATCT
TTTCCCCCTCGCCCCTTTGGGGAGAGGGCCGGGGTGAGGGGCAATATGTGATCCAGCTTA
AATTTCCCGCACTCCCTCTTCCCTTCCGATTTACCTCTCCTTGTTCTGCGTCATAGTATG
ATCGTTAAATAAACGAACGCTGTTCTATAATGTAGAACAAAATGATTCAGCAAGGAGATC
TCATGCCGCAGTCCGCGTTGTTCACGGGAATCATTCCCCCTGTCTCCACCATTTTTACCG
CCGACGGCCAGCTCGATAAGCCGGGCACCGCCGCGCTGATCGACGATCTGATCAAAGCAG
GCGTTGACGGCCTGTTCTTCCTGGGCAGCGGTGGCGAGTTCTCCCAGCTCGGCGCCGAAG
AGCGTAAAGCCATTGCCCGCTTTGCTATCGATCATGTCGATCGTCGCGTGCCGGTGCTGA
TCGGCACCGGCGGCACCAACGCCCGGGAAACCATCGAACTCAGCCAGCACGCGCAGCAGG
CGGGCGCGGACGGCATCGTGGTGATCAACCCCTACTACTGGAAAGTGTCGGAAGCGAACC
TGATCCGCTATTTCGAGCAGGTGGCCGACAGCGTCACGCTGCCGGTGATGCTCTATAACT
TCCCGGCGCTGACCGGGCAGGATCTGACTCCGGCGCTGGTGAAAACCCTCGCCGACTCGC
GCAGCAATATTATCGGCATCAAAGACACCATCGACTCCGTCGCCCACCTGCGCAGCATGA
TCCATACCGTCAAAGGTGCCCATCCGCACTTCACCGTGCTCTGCGGCTACGACGATCATC
TGTTCAATACCCTGCTGCTCGGCGGCGACGGGGCGATATCGGCGAGCGGCAACTTTGCCC
CGCAGGTGTCGGTGAATCTTCTGAAAGCCTGGCGCGACGGGGACGTGGCGAAAGCGGCCG
GGTATCATCAGACCTTGCTGCAAATTCCGCAGATGTATCAGCTGGATACGCCGTTTGTGA
ACGTGATTAAAGAGGCGATCGTGCTCTGCGGTCGTCCTGTCTCCACGCACGTGCTGCCGC
CCGCCTCGCCGCTGGACGAGCCGCGCAAGGCGCAGCTGAAAACCCTGCTGCAACAGCTCA
AGCTTTGCTGAGCCGGACGATAACGATGACCATTGAGAAAATTTTCACCCCGCAGGACGA
CGCGTTTTATGCGGTGATCACCCACGCGGCGGGGCCGCAGGGCGCTCTGCCGCTGACCCC
GCAGATGCTGATGGAATCTCCCAGCGGCAACCTGTTCGGCATGACGCAGAACGCCGGGAT
GGGCTGGGACGCCAACAAGCTCACCGGCAAAGAGGTGCTGATTATCGGCACTCAGGGCGG
CATCCGCGCCGGAGACGGACGCCCAATCGCGCTGGGCTACCACACCGGGCATTGGGAGAT
CGGCATGCAGATGCAGGCGGCGGCGAAGGAGATCACCCGCAATGGCGGGATCCCGTTCGC
GGCCTTCGTCAGCGATCCGTGCGACGGGCGCTCGCAGGGCACGCACGGTATGTTCGATTC
CCTGCCGTACCGCAACGACGCGGCGATCGTGTTTCGCCGCCTGATCCGCTCCCTGCCGAC
GCGGCGGGCGGTGATCGGCGTAGCGACCTGCGATAAAGGGCTGCCCGCCACCATGATTGC
GCTGGCCGCGATGCACGACCTGCCGACTATTCTGGTGCCGGGCGGGGCGACGCTGCCGCC
GACCGTCGGGGAAGACGCGGGCAAGGTGCAGACCATCGGCGCGCGTTTCGCCAACCACGA
ACTCTCCCTGCAGGAGGCCGCCGAACTGGGCTGTCGCGCCTGCGCCTCGCCGGGCGGCGG
GTGTCAGTTCCTCGGCACGGCGGGCACCTCGCAGGTGGTCGCGGAGGCGCTGGGTCTGGC
GCTGCCGCACTCCGCGCTGGCGCCGTCCGGGCAGGCGGTGTGGCTGGAGATCGCCCGCCA
GTCGGCGCGCGCGGTCAGCGAGCTGGATAGCCGCGGCATCACCACGCGGGATATCCTCTC
CGATAAAGCCATCGAAAACGCGATGGTGATCCACGCGGCGTTCGGCGGCTCCACCAATTT
ACTGCTGCACATTCCGGCCATCGCCCACGCGGCGGGCTGCACGATCCCGGACGTTGAGCA
CTGGACGCGCATCAACCGTAAAGTGCCGCGTCTGGTGAGCGTGCTGCCCAACGGCCCGGA
CTATCACCCGACCGTGCGCGCCTTCCTCGCGGGCGGCGTGCCGGAGGTGATGCTCCACCT
GCGCGACCTCGGCCTGCTGCATCTGGACGCCATGACCGTGACCGGCCAGACGGTGGGCGA
GAACCTTGAATGGTGGCAGGCGTCCGAGCGCCGGGCGCGCTTCCGCCAGTGCCTGCGCGA
GCAGGACGGCGTAGAGCCGGATGACGTGATCCTGCCGCCGGAGAAGGCAAAAGCGAAAGG
GCTGACCTCGACGGTCTGCTTCCCGACGGGCAACATCGCTCCGGAAGGTTCGGTGATCAA
GGCCACGGCGATCGACCCGTCGGTGGTGGGCGAAGATGGCGTATACCACCACACCGGCCG
GGTGCGGGTGTTTGTCTCGGAAGCGCAGGCGATCAAGGCGATCAAGCGGGAAGAGATTGT
GCAGGGCGATATCATGGTGGTGATCGGCGGCGGGCCGTCCGGCACCGGCATGGAAGAGAC
CTACCAGCTCACCTCCGCGCTAAAGCATATCTCGTGGGGCAAGACGGTGTCGCTCATCAC
CGATGCGCGCTTCTCGGGCGTGTCGACGGGCGCCTGCTTCGGCCACGTGTCGCCGGAGGC
GCTGGCGGGCGGGCCGATTGGCAAGCTGCGCGATAACGACATCATCGAGATTGCCGTGGA
TCGTCTGACGTTAACTGGCAGCGTGAACTTCATCGGCACCGCGGACAACCCGCTGACGCC
GGAAGAGGGCGCGCGCGAGCTGGCGCGGCGGCAGACGCACCCGGACCTGCACGCCCACGA
CTTTTTGCCGGACGACACCCGGCTGTGGGCGGCACTGCAGTCGGTGAGCGGCGGCACCTG
GAAAGGCTGTATTTATGACACCGATAAAATTATCGAGGTAATTAACGCCGGTAAAAAAGC
GCTCGGAATTTAATTATTTTAAGAGATAAAACCGTCTGCGGAATATTTCCCGCAGACGGC
TTTGTTGTTTTTGAAATTTATTAATTTAAACAATTAGTTGAGATATATCGTTGGCGTCAC
AAAAGCAAAATAACGTAATTCGGAAATAAGATATGACCATTGCTGGTTAATTGAATAGCT
CATTACACTCCATTAACACGATGTTGTAATTCGGCACACTACATAAGGGTGTAATTCTGA
TGACGCAATTAACCATGAAAGACAAAATTGGCTACGGGCTGGGAGACACCGCCTGCGGCT
TCGTCTGGCAGGCCACGATGTTCCTGCTGGCCTATTTCTACACCGACGTCTTCGGCCTGT
CGGCGGGGATTATGGGCACGCTGTTTTTGGTCTCCCGCGTGCTCGACGCCGTCACCGACC
CGCTGATGGGGCTGCTGGTAGACCGCACCCGCACGCGGCACGGCCAGTTCCGCCCGTTCC
TGCTGTGGGGGGCCATCCCGTTCGGCATCGTCTGCGTGCTGACCTTCTACACGCCGGACT
TCTCCGCACAGGGCAAGATCATCTACGCCTGCGTGACCTACATTCTCCTGACCCTGGTCT
ACACCTTCGTTAACGTGCCGTACTGCGCCATGCCGGGCGTCATCACCGCCGACCCGAAAG
AGCGTCACGCCCTGCAGTCCTGGCGCTTCTTCCTGGCGGCGGCGGGCTCGCTCGCTATCA
GCGGCATCGCGCTGCCGCTGGTGAGCATCATCGGCAAAGGGGACGAGCAGGTGGGCTACT
TCGGCGCCATGTGCGTGCTGGGGCTGAGCGGCGTGGTGCTGCTCTACGTCTGCTTCTTCA
CGACCAAAGAGCGCTACACCTTTGAGGTGCAGCCGGGCTCGTCGGTGGCGAAAGACCTTA
AGCTGCTGCTGGGCAACAGCCAGTGGCGCATCATGTGCGCGTTCAAGATGATGGCGACCT
GCTCCAACGTGGTGCGCGGCGGGGCGACGCTCTACTTCGTGAAATACGTGATGGATCACC
CGGAGTTGGCGACCCAGTTTTTACTTTACGGCAGCCTCGCCACCATGTTCGGCTCGCTTT
GCTCCTCACGCCTGCTGGGCCGCTTCGACCGCGTCACCGCCTTCAAGTGGATCATCGTCG
CCTACTCGCTGATCAGCCTGCTGATTTTCGTCACCCCGGCGGAGCACATCGCGCTCATTT
TTGCCCTCAACATCCTGTTCCTGTTCGTCTTTAATACCACCACGCCGCTGCAGTGGCTGA
TGGCTTCTGACGTGGTGGACTACGAGGAGAGCCGCAGCGGTCGCCGCCTCGACGGGCTGG
TGTTCTCCACCTACCTGTTCAGCCTGAAGATTGGCCTGGCGATTGGCGGGGCGGTGGTGG
GCTGGATCCTGGCGTACGTCAACTATTCCGCCAGCAGCAGCGTGCAGCCGGTTGAGGTGC
TCACCACCATCAAAATTCTGTTCTGCGTGGTGCCGGTGGTGCTCTACGCGGGCATGTTCA
TCATGCTGTCGCTCTACAAGCTCACCGATGCCCGCGTGGAGGCCATCAGCCGGCAGCTGA
TTAAGCACCGCGCGGCGCAGGGCGAGGCCGTTCCCGACGCCGCGACAGCCGCATCCCATT
AACCGGAGGCAATATGGAAATCACTAACCCGATACTCACCGGCTTCAACCCGGACCCGTC
CCTGTGCCGCCAGGGCGAGGACTACTACATCGCCACCTCGACCTTCGAGTGGTTCCCGGG
CGTGCGCATCTACCACTCCCGTGACCTGAAAAACTGGTCGCTGGTCAGCACCCCGTTGGA
CCGCGTGTCGATGCTGGACATGAAGGGCAACCCGGACTCCGGCGGCATCTGGGCGCCGTG
CCTGAGCTACGCCGACGGTAAATTCTGGCTGCTCTACACCGACGTGAAGATTGTCGACTC
GCCGTGGAAAAACGGCCGCAACTTCCTCGTCACCGCGCCCTCCATCGAGGGGCCATGGAG
CGAGCCAATCCCGATGGGCAACGGCGGGTTTGACCCGTCCCTGTTCCACGACGACGATGG
CCGCAAATACTATATCTACCGCCCGTGGGGGCCGCGCCACCACAGCAACCCGCACAACAC
CATCGTGTTACAGGCGTTTGACCCGCAGACCGGCACGCTCTCGCCCGAGCGCAAAACGCT
GTTTACCGGCACGCCGCTCTGCTACACCGAAGGCGCGCACCTGTATCGCCACGCGGGATG
GTACTACCTGATGGCCGCCGAGGGCGGCACCAGCTACGAGCACGCCGTCGTGGTGCTGCG
TTCCAAAAATATCGACGGGCCGTACGAGCTGCACCCGGACGTAACGATGATGACCAGCTG
GCACCTGCCGGAGAACCCGCTGCAGAAGAGCGGCCACGGCTCGCTGCTGCAGACGCATAC
GGGTGAATGGTACATGGCCTACCTCACCAGCCGCCCGCTGCGCCTGCCCGGCGTGCCGCT
GCTGGCCTCCGGCGGACGCGGCTACTGCCCGCTGGGGCGCGAGACCGGCATCGCCCGCAT
TGAATGGCGCGACGGCTGGCCGTACGTGGAAGGCGGCAAGCACGCGCAGCTGACCGTGAA
AGGCCCGCAAGTAGCCGAGCAGCCTGCAGCCGTTCCGGGCAACTGGCGGGACGATTTCGA
CGCCAGTTCGCTTGACCCGGAGCTGCAGACCCTGCGCATTCCGTTCGACGACACCCTCGG
CTCGCTCACCGCGCGCCCGGGCTTCTTACGGCTCTATGGCAACGACTCGCTCAATTCGAC
CTTCACCCAATCGACCGTGGCGCGCCGCTGGCAGCACTTCGCCTTCCGGGCAGAAACGCG
GATGGAGTTCTCGCCGGTGCACTTCCAGCAGAGCGCGGGGCTGACCTGCTACTACAACAG
CAAAAACTGGAGCTACTGCTTTGTGGACTACGAGGAGGGACAGGGTAGAACCATCAAAGT
TATCCAGCTCGACCACAACGTGCCGTCGTGGCCGCTGCACGAGCAGCCCATTCCGGTGCC
GGAACATGCGGAGAGCGTCTGGCTGCGGGTGGACGTGGATACGCTGGTCTACCGCTACAG
CTACTCGTTTGATGGCGAGACGTGGCACACCGTGCCGGTGACGTATGAGGCGTGGAAGCT
GTCGGACGACTACATCGGCGGGCGCGGCTTCTTCACCGGCGCGTTTGTGGGCCTGCACTG
CGAGGACATCAGCGGCGACGGCTGCTACGCGGACTTCGACTACTTCACCTACGAGCCGGT
CTAACGGCTCAGGCCGGGTAGCCCAGCGCGCGCGAGAGCGCGAGCCCGGCCTGCTGAAGC
TGCTCGCGGAAATTAGCCAGCTCCGCGTCGTCCACGCGGGAGGTCAGCGTCGACAGGCTC
AGGGCGGCGATGACGCGGGACTCGTGGTTCCACACCGGCACCGCCACGCAGCGCACGCCC
TGCTCGTTCTCTTCGCTGTCCAGGGCGTAGCCTTGCTCGCGGGTCTGCGCCAGGGCGCTC
ATTAAGGCTTCGCGAGACGCGAGGGTGGCGGGCGTAAAGGTAGTGTACTGATAGCCCTCC
AGCAGGGCGTTCAGCTCGGCCTCGCCCAGCCAGGCAATCAACACCTTGCCGATGGCGGTG
GCGTGCACCGGCAGGCGGCGGCCGATGCGTGAATAGGCGATGGCGGCCAGCTTGCCTTCA
ATCTTCTCGATATAGACCCCTTCACGCCCGTCCAGGATCCCCAGATGGGTGGTCTGCCCG
GTCCGCCGGGACAGCTCCGTCAGCCAGCCTTTTGCCTTCTGCCGAATATCGATGGAGCCC
ACGACAAAATGGCCGCGCTCGACCAGCTTCATGCCGAGGCGATACTTGCCGTTCTCCGGG
TTCTGATCGATATAGCCGTGAAGCTGCAGGGTTTTTAGCAGCGAGTGGAGGGTACTCTTG
CTCAGCCCCATCAGTTTGCTGATGTCGGTGATCTTAAGCTCGGTGGCCTGCTCGTTGAAC
AGGTCGAGGATCTGCAACGCACGTTCAACAGACTGAATAATCGGCATAATGCTGGCATGT
CCACGCTGGAATTAAGGCGAAAACGTACCTTTTTCGGGATGAAAAATCAATGAAATGGAG
CCGGTGTTCTCCCTCTCCCTGTGGGAGAGGGCCGGGGTGAGGGCACCAACGCGCAGCGGA
CCCAATCACTCCCCAAGCGTTGCCATCATCACCGCCTTAATCGTATGCATCCGGTTTTCC
GCCTGGTCGAACACGATGCTCGCCGCCGACTCAAACACCTCGTCCGTCACCTCCATCCCG
CCGTGCAGATCGAACTCCTTCGCCATCTGCTTGCCGAGCGTAGTCTGGTCGTCATGGAAC
GCCGGCAGACAGTGCAGGAACTTCACGTTCGGGTTGTCGGTCAGCGCCATCATCTGCGCG
TTCACCTGATACCCGCGCAGCAGCGCAATCCGCTCTGCCCACTTCTCTTTGGCCTCGCCC
ATCGACACCCACACGTCGGTATAGATAAAGTCCGCGCCCTTAACGCCTGCCGCCACGTCT
TCCGTCAGAGTAATTTTCCCGCCGTGCTTCTCCGCCAGCGCGCTGCACTCCGCCACCAGG
CTCTCTTCCGGCCAGCAGGCTTTCGGGGCCAACAGGCGCAGATCCAGCCCGGTCAGCGCC
GCCGCTTCCAGCATCGAGTTGCCCATGTTGTTGCGCGCATCGCCCGCGTAGACCAGCGTC
ATCTCGTTAAACGCCTTGCCCGGCAGGTGCTCCTGCATGGTCATCAGGTCCGCCAGCAGC
TGGGTCGGGTGGAACTCGTTGGTCAGCCCGTTCCACACCGGCACGCCCGCATACTGCGCC
AGCGTTTCGACCACTTCCTGGCCGTGACCGCGATACTGAATGCCGTCATACATCCGCCCG
AGAACCCGCGCGGTGTCCTTAATTGACTCTTTATGCCCAATCTGGCTGCCGCTCGGCCCT
AAATAGGTAACGCGCGCGCCCTGGTCAAATGCGGCAACTTCGAAAGAGCAACGGGTACGA
GTCGAGTCTTTTTCGAAGATGAGCGCGATGTTTTTACCGGTAAGCTTCTGTACTTCCTTG
CCATTTTTTTTATCGGCTTTGAGCTGTGCGGCAAGGGTCAGCAGAGAAGTGAACTGTGCA
GGGGTAAAGTCGAGCAGTTTCAGAAAGTGTTTTTTGTATAAATCGGACATTTTATCCTCG
CATGGCGAACGCCACTTATTGAATTAAAATTCACTTTATATGTGTAATTATTCATTTGCA
ACCCCATTTCACAATTCTTTCTTACAAAGGTGGAGGCAAACCCGTCCGTGTGTGAAAATA
ATCGTATCTGCCTCCGATTCTCTGCAGAAGCAGAAAGACATTGGATCGAATTCTACAACC
AGGTCGAGTCAGAAATGAGAATGATTGGCCTTCTTTATGATTTTAAGGATTATGCTTCTA
AAATGGCGGAGAACATGGCGAGGCTTGCTGCCTTACTTCATTACTTCAGCGGTGATGGAG
GCGATATATCTGTTACCGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATA
ATGCCCGATGACTTTGTCATGCTGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCC
CAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCG
CTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGT
CATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCAT
AGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAA
CAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCA
GACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTT
AAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCA
ACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAA
GTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCA
GTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAA
ACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGC
ATCACCGAATTTTCAGCCCGGATGTTTCACGTACCTATGTCGAATATCTGGCCGATAAGG
TTGCGGATCGAGAAGAGGATGCAGAGGAATATCTGGAAGCAATCATGGAGGCTCGTGTTA
CCGTTGCTGGCATGGGGCTGGTGATGGAGGTGCAGGATTACTTCGATGGCGAGGCCGATA
GACTGGCGAAGGCGTGGCTGGCCGAGTACACACCGCAAATCAAGTCGTTGAAAGATGAGC
GTAAAGAGGCCTATCGTCAAATCGTCGAAATGAGTACCGAACCGCAGGATGTGGATCTGG
TCAGGCCGGCGAACAAGTTTGAAATGACCAGGGTGCGTGAAGGTGAAAAGGAAGCTGACC
TTCCAGTCTGGAAACACCATTTGTTGTGTGACGAAAGCGGGAACTATCCGGCTCTGTTGA
ACCATTGGGAAACCAAGGTTTTTGAGATCGAAACCAAACGTGAAGGATTTGCTTTCTGGT
ATCGTAATCCACAGTACACAGGGCAGTCGTCACTGGGAATCGCTTATGTTGAAGCTGAAC
AGTACAAGATTGTTCGTCCCGATTTCCTGTTCTTTGCCGAACAGGATGGCAAAATGGTTG
TGGACCTGGTAGATCCACATAGCCTACATCTGGCTGATGCTTTGCCCAAACTGGAAGGAC
TTGCGCTATATGCCGAACATCATTCTGATGCTTACAGGCGAATCGAATCTGTCGCCGAAG
TAAAGGGTAAATTACGAGTGTTAGATTTGAAACGGCAGGATGTGCAGGATGCTGTTGCTA
CCGCTGAAAATGCAGAAACGTTATTTAGTAGCGGACTTGCTGATGACTATCAGTAATCTA
TAGAAAATTGCGTAACGAAACTGCATTTTAGTAATTTTTTGAAACAATACAAATAAGGCC
TTCTCACTGAGAAGGCCATTACCGACTTACAGTTCGATTTGGCTACAGCCGAAGTTACGG
TCTCCTTCACCAAACACTTTGCTTTCAACTTTGGTCAGGTAGTCCAGTCGGGTTAACAGC
GCCTGGTAGTTCTGCTGGAAGTCAGTACTATTGGTGTCTAGCACATACTTACAGTTTTCA
GGAAAATGGACCAGACCAGGGTGATCGTCTCTCTCCAGTCTCAGGGCGCTGTACCAGGCT
CCTGTGATCATCCCTCTAAGGTTATCGTCCTGATCGTAATCCCCGAGGTGGTAGTAAGCG
TCTTTGTTGAACAACAGGCAAATGTGATAGTGGCATTTACCTGATTCAGAATACTCTTTC
GCCCATATAATAAATAAAGGGCAACGGTAAATGCGTTTATCCTCACGCACCTTACGGGTA
CGGTCAGCCTCCAGCTTAGCTCTGAGGGATTCACGCATCCGGGATATCACCCCAGGTTCC
AGGTTAGGGAAGCAACAGATATTGTCACCGTTATCAACTATTTTGGGATAGTGGAGATCG
ACACGTACAGCAATTAACCTAGGATACCGGTTAGTCAAATAACATAATAATTTATTAATC
TTACTCTGATATTCGAGGATATGTACTCCATGAGTACCTTGATATGTTTTCATAATATAT
ACCTGTATTTGGTCCTACGGTCTATAGCAGACCGTACAGGGATGCCATACAGGCAGGGCT
ATTCCTGGTCACTGTTGTCGGTATATACTGGTATCAGATTTTAGTACGGACATACTGATC
TGATTACTACTCTTACTGGTGAATACAGGTAGTAAGAGTACACAATGCCATTATATAATA
CCTATCCAACATCTAAATTTGAGACGAAGGTAGCCCCAGCCTGTGATGGCTGTTAAAAAG
TTACTCTGCAATTAGCTTCTGGAATTAACCGATGATTCCGTTATTCCAGTGCCGCTTCAC
AGTCGATAAACTGATACTCAATTTCTTTGCAATCTCAGCCTGAGTAAATCCACCTTTCTT
AAGTATTGTGATATCACGTCGGTATTTGCTTCCCTCCTTTCGTCCTAATTTTTTCTTAAC
ATGTCGATATCGGCTTTTAGTTGATTTCAGATTGTGAATGTCAATCGTATCCTGACGAGC
AATCAAAAAAGACAAGCAACTTTCAGCAGAAGGCTCTATCCTTGAAGCTGGATGGTAGCT
GTAGATAAACATTTCTTTTTGAAGGCAAAAAAATAAAATATTCTGTAAGTCCTCCACAGT
TCTGCCAAGACAGCTTAGATCTGGAATGACAAGCGTGTCCTGCCGGTTCATTTCATGATG
AATCAATTGTCTGAGTAAACGTTGCTCTGAAACAACCTCTTTAATATCTACCTGCTCGAT
CACAACATGTTCAGGTAGAATATTAAATTTTTGGCATATCTCAGCAAGTGAGTGATGATC
TGTAATGCTTTCTTGCTGTTCGCTACTGCATATGGTGTAAAAAAATGAACGCATCTGATG
CACTCCGGTGTCATAAATTATTTTTTGATACCTGAATAATGTCATTTTGCATAAAAAACA
ACCAAAAATAGAGAGTGATTGCCAGCGATACTTTAACTGGTAAAGTAGTATTTTACCTCT
CATAATTGTTTGTCCTTCTTTGTTACCTCTTAGGTTCTGCTCTCTTGTGAGTATGGGTTT
ATAATGATGTCATCCGGTACATTAACACGGTTGGAAACATCTGTTTTGCGGAGCACTGGC
AGCATAACCACCATTTCATTGACATGGTAAATATCAATCCAACAAACAACCGGATAAGGC
ATAACAATCCCCTTTCTTCTAAGAACTTCATTTATCCCGAATATAATCAATTGGGATGTT
GACAAGAGTAGAGCCTGCCCGGCATCAAAGTAATAACCCTCAAAGGTTGTTCTATGAATA
AGAATAATGTTTGAATATCCTGAGACACTTTGATGCTTTACATCAAAATGTCTTTGATTG
TAAATGTAAATGGCTTTTTCCATATCGTAATTTTCCCTTAGCGAGGATAGCCTTTCACGT
ATAACTGTTTTTTCATCTTTCCCCATGAATTCATCATTAGCGTTCAGTTGAAAGTAATCT
GCAATGGGGATTTTTAATGGACTCATGATGTTCGTTTTCCAGATTAACGAACAGTACTCT
TCCAGAGTTACTTCTGTTTTACCTCGGCTTCGATTGATGCTTTCTTTTATAGAGAACTTT
AACAGGTCATTTTTTATTTCATTTATTGACCAGTTATGACGATTGCATTTTTCTAATATA
GGGATAGCCAAATCCACAACTTCCGCTATTACGGAAGAGTGAGATTTATTTGTTAGTCTG
GCATAATGATCAATTACTCCTAATGAAGATTGATTTTTGAACGTGACTGAGTGTTTTTTT
ATGGGAGTAGTCTGTACTACCTGTGACTCATTGTTTTTGCCTTGACAAGGTTTTTTTCCT
GGTAGAACGCTGCTCATCTCAAAATTAGTAACACTATTAGACATTTTTAAGGAAACCTCT
TTGTTATCTCAATATAAAACTACTATCTGAAATTTCTCAGTGTTGCCCCATTTTTCTCGG
GGCAACATCGCTATAAATCAATAAAATTAAATCTGTAATTTATTACAGACTTTCTCGTAC
AGAAAATGTATCTATAAAATCGAGGACATCTTTACGTAACCAGTAATGGCGGCCATTGAT
TTGTTTTGGGCGAGGTAGCCCCTCAGGCAATTTGTCCTGACAAAGCCATTTACGAATGGT
TTGAGATTTGTAGCTAATGATTTTAGCTAACTCAGCTGTTGAAATGAGCTGTGATTGAGA
TGTATCCGGGAGTTTGAATGCGCTCATTTTGCCACCTCAGTGATTGAGATATTGGCAAAG
AAAGCTTTAAGCATTATTGAATTAGTAGGGGTAGTAATGAAGGCAGAAGGAAACGTTTCG
GGCTCGGGGTCGGGGTCACTACCATCACCTGAATCTGATGATAAGGCACTTTTAGCTGAT
TTAGCCGTACTGTGATGCGATCTGGATGCCTGATTTTTACATGACATCAGACGCGCGAGA
AAGTTAGTAGCATTTTGCATTCTTTGTTTAAGATGTAAAATTTTCAGTTTGGCGCATGCG
ACAGACTTGCGAAGAGCTGAGTATGTTCCTTTGAGATACTCGACAACCTCTTCCATGGAC
GCAGGATCGTTAAAGGATTGAGTTGTTTTACTTGAATTAATACACCAGCGAGCTCTGATA
GCTGCCAGAGTGGGTTCTATGGATACAGTTGCTGGGGTTGCCATTGGCTTATCTCCTGTG
TAGTTGCTGTATCATTGACTAAACTGTGTATTACGATACATGAAAATCTATCTTGATCAA
TAGTTGATGATATTTTGTAATATGTTGATTTTTAATGGAATCAACGCATATCAACGTTGT
TTTTTATGGTAATACCTGCTTCATTTAAGATCCATGTCTCAATTTTCTCGTGCCATTTTC
GTAACAGATCTAACGGACGACGGCGATAGTGTTTTTCGGCAAGAGCGCTGGGTTTGTGTC
CCATAATTTGAGCAACAATACCAGTGGGAACTTCAACCCACTCGGCCAAAGTACCAAAAC
TACGACGTAAACCGTGAAGGCTGATATGTGGTAACTCAGCCAGCACTAATGCTCTGTTGT
GCGCTGAACGCGGCTCAATAATTTTGCCACTTTTACTGTTACTTCTGAAAACCCAACCCT
CCTTATTTACGTCAGAATTTGGGGATTGCGCTAGTACATTTAACAATTCAGAAACATAAG
GAGTGAGAGGGATGATACGTTCACCTTCGATCTTGTCTTTAATTCGCATGCTTGACCATT
TGAAATCTACGTCTGACCAGCGAAGCGACGCAATTTCTTCACGCCGAGCACCAGTGAGCA
AAAGTACTTGGAGATAGGCCGATGCAATAGGATTATTGAGGCTACGCACGGCACTAAACC
AGCTTTTTAGTTGTTCCTTTTGCAGGCAATCATCAGCTTTACTCGCTGACACGGGAACCA
TTTTTCTTACGTTGTAATCTTGTGCCAGATCGCCAGGAATGATCCCTTGATATTTTTTCT
GATAATTACTCCATTTGATGAAAGCACGTAGTAGGCGATAAGCGTGAGCAGTGACGGTAG
GTCTATTTTGCCTTTCTGTACTCAGCCACGCTGCTATGTAATCTGGGGTTAGCTCCGATA
ACGGCAGGTTGAGCAAACTAGCCAATGGTCCAGCCGAAGTCGGGCCTTGGCCTCTTTTTT
TACTTTCGCCTCCACGACTGGACAAGTTAATGTGATCGGCAATGTATCGAGTAGAATATG
GGCGTTTAGTTTTTGCACTGATACCGGTTCTCAATTCTTGAAGATAGTCTTCCCAGGCGA
CGGAGAAAGTCACTTTTGTTTTACGTGATTCTGCCTGCAGGGATTCTGCTTCTGCGATTT
TTACAGCCTTAGCAATTCGTGGATCTATCCCTGTATCGATCAATGTTTGTAACCGTCTTG
CCTCGGCTCTCGCATCATCAATCTTCCAGTCGTTAATGTTGCCAATAGTCATGCGAAGGG
TTTTCCCCGCATATACGCTTTGGAATACAAAGGCTTTTGCTCCGCTAGTTGCTCGGCATG
CCAGGGTTGTTACATCTGCATCCCAAAGAAAAGTTTGTTTTTTCCCTTCCGGTAAGGTGA
ATCTGCGAAGTCTTTCGAAGGTAAATTTTTGTCTTGAAAGCGCCATTTTTCGGCTCCAGT
TGAGAATTGCTGTCTTACAATAATGTAACTGCTGGTGTAAGTAAATGGAGGGAATAAACA
TCAACTTTTGTTAATTTCAATCAACGGGTTTATTGCTATAACTTGGTGTTTTATAATATA
AAGTATGTTGTTTTGATTGATTGCTCAAGTAGTTAAAAATGCATTAACATCGCATTCGTA
ATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAAGAGTTACCCC
ATATTTAAATACACCACGTTTCCTCCTGTGCCGTATTTGTGCCATTGTAACCTTGGCAAT
TCATCAAAATACTGTTCTGACATCAGGCAGTGCAGGTGCAGACATTTAAGCCAATTGCTG
CCGCCATTCTTTGACGTAGTCAATCAGGGCGCGGAGCTTTGGTGCAATATTGCGACGCTG
TGGGAAATACAGATAGAAGCCCGGAAATTGTGGAAGAAAGTCATCAAGCAGCGATACAAG
CTTACCGCTTTCAATATATGGCCTGAAAGTTTCCTGAGTGGCAATTGTTATTCCTCCGCC
GGCAAGAGCCAGCCTCAACATCAGACGCAGATCATTAGTCGTAATCTGCGGTTCAATCGC
AAGGTCGAAAGTTCTCCCGTTTTCTTCAAATGGCCAGCGATAAGGCGCAACCTCCGGGGA
CTGACGCCAGCCGATACACTTATGGGTATTTCCCCCGGAGGCGAGAAAGCACTCTCCACG
CCCGGCCGCAAGGATCAGGACGACGGGGGCAGGCATGAATCCTCCTCCTGATGGAGACGT
ACAGAGGCGACTTCTGCCAGCACGGAGAGTGCCAGAGTATGCGCATCCCGGGCTTTGGGG
AATATCCCGACGGGTGCCCGGATTTGCGTTGTTTCCTCCCTGGACCATCCCAGCTCGTGG
AGCTTTTGCAGACGTAACGTGTGGGTTCGATAGCTGCCCAATGCGCCGAGATAAAAGGGT
TTTGCTTCTCGCGCGGCCTGCAACACTGGCAGCTCCCGGTTGAGATCATGGCACAGCAAA
ATGACCGCCGTATCGGTATCGATCTGAGCGCTGGCTGAGGCCGGAAAAAGATCGAAGATA
TGGCTGTCATAGCCTGTGGCTGCTGCAAGACTCGCGGTTGCCTGCGCCTCAAGAGAACGT
CCGTAAATCATCAGCCTGACGCATGGCCTGAACCCCACCTCAAAGCCATTGAGATTCCAG
CCCGTCCGGGTTTGCGTGGGCAGGCACACCAGCGATTGTGCTTGCGGATCGTAGCGCAGC
CCCACCGGTTTTCTCTGTTCCAGGCGGTTCAGCACGGCGAGCAGAGGCTGTGCCGAGCGT
AGTTTATGGAGCGTCAGCGTGATCCCACCGCCGCAGGGCAGAACGATGTCAAACCACGGC
GAACCTTCGCCATAGCGAATTTCGCGATCGCGGCCTGAGCCCATCATCTCCAGCGCTTCA
AAAGCGGCAGCGGCCTCCACGCAGCCGCCAGAGACAAAACCGCAGTAACGACCATCTTCG
CGCACCACCATCTGCGCCCCGAGCGGGCGCGCCGCGCCGCCGCGTATCTCCACCAGCGTC
ACCAGCACCGCTCCTTTACCGGACATTAGCGCCTCTACGGCGAAGCGCAGAATGGTCCGG
TGGTCATCGGTGAGAAACGCCTGCTCTGGCTTATGCCAGTGTTCGTCTTTGTCAAAAAGC
GGGTATGACATTGTTCCTCCTTAAACCACATCCGGCAGCTTATCGAGCAGCTTATCCAGA
GTGATGGGATAATCCCGTACCCGAATACCGGTGGCGTTATACACCGCGTTGGCGATAGCC
GCGCTCACGCCGCACAGGCCCAGCTCACCGACACCTTTGGCCTTCATCGGGGAGGATATG
GGGTCGGTATCATCCAGGAAAATCACCTCCTGTTTTGGGATATCCGCATGAACCGGCACC
TCATACCCCGCCATATCGTGATTAACGAAGTAGCCCAAACGGTCATCCACCGCCAGCTCC
TCCATCAGTGCCGCGCCCATGCCCATAGTCATTGCGCCAATGACCTGGCTGCGCGCAGTT
TTCGGATTCAGGATGCGTCCTGCAGCACACACAGCGAGCATACGCCGGACCCGAACTTCT
CCCGTCGCGCTATGCACGCCGACCTCCACAAAATGCCCGGCAAAGGTCGACTGCTGGTAC
TCTTTGCTCAGTGTTCCGAATTCAATGCTCTCTTCCGCTGTCAGTCTGCCGCCTGCGGTG
GCTTCATGTAGCGTGGCGCTTCGGGTACCGTTGGTAATCTTGCCGTCGGCAAACTGCGAC
TGCTCAGGATCAAACCCGACTGCCGAGGCAATCATTTCGCGAAGCTTCATACAGGCGGCG
TAAACGCCGGAGGTGGAGGTATTCGCGCCCCATTGTCCACCAGAACCCGCAGAAACCGGG
AAACTGGAATCGCCGAGGTGAACCGCAACCTGCTCCAGCGGTACGCCAAGCATTTCCGCT
GCCGTCTGGGCCAGAATGGTGTAGCTGCCGGTGCCAATGTCGGTCATGTCCGTTTCTACG
GTAACGGTGCCGTTTTGTTCGAGGTGAACCCGAGCACCCGATTTTTCCAGCAGATTATTG
CGAAAGCCCGCCGCAACACCGTGGCCGACTAGCCACTCCCCGTCGCGCACCTGTCCGGGT
GTGGCGTTGCGCTGCTTCCAGCCAAATTTATCCGCTCCGGTGCGCAAGCACTCGATAAGC
TGACGGCGAGAGAAGCAGCGCGTCGGGTCGGCGGGGTCAACCTGAGTGTCATTCAGGATG
CGAAACTCGACGGGATCGATGCCCGCTTTTTCCGCCAGTTCGTCGATCGCGATTTCGAGC
GCCATCAGACCGGGGGCTTCGCCGGGCGCACGCATGGCGTTCCCTTCCGGCAAATCAAGC
GTGGCGAGCCGCAGGCCGGTATGACGATTCGCCCCGGCGTAGAGTAATTCGCTTTGCTGT
ACCGCCGTTTCCGGCGTGCCGCCGGGCAGGTTTCCAGACCAGCTTTCATGTGAGATAGCG
GTGATTTTCCCGCTCTGGTCGGCACCGATACGCAAGTGCTGAAGGGTGGCGGGGCGGTGC
GTGGTGTTATTGGGAATAGAGGGGCGGGGGAGCATCACTTTAACCGGACGTTTCACCGCT
CGGGCGGCGAGGGCCGCCAGCAGCGCATCGCTTCTCAGGAACAGCTTGCCGCCAAACCCT
CCGCCGATATACGGGGAGATAATACGCACATTCTCCACGGGAACTTTCAGCGTTTTTGCC
AGATCGGTGCGGCACCAGTCAATCATCTGATTTGAGGTCCAGAGGGTAAGCTTATTTCCA
TCCCAGACGGCCATCGAGGCATGCGGCTCCATCGCCATATGGCTCTGGTCCGGGGTCGTG
TAGGTAGCATCAATCTTCACCGCAGCGGAGGTGAAAGCCCCGTCAAAGTCACCGACGTTT
TTGTCGGGCGTGTCTTCCGGCGGCTGATTGACGGCCTGTTTTTCGTCCGCCAGGGAGTAA
GCTCCTTTATTACGGCGATAGTGTGCCTGCACCAGCGAGGCCGCCGCTCGCGCCTGTTCG
AAGGTCTCGGCCACTACCAGCGCAATGGCCTGATGATAGTGCTCAATAGTGGGGCCGCCT
AACAGCCTGGCGGTGTTTTTGTCGCCTTTGCCGAGTGCCCCGGCGTTACTGGCGGTAATG
ACAGCCAGTACGCCCGGCGCTTTTTGCGCGGCGTCCGTATCAAGGGCGGTGAGGCGTCCT
TTGGCAATGGCGGAACCGACGATATAGCCATAGGCGGCGTTGGGGGCTTCTTCATGCCAT
TCGTAGGCGTAGCGTGCCGTGCCGGTAGTTTTCAGCGGTCCGTCGATGCGGTCATGGGGA
CGACCGACAACCTTCAGCTGATCGATCGGGTTTTCCCCTGCGGGTTTATCAAATTTCATG
CCTGTGCCCTCGCTTCAGCCAGTACGGAGGCAAGCGTTCGCTTCGCCAACAGGAGTTTAA
AGGTGTTTTCAGCGGTGGGATGGGCGCTGGCGAACAGCGTGTCATATACGGCCTGCGCCC
CCTGGGATAGCTGAGCATCCGCAGCCTCAATGCGCCAGGGCTTATGTGCTACTCCGCCCA
GCGCGACGCGCCCGCTGCCGTCAGGCTGAATAATCGCCGCGACCGATACCAGGGCAAAGG
CGTAGGAGGCGCGATCGCGCACCTTACGGTAGATATGTTTTCCGCCGAGCGGTGGAGGTA
ACGTCACCGCAACGATAAGCTCACCGGGAAGCAGGGCGGTTTCAATGTGCGGCGTTTTTC
CCGGAGGGTGATAAAAATCAGCCAGTGTGATACTGCGAGTCTTTCCCTCCGGCGTGATGG
TTTCCACCACCGCATCCAGCAACCGCATTGCGACCGCCATATCGCTCGGATGGGTGGCAA
TGCAGGCTTCGCTTACGCCTACCACCGCGTGCTGACGGCTAAAGCCTTCAAGCGCCGCGC
AGCCGCTCCCGGGCAGGCGCTTATTGCAGGGCTGATTGGTGTCGTAAAAATAGGGGCAGC
GCGTGCGCTGGAGCAGATTACCTGCGGTGGTTGCCTGATTACGTAACTGACCAGACGCGC
CAGCGAGCAGGGCGCGGGAGAGTACCGCGTAATCACGACGCACGCGCTCGTGAGCCGCCA
GGTCGGTGTTCCGTACCAGTGCGCCGATGCGCAGCCCACCCGCGTCGGTCACTTCAATCT
TATCGAGCCCGAGGCCGTTCACATCGATAAGGTGGGTGGGCGTTTCAATTTCCAGCTTCA
TCAGGTCCAGCAGATTGGTCCCGCCCGCGATAAATTTTGCGCCGGGTACGCGCTGAGCGC
TAAGTGCCGCCTCGGCTGGGGTATTCACTCGTTCATAGGTAAACGCCTTCATGATTTTAT
CTCCCCCGCAGCATCTTCAATGGCGGCAAGGATGTTAGCGTATGCACCACAGCGACAGAT
GTTGCCGCTCATACGTTCACGGATCTCATCGGCAGTTGTTTCTGGAGCGGAAACCAAATC
GACCGTGACGTGACTGGGAATGCCGTCCTGAATCTCTTTTAGCACCGCTACTGATGAGCA
AATTTGCCCGGAGGTGCAGTAGCCGCACTGGAAGCCATCATGCTTGATAAAGGCCGCCTG
CATGGGGTGAAGATTATCTGGCGAACCCAGGCCTTCAATGGTGGTGATCTCGGCCCCCTG
ATGCATGACTGCAAGCGTCAGGCAGGCATTAAGCCTGCGACCATTGACCAGCACGGTACA
GGCTCCGCACTGTCCGTGATCGCAACCTTTCTTGGTACCGATCAAATGCAGATTTTCACG
CAAAGTGTCCAGTAGCGTGGTTCGGGTATCCACCTCAAGCTGCTCGGTTTTGCCGTTCAC
CTTCAGTGTCAGGGGCATTATCTCTGGCGCGGGTGTAGCTGCCGGAACGCTTGCCGCCAG
CGTAGAATGAGGATAAACCACGGCGGTCGCCGCTGTTGCGGCGCTCACTTTAATCAGATC
GCGACGGGTCAAACTTAAATCGTGCGGCTCGTGCTTCCCAACCCGATTATCTTCGGGGTA
TTCGCCTTGGTTGCTCATACCAGGCCTCCGGTATTCTAAAGGGGAAAATAAGAGTGCGTT
GCGAGAGTGCTGATGCTTTTTTAAACGTTAAGCATAGTCGGCGACAGCAGGAGGATTATT
CTTAAAACGCGAATGCAGCTATGAGCCCGGCTAATAAATTCATGTTCGCCGGGATGTTGA
TGATGATGGGAGCTGGTTTATTGCTTTAGTTGTACGATGCAAAAACCAATAAGGAAACCT
GTGATTTTCAGCTCTACATCACCCTGCAAATCTCTGTCACTTCTAATATAAAAATAGGGA
GAAATGATGGAGCTTATATTCATTGGCGATTAGGAAACTATCTTGTTATACAAAACAATA
CAGTTCTTTACATTTGCCTTGTTTTATGAATACTCCTGAAGAGGTGTATAACATAATGGT
ACAAGCAGGGTAGATATGAATATATTTGAACAAACTCCACCGAACCGCAGACGTTATGGT
CTTGCTGCATTCATTGGGCTGATTGCTGGCGTTGTTTCCGCATTCGTGAAGTGGGGGGCT
GAAGTTCCATTGCCGCCACGTAGCCCGGTGGATATGTTTAATGCAGCGTGTGGCCCGGAA
TCATTAATCAGGGCTGCAGGCCAAATTGATTGCTCGCGTAATTTTCTCAATCCACCGTAT
ATTTTTCTTCGAGACTGGTTGGGGCTGACAGATCCCAATGCGGCTGTTTATACCTTTGCC
GGGCATGTCTTTAACTGGGTTGGTGTTACGCACATTATCTTTTCGATAGTGTTTGCTGTC
GGTTATTGTGTGGTCGCTGAAGTATTTCCAAAAATTAAACTCTGGCAGGGCTTACTGGCA
GGTGCTTTAGCCCAACTTTTTGTTCATATGATTTCATTCCCTCTCATGGGACTGACGCCA
CCTCTGTTTGATCTCCCGTGGTATGAGAATGTTTCTGAAATTTTTGGACATTTAGTCTGG
TTCTGGTCTATTGAAATTATTCGCAGAGATTTACGAAACAGAATTACTCATGAGCCAGAC
CCTGAGATCCCTTTAGGCTCAAACAGATAATGCATTGAATGATAAAAATGGCGCAAATAC
AGCGCCATTTTTATAGGTTAAAAACATTGCTTTTTATATTCTGATGCAGATAGTCAGTGA
GTATATCGCGCTACTTCAGGATGATGTAGATCCGAAGAACGCTACAGAAGAGAGGCATTG
TTGCTGGCAAATAGAAGAAGTATCGGGTTTTGTTACCCCTGAAAAACGAAGCCCCGCTAT
TATCGCTGGCGGGGCAGTGCAATTAATTATTGTATGTTTATAACGGTGTCAGCCCGTATT
TAGCCCTTGCACGATTGCAAGCCTCATTGACGACTCCGTTCTCACCAGACATGGCGAATT
CTCTGCATGTGGACGATCGATTTTTATATATCGTGCAGCAGGCATTTTTGCCCGGGGTTC
CTGCAAGGGCAATACATCGGGGGTTTTTCTGATTGGTACCGCTCATGCATCGGTGAAAAG
GGGATATTTGTTCAGTGAGCCTGGCGGGAATAGTACCGCCAGCATCGTCGGCTTCGGCCC
AGTAAAAAGAGACGCGGAAAAATGCACAACAGGCACCACACGTCATGCATGGATTCAGAT
TGCTCATAATTCACCAGTACAGCTAAAAATCGTAAAGAGAACAGCGGTACATCGTATGTA
AGAACGTACCGCGGTTGGCTGGGGAACTTTCGATAGTGTGAGTATTGAATGATTTCCAGC
CGTTACCGATTTTACGTACTAATTCGTGATTAAACCACTCGTTAGCAGGCTGCCTGATAC
CTTTCCGTGTCTCCTGAACACTATGGTGTGCATATGAGAAAGCCCATCGTTACAGGTGAT
ATTGACGATCGCTTCCACATCATTTAAACGATTTTTGGGGCTCTGAGGTGGAATTCTTCC
CTCGACCGATGGATAAGTCTTAGTCCGCCGAAGGGGGCTTAGCCGGACAGGAATCGCTAA
TCTTAATGAATTTGTCGTTATAGACCAGATAGTGATTCCCCGGCTGACGTAACTCAGGCT
GATGAACCACGTCTCCCGGACGTAGATACCAGGCATCGCCTTCCTCTTCGGTCGAATCAC
ATCCTGGCTTAATCAGTAGCTTAAACCATGTGTTGCCAGTGTTACTTACCGTTCCTGTCA
CCTTGTCGAAGGACCATTTAAACTGAACCTGACGTGGTCGTACTACCAGAATGGTATCCA
TCACCACCACCGGCTCCGTGCTGACCACGCCGCCGGTTGGGCTGCGTCTTGTATGGTTAC
GAGTGGGGACCTCGCGAAATGAGACCCGGTAGTAGCGCTCGCGGTTATCCCGTGGACCAT
GATAGTAAAATTTAAAATACTCGCTCTCACCAGCCTGCAACGCCAGCTGGCGGGGGGCGA
AAAGCAGTTCACCATCCACCGGTCGGGTGCGCAATTCACTGCTGCCCGGGCTATCAATAG
CACTGATGGCAATACGGTATATCCGTGCGCTTTTGTTGTTATTCACTACACGTTTGCTGA
CAAAGTCAGTCTCGGACGGCAGCGAAAATGTCAGATTGCCGACCGAAATCGCCTGTGTCA
AAGGTGCCGCCAGCATACAGACCGCTGTCAGCAGGGCCTTAGTTAATGTTACGCCACGTC
GCCTGAACATGAATCTCTCCTGAAGCGCTGACTTCGCCAAACCAGCCGTTATCATCTACC
GTACGCAGCGAAATGGCGTTATCCATTGGAATCGAAAATTTGACTGTGGTCTTATCCATC
TGCCCCACTTCGCCAGAGATATCAGTCCACGGTGTGGTCAACCACAGCGCATCGGTCATA
TCCCGCCAGCTATCATCGCACCCGGCATCGTAGGTTTTTGTAGCTCCGTTGCGGGTAATA
AAGGAAAGTGTCGCCGGGAACGGTACTTTCGCCTTACCGTCATCGGAGCTGAAGACACAA
TAGGAGCGCCCGCCAATCACCTGCGCGGGTCCGGTCACCTTGATCAGCACTTCGTCGGCA
GCTGTTTTACCGCTGGTGGTTACGATATAGCCGAAATCGAGTGCCGACTCGCCGCTGCCA
ACATATCCCTCCCGCGACGGTGTCTGAGTATATTCATCGGAGATAATACTGATGCTGAAA
TCACGGGGTTTGATAATCAGCGTGTTGGAGGTAGAAAATTCATACCAGCCAGACTCCGGT
GATGTGGTGTTCTGAAAGCGAAAGTTGAATAGATCTTTGGTGTTGATATCGCTGATCCCG
AGGTTCACCATCTGCTTAAAGAAGTTGCTCGAGAAGAAAACATAGATCGAGTCTGCGCTC
TTCATCTCGTTGAAGGTGTAGTAATAGGCGGTATTGCTCACCGGTTTCCATGAACTGCCA
TTCAGACTGAACTGCATATCGTACGCCCCGACGGCCGAGGCTAACGACGAGTTGGCGATC
GCCGGGAATATATGGATTGAGGTGTTGCTGAGTCCGTTTGTTTGCAGGGTATAGTTAACC
ATCTTACAACTTAATCCTGAACGGCTGCCGATGGTTTGCGTCCGGCAGTCGGCGTTCCCT
TCGCCCAGAGTCGGTACTCCGTCGCTGTTGATAAATACTTCCGCCAGCGAGTGGGTATTT
ATCAACCGTAGATTTGCTGCTTTCGTATGGGTGACGTTGCGAACATACCAGTTGCCGGAG
GCCTGATCCTTACAGCGTGCGCCGCTGCTGGCGTCATAGTTCACAGAGGTCTGGCAGGCA
TTGATGGTCATTGTAAAGCTGCTGCCGACGGGCATTTGTTGCATATACTGGTAAAACGCG
TCTGACAACATGCCGTGCATCCACTTCGCGCCGCCGCTGGTCACCGTCGCGCCATAAAAT
CCACTGGCGTCGGTGGTTTGCGGCAGGATAAGACTGGTGGTCATATTACACCCAGCGTAC
CAGTTGATGCAGCGCAAGCCAGTTAAAGGAGATGAAACTGGTGAATTTTCCAGCCACATA
TCAAACTTCCAGTTGGTATAAAGGCCGGTGTTGTAACCGTTATCAATGTAGCCGAGGCTT
TGCTGATAGATGGTTCCTGAACCAGTGTATTTTAAACCGGTCCAGCGGTTGGCACCGGTC
AGGCGCGGATCCAGCGCCCCGCCAGGAGTGACGAAAAAGTTGTCGTCTGAGTTGTTTTCG
ACAAACACAAACTCGCGTGCCGGTGCATCCGCCCAGGTTGTTTTGCTCACTGCCGCTCTG
AGCGCAGTTACTGGCCAGATTAGCGCGAAAATTATCATCGTTATTAGTAGGTTAACTCTC
ATTCTCTTCTCCTGTCTGCGTCACCGCCGCCCACGATGAGAGGCCGCTGCAGACCACATC
ACCGACCCAGACGGCACCGCGCGCCTGGTTGAGTTCCAGAGCCACTTCGCAGGTTTTATT
GCCACTGTAGCGAAAATCGATAGTGGGGTATTTCTTATCCACGTCCATGACAAACTCGCC
GTTTTCATCGGTTCGGGTTCGGCCGATATGGTTGTTAATCCGTGCGTTAGCCAGCAGTGT
GCCGTCTTCCGCACGGATACGACCGGAGACGGTAACCATCTGCTTCACCTCTGGCTCAAT
GACAGCGACATTGCCTGGATAGAGAGTCAGACGACTTTTGCGGCCGCTGACGATATCGTA
ACTGTCGAGTGAGTTTTTGCTGTTCTGTAACTCCACCTCATATCTTCCATAGGGAGAGAG
CGGGAGATAGTTACGCTTGCCGTTAAGCGGGAAAATCCGCCCGTTGATTTTGGCGCTGAT
CTGACCGTCGTCCTCCAGCCCGGTGTTGAATATCACCCCAGCGTTGCCATCAGTCCGCCC
GCTGGCAGCAATGTTTTTACCCTGCCAGCCGACGCTGCCATTGGCGGTCAAGTTGGTATT
GACGTAGCCGTCCGCCGCGCTATTGACGTTCAGCGTTCCGCTGGCGTAACGAGCGTCGAA
TTGTGCATACGCCCCGCCGCTGAGGGTTTTGTCATCACCGGTATCGCCGGAGATGGCACG
TGACAGATTGGCACCAACAGTGCGAATGGTTCCTTCATCAAACTGTTTGCGTGCTGACAG
GTTTGCCATGGTGTAGCCGTTTTGATGAGTCATCCCTGCGCTAAACCAGTTGCCCAGTGG
TAGCGAGAGATCGAGAGCGATATATTTTCCTGTATTGGCGTTGCTGTCGCCGTTGTTATA
GCGCTGAATACCGGCCCGCAGGCCAAGCGAACCAAAGGTACCGCTGTAGACATTTTGATA
GTAATCTGCCGTGTAATAATGGCTGTTGTAACGGCGGTCATCATTGTAGCTGATGCTGAA
TGTGCCCAGCTTCGACCACAGTGAGTTCAGGTTGAGTGTGCCGCCGATTGCACGGTTGTC
GGCATCGCTACGTCGCAATTGATTGCCAATGCGGGTTTTTTCCTGATTAACCCACAGCGA
ACTAAAGCCTCCCGGTAGAGTGGCGCTGATGCTGCCGATGCTGCTCCATGAGCTGTCACT
GGCCAGCATATTTTGCAGGTTAACGTTGATCGCCCCCCCAAGCGGCAGCGTCAGACGGGT
TTCACCCACCGCCTGATTATCGTATCCATATCCCGTTGCCGCCCAGCTAAGCGTACTCAA
TGAGCCGGAGGTCGAGGCACCTGCTAGCCAACTCTCTTTAGCTGGTCGCGTCTTTTTCCC
GTTTTCCGACCAGCGATCCATATGAAAGCTACCGCCCCATACCTGCCACGCCAGTGGTGC
ACCGACGCCGCGCCCCCGGCTAAACAGCTTATTGACCCGCTGGGTGCGTTTGCTGATCAC
GCGACCGTTAACGATCACCTCAACTTCCACATCGTAAATCCCGTACGGTAGACCCCGGGT
ATCCACTTCATGATTGCCCATAGTGAAGTTCTGAACGCTTAGTAGCCGCCCATCACGGGT
GAGATGTACTTCGCCCGCCGCCGGTAAAAAGGCGATCACTGGCGTGGCTGACTGGCTGCT
GTCGAAGATGGTGGAGCTGGCCTGGTTTCCCCAGGAAAGGCCGTAAATCTTCCCTGCTGA
AATGGCGGTCATCGGCCCTAAGGACTGCAAGTTCCAGGTGTCGAGCATTCCACCGGCAAA
TCGGTGACCGGCAAAATCGCGTTCATACATCGCTTTATATAATTCACTGTCCTGTTGACC
GCTACCGATCCCGTACAGCGAGCCGTCGAGCACCACATGATGTTCGCGCAGTGCAGTAAC
GTTATTCAGCGACAGATAGCTGGATGTGTTGCTCCCGCCGTTACGCAACTGGTTGTTATA
GACGCCCAAGTTATAGCTCAGATTACTGCTGAGGGTGTTAACACTGGACTGCCCGATGTC
TTCGCTACGTGAGCGTAGTACGGTGCCCAGCGCTTCGCGCTTGACCACTAGCTGCAGCAG
CAGTTGGCGCAAGCTGAGATCCAGCTGCGCGTTGTCAGTCAGGGGGATGGTAAGGGCCTC
ATTGAACGGGGCGTTGGCCAGAGCCATCAGCTGCTGTCGAGTTTGTTCGCTGACACTGGC
GTTATCTTCACTCTCTTCCAGCTGTATTTTCCGGATGCGTAGCTGTCCATCGTCCAGCCA
GATAAAAGCGCTGCCGATTCGCTGATCGTCCTGGCGACCCTGGCTACCGGCGAGATGAAT
ATAGAGCGGGACGCTCATGCCGTCCTGAAGCGCCTGACTGAAGGCCTGCGGAATAATCAC
CCCACCTATTTGCTGCGCACTTATGTCAGCAGCGCTGGCATCGGGCTGAACGAACAAAAA
GACCATGCCGAAGGCAAACTGGGCTTTCAGTCCTGGGGAGAACCGTCGTAAAGGCATTGT
CGTTATCCATCTGCACAGCTATCTATTTCACGGGAATGAACTTATCACCCTGCCAAAGTG
CAACCCGTCCTTTGTTATCCGCAGTGTCCACGCGGGTAAAACGACGCGACTTGCCCGGCA
TCAGGTAGTAATTCTCTTTACACTCCTTACCGTTGGCGGCTTTCAGGCAAGGTCCGTAGG
CGAGGATCCGCAGCGTCGCATTTCCTGTATTTGTCAGGGAGCCGTTGGCGTACTGAAAGT
GGTAGTTCGCCTGACGAGGGGCGACGACCAGAATGGTGCCGATGCGGGCGGAAGCAGTGG
CCACAGCGCTGCGGTTGGCATTATCGCGCTGCGCATCACTGAGGGCCTGATCAAACCAGA
CAATGCGGTAGTAGCGCTCTTTTTCATCTGCGGGTCCCTTATAGAAGAAGCGGATCACTT
CGCTGGCTTGGGCGGGTAGCAGCAAGCTGGCGGGAGTGAGTAGCAACTCATCCGGCTTGT
CCATTGAGATAACCTGCCCGTCGTCAAGCGGTGAAGAGAGCCGTTCGAGACGGATATTGA
TAAGGCGACCACTGTCGGTACTGTTTTTGATCGTTTTGCTCAGCGTGCTGCTGTCACTGT
TCATAAACGATGATATATCGCCGACATCCAGCGCCTGGGCCGGAGATATTCCGGAAAACA
GCAGAGCGAGAGGCAGAAGGTGCTTTTTCATAACAATTCCGTCCAGGAATAAAGCAGGGG
GGCTACCCCTGCTGGTACATCAGAGAGATTAACTGGTCCAGGTCGCGTCGAACTGTACGC
TAACGTCGCCGCTCCAGATGCCTTCCGGTAGAGTGCTGTAATCTGTTACTGCGGTGGTAC
CATTGGTGGTACCGCTGATGATGGAGAAGGTGAAACCATCCTGTGCGGTGGTACGATTGC
TGGCATTGTAACCGTTAGCCAGCGGGCTAAGGTTGCCGCCCAGTACGCCGTTGGCGGTAT
CGATCATCACGGTATCGCCAGTTTTTTCGACTGCCGCGCCGTTATAATCCACGCCCACAT
TCAGTGTGGAACCTGAGGTATCCAACTGGGTTAATGTGTTGGTGATAAGACGTGAGGTCA
GTTTAAAGGCGGTAGCCGTTGAGTCACCCTCGATAGCCACGTCAAATAGACCTTTCTGTG
AGTTAAAACCTTTAATGCCTTCGGCATACTGGAACGCCAGGCTACCGAGTGGCGTCACAA
CCAGCTTACTGGTGGTGTCTTTTTTGGCTGTTGCCGACCAGGTCGCTACAGCCTGAGCTG
TTACGTCAGCAGCCTGCGCCACACCCATGCCGGTAAACACCGTTACCAGAGCTATTGCCA
GAACCTTTTTTTTCATTGCATTTCTTCCCGAGTTGAATTGAGGACGTGATGTCCCAGTGA
GTCATTTTTTAAAACTAACTTGCCTGGAGTTTACTGAACCAACTTATATATTTTTGAGTA
CAGCTTGGCCTCAGCATTACGCCGATGGGTATACACTGTCTTCACACTACAATTTTCAAT
TCTGGCAATCGATTTAGGTTGCATTCCCTGGGCCGTCATGCGGATAATTTCCATTTCCCG
GTCCGTGATTTTATCTTTCTTAATATCTTTTCTCAGGAACCTGCCATTAATCACATAGAC
CAGTTCTTTTCTAATATCACGACTCAGTCCAGCGTATACCACGCCCCTAATATTGCTATT
GTAATACCAATAATTTGCTAAGGCCTCTGACTTTCTGGCCGCAATCAATACGACCTGTTT
CCCCTTTACCGCGGATAACCATTCATTATCACGGTTTATAAATTCAGATAAAGAATCCGT
ACTGAGATTGATAAACACGAAATCTTTTCTAATTTTCTCCAACGATAGATAAATTAATCT
GTCGATATCCACAATCAGTTCAGATAGTCCTTTATAGAAGTAGGCGTCATGGGGAGACCA
GATGTATTTATCAGAACGGTTTTGACATTCCATATGGTTTTTAACCTCATAGTCCCTACT
GTAATCACTTTGCCATGTCACTACTTTCCAAACCTGTAATTTTTACAGGTGCATTCAGTT
TCCTTAGTAAACCGGAAGTAAATAAGATACGTAGTACATATCAATAAAGGTTAAACGAGA
TTAAGTTTAATTATTTTCGATTGGGCTTAAATTTATGTTTTTTTTCCCGATGAGTGTCAA
TATGTGAACGGAAAAGGAATTCAATGGTTAAGTCAATATTTAGAAAAACTGAAAATATTG
CTTTTTTGATAAGAAGAAAAAGACATTTGGTTTCATAAGGTTATTGGCAATATAACGTTC
AATTCTTACTTGCATTTTATATTGGTCAGGAACTTTGCCCTGAAGTGTTAGGAATAGTCT
TAATGCGCTGTGTGATGGACTAGTAAAAAAACAAGTTTTAAGGGTAAGGGATAGAATATA
AAACTATGATGAGCTGTCATTGAAGATGATTTGCCAATCAGTAAGATATTTTAATGGATT
AACATGCCGCACAAAATGGTTACAGGTGTTCATTCCAATAAGTAATGGAAAATTGAACGG
GCGTATGTACGTCATCTGTTCGGTAAGCCCCCAAGAGCCAGATTAAGTGAAGTTAAACGA
AGGCTGCCAGCTGTCACAGGAACGATGGCCTTTTTGTCAGGGCACTGCATTCAGTTATCT
GTGCGCGTTACTCTAACTGGCACTCGAACGTCGGCGACGGGGTTACCGGTGGATCAGACT
GTTCCTGTGGCGTAAACGTTTTTATGTTAGTACCAACAGATTTACCACATTTATCATCTT
AACAGTTTGAGTGAAAATGCAGGCTGCGCCGCAAAGGGAGGAGACTGAGTGGCGTGTTCA
GTCTAAAAGAGGGTTGATGCCAGCATACAGGGGCGAAGCTGGTCAACAAGTCAACATTAA
GATAATGGAATATTCGGAGAGAAACGTCAGGCAGTTGGCCTCAAATGAACAGGAAGAATA
TATCCCCAGGAAAATTAATGTTGGTGTTATAAACACACCAACATTAATCCGATCTGATTA
TTAATCAGACAAATATCGTTAATCCGTCGAATTTTGAATCAACGTTTTTTCTTACGACCC
TGAACGGCCTTAAAACGTGGATTAGATTTACAAATCACATATAGCCGTCCTTTTCGCTTC
ACAATCTGACAGTCTGGATGGCGTTCTTTTGCGGTACGCAGAGAGTTAAGAACTTTCATC
ACGCCCCCTTTTTCGTGCTAACAAAACGACCAAAACGTTGGGTGAATCGTGCAACATTTC
CTTCTGATGCCACTGTTCTCAGCTTCCCTGTATAGAACGGGTGCGATTTAGAAGAGACAT
CAATTGTCACGTATGGATACGTTACGCCATCCAGCTCAATCTCACGGTCTGTTTTGATAG
TCGAGCCGATTTTAAAGTACTCATCAACACTGGTGTCGTGGAACACCACAGTACGATACT
CAGGATGGATATTGGGCTTCATCATTTTTACCTGTTATGTTATAACATAACCATAAAGAT
ACATGCTCATCCGGATCATTTCAACACTCAATCCCTGTGACTCTTTGTGGATGTGGAATT
TTCGCAACGGGGAACTCTGGCATTGTTAGCAGCCATTGGTGACGCTCCCATAAACGCCTG
GATGAGTGATTGATGATGGTTTTGCTGAGAGTATGGATTTTTCGAGAATGGAGGTTATCT
CCACTTTACTGGCCGATAATTTATCGCAGTATGATTGATTACCTGACAGCGTGTATTCCT
CTCCCACGGATATAATAATTACTTACAAAAAAGGGAGAGGATGCATATTTTAAATATCAC
TGAAGTGAACAGTTTATTTCCGTTATTAATAGAAATGGAGAAATAAATAGGCGTATTCTA
CAATTGCGACAAAAACAACGATATTAATCAGTTTATGACTGATTTGCTGTACTTTATTCT
CTTTCATTGGTACTTCCTCGCTTTAAAAAAGAGTGCACTTCGTAAGTGCCCTTATATAAA
TAACGAGTTTGGTCAACCAATTTTTTGACATGTATCACAAATTTGAATAGATGTATTACA
TCAACTATCTTTTATTGCACCAACGTCATTGATATATGTCGCCTGAAGTCAGTTCCGGGA
ATGAGTCTGATCTCAAGACTGGCCCAGTCCGGGCGTTGATTGGTGCTGAGGAGCATATCG
CATCTCATCATAATGTCGTATCTCCTGGGGTGTTATACAAGATATCGTTGTTGGTGACCT
GGGAGAGGAATTGAGTTCTATTAAACCGTCAACTATGCCGGATACATACTGGATTACACT
GCAGGCACGCCTTATGAGAGAACGTGCCGCAGTGACGGGTTAATTATCTGAAAGAATTTG
TGAGGCTGTATCGGTTACTCATTGATTTGATAGTTTTACTCTCGGGAGAATAATAGATAT
TTAATCCATTAACGGAAACCAGCCAGTTCCTTTCGATGCCTGAATTTGATCCCATAGTTT
ATCCGGAATGGTTAATTCATGAACAAGTTGTGTTATCGTTCATGAGAAGCATAACGTAAA
GGGAAAAGCTCGATTAGACGGCAGAATTTGTCAGGGGTTATGAACGAAATTCATAAATCT
GTTTGAGTGTTGCGATGGGTAGTGCAAGTTCGATATCTCCGCAATTTACAGTCCGATGAA
GGAAAATGAATATCCATAAAAAATATATTGGTTTATCCTGGCATATATACCTATTTCGAC
GTATTTCCAATAGTTTTAATTAAAGGCAGGTCATTGTTATTCACTCTGAATAGTGAATTA
TTCACTGTCCGCAGAGTAAGAAATATAACTTAGGTATCTATTTAATGACTTGCACAAAAA
GCTAAATTTTCCCCCATAAATAAAAATATAATCCCGCGCCCAACCACCTGATGAGTGGCT
ATAGGCACTGGATATATTAGGTGGCGGTGCACTTTCTTACATAAAGGTATTTCCTTTTCT
GCGGAAAAGGAAATCGGGAAATCCCCGGTTTTTCTGACAAGCAGACGCCATTATTTGTGT
CTGCCTATGTTCGTTAATTCGTTCATCAGGAAATTATCTCAATGTCACATTATAAAACAG
GTCATAAACAACCACGATTTCGTTATTCAGTTCTGGCCCGCTGCGTGGCGTGGGCAAATA
TCTCTGTTCAGGTTCTTTTTCCACTCGCTGTCACCTTTACCCCAGTAATGGCGGCACGTG
CGCAGCATGCGGTTCAGCCACGGTTGAGCATGGGAAATACTACGGTAACTGCTGATAATA
ACGTGGAGAAAAATGTCGCGTCGTTTGCCGCAAATGCCGGGACATTTTTAAGCAGTCAGC
CAGATAGCGATGCGACACGTAACTTTATTACCGGAATGGCCACAGCTAAAGCTAACCAGG
AAATACAGGAGTGGCTCGGGAAATATGGTACTGCGCGCGTCAAACTGAATGTCGATAAAG
ATTTCTCGCTGAAGGATTCTTCGCTGGAAATGCTTTATCCGATTTATGATACGCCGACAA
ATATGTTGTTCACTCAGGGGGCAATACATCGTACAGACGATCGTACTCAGTCAAATATTG
GTTTTGGCTGGCGTCATTTTTCAGGAAATGACTGGATGGCGGGGGTGAATACTTTTATCG
ATCATGATTTATCCCGTAGTCATACCCGCATTGGTGTTGGTGCGGAATACTGGCGCGATT
ATCTGAAACTGAGCGCCAATGGTTATATTCGGGCTTCTGGCTGGAAAAAATCGCCGGATA
TTGAGGATTATCAGGAACGCCCGGCGAATGGCTGGGATATTCGTGCTGAGGGCTATTTAC
CCGCCTGGCCGCAGCTTGGCGCAAGCCTGATGTATGAACAGTATTATGGCGATGAAGTCG
GGCTGTTTGGTAAAGATAAGCGCCAGAAAGACCCGCATGCTATTTCTGCCGAGGTGACCT
ATACGCCAGTGCCTCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAG
TCAGAGGTGACTCACATGACAAAAACAGTATCAACCAGTAAAAAACCCCGTAAACAGCAT
TCGCCTGAATTTCGCAGTGAAGCCCTGAAGCTTGCTGAACGCATCGGTGTTACTGCCGCA
GCCCGTGAACTCAGCCTGTATGAATCACAACTCTACAACTGGCGCAGTAAACAGCAAAAT
CAGCAGACGTCTTCTGAACGTGAACTGGAGATGTCTACCGAGATTGCACGTCTCAAACGC
CAGCTGGCAGAACGGGATGAAGAGCTGGCTATCCTCCAAAAGGCCGCGACATACTTCGCG
AAGCGCCTGAAATGAAGTATGTCTTTATTGAAAAACATCAGGCTGAGTTCAGCATCAAAG
CAATGTGCCGCGTGCTCCGGGTGGCCCGCAGCGGCTGGTATACGTGGTGTCAGCGGCGGA
CAAGGATAAGCACGCGTCAGCAGTTCCGCCAACACTGCGACAGCGTTGTCCTCGCGGCTT
TTACCCGGTCAAAACAGCGTTACGGTGCCCCACGCCTGACGGATGAACTGCGTGCTCAGG
GTTACCCCTTTAACGTAAAAACCGTGGCGGCAAGCCTGCGCCGTCAGGGACTGAGGGCAA
AGGCCTCCCGGAAGTTCAGCCCGGTCAGCTACCGCGCACACGGCCTGCCTGTGTCAGAAA
ATCTGTTGGAGCAGGATTTTTACGCCAGTGGCCCGAACCAGAAGTGGGCAGGAGACATCA
CGTACTTACGTACAGATGAAGGCTGGCTGTATCTGGCAGTGGTCATTGACCTGTGGTCAC
GTGCCGTTATTGGCTGGTCAATGTCGCCACGCATGACGGCGCAACTGGCCTGCGATGCCC
TGCAGATGGCGCTGTGGCGGCGTAAGAGGCCCCGGAACGTTATCGTTCACACGGACCGTG
GAGGCCAGTACTGTTCAGCAGATTATCAGGCGCAACTGAAGCGGCATAATCTGCGTGGAA
GTATGAGCGCAAAAGGTTGCTGCTACGATAATGCCTGCGTGGAAAGCTTCTTTCATTCGC
TGAAAGTGGAATGTATCCATGGAGAACACTTTATCAGCCGGGAAATAATGCGGGCAACGG
TGTTTAATTATATCGAATGTGATTACAATCGGTGGCGGCGGCACAGTTGGTGTGGCGGCC
TCAGTCCGGAACAATTTGAAAACAAGAACCTCGCTTAGGCCTGTGTCCATATTACGTGGG
TAGGATCATAAAGTCCTCGGGTCGTTGTCCACTCTTTTGGCATGTCAGCATATTCACATA
CCGTACCAGCAAAAGTTTCAACCGTGAGCAAATCGACCGATTTTGTTGACGGTTCAAACG
TGGAAACGAAATAGATATCCGTCTTAAAATTCTTCATACATCTGGCTAAATGATGACGTC
GTAGTTTGACTTCTTCATCCGGTGATTTATTCGACACTTCAATGTCATATTTAAATGAGT
TGCCAAAAATAGGTGTCTCAGGAAAGTTGATTAATCTACACTCCGTCTTTTGCTGTTGAC
GTATTAAAAAAGAAGGGAAGATATTTGCGAGATCCCAATAATCACGGTGGCGGTATTCAC
GGGGAGAGCAGCCGAATAACTTTTTAAATTCGCGGCTGAATGACTGCTGTGAATCAAAAT
GCAAAGAGAGTGCAATATCAAGCATAGATTTCGCGGTGAGCCGGACAAGAATGGCGGCAC
GACAAAGCCTTCGTTTGCGAATGTATTCTCCCAAAGGCACATGCATGAAATTTCGGAACA
GAAGCTGGATGTTGCGTCTGCTGTAGCCAGATTTCTGTGCGATATCTTCGATTGAAATAG
GGTGCTCAAGATTGCACTCAATCCACTCCAGGAGCTGCTGTAGAATCTTCTGCCTGATCA
TCTCATTCTCCGTTAATTCTTTGTCATATCGCACATTTTCGTTATACCCTGGGCCCTAAG
TGTATCAAAAATAGCAAGGGCGAAGGCAAAAGCACTGGTAGCGTCTGCTTCGTTGTCCCC
GAAAATAGAGAGGTTTCAGTCCTACATTATTAATGAATTTTTTGCATAAGTGATATCAAA
ATCCACATACTACTTTGAGGTTACGTTTTAACGTAGACTCATTGTTCATGCCTAATGGAG
GGACTGACAGTGGAATTTTCCGTATAGTCTGCTTCAGAGTATTGCAGATGCCCATCAAAA
ATCGATTTCTCACTGACAGATAAAGAAATGGCACAAATTAGTTCGCTTGATTTGGGTTAT
GTTGGGGAGTCGGTAAAACATTTTAATCCTGAATTTGTTCGTGGTTGTCTTGCTGTAAAA
ATACATGATTGATATTAATCATGTATTTTACCTAAGACGACAAAAACCTTTTAACAGGGA
GTGATATTGATCTTCACTCTGTCATATCTCCGGTAATATGGCGTCAGGCTTCATCATCAG
AAAGGGGGCCTGACGCCTGAAAAAGTGAACAACAGACAGTGTTCGGATTATCAATATTCA
GTTTTTAACGTTGAACTGGATTCATTACTGCGTTGTTTAAGAATTTCCCGCGCCGAATCT
GCCATTATCATGACTGCACCTGCCAGCATCAGAGTATCTTTCAATACCAGGCGACCAGCA
CCGGATAAATAAGGGAAACCATGATGAGCGTCACCCAATGCGGGTACCCATGCCTCCGGG
GTGGTGATTAAAAATGAGAGTGTTACCAGCGGCGTGGTAAATGCCATCAGTCCTCCCAAT
AAACCTAACCAGCGATTGACAGGATTAGCCAAAACCAGCAGAGCAATAATCACCTCCACG
ACGCCAAGACCGTTGGAAAAACCATAGGTATTATTGGCCGTTTGCCATGCCCTTGCTTCT
GGTTTGTATTCGCCTTCGTGAGTCAGATACTGTTTATAGTCTTCCGGGTGTTCATAAAAG
AACGACATTAGTGGACTGTTTGCGACGAATGGTGTAATGCTGTCTGCCTCGTAAGGGACA
AACTTTAATAACCCAATCCACATAAAAACAATTGCAATACTCAGACGAATCAATGTCAGG
CCAATTTTATCTCCCCGACTTAACAGGTGCAGGTATTTTTCCATTGTGAACATCCTTATT
TATACAATACTGCTGTTGCGGTTGAATTATTATCAATTCGCATCGATGTGACTTTCCAGG
ATGAAGCATTATATTTTCTGGCTATATCAGCAATGGTATCCTCCAGAACTGTCGGTGATG
CTGATACTGACGAGACGCTGATATGTTTCAGAATTATTTTATCATCTGCATTGGTGGAAA
ATGCCATAACGCCAGATAATAGTGTTGCAAATAAAACAGATTTTTTAAACATATAAAATA
CCATCAATGAAGTGATTAAGAAGTTATAGAGTAACAGAGAATTAATAAGATTCTTTTCTC
TGAGACGCCAGAATATTTGTTCTGGCGTCTGATTTTGAGTTTATTTGACTAATGAAAATA
GATCATTGAGTGATTCGCTCATCGACGGATGAGTAAATATCTGATCGCGTAATATGCTAT
AAGGCAGCCCGGCATCCATCACCATTTTCACTATATTGATCATCTCGTGGGAGTCAACAC
ACAGCAGTGATGCCCCTAACATACGTTGGGTTTTATTATCAACAATCGCTTTTAATACCC
CACGAGTATCATTCATCACTCTGGCACGCGGAATTGCAGCTACAGGCAATGTCACCACCT
GAATATCAGCACCACTCTCTCTGGCTTGTTCTTCTGTCATACCAACCCTGGACAGGGGCG
GTGTCATAAATACGGAATAAGGCACATTTTTCCGATCATCAGTACTACGTTTGCCTTCAC
CCAGTAACTCATCACGTACAATGCGGTAATCATCCAGTGATATGTAAGTAAATTGCAGCC
CGCCGGTAACATCTCCCATCGCCCAAATATTGTCTGCGGTGGTATGTAATCGCTTGTCAA
CGACAATTGCCCCGCGCTCGTTTACTGCGATACCGGCATTTTCTGGATGTAACGAAGCGG
TAGCCGGTTGACGACCGGAAGCTATTAACAGTGCATCCACCGCCAGTTGGGCGTGCTCGC
TATGCACTTGCACTTGATTTTCATGGTGACTGATTCGCTCCACATGGGCATTGAGGATAA
TATCGACGCCCTGATCGCGTAAAATCGTCGCGATATTATCAGCAATATCCCGATCTTCCC
GAGGCAAAAACAGCGAAGCTGCTTCTAAAATGGTTACCTTGCTGCCAAAATTAGCGAACA
TAGAGGCGAACTCAACGCCAATATATCCGCCGCCCAAAATACCTAAATGCCCAGGCAATT
CTTTTAGATTAAGTAATCCGGTGCTGTCATATACTCCTGGCGTGGTGGTAATTCCAGGAA
TTGGCGGAACCACGGTTTGTGCACCGGTATTAATAAAAATTTTCTCGCCATGAATTTCCA
GATTTCCCTCAGGCCGATGAACACGCAGGCTATGATTATTGATAAACTCCGCCTGGCCGT
CGATCACGTCGATATTGGGCATATCCGCAAGATTATGAAAATTCTTATTACGTAAAAAAT
TAACCACTTCATTTTTACGCTGTATGGCACGGACAAAATCTGTGTGCTGCTGTGCGTCAT
GAACCAATGTTTTGGTTGGGATGCAGCCGATATTAATACAGGTCCCGCCATACATTGCAT
TTGATTGTTCGATGAGAGCCACTCGCCAACCTGCTTTTGCCAGCGTGACGGCTAATGTTT
TTCCAGCCTTGCCAAAACCAATAATCACTGCCTGATATTTATTCATGATGATTTCCTGTC
GAAACGCGTTCATTTGACATCATGACTATAGACGCAAAAGAGCAAATAACATTTCTTCAC
AACGCTTGATATTTTGTCTTATCGTCTGATATTTTCTTTTTCTTAATCAGAATCACAAAA
CAAAAATCATGATTAACTATTTGATGGTATTAGATTAGTTATTTACTAAGATTGTTGGTG
TTTGTAATCAAAAACCACTCAGGAGTCTGATATGGATGCCCTTAGCCGTTTGTTGATGCT
TAACGCTCCACAAGGAACGATCGATAAGAATTGCGTGTTAGGAAGTGACTGGCAGCTTCC
ACATGGTGCCGGGGAATTATCGGTTATTCGTTGGCATGCGTTAACGCAAGGAGCGGCGAA
GCTGGAAATGCCGACGGGGGAGATTTTTACATTACGCCCGGGAAATGTGGTCCTGCTACC
ACAAAATTCAGCTCATCGCCTGAGTCATGTCGATAATGAATCGACCTGTATTGTCTGCGG
CACTCTTCGGTTGCAACATTCGGCGCGTTATTTTTTAACGTCTTTGCCGGAAACGCTGTT
TTTAGCACCGGTTAACCACAGCGTGGAATATAACTGGCTGAGGGAGGCGATCCCGTTTTT
ACAACAGGAATCCAGATCGGCAATGCCGGGAGTGGATGCACTGTGTAGCCAGATCTGCGC
TACATTCTTTACCCTCGCGGTGCGTGAGTGGATTGCACAGGTTAATACTGAGAAAAACAT
TCTCAGTTTGCTTCTGCATCCACGTCTTGGTGCGGTAATACAGCAAATGCTGGAAATGCC
AGGACACGCCTGGACCGTCGAATCGCTGGCCAGCATCGCTCACATGTCCCGGGCAAGTTT
TGCCCAGCTTTTCCGTGATGTTTCCGGAACCACGCCGCTGGCTGTATTAACAAAGTTGCG
TCTACAAATAGCGGCCCAGATGTTTTCCCGGGAAACGCTCCCTGTTGTGGTGATCGCTGA
GTCAGTAGGCTATGCCAGTGAATCATCTTTTCACAAGGCGTTTGTCCGCGAGTTTGGTTG
TACCCCGGGAGAATATCGGGAAAGGGTCAGACAGCTTGCACCCTGAATAAAACCGCCAGA
AATCAGGGCAAAGATAATCCGCATTCCGGGAGTTGTGAGCCTTTCAACTATTTCTATTTC
CAACGGTGGTTTGGGCTTTATATATTTTTTCTGATGGACTCTAGCTCAGTTTTTAAATAA
AAATGCAAACTAAATTGCTTCAATTAAATAAAATCCCGACTATTACTTGATACGTGATTA
TTGTCGGTGATTTTTTTGTACACCATCAGTGTATATCTCAATAACCCCTGAATAAGTAGC
TCTGAATAGGTATAAGGGATGTAGCCATTTTTAAATGGATTTCTTATGCCAAAAATGATC
GTCGATTTCCCCATAAAATGTGAGCGATGCCGAAAGAAATAAAATTAGTTATTGCATTTG
ACGTTTGGATGAAAGATTATCATTTGTCATACAAATGAGGGGTGGTATGTTGCTAGCCAA
TTAAAAAAGAACGCCATATTTATTGATGATTGATCCCCCGGTGGGGGGGAAACATCGGGC
ATAAATGGGCATGAAGTAATGGAGTATTAGTTGTGAATGTCAATTTCTTTGTCACCTGTA
TTGGTGACGCCCTGAAATCAAGAATGGCACGAGACTCCGTGCTGCTACTGGAAAAACTCG
GCTGTCGCGTAAATTTCCCGGAGAAACAGGGATGCTGCGGTCAGCCTGCGATCAATAGCG
GTTATATCAAAGAAGCGATTCCAGGGATGAAAAATCTGATCGCCGCACTGGAGGATAACG
ACGATCCCATTATTTCACCGGCTGGCTCTTGCACCTATGCCGTAAAAAGTTACCCGACGT
ATCTGGCGGATGAACCTGAATGGGCATCACGTGCCGCAAAGGTTGCCGCGCGTATGCAGG
ATCTCACCTCTTTTATTGTTAATAAATTAGGGGTAGTCGATGTAGGTGCCAGTTTGCAAG
GGAGAGCGGTGTATCACCCATCTTGTAGCCTGGCCCGTAAGCTGGGAGTGAAGGACGAGC
CACTTACGCTGCTGAAAAATGTGCGTGGACTGGAGCTGTTGACCTTTGCTGAACAGGATA
CCTGCTGCGGATTTGGCGGCACGTTCTCGGTCAAAATGGCCGAAATATCCGGCGAGATGG
TGAAAGAAAAGGTTGCGCACCTGATGGAAGTCCGCCCTGAGTATTTAATTGGTGCTGACG
TGAGTTGCCTGCTAAACATCAGTGGGCGATTACAACGGGAAGGGCAGAAAGTCAAAGTGA
TGCATATTGCTGAAGTGTTGATGAGCCGCTGAGGATATAAAGATGTCGATCAAAACCAGT
AATACAGATTTTAAGACACGCATCCGTCAGCAAATTGAAGATCCGATCATGCGCAAAGCG
GTGGCAAACGCGCAGCAGCGTATTGGGGCAAATCGGCAAAAAATGGTCGATGAATTGGGG
CACTGGGAGGAGTGGCGCGATCGGGCCGCCCAGATACGTGATCATGTTCTGAGTAATCTC
GACGCTTATCTGTACCAGCTCTCAGAAAAAGTGACGCAAAACGGCGGTCACGTCTATTTT
GCAAGAACCAAAGAAGACGCTACCCGCTACATTTTACAGGTTGCCCAACGCAAAAATGCC
CGGAAGGTGGTGAAATCTAAATCGATGGTGACCGAAGAGATTGGTGTCAATCATGTGTTG
CAGGATGCTGGCATTCAGGTGATTGAAACCGATCTGGGTGAATATATTCTCCAGCTGGAT
CAAGATCCGCCATCTCATGTTGTGGTCCCGGCAATTCATAAAGATCGCCATCAGATCCGT
CGAGTGCTACACGAACGTCTGGGCTATGAGGGGCCGGAAACGCCTGAAGCGATGACCTTA
TTCATCCGGCAAAAAATCCGCGAAGATTTCCTCAGTGCTGAAATAGGTATTACCGGCTGT
AATTTCGCGGTGGCAGAGACCGGTTCGGTATGCCTGGTGACCAATGAAGGTAATGCGCGA
ATGTGTACCACGCTGCCTAAAACGCATATTGCAGTGATGGGAATGGAGCGTATTGCCCCC
ACGTTTGCCGAGGTAGATGTATTGATCACCATGCTGGCGCGCAGTGCCGTTGGTGCACGT
TTGACGGGATACAACACCTGGCTGACAGGACCGCGCGAAGCTGGGCACGTTGATGGTCCT
GAAGAGTTTCATCTGGTTATTGTCGATAACGGGCGTTCTGAGGTGCTGGCCTCTGAATTT
CGGGATGTGCTGCGCTGTATTCGCTGCGGGGCTTGTATGAATACTTGTCCGGCATATCGC
CATATTGGCGGTCATGGATATGGCTCTATTTATCCAGGGCCAATTGGTGCGGTGATTTCT
CCGCTACTTGGCGGCTATAAAGATTTTAAAGATTTACCCTACGCCTGCTCTTTATGCACA
GCTTGTGACAACGTGTGTCCGGTGCGTATTCCGCTGTCAAAACTGATTTTGCGTCATCGT
CGGGTGATGGCTGAAAAAGGGATCACCGCAAAAGCAGAGCAACGGGCGATAAAAATGTTC
GCTTATGCCAATAGTCATCCAGGATTGTGGAAAGTCGGGATGATGGCCGGTGCTCATGCG
GCAAGCTGGTTTATCAATGGCGGCAAAACACCACTCAAATTTGGCGCGATTAGCGACTGG
ATGGAAGCACGCGATCTTCCTGAAGCTGACGGAGAGAGTTTCCGTAGTTGGTTTAAGAAA
CATCAGGCGCAGGAGAAAAAGAATGGATAATCGAGGCGAATTTTTGAATAACGTTGCTCA
GGCACTGGGTCGCCCGCTGCGACTTGAACCGCAAGCAGAAGATGCGCCGCTTAACAACTA
TGCTAACGAGCGGCTTACCCAACTTAACCAACAGCAGCGCTGTGACGCGTTTATTCAGTT
TGCCAGCGATGTTATGTTGACGCGCTGTGAGCTGACCAGCGAGGCGAAGGCGGCAGAAGC
TGCAATACGTCTGTGTAAAGAGCTGGGAGATCAGTCGGTCGTGATTAGCGGTGACACGAG
GCTGGAGGAATTGGGGATTAGCGAACGTTTGCAGCAGGAATGCAATGCCGTTGTTTGGGA
TCCGGCGAAAGGTGCCGAGAATATCTCGCAGGCAGAGCAGGCTAAAGTGGGTGTTGTGTA
TGCTGAATATGGTTTAACCGAATCGGGAGGCGTGGTTCTTTTTTCCGCCGCCGAGCGCGG
GCGTTCATTGAGCCTGCTCCCGGAATATTCTCTTTTTATCCTGCGTAAAAGCACTATCCT
GCCGCGTGTAGCGCAACTCGCAGAAAAATTGCATCAGAAAGCGCAGGCCGGTGAACGAAT
GCCTTCCTGCATTAACATCATTAGCGGCCCCAGTTCAACGGCGGATATTGAGCTTATCAA
AGTCGTCGGAGTTCATGGCCCGGTGAAAGCGGTGTATCTGATTATTGAGGATTGTTGAGA
GAGATATGAAGTCTGGACATAAACCTGAAGAAGGCATACGAGGTTGAAAATAGCGTTTAG
GACAACCTGACTTAACCCCGTTCCGTCATGGTTATGCTGCTCTTCTGTAAATATCCTGGT
ATTACCAATGCCAGGATATTTACAGTGAAAAAGACAGGCATCCATTCCTGAAAACGGGTT
CCCTTCCCGGTCATTGTCACTTCAGCTTTATACAGGCACTCTCTATCAGAATGTTGTTTA
TTACTGCCCAGAGTTTTGTTGGTATTCATCTACCATTTTTTTGACAAGGCAAAACATTAC
AGAAATTACAATGCTTAGAAAAAATCCCAGAGCCAGGCAAATGGCAGCAGGGTATTTATT
TTTTATTTCTGGTGAGCTTATAGTTACACAGCCATCACCGTTCGGATACAATGACCAGTT
CCTGGTCAGGTATATCATTTTTGTATAAAGCTCACTGTTAATTGCTGAAGGCGTTTGTAT
CTCATCGAGAACTTGCCTGCCATTATGATATTCTGACGCATACCATTTGATAATAGAGGC
CTGCACGCGAGATATTTCCTCTTCAGCAGTTGGTAAAGCTCTCTTATCTCCTGACCATTC
CAGCCTTATTTCTCTGTTCTTGACATCTGGGCTGGTGTGAAAAAATGTAGTAATTCGCTG
AATAACATCTTCAGTCATTGTAGTCTGACAGGCAAAATTATTATTGCTATCACAGCTAAC
AAGTATACCTGGCGTTGTCTGGTTTATTTTTAGGCTGTAAATCACTTTTATATTGTCTTT
ATTGATATACAGAAACAACAGCACCATAGCCATACATATAGCCATAATAAAAAGGATAAC
ACGAATCTTTTTCTTCAGATAAAATAAAATCTCAATCAGATCGATATCCTGTTTGATTTG
TTCACGCATAATATATCCAGAGAATAAAATCTGTCGCAGATAAGGTTGTATTAATAGTCT
GTATCAGGAATGTTCGGGTTAAATATCAGCAAAAAGCCCGCATCATGAATACTGGATATG
AAGCATGAGAGTTACCTCAGTGTTTATATAAGGATTCGGTCCCCCTCTCTGGAACGGTAA
CTCTCAATCTGATCGGTTCCTGCGTTAGTTCACATCACGACTCATTTTTTCGCTCTCACC
GGCATCCCATTTGCCACAAAATATCCCGCCGTGCTCCTCGGCAGCGCTTCCTGTCCACGA
ATCATATCCGCTATTTTCTCGCCAATCATAATTGTCGTGGCGTTCAAATTCCCGGTGATA
ATCTGCGGCATAATCGACGCATCCACCACACGCAGGCCTTCTAACCCGTGTACGCGGCCT
TCGCCGTCAACCACGGACATCTCGTCGTAACCCATTTTGCAGGTACCGCACGGATGGAAG
GCGGTTTCGGCGTGGTTACGCACGAACTCATCGAGCTGTTCATCCGTCTGGCATTCGACA
CCGGGGCTGATTTCGCGGCCACGATACTGATCCAGCGCGGGTTGATGCATGATCTCGCGG
GTGATGCGAATTGCGTCGCGGAACTCCTGCCAGTCCTGCTCGTGCGACATGTAGTTAAAC
AGAATCGCCGGATGCTGGTGCGGGTCGCGGGATTTAATCCGCACATGCCCACGGCTTGGC
GAGCGCATTGAGCCGACGTGGCACTGGAAACCGTGCTCTTTCACTGCATTCGAGCCGTTA
TAGTTAATCGCTACTGGCAGGAAATGGTACTGAATATTCGGCCACGCAAATTCCTCACGG
CTGCGAATAAATCCACCTGCTTCAAAGTGGTTGCTGGCACCAACGCCAGTGCCGCCAAAC
AGCCACTCCGCACCGATTTTCGGCTGGTTCCACCACTGCAGGGCAGGGTAGAGGGAAACC
GGTTCTTTGCACTCATATTGCAGATACATCTCCAGATGATCCTGAAGATTTTCGCCGACG
CCGGGTAATTCATGCACCAGCGGAATATCAAACTCCGCCAGCAGTTCAGCGTTGCCGACG
CCGGAGCGTTGCAGGATCTGCGGTGAGGCAATCGCGCCTGCACATAACAGCACTTCTTTG
TTGGCCGTTGCGCGGGTTGGGATGGTGCTGTCGCCTTCCAGCCATTCGACGCCCACCGCG
CGTTTGCCGTCAAAAATGATGTGATCGGTCATAGCGTGAGTACGAATGGTCAGGTTAGGA
CGCGATTTGGCCTGATCGAGATAGCCACGCGCGGTGCTGGCGCGACGGCCCTGCGGCGTG
ACGGTGCGATCCATCGGACCAAAACCTTCCTGCTGATAACCGTTGAGATCGTCCGTGCGC
GGGTAGCCCGCCTGCACGCCCGCTTCAATCATCGCTTCAAACAGCGGATTGACGCCGGGT
TTGGAGGTAGTGACGCTCACCGGGCCATCACCGCCGTGATAGTCGTTTTCACCCATATCG
CGAGTCTCGGCCTTGCGGTAGTAGGGCAGGCAGTCGAGGTAGCTCCAGTTCTCCAGACCG
GGTTCTTGCGCCCAGTTATCGAGATCCAGCGCATTGCCACGGATGTAGCACATGCCGTTG
ATCAGCGACGATCCACCCAGACCTTTACCGCGTCCGCACTCCATGCGGCGGTTATTCATA
AACGGTTCAGGTTCCGTTTCATAGGCCCAGTTGTAGCGTTTACCCTGTAGCGGGAATGCC
AGGGCAGCGGGCATCTGGGTGCGGAAGTCAAAGCGATAGTCCGGGCCGCCCGCTTCAAGC
AGCAGCACGGAGGTATTCGGATCTTCAGTCAGACGGGTAGCGAGAACGTTGCCGGCTGAG
CCGGCACCAATAATGATGTAGTCAAATTGCAAATAAACCTCCTGGTTAGAATATGGACTG
GAATTTAGCCATCTCAACCTGGATGGACTTCACCTGGGTGTAACTCTGGAGCGTCATCAC
GCCGTTCTCGCGACCAATGCCGGAGTGTTTGTAGCCGCCAACGGGCATCTCTGCCGGGGA
TTCGCCCCAGGTGTTGATCCAGCAAATACCCGCTTCCAGCTGATGAATGACGCGATGCGC
GCGGTTCAGGTCCGCTGTCACGATGCCCGCCGCCAGGCCGTAGTCGGTATCGTTAGCGCG
GCGAATGACTTCGTCTTCCGACTCGTAGGTCAGAATGGACATCACTGGCCCGAAGATCTC
TTCACGCACGATGGTCATATCGTCGCTGCAATCGGTGAACACTGTCGGTGCAACCCATGC
GCCGTTATCGAAGCCATCGCCTTTCAGTACATCGCCGCCGCACAGTACGCGCGCGCCTTC
CTCTTTGCCTTTGGCGATATAGCGCAGCACGTTATCGCGATGCGGGAAGCTGACCAGCGG
GCCGAAGTTAGTTTGCGGATCGAAAACGTCGCCCGCGCGAATGCGCTCAACGCGCGCCAG
AATTTTCTGCTCAAATGCGGCTTTGCATTTCGCCGGAACGAAGACGCGGGTGCCATTGGT
ACACACCTGACCGGAGCTGAAGAAGTTTGCCATCATGGCGATATCGGCGGCGAGATCGAG
ATCCGCATCATCGAAAACGATCAGCGGTGATTTACCGCCCAGTTCCATGGTCACTTCTTT
CAGGGAAGAGGCCGCCGAGTTAGCCATCACTTTTTTGCCGCTGGCGACACCGCCGGTAAA
TGACACTTTGGCAATGCCCGGATGCTCGGTCAGATATTGCCCGGTCTCCGCGCCCACGCC
CGGCAACACGTTAAATACGCCGTCCGGCAGGCCCGCTTCGCTGTAAATTTCAGCCAGCTT
TAACGCGGTAAGCGGGGTAACTTCGCTCGGTTTGAAAATCATTGCGTTGCCTGCCGCCAG
CGCCGGGGCGGATTTCCACAGGGCAATCTGGATCGGGTAGTTCCATGCGCCAATCCCTGC
CACTACGCCCAGCGGTTCGCGGCGGGTATACACAAAGGACGTTTCACGCAACGGGATCTG
GCTGCCTTCCAGCGCCGGGATCAGCCCGGCGTAGTACTCCAGCACGTCCGCACCGGTAAC
GATATCGACGGTTGAGGTTTCCGAATATGCTTTTCCGGTGTCGAGGGTTTCCAGTTTTGC
GAGTTCGTCATTGCGTTCACGCAGAATATCAACGGCCCGACGCAGAATACGCGAGCGCTC
CATGGCGGTCATCGACGCCCAGATTTTTTGCCCCTGCTGGGCGCTTTTCACGGCGCGATC
GACATCCTCGCGCCCGGCGGCCTGCACGGTCGCCAGCACGTTACCGTTGGCCGGGTTAAT
GGTCTCGAAGGTGCGACCGCTGGTGGCGGAGGTATAACCACCATGTATATAAAGCTGCTG
TTCTGCCATTCGGGACATCACGTCTCCTCGGTTAATCGGTGGGTAGATGCTGAGTGATAA
AGTGGCGGGTCAGGGAATTAGCGCGGGTTTTATCCAGCGGTTTGCCGCTCAGAGCCGCGC
GCAGCCATAATCCATCAATCAGCGCGGCCAGGCCGTAGCCCGCTTCCTGTGCCTGTTCGC
GCGGCAATTCGCGACGAAACTCGCTCACCAGATTCGACAGCAAGCGGCGGCTGCTGACCT
GCTGTAAACGATAGAGCATCGGCTGATGCATACTGCTGGCCCAGAACGCCAGCCAGGCTT
TCATCGCCGCACTGCTCACCTGCGTTTCATCGAAGTTTCCGCCAACAATCGCCTGTAATC
GCTGCTCTGCACTGCCCTGCGGAAGTGCATGTAATCGATTCAAAACCGCGTCACGCAGCT
GACTGGTGATATCGCGCATGGTTGCTTCCAGCAGACCATTTTTGTCCCTGAAATAGTGGC
TGATGATCCCCGTAGAAACGCCTGCACGGCGGGCGATCTGCGCGATCGTTGCATCGTGCA
TGCCCACTTCATTTATTGCTTCCAGTGTGGCGTCGATCAGTTGTCTGCGCCGGATCGACT
GCATCCCCAATTTGGGCATTTTCGCCACTCCATTCATCAGCGGTGTTTATCTATTAAAGC
GGTTATTGATTGGACGTTCAATATAAAATGTGTCTTAATTGTTACGAATTTGATTTTAAA
TAGTAACAATAACAGTGGGGATACTGGATGACAGACCTTTCACACAGCAGGGAAAAGGAC
AAAATCAATCCGGTGGTGTTTTACACCTCCGCCGGACTGATTTTGTTGTTTTCCCTGACA
ACGATCCTGTTTCGCGACTTCTCGGCCCTGTGGATTGGCCGCACGCTGGACTGGGTTTCT
AAAACCTTCGGTTGGTACTATCTGCTGGCGGCAACGCTCTATATTGTCTTTGTGGTCTGT
ATCGCTTGTTCGCGTTTTGGTTCGGTGAAGCTCGGGCCAGAACAATCCAAACCGGAATTC
AGCCTGCTGAGTTGGGCGGCGATGCTGTTTGCTGCCGGGATCGGTATCGACCTGATGTTC
TTCTCCGTAGCCGAACCGGTAACGCAGTATATGCAGCCGCCGGAAGGCGCGGGACAGACG
ATTGAGGCCGCGCGTCAGGCGATGGTCTGGACGCTGTTTCACTACGGCTTAACCGGCTGG
TCGATGTATGCGCTGATGGGCATGGCGCTCGGATACTTTAGCTATCGTTATAATTTGCCG
CTCACCATCCGCTCGGCGCTGTACCCGATCTTCGGTAAACGGATTAACGGGCCGATAGGT
CACTCAGTGGATATTGCAGCGGTGATCGGCACTATCTTCGGTATTGCCACTACGCTCGGT
ATCGGTGTGGTGCAGCTTAACTATGGCTTGAGCGTACTGTTTGATATTCCCGATTCGATG
GCGGCGAAAGCGGCACTGATCGCCTTGTCGGTGATAATCGCCACGATCTCTGTCACCTCC
GGTGTCGATAAGGGCATTCGCGTGTTATCGGAGCTTAATGTCGCGCTGGCGCTGGGATTG
ATCCTGTTCGTATTGTTTATGGGCGACACTTCGTTCCTGCTTAATGCACTGGTGCTGAAT
GTTGGCGACTATGTGAATCGCTTTATGGGCATGACGCTCAACAGTTTTGCCTTCGACCGT
CCGGTTGAGTGGATGAATAACTGGACGCTCTTCTTCTGGGCATGGTGGGTGGCATGGTCG
CCGTTTGTCGGCTTGTTCCTGGCGCGTATCTCGCGTGGGCGTACCATTCGCCAGTTCGTG
CTGGGCACGTTGATTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAAT
AGCGCGCTGTATGAAATCATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATGGTCCAT
CCGGAGCGCGGCTTCTACAGCCTGCTGGCGCAGTATCCGGCGTTTACCTTTAGCGCCTCC
GTCGCCACCATTACTGGCCTGCTGTTTTATGTGACCTCGGCGGACTCCGGGGCGCTGGTG
CTGGGGAATTTCACCTCGCAGCTTAAAGATATCAACAGCGACGCCCCCGGCTGGCTGCGC
GTCTTCTGGTCGGTGGCGATTGGCCTGCTGACGCTCGGCATGCTGATGACTAACGGGATA
TCCGCGCTGCAAAACACCACGGTGATTATGGGGCTGCCGTTCAGCTTTGTGATCTTCTTC
GTGATGGCGGGGTTGTATAAATCTCTGAAGGTAGAAGATTACCGCCGTGAAAGTGCCAAC
CGCGATACCGCACCGCGACCGCTGGGGCTTCAGGATCGCCTGAGCTGGAAAAAACGTCTC
TCGCGCCTGATGAATTATCCGGGCACGCGTTACACTAAACAGATGATGGAGACGGTCTGT
TACCCGGCAATGGAAGAAGTGGCGCAGGAGTTGCGGTTGCGCGGCGCGTACGTGGAGCTA
AAAAGCCTGCCACCGGAAGAGGGACAGCAGTTGGGTCATCTGGATTTGTTGGTGCATATG
GGCGAAGAGCAAAACTTTGTCTATCAGATTTGGCCGCAGCAATATTCGGTGCCGGGCTTT
ACCTACCGCGCACGCAGCGGTAAATCGACCTACTACCGGCTGGAAACCTTCCTGTTAGAA
GGCAGCCAGGGCAACGACCTGATGGACTACAGCAAAGAGCAGGTGATCACCGATATTCTT
GACCAGTACGAGCGGCACCTTAACTTTATTCATCTCCATCGTGAAGCGCCGGGCCATAGC
GTGATGTTCCCGGACGCGTGATTGTTATTGCATAAAACCGCGCCATGTCTGCATATGGCG
CTGTTTCTCCTACCTCTTGATACGTTATATCTATACGGTTAAGCCCTTAGTATCTATTGA
TGATTACCAGACAACAGATAATAAAAAAGAAAAGAACTATTGCAGCCCAAAACCTACATT
TGGGCTGTTGCGAATGTTCAATAAGTTTAGTCTTATTTAATGTAAATATTGCTGATCATT
TGAAATGACGCATTATTCATGAGAAATGTGTATCGTAAATCAACTGAAATTAACGCAACC
ATTTGTTATTTAAGGTTTAATTATCTGTGTGTGATATTTTATTGAATGTTTTAAATATTG
TTTTTATTGGCATTGCTATAATATTGGTTATCATTTGCTGAATGGATTCAGTCTTAATGA
GTGGGTTTTTAAGGGACAGGCATAGAGTAATGATACGTATGCATAACCAACATCTTTACT
CATTATGTCATTGAATGTTGACGCTATGTGTTTATGAGGGAGAGGTATTTTCAGTTGATC
TGGATTGTTAAATTCATATAATGCGCCTTTGCTCATGAATGGATGCCAGTATGTAGTGGG
AAATTATAAATATTGAAATAGTCCAACTACTTCTTTATTACCAAAAATGAGTATCTGAAT
TTTAATATTGCATTCTTGCGTGATTATCTCCTGAGTTTGACTTGTGATTACCTTTTTAAG
GTATTTAGCGTAACTGTTTTTGAGCGAGCATCAGAGGTAAAGATAATCTTCTTGATAGTG
ATGTGGGATGTTATACGTATGGCATCGCTGATGTTTATGGTTACCCCTTATGTGTGCTCA
GGAATCGACAGGTAATCACTCATACTGAACAGCGATAAAAGATAAAGGTGTGTTCATGAA
TTCATGTGATTTTCGTGTTTTTCTGCAAGAGTTCGGTACAACGGTTCATTTGTCATTGCC
TGGTAGCGTATCCGAGAAAGAACGACTGCTACTCAAGCTGCTGATGCAGGGAATGTCTGT
AACAGAAATATCACAGTACAGAAATCGCAGTGCAAAGACAATTTCACATCAAAAGAAACA
GCTCTTTGAGAAACTGGGGATTCAGAGCGATATTACTTTCTGGCGCGATATTTTCTTTCA
GTACAATCCGGAGATCATATCCGCCACGGGGAGTAATAGTCACAGATATATTAATGATAA
TCACTATCACCATATCGTCACGCCTGAAGCCATCAGTCTGGCGTTGGAAAACCACGAATT
CAAACCGTGGATCCAACCGGTTTTCTGCGCGCAGACTGGCGTACTGACGGGCTGTGAGGT
GCTTGTCCGCTGGGAACATCCACAAACGGGAATTATCCCACCGGATCAGTTTATTCCTCT
GGCGGAGTCATCCGGTCTTATTGTCATAATGACCCGCCAACTGATGAAACAGACTGCGGA
TATTCTGATGCCGGTAAAACATTTGCTGCCGGACAATTTCCATATTGGCATCAACGTCTC
GGCGGGTTGTTTTTTGGCAGCGGGATTTGAAAAAGAGTGTCTGAACCTGGTTAATAAATT
AGGTAACGATAAAATCAAGCTGGTTCTCGAGCTAACGGAACGTAACCCTATTCCGGTAAC
GCCAGAAGCCAGAGCGATATTTGACAGCCTTCATCAGCACAACATTACCTTTGCGCTGGA
TGACTTTGGTACGGGTTATGCGACCTATCGTTACTTGCAGGCGTTCCCGGTCGATTTTAT
TAAGATCGATAAGTCATTTGTGCAAATGGCGAGTGTCGACGAAATCTCCGGTCATATTGT
GGACAATATTGTCGAACTAGCGCGTAAGCCTGGTCTGAGTATCGTGGCGGAAGGGGTAGA
AACCCAGGAGCAGGCGGATTTAATGATCGGTAAAGGCGTTCACTTTTTGCAGGGCTATTT
GTACTCTCCGCCAGTACCGGGTAATAAATTTATCTCTGAATGGGTAATGAAAGCAGGTGG
TTGATGTAAACCGCTATTCACAGCGCATCGGGAGGTTGGCAGCGATTAATTCTCCCGATG
CAGTAAATCCTGATAGATCCCCGTTAATATGCCATTTGGCGCAAATTGTTTTTTAATCCA
CTGCGTCACCTGACCCGTAGCAGAATGCTGAGTCGCCAGTAACATGCGCGAATCCTGGCG
CGGATTATGGATTTGTCGGGTAACCAGCAGGGATTGCGTCATCGCCTCACGGACCATGTA
ATCCGGCAAAAAACCAATTCCTTCACCTAAAATCTGGCACTGACATTTGGTGTTGAAATC
TGGCACCAGAATTGACTCCTGCCCGTGCAGCAACCAGCCCACTTTTTTATTAATCGTATG
CGCGGTGTCCTCCACCATAATATTAGGGTAGAGACGCAGTTGGCTTTCGGCGATGGGTTC
CGGCACAAAGGCTAACGGGTGATCCGGGGCGATAGCAAAAGCCCAGCGAATCGCGCCAAT
TTCAGTGTAATCAATACCGCCGCCGTCCAGTAGTGTATCGGGTGCGCCGATGGCGATATT
GGCCTGATTATTAATAATCGCATCCCAGACGCCGTTATACACTTCGGTGGTGACGGTAAT
CTGGCAGGTAGGAAACTGCTTTTTCAGCACCTGTAACAAGCGTGCGGTGTGTTTGGGCGT
ATAAAGCAGCTGATTAATACAAATGCGCACACGCGCTTCTATGCCCTGCGAAATAGTATC
GATTCTGCGTTTGATGGCATAAAAATCATTCAGCAGGTCGGTAGCTTTGCGGAAAAAATA
ACGCCCGGACTCCGTTAACTCAATGCTGCGGGTACTGCGAGTGAACAGCACCACATCCAG
CCCCGTCTCCATACGCTTAATGGTGTAGCTAATGGCGGAAGTGGTTAAACCCAACTCTTC
TGCGGCTTTACTGAAGCTGCCAAAACGCGCAGCGGTAGTAAATGCCAACAGATTCTCTTC
GGTAAAAATTGAGTTCATTAAACCATTCTCGCCATTATCTACTATGAATTTCTCCAGCTA
TGACTGTAGAGGTATCGGTTAAAGATAGATAATCATTTTTGAATAACTTTTAATACCCGT
CGCGTTTAGTCGTCGCTTCGCTTAATTTTTGTCCACCATATTCTGAAATTACCCCCACGC
AGTTACCCGCCAGAAAACCCAGTAACGTCACCGTCCAGTTCATCCCGCTGGCAAAAAACA
GCGTCATGCCGAGAAAGCCACCGGGAATAAAGGACAGTAACCAGAAACGCCCTTGCCAGA
CCACTACCGCCGAGAAGGGTACGGTAGTAATTACGCTCGCCCAGAACGCGGACAGTCCAC
TTACAGAGGCCAGCCAACCAGCAGTCAGCGCGGCGAAAAACGCCCACACCATCCCGGAAT
AATTAACCGCCAGACTTCTGATAAACCCCGATTTACCGCCGCCTGCGGCATAAAAACTGC
AAAAGGCGACGAAGCCAATGGTTCCTAATAATTCCCATCCTTGAGAGAGCCCGACATGTG
AAGACACTAACTGCCAAAGCCCTGCACAAATACCGACGGTGACACCCGTTGCCGTGAGTC
CGTTCATCTTGTTCCCCTCTGGTTAGACATGGACGAAAGCTACTCTTACATGTGCAGACT
ATAGAGAAATAAAACCTGATTGAGTGAAAGGGTATCGGGTCAAAGAAACAAATATTGCAC
TACCGCACACTGCGAAAAGATTGTTGAATATTATTCAACAAAAAGGCGAGATACGGCGAA
TTAAATTTAAGCGGGTTCTTTTATCAGATTATCGTTGCTATTCTCAATTCATCGAAAACA
GCCACAAAAACCAGGGGAATGTGAATGAGTATAAAAAATCTACCTGCCGACTATTTATTG
GCTGCACAACAGGGTGATATCGATAAAGTAAAAACCTGCCTTGCGCTGGGTGTCGATATT
AATACCTGCGATCGTCAGGGGAAAACGGCAATTACGCTGGCAAGTTTATATCAGCAATAT
GCTTGCGTTCAGGCATTAATTGATGCCGGAGCGGATATTAATAAGCAAGATCATACCTGT
TTAAATCCTTTTTTAATTAGCTGTCTGAACGATGATTTAACGCTACTACGAATTATTTTA
CCGGCTAAACCCGATCTTAATTGCGTAACCCGTTTTGGCGGTGTCGGCCTGACGCCTGCC
TGTGAAAAAGGCCATTTAAGTATTGTAAAAGAGCTTTTGGCGCATACGGAGATTAACGTT
AACCAGACCAACCATGTAGGCTGGACGCCGCTACTGGAAGCGATTGTGCTTAATGATGGT
GGTATTAAACAGCAGGCGATTGTGCAGTTATTGCTGGAACACGGTGCCAGCCCGCATCTG
ACCGATAAATATGGCAAAACGCCACTGGAACTGGCGCGGGAACGGGGCTTTGAAGAGATT
GCGCAGTTACTGATTGCCGCAGGTGCATAAACCGGGAGGCTTGCTATCAACACACCAGAA
AGACGGTGTGTGTGGGCGCTAACTGCGGATGCGGATTTTCTGGCGCAGCGGGGGCAAGGA
CAGGTTGAACAGGTCTTTGCCAGAGCGGTAAATATCGCACTCCCGGCTCGCCAGCAGTTG
CTGACGCTGCTTTGTGAAGAGTACGACAATGCGCCAAACAGTTGTCGGTTGGCACTCACT
CACTTTGATGATCTGTTCCGGCATGGTGATAAGGTTCAGTTTGACGATCAAGGTATTACG
GTTGGTCAACATCTTCATATAGAGATGAGTCGTTGTCGGCGTTGGCTGTCCCCAACCTTG
CAAATGACCGCTGTGAATTTTCACCTTATCGCCTGGCTACAGTGGCACGACATTATTCAT
CAGCACCTGGGGGAAAATGAAACCCTGTTTAATTATCGCGGCGATAATCCGTTTTATCAG
GCGTTAAATAAAGAATTACATATTAAACGACGGGCAGTTATTCAGGCCGTAAACGATAAA
CAAAATATCGCCTCAGCGGTCGCCAGTATGATGGGGTTAGGGATTGGCCTTACGCCATCA
GCCGACGATTATTTAACAGGTCTGGCGCTTATTTTATTTATTCCCGGGCATCCGGCGGAA
AAATACAAAGAGGAATTTTATCTCGGTCTGCAACGCGGCAAAAATAATACCACATTATTA
AGTGCCATAACGCTGGAAGCCGCATTACAACAACGCTGCCGGGAAAATATTCATCGTTTT
ATTCACAACATTATTTATGACATCCCTGGGAACGCAACTCAGGCAATAGAAAAAATTAAA
CATATTGGCTCCAGTTCCGGCTGCGACATGCTGTATGGCATGGCCGATGGTTGTGCGCTG
AGCCAAACCTACGGAGGGAATTATGTCAGTTAAAATAGTCATTAAACCGAATACCTATTT
TGATTCTGTCTCGCTGATGTCTATCTCCACGCGTGCAAATAAACTCGACGGCGTCGAGCA
GGCATTTGTGGCGATGGCGACCGAAATGAATAAAGGCGTGCTGAAGAATTTAGGACTGCT
GACGCCGGAGCTGGAGCAGGCGAAAAACGGCGACCTGATGATTGTCATCAATGGTAAATC
GGGTGCGGACAACGAGCAGTTACTGGTGGAGATTGAAGAACTGTTCAACACCAAAGCGCA
AAGCGGCTCGCACGAGGCGCGTTACGCCACTATTGGCAGCGCCAAAAAGCATATCCCGGA
AAGTAACCTGGCGGTGATTTCGGTCAACGGTCTGTTTGCCGCTCGCGAAGCGCGTCAGGC
GCTGCAAAACGATCTCAACGTGATGCTGTTTTCCGATAACGTCTCAGTTGAAGATGAACT
GGCGCTCAAGCAACTGGCCCACGAAAAAGGGCTGCTGATGATGGGGCCAGACTGTGGCAC
GGCGATTATCAACGGCGCGGCGCTCTGTTTTGGTAACGCCGTGCGTCGCGGCAACATCGG
TATTGTTGGCGCATCCGGCACCGGCAGTCAGGAGTTGAGCGTCCGCATTCATGAATTTGG
CGGCGGCGTTTCGCAACTGATTGGCACCGGCGGGCGCGACCTGAGCGAGAAAATCGGCGG
CCTGATGATGCTCGACGCCATCGGGATGCTGGAAAACGATCCGCAAACTGAAATCATTGC
GCTTATCTCCAAACCGCCTGCGCCTGCGGTGGCCCGCAAAGTGCTGGAACGTGCGCGCGC
CTGCCGCAAGCCGGTGGTCGTCTGCTTCCTCGATCGTGGCGAAACGCCAGTGGATGAGCA
GGGGCTACAGTTTGCCCGCGGCACCAAAGAGGCAGCGCTAAAAGCGGTGATGCTCTCCGG
CGTGAAACAGGAAAATCTCGACCTGCATACGCTTAACCAGCCGTTGATTGCGGATGTGCG
TGCGCGTCTGCAACCGCAGCAGAAATACATTCGTGGCCTGTTCTGCGGCGGCACGCTGTG
CGACGAAACCATGTTCGCGGTGATGGAAAAACATGGCGATGTCTACAGCAACATTCAGCC
CGATCCGGAATTCCGCCTGAAAGATATCAACCGCAGCATCAAACACACCTTCCTCGACTT
TGGCGATGACGACTTCACCAATGGCAAGCCGCACCCGATGATTGACCCCACCAACCGCAT
CAGTCGCTTGATCGAAGAGGCGCGCGATCCAGAAGTGGCGGTGATCGTGATGGATTTTGT
GCTCGGATTTGGATCGCATGAAGATCCGGTCGGCTCCACCATCGAGACGATCAAAGAAGC
GAAAGCGATCGCCGCTGCCGAAGGACGCGAGTTGATCATTCTCGCCTATGTGCTGGGTAC
CGATCTTGATACGCCATCGTTAGAACAACAAAGCCAGATGCTGCTTGATGCCGGAGTGAT
TCTGGCGAGCAGCAGCACCAATACCGGATTGCTGGCGCGTGAATTTATCTGCAAAGGGGA
GGAAGCCTGATGAGCCAGTCACTGTTTAGCCAACCATTGAACGTTATTAACGTCGGCATC
GCCATGTTTAGCGATGACCTGAAAAAGCAGCATGTAGAAGTGACTCAACTCGACTGGACG
CCGCCGGGGCAGGGCAATATGCAGGTGGTGCAGGCGCTGGATAACATTGCCGATTCGCCG
CTGGCGGACAAAATCGCCGCCGCTAACCAGCAGGCGCTGGAGCGTATTATCCAGTCGCAT
CCGGTGCTGATTGGTTTTGATCAGGCGATTAACGTGGTGCCGGGCATGACGGCGAAAACC
ATTCTTCACGCCGGGCCGCCGATCACCTGGGAAAAAATGTGCGGCGCGATGAAAGGCGCG
GTCACCGGAGCGCTGGTGTTCGAAGGACTGGCGAAAGATCTCGACGAGGCGGCTGAACTG
GCGGCTTCCGGGGAGATCACCTTCTCGCCGTGTCACGAGCACGACTGCGTGGGATCGATG
GCGGGTGTTACCTCGGCCTCGATGTTTATGCACATCGTAAAAAACAAAACCTACGGCAAC
ATCGCTTATACCAACATGAGCGAGCAGATGGCGAAGATTTTGCGTATGGGCGCTAACGAC
CAGAGCGTGATTGACCGCCTGAACTGGATGCGTGATGTGCAGGGACCAATACTGCGCGAC
GCGATGAAAATTATCGGCGAAATCGATCTGCGCTTAATGCTGGCGCAGGCGCTGCATATG
GGCGATGAGTGCCATAACCGCAATAACGCCGGGACGACACTGCTGATTCAGGCGCTGACG
CCGGGGATTATTCAGGCGGGTTATTCCGTCGAGCAACAGCGCGAAGTGTTTGAGTTTGTC
GCCAGCAGCGACTACTTCTCCGGCCCGACGTGGATGGCGATGTGTAAAGCGGCGATGGAT
GCGGCGCATGGCATCGAATACAGCACCGTGGTCACCACCATGGCGCGTAACGGCGTCGAG
TTCGGCCTGCGGGTCAGCGGCCTGCCGGGGCAATGGTTTACCGGCCCGGCGCAGCAGGTG
ATCGGCCCGATGTTTGCCGGTTATAAGCCGGAAGATTCGGGGCTGGATATCGGCGACAGC
GCCATCACCGAAACCTACGGTATTGGCGGATTTGCTATGGCGACCGCGCCCGCTATCGTC
GCGCTGGTGGGCGGCACGGTGGAAGAAGCTATTGATTTCTCCCGTCAGATGCGCGAAATC
ACCCTCGGTGAAAACCCCAACGTCACCATTCCGCTGCTCGGTTTTATGGGCGTGCCGTCG
GCAATCGACATCACCCGCGTGGGTAGCAGCGGCATTCTGCCGGTGATCAACACCGCCATC
GCCCATAAAGATGCGGGCGTCGGCATGATTGGCGCGGGCATTGTGCATCCACCTTTTGCC
TGCTTCGAGAAAGCCATTCTTGGCTGGTGCGAACGTTACGGCGTCTGACCTACATGTTCA
TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACGAATGGCGCAAGAATCTGTAGGCCT
GATAAGCGTAGCGCATCAGGCATTTGTCACCATTGCCGGATGCGGCGTGAACGCCTTATC
CGGCCTACGAATGGCGCAAGAATCTGTAGGCCTGATAAGCGTAGCGCATCAGGCATTTGC
CACCACTGCCGGATGCGGCGTGGACGCCTTATCCGGCCTACGAGTGGCGCGAGAATCTGT
AGGCCTGATAAGCGTAGCGCATCAGGCATTTGTCACCATTGCCGGATGCGGCGTGAACGC
CTTATCCGGCCTACGAGTGGCGCGAGAATTGTAGGCCTGATAAGCGTAGCGCATCAGGCA
GTCTGGCGTTGGTCATAACCCCATCACCCTCTGTAGCGGACATAACAACATGAAAGAGCT
TGTGGTCGTTGCCATTGGTGGCAACAGCATTATCAAAGATAACGCCAGCCAGTCGATTGA
GCATCAGGCGGAGGCGGTGAAAGCCGTCGCCGATACGGTGCTGGAAATGCTGGCTTCCGA
TTACGACATTGTGCTGACCCACGGCAACGGGCCGCAGGTCGGGCTGGATTTACGCCGTGC
GGAGATTGCCCACAAGCGCGAAGGGCTGCCCTTAACGCCGCTGGCGAACTGTGTGGCAGA
TACGCAGGGCGGCATCGGCTATCTGATCCAACAGGCGCTGAATAACCGGCTGGCGCGTCA
CGGCGAGAAGAAAGCCGTCACCGTGGTGACTCAGGTGGAAGTGGATAAAAACGATCCAGG
TTTTGCCCATCCCACCAAGCCCATCGGCGCATTCTTTAGTGACAGCCAGCGTGACGAATT
ACAAAAGGCAAACCCTGACTGGTGTTTTGTTGAAGATGCCGGGCGGGGCTATCGCCGCGT
GGTCGCCTCGCCGGAACCGAAACGTATTGTCGAAGCACCTGCCATTAAAGCGCTGATCCA
ACAAGGTTTTGTCGTAATTGGCGCGGGCGGCGGTGGAATTCCGGTAGTGCGTACTGACGC
GGGAGATTACCAAAGCGTGGACGCGGTTATCGACAAAGATCTCTCTACCGCGCTGCTGGC
CCGTGAAATTCACGCCGACATTCTTGTGATCACCACTGGCGTCGAAAAAGTGTGTATTCA
CTTTGGCAAACCGCAGCAGCAGGCGCTCGATCGGGTGGATATTGCCACCATGACCCGCTA
TATGCAGGAAGGGCATTTCCCGCCCGGCAGCATGTTGCCAAAAATCATCGCCAGCCTGAC
ATTTTTAGAACAAGGCGGCAAAGAAGTGATTATCACCACGCCGGAATGCCTGCCTGCGGC
GCTGCGCGGCGAAACGGGCACTCATATTATTAAAACGTAAGGACGTAAGATGAAAGAAAG
CAATAGCCGCCGTGAATTTCTGAGCCAGAGCGGTAAGATGGTCACCGCCGCCGCGCTGTT
TGGTACCTCTGTGCCGCTCGCCCATGCGGCGGTAGCTGGCACCCTAAACTGCGAAGCGAA
CAACACCATGAAAATCACTGACCCGCATTACTATCTCGATAACGTGCTGCTGGAAACCGG
TTTTGACTACGAAAATGGCGTGGCGGTGCAGACCCGCACGGCGCGCCAGACCGTGGAGAT
TCAGGACGGCAAAATTGTCGCCCTGCGCGAGAACAAGCTGCATCCGGACGCCACGCTGCC
GCACTATGACGCTGGCGGTAAGCTGATGCTGCCCACCACCCGCGACATGCATATTCATCT
CGACAAAACCTTTTACGGCGGGCCGTGGCGCTCGCTCAATCGTCCGGCAGGCACCACCAT
CCAGGACATGATCAAACTCGAGCAGAAAATGCTGCCGGAACTGCAACCGTACACTCAGGA
GCGGGCAGAAAAACTGATTGATTTATTGCAGTCGAAAGGCACCACCATTGCCCGCAGCCA
CTGCAATATCGAACCGGTTTCCGGCCTGAAAAATCTGCAAAATTTGCAGGCGGTGCTGGC
GCGACGTCAGGCGGGCTTTGAGTGTGAAATCGTCGCCTTCCCGCAGCACGGTTTGCTGCT
GTCGAAATCTGAACCTTTAATGCGTGAAGCGATGCAGGCGGGGGCGCATTACGTCGGCGG
CCTGGACCCGACCAGTGTTGATGGCGCGATGGAAAAATCCCTCGACACCATGTTCCAGAT
TGCGCTGGACTACGACAAAGGCGTCGATATTCACCTGCACGAAACCACTCCGGCAGGCGT
GGCAGCCATCAATTATATGGTTGAAACGGTAGAGAAAACGCCACAGCTGAAGGGCAAGCT
GACCATCAGTCACGCCTTTGCGCTGGCAACGCTCAACGAGCAACAGGTAGATGAACTGGC
GAACCGGATGGTGGTGCAACAAATTTCTATCGCCTCGACGGTGCCGATTGGCACGCTGCA
TATGCCGCTCAAACAGTTGCACGACAAAGGCGTAAAAGTGATGACTGGCACTGACAGCGT
TATCGACCACTGGTCGCCTTATGGTCTGGGCGACATGCTGGAAAAAGCCAATCTGTACGC
GCAGCTCTATATTCGTCCTAACGAACAGAACCTCTCCCGCTCGCTGTTTTTAGCCACTGG
CGATGTATTGCCGCTGAATGAAAAAGGCGAGCGTGTATGGCCAAAAGCGCAGGATGACGC
CAGCTTTGTGCTGGTGGACGCCTCCTGTTCCGCCGAGGCGGTGGCGCGTATCTCGCCGAG
AACCGCAACGTTCCATAAAGGGCAACTGGTGTGGGGGAGTGTGGCAGGTTGATGCGCATT
TGAAACGCCTGCAACGGTGAATAGTAAGAGATTTAAGCCCCAGGGAGTGGGGCAATCTGA
ATATGAGTGTGTCGGCAGAAATGGACATTATCTTTGAGGAATATGCCCTTATTGACGTTG
TGTAGATAACTATTTGTCTACGTGAAAAGATCATCAGTTTTGCCGATTTTAGTCTTTTAC
AGATAGCAAATATCACACTTACAGGCGCTCGCCTTATGGGGAACGTTGCTGCTCTGTTTC
ATTCAGGCTCGCGGCATGTTGGGGCTGGATCGGGTGGTTTAAATATTGGCTATATTCAAT
GGACGCGTTTTGCCGCGATGACATATCAGGCGTTGCCAAATACACATAGCTAATCAGGAG
TAAACACAATGAAGATCAAAGCTGTTGGTGCATATTCCGCTAAACAACCACTTGAACCGA
TGGATATCACCCGGCGTGAACCGGGACCGAATGATGTCAAAATCGAAATCGCTTACTGTG
GCGTTTGCCATTCCGATCTCCACCAGGTCCGTTCCGAGTGGGCGGGGACGGTTTACCCCT
GCGTGCCGGGTCATGAAATTGTGGGGCGTGTGGTAGCCGTTGGTGATCAGGTAGAAAAAT
ATGCGCCGGGCGATCTGGTCGGTGTCGGCTGCATTGTCGACAGTTGTAAACATTGCGAAG
AGTGTGAAGACGGGTTGGAAAACTACTGTGATCACATGACCGGCACCTATAACTCGCCGA
CGCCGGACGAACCGGGCCATACTCTGGGCGGCTACTCACAACAGATCGTCGTTCATGAGC
GATATGTTCTGCGTATTCGTCACCCGCAAGAGCAGCTGGCGGCGGTGGCTCCTTTGTTGT
GTGCAGGGATCACCACGTATTCGCCGCTACGTCACTGGCAGGCCGGGCCGGGTAAAAAAG
TGGGCGTGGTCGGCATCGGCGGTCTGGGACATATGGGGATTAAGCTGGCCCACGCGATGG
GGGCACATGTGGTGGCATTTACCACTTCTGAGGCAAAACGCGAAGCGGCAAAAGCCCTGG
GGGCCGATGAAGTTGTTAACTCACGCAATGCCGATGAGATGGCGGCTCATCTGAAGAGTT
TCGATTTCATTTTGAATACAGTAGCTGCGCCACATAATCTCGACGATTTTACCACCTTGC
TGAAGCGTGATGGCACCATGACGCTGGTTGGTGCGCCTGCGACACCGCATAAATCGCCGG
AAGTTTTCAACCTGATCATGAAACGCCGTGCGATAGCCGGTTCTATGATTGGCGGCATTC
CAGAAACTCAGGAGATGCTCGATTTTTGCGCCGAACATGGCATCGTGGCTGATATAGAGA
TGATTCGGGCCGATCAAATTAATGAAGCCTATGAGCGAATGCTGCGCGGTGATGTGAAAT
ATCGTTTTGTTATCGATAATCGCACACTAACAGACTGAAAAAATTAATAAATACCCTGTG
GTTTAACATATTAACTTCGCTCTCCACTTAACTTTTTAGTTAAGGAGAGCGAAATAATAT
CAAAGTAGCAGTAAAACCTATAACGTAAATTTAAATTGTTAAATTAACGCCCTCCAGTAC
ACAATACTTCACACGTTAGTTATGAGCGATTTCTGATAGTGCCTGGTTTAATCAGAGCTT
TATTATCTGCGACGTTTATTTTTATTTAAGAGAGATCGCGATGATATCATTAAAAGCTCC
GCACAATAATTTGATGCCATATACGCAACAAAGCATACTTAATACGGTTAAAAACAATCA
GTTACCAGAGGATATCAAAAGCTCCCTGGTTTCCTGTGTCGATATATTCAAGGTTTTGAT
TAAACAATATTATGATTATCCTTATGATTGTCGTGATGATTTAGTCGATGACGACAAACT
CATTCATCTCATGGCTGCCGTACGAGACTGTGAGTGGTCAGACGATAACGCACTCACCAT
AAATGTGCAGTTTAATGATTTCCCTGGATTTTATGACTGGATGGATTACCCTGATCACCC
GGTTAAGTTTGTTTTTCACATACTTGAAAATCAAAAAGGGACAGTTTGGGTATATGACCA
GGATGATGCGTTTCTTGATATTAAAGCAAACGTGCAGGCTGGACGCTTTACCGGGCTTAA
GAAATTAGTGCAGTTTATCGATTCAGTGCGAACAGATTGCAAATGTATTCTTCTTGAATA
CCATATGCCTTTGCTGAGAATTTTCCCTAAAGGGAAAGAGTGTATGCATGTGGAAAAATG
GCTTCGCGAAATGTCGTCTATTCCGGAGACAGACGCGCCCATTAAGCAGGCGCTTGCGCA
TGGATTATTATTACACTTAAAAAATATCTACCCTGTTTTTCCTGAATCACTGGTGATGTT
ATTGCTCTCTGTTCTGGACGTAAAAACATACAGAGATGATGCGCGATTAAATGAATGGAT
ATCTAATAGAGTGCAGGAATTAGGTGACAGATATTATCCTGTAAATAAGCACGTTAAAAT
CCGCTACACTCTTTAGTTCAGAAAGGGTTCCACCTGCAAGTTGTTATTCCACCTGAGAGT
GAATCGCAATGCAGGTAATCATTTCATCTGTATATCTGTATGCCAACTGGCATTCCATCT
CTTTTTTCGCCGATATTTTGTTGTGATCGGCGACACTTCGCTTAAAAAAGCACCAGTAGT
GGTTTCGCAGCCATGCGGTGTATAAAAAATGATCTCATGCAGATGTTTTGTGAATGTGTT
GGTTGACATTCATATGAAAAAAATCATAATTCCATCATGTTTGTGTGGGGTCTTTTCTGT
ATCTTACGCATCGCACTCAAGCCTGACAGAAAATATGCTGTAAGGCTCATATCAAAAACC
GCCATTAGCTCATCAGGAAGAGCAGACGACAACCAGGATTGTTGTATGGTACGGGGTTCG
AGGCCTCGATGGCGGTCCAACTTTTCAAAACTCTTCTGAATCAGATCCCCTTATTATCAT
CCCTGCAAAGTGGAACATTGCCATTGTTTGGCTATTCAGGATGGGGCAGACCAATGAAAA
AAGCCCACACAGGGGAGAGTGGGCTGAAATGGGAAGCTAAAGACTCAAGTAAACTTATCG
GAAATAAGGACCACGCATTACGGGGGCTATCATCGCCGATGGCCGTGATTCGGCAAATCA
GGTTGATTACGTAGAGAGTAAATTATCTGCTCACCGCTGCGTCACCCCTTCGTAAATCAG
GCGTAGCGCGAATACACCAATAATTGCACCAATAACCCGACTGGCAACGCGTTGCATACG
CCCATAAGCACGACGCACAGCGGGCAAAGAAAACGCCTGACTAAGAAAAACTCGCCAGAT
AATTGATGCGAGCACAATCCCCGCCCAGGCCATTAAACGTGCCCATGTTGGTGTTTCGGC
ATTTAATGTTACTGAGAAAATACTGATAAAAAATAAAACGGTTTGCGGGTTAGAGAGATC
GGTAATTAATCCGCGGCGAAAAAAGACATACCAGGGGGCGCTAATCGGTTGTTGTAGTGT
GCTCATTTGCGGTGTTGACTGGCGGCGCATGCTGCACCACGCAAACCATAAGAGATAAGC
GCCGCCGACGATTCTGATAAGCGAAAAAATCTCCTCACACTGCGTAATTAGCGTTGCAAG
ACCAAACAAACCCAACCCGGAATAAAATGCATCGCCCAGCGCCACGCCCAGCCCGGTCAG
CACCCCTGCGCGTCGACCGGAAGCCAGGCTGGTTTGTACTACCACAAAGAGATTGGCTCC
CGGATTAAAAAAAGTAATCACGAACAGTCCTACGGTCAGGTAAACGGCATGCAAAGGATC
CATAGTGATTTCATCCATAAATAAGTGAACTAACTGCATCATATTTCTACCAAAAATAAT
CGGGTGCGAGAGAGATCACAAAGTGTCTTATTTCCGGTTACTGGCGTTTATGCCCTGACT
GAACTAATTATTAATCAACCCAATAATGTGGGTGGGTGATAGTGTGATAACAACTCTGGA
GCCGTAATATGAAAATAATCTCTAAAATGTTAGTCGGTGCGTTAGCGTTAGCCGTTACCA
ATGTCTATGCCGCTGAATTGATGACCAAAGCGGAATTTGAAAAAGTTGAATCGCAGTATG
AAAAAATAGGTGATATTTCAACCAGCAATGAAATGTCGACTGCAGATGCAAAAGAAGATT
TGATCAAAAAAGCGGATGAAAAAGGGGCTGATGTGTTGGTACTGACCTCCGGTCAAACTG
ACAATAAGATCCACGGCACGGCAAATATTTATAAGAAGAAGTAATTCTGAATCCTATGTA
AACATCTCCGATGCGTAAGTTTATCGGTGATCATCTATTGAAATTTATGCCGGATAAAGC
GTTCGCGCTGCATTCGGCAGTTCAGCTTTTCAGCCGCCGCCAGAACGTCGTCCGGCTGAT
GCCTAAATAATTCGCCGCTGCTGTTTTATCGCCATTAAATTTCTCCAGTGCCTGTTGTGG
TGTCAGTAAGCGTGGAGCGGGAGTTTTCGCCGACTCGCGCGCCAGTTCCGGCAGTAGCAG
TTGCATAAACTGCGGCGTTAAATCCGGCGTCGGTTCCACACTTAAAAACAGCGCCAGTCG
TTCCATCATATTGCGCAGTTCACGAATATTGCCTGGCCAGTCGTAGTGCAGCAGCACAGT
TTCACTTGCCTGTAACCCCTGGCGTAATGCAGCAGAAAATGGGGCGGAGAGCGCCGCCAG
AGACACTTTCAAAAAGCTTTCCGCCAGCGGAAGAATATCCGCCACCCGCTCGCGCAGTGG
TGGCAATTGCAGACGCAAAATACTCAGCCGATAAAACAGATCACGGCGAAAACGTCCTTG
CTGCATATCTTCTTCCAGATTGCAGTGAGTGGCGCTAATGACCCGTACATCTACCGGAAC
AGGCTGATGCCCGCCGACGCGGGTGACCTCTTTTTCTTCCAGCACCCGCAGCAGCCGGGT
CTGCAAAGGTAGCGGCATTTCGCCAATCTCATCCAGAAACAGCGTACCGCCGTGGGCAAT
TTCGAACAGCCCGGCGCGACCTCCGCGTCGCGAGCCGGTAAACGCCCCTTCCTCATAGCC
AAACAGTTCTGCTTCCAGCAGCGATTCGGCAATCGCCCCGCAGTTGACGGCAACAAACGG
ATGCGACTTTTTGCCCTGTCGCGCATCGTGGCGGGCAAAATATTCCCGATGAATCGCCTG
GGCCGCCAGCTCTTTGCCCGTCCCCGTTTCCCCCTCAATCAACACCGCCGCACTGGAGCG
GGCATACAGCAAAATAGTCTGCCGTACTTGTTCCATCTGTGGTGATTGACCGAGCATATC
GCCCAGCACGTAACGAGTACGCAGGGCGTTGCGGGTGGCATCGTGAGTGTTATGGCGTAA
CGACATGCGCGTCATATCCAGCGCATCGCTGAACGCCTGGCGCACGGTGGCGGCGGAATA
GATAAAAATTCCGGTCATTCCGGCTTCTTCTGCCAAATCGGTAATCAGCCCTGCGCCGAC
CACCGCTTCGGTGCCGTTAGCTTTTAGCTCGTTAATCTGCCCGCGTGCGTCTTCCTCGGT
AATGTAGCTACGTTGGTCGAGGCGCAAATTAAAGGTTTTTTGAAACGCCACCAGCGCTGG
AATGGTTTCCTGATAGGTGACAACGCCGATAGAAGAGGTGAGTTTTCCGGCTTTTGCCAG
TGCCTGTAACACATCGTAGCCGCTCGGTTTAATCAAAATAACTGGCACTGACAGGCGGCT
TTTCAGGTACGCGCCGTTAGAGCCAGCCGCGATGATGGCGTCACAGCGTTCGTTTGCCAG
TTTCTTGCGGATGTAGGTCACTGCTTTTTCAAAGCCAAGCTGAATAGGGGTAATGTTCGC
CAGGTGATCAAACTCGAGGCTGATATCGCGAAACAGCTCGAACAGGCGCGTTACAGATAC
CGTCCAGATAACCGGTTTGTCGTCATTAAGCCGTGGTGGATGTGCCATAGCGCACCGCAA
AGTTAAGAAACCGAATATTGGGTTTAGTCTTGTTTCATAATTGTTGCAATGAAACGCGGT
GAAACATTGCCTGAAACGTTAACTGAAACGCATATTTGCGGATTAGTTCATGACTTTATC
TCTAACAAATTGAAATTAAACATTTAATTTTATTAAGGCAATTGTGGCACACCCCTTGCT
TTGTCTTTATCAACGCAAATAACAAGTTGATAACAAAGGATGGGCTATGTCTCTACACTC
TCCAGGTAAAGCGTTTCGCGCTGCACTGACTAAAGAAAATCCATTGCAGATTGTTGGCAC
CATCAACGCTAATCATGCGCTGTTGGCGCAGCGTGCCGGATATCAGGCAATTTATCTTTC
TGGCGGTGGCGTGGCGGCAGGTTCGCTGGGGCTGCCCGATCTCGGTATTTCTACCCTTGA
TGATGTGCTGACCGACATTCGCCGTATCACCGACGTTTGTTCGCTGCCGCTGCTGGTGGA
TGCGGATATCGGTTTTGGTTCTTCGGCCTTTAACGTGGCGCGCACCGTGAAATCGATGAT
TAAAGCCGGTGCGGCAGGATTGCATATTGAAGATCAGGTTGGTGCGAAACGCTGCGGTCA
TCGTCCGAATAAAGCGATCGTCTCGAAAGAAGAGATGGTGGATCGGATCCGCGCGGCGGT
GGATGCGAAAACCGATCCTGATTTTGTGATCATGGCGCGCACCGATGCTCTGGCGGTAGA
GGGGCTGGATGCGGCGATCGAGCGTGCGCAGGCCTATGTTGAAGCGGGTGCCGAGATGTT
GTTCCCGGAGGCGATTACCGAACTCGCCATGTACCGCCAGTTTGCCGATGCGGTGCAGGT
GCCGATCCTCGCCAACATCACCGAATTTGGTGCCACGCCGCTGTTTACCACCGACGAATT
ACGCAGCGCCCATGTCGCAATGGCGCTGTACCCACTTTCAGCGTTCCGCGCCATGAACCG
CGCCGCTGAACATGTCTACAACGTCCTGCGCCAGGAAGGCACGCAGAAAAGCGTCATCGA
CACCATGCAGACCCGCAACGAGCTGTACGAAAGCATCAACTACTACCAGTACGAAGAGAA
GCTCGACAACCTGTTTGCCCGTAGCCAGGTGAAATAAAAAACGCCCGTTGATTGTATTCG
ACAGCCGATGCCTGATGCGTCGCTGACGCGACTTATCAGGCCTACGAGGTGCACTGAACT
GTAGGTCGGATAAGACGGATGGCGTCGCATCCGACAACCGATGCCTGATGCGCCGCTGAC
GTGACTTATCAGGCCTACGGGGTGCACTGAACTGTAGGTCGGATAAGACGCATAGCGTCG
CATCCGACAACCGATGCCTGATGCGCCGCTGACGCGACTTATCAGGCCTACGGGGTGCAC
TGAACTGTAGGTCGGATAAGACGCATAGCGTCGCATCCGACAACCGATGCCTGATGCGCC
GCTGACGCGACTTATCAGGCCTACGGGGTGAACTGAACTGTAGGTCGGATAAGACGCATA
GCGTCGCATCCGACAACAATCTCGACCCTACAAATGATAACAATGACGAGGACAACATGA
GCGACACAACGATCCTGCAAAACAGTACCCATGTCATTAAACCGAAAAAATCTGTGGCAC
TTTCTGGCGTTCCGGCGGGCAATACGGCGCTCTGCACCGTGGGTAAAAGTGGCAATGACC
TGCATTACCGCGGCTACGATATTCTTGATCTGGCGAAACATTGCGAATTTGAAGAAGTGG
CGCATCTGCTGATCCACGGCAAACTGCCGACCCGTGACGAACTCGCCGCTTACAAAACGA
AACTGAAAGCCCTGCGCGGTTTACCGGCTAACGTGCGTACCGTGCTGGAAGCCTTACCGG
CGGCGTCGCACCCGATGGATGTTATGCGCACCGGTGTTTCCGCGCTCGGCTGCACGCTGC
CAGAAAAAGAGGGGCATACCGTCTCTGGCGCGCGGGATATTGCCGACAAACTGCTGGCGT
CGCTTAGCTCGATTCTCCTTTATTGGTATCACTACAGCCACAACGGCGAACGCATCCAAC
CGGAAACCGATGACGACTCCATCGGCGGTCACTTCCTGCATCTGCTGCACGGCGAAAAGC
CATCGCAAAGCTGGGAAAAGGCGATGCATATCTCGCTGGTGCTGTACGCCGAACACGAGT
TTAACGCCTCCACCTTTACCAGTCGGGTGATTGCGGGCACCGGCTCTGATATGTATTCCG
CGATTATTGGCGCGATTGGCGCACTGCGCGGGCCAAAACACGGCGGGGCGAATGAAGTGT
CGCTGGAGATCCAGCAACGCTACGAAACGCCGGACGAAGCCGAAGCAGATATCCGCAAGC
GCGTGGAAAACAAAGAAGTGGTCATTGGTTTTGGTCATCCGGTTTACACCATCGCTGACC
CGCGCCACCAGGTGATTAAACGTGTGGCGAAGCAGCTCTCGCAGGAAGGCGGCTCGCTGA
AGATGTACAACATCGCCGATCGCCTGGAAACGGTGATGTGGGAGAGCAAAAAGATGTTCC
CCAATCTCGACTGGTTCTCTGCTGTTTCCTACAACATGATGGGCGTTCCCACCGAGATGT
TCACACCACTGTTTGTTATCGCCCGCGTCACCGGCTGGGCGGCGCACATTATCGAACAAC
GTCAGGACAACAAAATTATCCGTCCTTCCGCCAATTATGTTGGACCGGAAGACCGCCCGT
TTGTCGCGCTGGATAAGCGCCAGTAAACCTCTACGAATAACAATAAGGAAACGTACCCAA
TGTCAGCTCAAATCAACAACATCCGCCCGGAATTTGATCGTGAAATCGTTGATATCGTCG
ATTACGTCATGAACTACGAAATCAGCTCTAAAGTGGCCTACGACACCGCACATTACTGCC
TGCTCGACACGCTCGGCTGCGGTCTGGAAGCTCTCGAATACCCGGCCTGTAAAAAACTGC
TGGGGCCAATTGTTCCCGGCACCGTCGTACCCAACGGCGTGCGCGTCCCCGGAACTCAGT
TCCAGCTCGACCCCGTCCAGGCGGCATTTAACATCGGCGCGATGATCCGCTGGCTCGATT
TCAACGATACCTGGCTGGCGGCGGAGTGGGGCCATCCTTCCGACAACCTCGGCGGCATTC
TGGCAACGGCGGACTGGCTTTCGCGCAACGCGGTCGCCAGCGGCAAAGCGCCGTTGACCA
TGAAACAGGTGCTGACCGCAATGATCAAAGCCCATGAAATTCAGGGCTGCATCGCGCTGG
AAAACTCCTTTAACCGCGTCGGCCTCGACCACGTTCTGTTAGTGAAAGTGGCTTCCACCG
CCGTGGTCGCCGAAATGCTCGGCCTGACCCGCGAGGAAATTCTCAACGCCGTTTCGCTGG
CGTGGGTGGACGGTCAGTCGCTGCGCACCTATCGCCATGCGCCGAACACCGGCACGCGTA
AATCCTGGGCGGCGGGCGATGCCACTTCCCGCGCGGTACGTCTGGCACTGATGGCGAAAA
CGGGCGAAATGGGTTACCCGTCAGCCCTGACTGCGCCGGTGTGGGGCTTCTACGACGTCT
CCTTTAAAGGTGAATCGTTCCGCTTCCAGCGCCCGTACGGTTCCTACGTTATGGAAAATG
TGCTGTTCAAAATCTCCTTCCCGGCGGAGTTCCACTCCCAGACGGCAGTTGAAGCAGCGA
TGACGCTCTATGAACAGATGCAGGCAGCAGGCAAAACGGCGGCGGATATCGAAAAAGTGA
CCATTCGCACCCACGAAGCCTGTATTCGCATCATCGACAAAAAAGGGCCGCTCAATAACC
CGGCAGACCGCGATCACTGCATTCAGTACATGGTGGCGATCCCGCTGCTATTCGGGCGCT
TAACGGCGGCAGATTACGAGGACAACGTTGCGCAAGATAAACGCATTGACGCCCTGCGCG
AGAAGATCAATTGCTTTGAAGATCCGGCATTTACCGCTGACTACCACGACCCGGAAAAAC
GCGCCATCGCCAATGCCATTACCCTTGAGTTCACCGACGGCACACGATTTGAAGAAGTGG
TGGTGGAGTACCCCATTGGTCATGCTCGCCGCCGTCAGGATGGTATTCCGAAACTGGTCG
ATAAATTCAAAATCAATCTCGCGCGCCAGTTCCCGACTCGCCAACAGCAGCGCATTCTGG
AGGTTTCTCTCGACAGAGCTCGCCTGGAACAGATGCCGGTCAATGAGTATCTCGACCTGT
ACGTCATTTAAGTAAACGGCGGTAAGGCGTAAGTTCAACAGGAGAGCATTATGTCTTTTA
GCGAATTTTATCAGCGTTCGATTAACGAACCGGAGCAGTTCTGGGCCGAGCAGGCCCGGC
GTATTGACTGGCAGACGCCCTTTACGCAAACGCTCGATCACAGCAATCCGCCGTTTGCCC
GTTGGTTTTGTGAAGGCCGAACCAACTTGTGCCACAACGCCATCGACCGCTGGCTGGAGA
AACAGCCAGAGGCGCTGGCGCTGATTGCCGTCTCTTCGGAAACAGAAGAAGAGCGCACCT
TTACCTTTCGTCAGCTGCATGACGAAGTGAACGCGGTGGCCTCAATGTTGCGTTCATTGG
GTGTGCAGCGCGGCGATCGGGTGCTGGTGTATATGCCGATGATTGCCGAAGCGCATATTA
CTCTGCTGGCCTGCGCGCGCATTGGCGCTATTCACTCGGTGGTGTTTGGTGGATTTGCCT
CGCACAGCGTGGCGGCGCGAATTGATGACGCTAAACCGGTGCTGATTGTCTCGGCTGATG
CCGGAGCGCGCGGTGGCAAAATCATTCCCTATAAAAAATTGCTCGACGATGCGATAAGTC
AGGCGCAGCACCAGCCACGCCATGTTTTGCTGGTGGATCGCGGGCTGGCGAAAATGGCGC
GCGTCAGCGGGCGGGATGTCGATTTCGCGTCGTTGCGCCATCAACACATCGGCGCGCGGG
TACCGGTGGCGTGGCTGGAATCCAACGAAACCTCCTGCATTCTCTACACTTCCGGCACGA
CCGGCAAACCTAAAGGCGTGCAGCGTGACGTCGGCGGATATGCGGTGGCGCTGGCGACCT
CGATGGACACCATTTTTGGCGGCAAAGCGGGCAGCGTGTTCTTTTGCGCATCGGATATCG
GCTGGGTGGTGGGGCATTCGTATATCGTTTACGCGCCGCTGCTGGCGGGGATGGCGACTA
TCGTTTACGAAGGATTGCCGACCTGGCCGGACTGCGGCGTGTGGTGGACAATCGTCGAGA
AATATCAGGTTAGCCGGATGTTCTCAGCGCCGACCGCCATTCGCGTGCTGAAAAAATTCC
CTACCGCTGAAATTCGCAAACACGATCTCTCGTCGCTGGAAGTGCTCTATCTGGCTGGAG
AACCGCTGGACGAGCCGACCGCCAGTTGGGTGAGCAATACGCTGGATGTGCCGGTCATCG
ACAACTACTGGCAGACCGAATCCGGCTGGCCGATTATGGCGATTGCTCGCGGTCTGGACG
ACAGGCCGACGCGTCTGGGAAGCCCCGGTGTGCCGATGTATGGCTATAACGTGCAGTTGC
TTAATGAAGTCACCGGCGAACCGTGTGGCGTCAACGAGAAAGGGATGCTGGTGGTGGAAG
GGCCGCTGCCGCCGGGGTGTATTCAGACCATCTGGGGCGACGACGGCCGCTTTGTGAAGA
CTTACTGGTCGCTGTTTTCCCGCCCGGTGTACGCCACCTTTGACTGGGGCATCCGTGACG
CTGACGGTTATCACTTTATTCTCGGGCGCACTGACGATGTAATTAACGTTGCCGGGCATC
GGCTGGGGACGCGCGAGATTGAAGAGAGTATCTCCAGCCATCCGGGCGTTGCCGAAGTGG
CGGTGGTTGGGGTGAAAGATGCGCTGAAAGGGCAGGTGGCGGTGGCGTTTGTCATTCCGA
AAGAGAGCGACAGTCTGGAAGATCGTGATGTGGCGCACTCGCAAGAGAAGGCGATTATGG
CGCTGGTGGACAGCCAGATTGGCAACTTTGGCCGCCCGGCGCACGTCTGGTTTGTCTCGC
AATTGCCAAAAACGCGATCCGGAAAAATGCTGCGCCGCACGATCCAGGCGATTTGCGAAG
GACGCGATCCTGGAGATCTGACGACCATTGATGATCCTGCGTCGTTGGATCAGATCCGCC
AGGCGATGGAAGAGTAGGTTATTGTCGGATGCGTCGCGCGGTGCATCCGGCACTGTGTGC
CGATGCCTGATGCGACGCTGACGCGTTTTATCATGCCTACGGACCTGAACCGTAGGTCGG
ATAAGGCGCTCGCGTCGCATCCGACACCATGCTCAGATGCCTGATGCGACGCTGACGCGT
CTTATCAGGCCTACCCACTGTTTTTACACCGATAATTTTTCCCCCACCTTTTTGCACTCA
TTCATATAAAAAATATATTTCCCCACGAAAACGATTGCTTTTTATCTTCAGATGAATAGA
ATGCGGCGGATTTTTTGGGTTTCAAACAGCAAAAAGGGGGAATTTCGTGTCGCAAGATAA
CAACTTTAGCCAGGGGCCAGTCCCGCAGTCGGCGCGGAAAGGGGTATTGGCATTGACGTT
CGTCATGCTGGGATTAACCTTCTTTTCCGCCAGTATGTGGACCGGCGGCACTCTCGGAAC
CGGTCTTAGCTATCATGATTTCTTCCTCGCAGTTCTCATCGGTAATCTTCTCCTCGGTAT
TTACACTTCATTTCTCGGTTACATTGGCGCAAAAACCGGCCTGACCACTCATCTTCTTGC
TCGCTTCTCGTTTGGTGTTAAAGGCTCATGGCTGCCTTCACTGCTACTGGGCGGAACTCA
GGTTGGCTGGTTTGGCGTCGGTGTGGCGATGTTTGCCATTCCGGTGGGTAAGGCAACCGG
GCTGGATATTAATTTGCTGATTGCCGTTTCCGGTTTACTGATGACCGTCACCGTCTTTTT
TGGCATTTCGGCGCTGACGGTTCTTTCGGTGATTGCGGTTCCGGCTATCGCCTGCCTGGG
CGGTTATTCCGTGTGGCTGGCTGTTAACGGCATGGGCGGCCTGGACGCATTAAAAGCGGT
CGTTCCCGCACAACCGTTAGATTTCAATGTCGCGCTGGCGCTGGTTGTGGGGTCATTTAT
CAGTGCGGGTACGCTCACCGCTGACTTTGTCCGGTTTGGTCGCAATGCCAAACTGGCGGT
GCTGGTGGCGATGGTGGCCTTTTTCCTCGGCAACTCGTTGATGTTTATTTTCGGTGCAGC
GGGCGCTGCGGCACTGGGCATGGCGGATATCTCTGATGTGATGATTGCTCAGGGCCTGCT
GCTGCCTGCGATTGTGGTGCTGGGGCTGAATATCTGGACCACCAACGATAACGCACTCTA
TGCGTCGGGTTTAGGTTTCGCCAACATTACCGGGATGTCGAGCAAAACCCTTTCGGTAAT
CAACGGTATTATCGGTACGGTCTGCGCATTATGGCTGTATAACAATTTTGTCGGCTGGTT
GACCTTCCTTTCGGCAGCTATTCCTCCAGTGGGTGGCGTGATCATCGCCGACTATCTGAT
GAACCGTCGCCGCTATGAGCACTTTGCGACCACGCGTATGATGAGTGTCAATTGGGTGGC
GATTCTGGCGGTCGCCTTGGGGATTGCTGCAGGCCACTGGTTACCGGGAATTGTTCCGGT
CAACGCGGTATTAGGTGGCGCGCTGAGCTATCTGATCCTTAACCCGATTTTGAATCGTAA
AACGACAGCAGCAATGACGCATGTGGAGGCTAACAGTGTCGAATAACGCTTTACAAACAA
TTATTAACGCCCGGTTACCAGGCGAAGAGGGGCTGTGGCAGATTCATCTGCAGGACGGAA
AAATCAGCGCCATTGATGCGCAATCCGGCGTGATGCCCATAACTGAAAACAGCCTGGATG
CCGAACAAGGTTTAGTTATACCGCCGTTTGTGGAGCCACATATTCACCTGGACACCACGC
AAACCGCCGGACAACCGAACTGGAATCAGTCCGGCACGCTGTTTGAAGGCATTGAACGCT
GGGCCGAGCGCAAAGCGTTATTAACCCATGACGATGTGAAACAACGCGCATGGCAAACGC
TGAAATGGCAGATTGCCAACGGCATTCAGCATGTGCGTACCCATGTCGATGTTTCGGATG
CAACGCTAACTGCGCTGAAAGCAATGCTGGAAGTGAAGCAGGAAGTCGCGCCGTGGATTG
ATCTGCAAATCGTCGCCTTCCCTCAGGAAGGGATTTTGTCGTATCCCAACGGTGAAGCGT
TGCTGGAAGAGGCGTTACGCTTAGGGGCAGATGTAGTGGGGGCGATTCCGCATTTTGAAT
TTACCCGTGAATACGGCGTGGAGTCGCTGCATAAAACCTTCGCCCTGGCGCAAAAATACG
ACCGTCTCATCGACGTTCACTGTGATGAGATCGATGACGAGCAGTCGCGCTTTGTCGAAA
CCGTTGCTGCCCTGGCGCACCATGAAGGCATGGGCGCGCGAGTCACCGCCAGCCACACCA
CGGCAATGCACTCCTATAACGGGGCGTATACCTCACGCCTGTTCCGCTTGCTGAAAATGT
CCGGTATTAACTTTGTCGCCAACCCGCTGGTCAATATTCATCTGCAAGGACGTTTCGATA
CGTATCCAAAACGTCGCGGCATCACGCGCGTTAAAGAGATGCTGGAGTCCGGCATTAACG
TCTGCTTTGGTCACGATGATGTCTTCGATCCGTGGTATCCGCTGGGAACGGCGAATATGC
TGCAAGTGCTGCATATGGGGCTGCATGTTTGCCAGTTGATGGGCTACGGGCAGATTAACG
ATGGCCTGAATTTAATCACCCACCACAGCGCAAGGACGTTGAATTTGCAGGATTACGGCA
TTGCCGCCGGAAACAGCGCCAACCTGATTATCCTGCCGGCTGAAAATGGGTTTGATGCGC
TGCGCCGTCAGGTTCCGGTACGTTATTCGGTACGTGGCGGCAAGGTGATTGCCAGCACAC
AACCGGCACAAACCACCGTATATCTGGAGCAGCCAGAAGCCATCGATTACAAACGTTGAA
CGACTGGGTTACAGCGAGCTTAGTTTATGCCGGATGCGGCGTGAACGCCTTATCCGGCCT
ACGTAGAGCACTGAACTCGTAGGCCTGATAAGCGTAGCGCATCAGGCAATTCCAGCCGCT
GATCTGTGTCAGCGGCTACCGTGATTCATTCCCGCCAACAACCGCGCATTCCTCCAACGC
CATGTGCAAAAATGCCTTCGCAGCGGCTGTCTGCCAGCTGTAGTTTATGCCGGATGCGGC
GTGAACGCCTTATCCGGCCTACGTAGAGCACTGAACTCGTAGGCCTGATAAGCGTAGCGC
ATCAGGCAATTCCAGCCGCAGACCTGTGTCAGCGGCTACCGTGATTCATTTCCGCCAACA
ACCGCGCATTTATCCAACGCCATGTGCAAAAATGCCTTCGCGGCGGCTGTCTGCCAGCTA
TTTTTCCGCCGCAACAAAACCGCCGTTCTCTCCAGTAGTGGCGGGGCAAGAGAAATAGCT
TTAAGCCCGTCATGTTGTGTGGCAATCGCTGCTGGTAACAATGTGGAAAGGGAAGTGCGG
CGAATCAGCTCCAGAACCGCGCTAATTGAGTTCGCCTCAATGACCACCTGTGGATGTAGC
CCCGCTTTCTCGCAGTAGTGGTCAATTTGCTCTCTGGTGGCAAATTCCGCGCTGAGCAGG
ACCAGTTTTTCATCATGCAAGCGACTCAACGCCACCTGTTCATGGACGGCCAGCGGATGA
TGTTGCGCCACGACTAACGCTAAACTTTCTGTCAGTAAAGGAATTGCCTCCAGCTCCGGC
GAATGCACAGGCGCGAAGGCAATCCCAACGTCCAACTCGTCGCGGCAAAGCATATCCTCG
ATTTTCTCCTGCGACATTTCCTGTAGCTGGAGCGTGATGCTGGGATAGCGCGCATAGAAA
TCCGCCATTAAGGGGCCGATAAAGTAGCTCGTAAAGGTGGGGGTGACGGCGATACGCAGC
GATCCTCGCGTCAGATCGGCAACATCATGAATCGCCCGTTTACCCGCCCCCAGTTCCTGT
AACGCCCGGCTGGCGTACTGTCGCCAGACTTCTCCTGCATCAGTGAGACGAATCGTTCGC
CCGCTACGGTCAAACAGCGGCACGCCTAAACTCTCCTCTAACTGGCGAATCTGCTGGGAA
AGCGCAGGTTGGGAGACGTGCAACGCACTGGCGGCACGGGTGAAGCTGCCATGTTCAGCC
ACGGCAAGAAAATAATTGATATGTCGAGAGAGCATTCGCAACCTATAAGTAAATCCAATG
GAACTCATCATAAATGAGACTTTTACCTTATGACAATCGGCGAGTAGTCTGCCTCTCATT
CCAGAGACAGACAGAGGTTAACGGTGAAAGAGATTATTGATGGATTCCTTAAATTCCAGC
GCGAGGCATTTCCGAAGCGGGAAGCCTTGTTTAAACAGCTGGCGACACAGCAAAGCCCGC
GCACACTTTTTATCTCCTGCTCCGACAGCCGTCTGGTCCCTGAGCTGGTGACGCAACGTG
AGCCTGGCGATCTGTTCGTTATTCGCAACGCGGGCAATATCGTCCCTTCCTACGGGCCGG
AACCCGGTGGCGTTTCTGCTTCGGTGGAGTATGCCGTCGCTGCGCTTCGGGTATCTGACA
TTGTGATTTGTGGTCATTCCAACTGTGGCGCGATGACCGCCATTGCCAGCTGTCAGTGCA
TGGACCATATGCCTGCCGTCTCCCACTGGCTGCGTTATGCCGATTCAGCCCGCGTCGTTA
ATGAGGCGCGCCCGCATTCCGATTTACCGTCAAAAGCTGCGGCGATGGTACGTGAAAACG
TCATTGCTCAGTTGGCTAATTTGCAAACTCATCCATCGGTGCGCCTGGCGCTCGAAGAGG
GGCGGATCGCCCTGCACGGCTGGGTCTACGACATTGAAAGCGGCAGCATCGCAGCTTTTG
ACGGCGCAACCCGCCAGTTTGTGCCACTGGCCGCTAATCCTCGCGTTTGTGCCATACCGC
TACGCCAACCGACCGCAGCGTAACCTTATTTTTAAACCATCAGGAGTTCCACCATGATTC
AGTCACAAATTAACCGCAATATTCGTCTTGATCTTGCCGATGCCATTTTGCTCAGCAAAG
CTAAAAAAGATCTCTCATTTGCCGAGATTGCCGACGGCACCGGTCTGGCAGAAGCCTTTG
TAACCGCGGCTTTGCTGGGTCAGCAGGCGCTTCCTGCCGACGCCGCCCGCCTGGTCGGGG
CGAAGCTGGATCTCGACGAAGACTCCATTCTACTGTTGCAGATGATTCCACTGCGTGGCT
GCATTGATGACCGTATTCCAACTGACCCAACGATGTATCGTTTCTATGAAATGTTGCAGG
TGTACGGTACAACCCTGAAAGCGTTGGTTCATGAGAAATTTGGCGATGGCATTATTAGCG
CGATTAACTTCAAACTCGACGTTAAGAAAGTGGCGGACCCGGAAGGTGGCGAACGTGCGG
TCATCACCTTAGATGGTAAATATCTGCCGACCAAACCGTTCTGACAGCCATGCGCAACCA
TCAAAAGACGTTCACGATGCTGCTGGTACTGGTGCTGATTGGTCTTAATATGCGACCACT
GCTCACCTCCGTCGGGCCACTGCTACCGCAATTGCGCCAGGCGAGCGGAATGAGCTTTAG
CGTGGCTGCCCTGTTGACCGCTCTGCCGGTGGTTACCATGGGCGGGCTGGCGCTGGCCGG
AAGCTGGCTTCATCAGCATGTCAGCGAACGTCGCAGTGTCGCCATCAGTCTGTTGCTGAT
TGCCGTCGGTGCATTGATGCGTGAGCTTTACCCGCAAAGTGCGCTGCTGCTTAGCAGCGC
ACTGCTTGGTGGGGTGGGGATCGGCATCATTCAGGCGGTGATGCCTTCGGTGATTAAACG
GCGGTTTCAGCAGCGCACGCCACTGGTGATGGGGCTGTGGTCCGCGGCTCTGATGGGCGG
CGGTGGGCTTGGTGCCGCCATAACGCCCTGGTTAGTTCAACATAGCGAAACCTGGTATCA
AACACTCGCCTGGTGGGCGCTGCCTGCCGTTGTTGCGCTCTTTGCCTGGTGGTGGCAAAG
CGCCCGCGAGGTCGCCTCTTCCCACAAGACAACAACCACTCCGGTTCGCGTGGTATTCAC
TCCCCGCGCGTGGACGCTGGGTGTTTACTTCGGTCTGATTAACGGCGGTTACGCCAGCCT
GATTGCCTGGTTACCCGCTTTCTATATTGAGATTGGTGCCAGCGCGCAGTACAGCGGTTC
CTTACTGGCATTGATGACGCTTGGGCAAGCCGCAGGAGCTTTGCTGATGCCTGCTATGGC
TCGCCATCAGGATCGGCGCAAACTGTTAATGCTGGCGCTGGTGTTACAACTGGTGGGGTT
CTGCGGCTTTATCTGGCTGCCGATGCAATTGCCGGTATTGTGGGCGATGGTGTGTGGGTT
AGGTCTGGGCGGCGCGTTTCCGCTCTGTTTGCTGCTGGCGCTCGATCACTCTGTGCAACC
GGCTATTGCTGGCAAGCTGGTGGCGTTTATGCAGGGAATCGGTTTTATCATCGCCGGGCT
TGCCCCGTGGTTTTCTGGCGTGCTGCGTAGTATCAGCGGCAATTACCTGATGGACTGGGC
ATTTCATGCGCTGTGCGTCGTTGGGCTGATGATCATAACCCTGCGTTTTGCACCAGTACG
TTTTCCGCAGCTGTGGGTCAAAGAGGCATGATGCGACGCTTGTTCCTGCGCTTTGTTCAT
GCCGGATGCGGCTAATGTAGATCGCTGAACTTGTAGGCCTGATAAGCGCAGCGTATCAGG
CAATTTTTATAATTTAAACTGACGATTCAACTTTATAATCTTTGAAATAATAGTGCTTAT
CCCGGTCGTTTATTTCGCGAATAACCCGACAAGGAACGCCAGCCGCCACGACGTTTGGTG
GAATGTCTTTTGTGACGATACTACCCGCGCCAATAACAGAATTATCCCCGATGGTGACGC
CTGGATTAATAACCACATGACTTCCGATCCAGACGTTATTGCCAATCGTTATCGGAAAAG
AGTACATCTCGCCGTTTTTTCTCAATTCATGGTGTACAGGGTGTCCCGTAACGGAAAGAG
TAACGTTGGGTGCAATCAGTACGTTATCACCGATTGTTACCGTGTAGTCATCGACAATGG
TTAAATTGAAATTTGCATAAAAATTGCGGCCTATATGGATGTTGGAACCGTAAGAGAAAT
AGACAGGCGGTTCTACCCAGGCGTTTTCCCCTACCGTGGCAAACATTTCTTTAATCAGGC
TTTCTCTTTTTTCAACTTCTGATGGATGCGAGTGATTAAACTCATACATTAACGTTTTCC
CACGAAGTCTTTTTTCCGGTAAGCCTTCGCACATATCGGTAAATAGCTTGCCTGCTCTTA
TTCTTTCGGTCATTGGCATGTTCAATGCGATCACTCCGTTATGATATGTTGGTCGGATAA
GGCGCTCGCGCCGCATCCGACATTGATTGCTTAAGCGACTTCATTCACCTGACGACGCAG
CAGGGAAAGCGGGCCGGGGCCGCTAAGCGTGAACACGGAAATTAAGGTGAAGCCCAGCGC
CACCAGACCCAGCACCAGATAAGCGCCCTGGAAACCGATGCTTTCATACATATTGCCCGC
CAGTACAGACATAAAAATCATCGCCAGTTGCTTAAAGAAGCAGAAACAGACCAGATAAAT
CGTCGCTGAAAAACGCACTTCAAACTGGCTGGTAATATATTTAAAGCAGCCCACCAGCAG
GAACGGTACTTCAAACATATGCAGCGTTTTCAGAATAACCACTTCCAGCGCTGAGGTGGC
GAACGATGAGCCAATAATACGTACAGACATAATAGTGCCAGCCAGCAGCAGGGCGTTTTT
CCCACCGATGCGATTAATGATCAGTGGCGCAAAGAACATAATCGAGGCGTTAAGTAATTC
GCCCATTGTCGTTACGTAGCCAAATACCCGCGTACCCTGTTCACCGGTAGCAAAGAACGA
AGTAAAGAAATTAGCAAACTGTTGGTCAAAAACATCGTAGGTGCAGGAAACGCCAATAAC
ATACAGTGACAAAAACCACAGTTTTGGCTGTCTGAACAGTTCCAGTGCCAGCTTAAGGCT
AAATGCCGAATGGTTGGCACCTACCGCATTGGCAACCGTGGCAGAAGAGGGCGCATCCGT
TTTGGCGAAAAAGAGTAAAACGGCGAGGATGAGTGCACAGCCAGAGCCCAGCCAGAAAAC
AAACTGATTATTGATGGTGAACATGATGCCGACAATCGAGGCACACAGCGCCCAGCCAAC
ACAGCCAAACATCCGCGCGCGACCAAATTCGAAATTACTGCGACGGCTGACTTTCTCAAT
AAATGCCTCTACTGCTGGCGCACCGGCGTTAAAACAAAAGCCTAGATAAATACCACCAAC
AATCGATCCTACTAAAATGTTGTATTGTAACAGTGGCCCGAAGATAAAAATAAAGAACGG
CGCAAACATCACTAACATGCCGGTAATAATCCACAGCAGGTATTTGCGCAGCCCGAGTTT
GTCAGAAAGCAGACCAAACAGCGGTTGGAATAATAGCGAGAACAGAGAAATAGCGGCAAA
AATAATACCCGTATCACTTTTGCTGATATGGTTGATGTCATGTAGCCAAATCGGGAAAAA
CGGGAAGTAGGCTCCCATGATAAAAAAGTAAAAGAAAAAGAATAAACCGAACATCCAAAA
GTTTGTGTTTTTTAAATAGTACATAATGGATTTCCTTACGCGAAATACGGGCAGACATGG
CCTGCCCGGTTATTATTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCT
CAGCTGGAATTCCGCCGATACTGACGGGCTCCAGGAGTCGTCGCCACCAATCCCCATATG
GAAACCGTCGATATTCAGCCATGTGCCTTCTTCCGCGTGCAGCAGATGGCGATGGCTGGT
TTCCATCAGTTGCTGTTGACTGTAGCGGCTGATGTTGAACTGGAAGTCGCCGCGCCACTG
GTGTGGGCCATAATTCAATTCGCGCGTCCCGCAGCGCAGACCGTTTTCGCTCGGGAAGAC
GTACGGGGTATACATGTCTGACAATGGCAGATCCCAGCGGTCAAAACAGGCGGCAGTAAG
GCGGTCGGGATAGTTTTCTTGCGGCCCTAATCCGAGCCAGTTTACCCGCTCTGCTACCTG
CGCCAGCTGGCAGTTCAGGCCAATCCGCGCCGGATGCGGTGTATCGCTCGCCACTTCAAC
ATCAACGGTAATCGCCATTTGACCACTACCATCAATCCGGTAGGTTTTCCGGCTGATAAA
TAAGGTTTTCCCCTGATGCTGCCACGCGTGAGCGGTCGTAATCAGCACCGCATCAGCAAG
TGTATCTGCCGTGCACTGCAACAACGCTGCTTCGGCCTGGTAATGGCCCGCCGCCTTCCA
GCGTTCGACCCAGGCGTTAGGGTCAATGCGGGTCGCTTCACTTACGCCAATGTCGTTATC
CAGCGGTGCACGGGTGAACTGATCGCGCAGCGGCGTCAGCAGTTGTTTTTTATCGCCAAT
CCACATCTGTGAAAGAAAGCCTGACTGGCGGTTAAATTGCCAACGCTTATTACCCAGCTC
GATGCAAAAATCCATTTCGCTGGTGGTCAGATGCGGGATGGCGTGGGACGCGGCGGGGAG
CGTCACACTGAGGTTTTCCGCCAGACGCCACTGCTGCCAGGCGCTGATGTGCCCGGCTTC
TGACCATGCGGTCGCGTTCGGTTGCACTACGCGTACTGTGAGCCAGAGTTGCCCGGCGCT
CTCCGGCTGCGGTAGTTCAGGCAGTTCAATCAACTGTTTACCTTGTGGAGCGACATCCAG
AGGCACTTCACCGCTTGCCAGCGGCTTACCATCCAGCGCCACCATCCAGTGCAGGAGCTC
GTTATCGCTATGACGGAACAGGTATTCGCTGGTCACTTCGATGGTTTGCCCGGATAAACG
GAACTGGAAAAACTGCTGCTGGTGTTTTGCTTCCGTCAGCGCTGGATGCGGCGTGCGGTC
GGCAAAGACCAGACCGTTCATACAGAACTGGCGATCGTTCGGCGTATCGCCAAAATCACC
GCCGTAAGCCGACCACGGGTTGCCGTTTTCATCATATTTAATCAGCGACTGATCCACCCA
GTCCCAGACGAAGCCGCCCTGTAAACGGGGATACTGACGAAACGCCTGCCAGTATTTAGC
GAAACCGCCAAGACTGTTACCCATCGCGTGGGCGTATTCGCAAAGGATCAGCGGGCGCGT
CTCTCCAGGTAGCGAAAGCCATTTTTTGATGGACCATTTCGGCACAGCCGGGAAGGGCTG
GTCTTCATCCACGCGCGCGTACATCGGGCAAATAATATCGGTGGCCGTGGTGTCGGCTCC
GCCGCCTTCATACTGCACCGGGCGGGAAGGATCGACAGATTTGATCCAGCGATACAGCGC
GTCGTGATTAGCGCCGTGGCCTGATTCATTCCCCAGCGACCAGATGATCACACTCGGGTG
ATTACGATCGCGCTGCACCATTCGCGTTACGCGTTCGCTCATCGCCGGTAGCCAGCGCGG
ATCATCGGTCAGACGATTCATTGGCACCATGCCGTGGGTTTCAATATTGGCTTCATCCAC
CACATACAGGCCGTAGCGGTCGCACAGCGTGTACCACAGCGGATGGTTCGGATAATGCGA
ACAGCGCACGGCGTTAAAGTTGTTCTGCTTCATCAGCAGGATATCCTGCACCATCGTCTG
CTCATCCATGACCTGACCATGCAGAGGATGATGCTCGTGACGGTTAACGCCTCGAATCAG
CAACGGCTTGCCGTTCAGCAGCAGCAGACCATTTTCAATCCGCACCTCGCGGAAACCGAC
ATCGCAGGCTTCTGCTTCAATCAGCGTGCCGTCGGCGGTGTGCAGTTCAACCACCGCACG
ATAGAGATTCGGGATTTCGGCGCTCCACAGTTTCGGGTTTTCGACGTTCAGACGTAGTGT
GACGCGATCGGCATAACCACCACGCTCATCGATAATTTCACCGCCGAAAGGCGCGGTGCC
GCTGGCGACCTGCGTTTCACCCTGCCATAAAGAAACTGTTACCCGTAGGTAGTCACGCAA
CTCGCCGCACATCTGAACTTCAGCCTCCAGTACAGCGCGGCTGAAATCATCATTAAAGCG
AGTGGCAACATGGAAATCGCTGATTTGTGTAGTCGGTTTATGCAGCAACGAGACGTCACG
GAAAATGCCGCTCATCCGCCACATATCCTGATCTTCCAGATAACTGCCGTCACTCCAGCG
CAGCACCATCACCGCGAGGCGGTTTTCTCCGGCGCGTAAAAATGCGCTCAGGTCAAATTC
AGACGGCAAACGACTGTCCTGGCCGTAACCGACCCAGCGCCCGTTGCACCACAGATGAAA
CGCCGAGTTAACGCCATCAAAAATAATTCGCGTCTGGCCTTCCTGTAGCCAGCTTTCATC
AACATTAAATGTGAGCGAGTAACAACCCGTCGGATTCTCCGTGGGAACAAACGGCGGATT
GACCGTAATGGGATAGGTCACGTTGGTGTAGATGGGCGCATCGTAACCGTGCATCTGCCA
GTTTGAGGGGACGACGACAGTATCGGCCTCAGGAAGATCGCACTCCAGCCAGCTTTCCGG
CACCGCTTCTGGTGCCGGAAACCAGGCAAAGCGCCATTCGCCATTCAGGCTGCGCAACTG
TTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATG
TGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAAC
GACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
TCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAAT
GAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACC
TGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG
GGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACC
GCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAA
TCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTAT
CCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCG
CCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGC
ATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATC
GGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAG
ACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGC
TCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGG
TCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCA
TCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTG
TGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTG
GCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGG
GCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCC
ACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTC
GCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCA
TACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCT
TCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCAACGTAA
ATGCATGCCGCTTCGCCTTCCGGCCACCAGAATAGCCTGCGATTCAACCCCTTCTTCGAT
CTGTTTTGCTACCCGTTGTAGCGCCGGAAGATGCTTTTCCGCTGCCTGTTCAATGGTCAT
TGCGCTCGCCATATACACCAGATTCAGACAGCCAATCACCCGTTGTTCACTGCGCAGCGG
TACGGCGATAGAGGCGATCTTCTCCTCCTGATCCCAGCCGCGGTAGTTCTGTCCGTAACC
CTCTTTGCGCGCGCGCGCCAGAATGGCTTCCAGCTTTAACGGTTCCCGTGCCAGTTGATA
GTCATCACCGGGGCGGGAGGCTAACATTTCGATTAATTCCTTGCGGTCTTGTTCCGGGCA
AAAGGCCAGCCAGGTCAGGCCCGAGGCGGTTTTCAGAAGCGGCAAACGTCGCCCGACCAT
TGCCCGGTGAAAGGATAAGCGGCTGAAACGGTGAGTGGTTTCGCGTACCACCATTGCATC
AACATCCAGCGTGGACACATCTGTCGGCCATACCACTTCGCGCAACAGATCGCCCAGCAG
TGGGGCCGCCAGTGCAGAAATCCACTGTTCGTCACGAAATCCTTCGCTTAATTGCCGCAC
TTTGATGGTCAGTCGAAAACTATCATCGGAGGGGCTACGGCGGACATATCCCTCTTCCTG
CAGCGTCTCCAGCAGTCGCCGCACAGTGGTGCGATGCAGGCCGCTGAGTTCCGCCAGCAG
CCCGACGCTGGCACCGCCATCAAGTTTATTTAACATATTTAATAACATTAGACCGCGGGT
TAAGCCGCGCACGGTTTTGTATTCCGTCTGCTCATTGTTCTGCATATTAATTGACATTTC
TATAGTTAAAACAACGTGGTGCACCTGGTGCACATTCGGGCATGTTTTGATTGTAGCCGA
AAACACCCTTCCTATACTGAGCGCACAATAAAAAATCATTTACATGTTTTTAACAAAATA
AGTTGCGCTGTACTGTGCGCGCAACGACATTTTGTCCGAGTCGTGAGGTACTGAAATGGC
AATACAACACCCTGACATCCAGCCTGCTGTTAACCATAGCGTTCAGGTGGCGATCGCTGG
TGCCGGCCCGGTTGGGCTGATGATGGCGAACTATCTCGGCCAGATGGGCATTGACGTGCT
GGTGGTGGAGAAACTCGATAAGTTGATCGACTACCCGCGTGCGATTGGTATTGATGACGA
GGCGCTGCGCACCATGCAGTCGGTCGGCCTGGTCGATGATGTTCTGCCGCACACTACGCC
GTGGCACGCGATGCGTTTTCTCACCCCGAAAGGCCGCTGTTTTGCTGATATTCAGCCAAT
GACCGATGAATTTGGCTGGCCGCGCCGTAACGCCTTTATTCAGCCGCAGGTCGATGCGGT
GATGCTGGAAGGGGTGTCGCGTTTTCCGAATGTGCGCTGCTTGTTTTCCCGCGAGCTGGA
GGCCTTCAGTCAGCAAGATGACGAAGTGACCTTGCACCTGAAAACGGCAGAAGGGCAGCG
GGAAATAGTCAAAGCCCAGTGGCTGGTAGCCTGTGACGGTGGAGCAAGTTTTGTCCGTCG
CACTCTGAATGTGCCGTTTGAAGGTAAAACTGCGCCAAATCAGTGGATTGTGGTAGATAT
CGCCAACGATCCGTTAAGTACGCCGCATATCTATTTGTGTTGCGATCCGGTGCGCCCGTA
TGTTTCTGCCGCGCTGCCTCATGCGGTACGTCGCTTTGAATTTATGGTGATGCCGGGAGA
AACCGAAGAGCAGCTGCGTGAGCCGCAAAATATGCGCAAGCTGTTAAGCAAAGTGCTGCC
TAATCCGGACAATGTTGAATTGATTCGCCAGCGTGTCTACACCCACAACGCGCGACTGGC
GCAACGTTTCCGTATTGATCGCGTACTGCTGGCGGGCGATGCCGCGCACATCATGCCGGT
ATGGCAGGGGCAGGGCTATAACAGTGGTATGCGCGACGCCTTTAACCTCGCATGGAAACT
GGCGTTGGTTATCCAGGGGAAAGCCCGCGATGCGCTGCTCGATACCTATCAACAAGAACG
TCGCGATCACGCCAAAGCGATGATTGACCTGTCCGTGACGGCGGGCAACGTGCTGGCTCC
GCCGAAACGCTGGCAGGGTACGTTACGTGACGGCGTTTCCTGGCTGTTGAATTATCTGCC
GCCAGTAAAACGCTACTTCCTCGAAATGCGCTTCAAGCCGATGCCGCAATATTACGGCGG
TGCGCTGATGCGTGAGGGCGAAGCGAAGCACTCTCCGGTCGGCAAGATGTTTATTCAGCC
GAAAGTCACGCTGGAAAACGGCGACGTGACGCTGCTCGATAACGCGATCGGCGCGAACTT
CGCGGTAATTGGCTGGGGATGCAATCCACTGTGGGGGATGAGCGACGAGCAAATCCAGCA
GTGGCGCGCGTTGGGCACACGCTTCATTCAGGTGGTGCCGGAAGTGCAAATTCATACCGC
ACAGGATAACCACGACGGCGTACTACGCGTGGGCGATACGCAAGGTCGCCTGCGTAGCTG
GTTCGCGCAACACAATGCTTCGCTGGTGGTGATGCGCCCGGATCGCTTTGTTGCCGCCAC
CGCCATTCCGCAAACCCTGGGCAAGACCCTGAATAAACTGGCGTCGGTGATGACGCTGAC
CCGCCCTGATGCCGACGTTTCTGTCGAAAAGGTAGCCTGATATGCACGCTTATCTTCACT
GTCTTTCCCACTCGCCGCTGGTGGGGTATGTCGACCCGGCGCAAGAGGTGCTCGATGAGG
TCAATGGCGTGATTGCCAGCGCCCGCGAGCGTATTGCGGCATTCTCCCCTGAACTGGTGG
TGCTGTTTGCGCCAGATCACTACAACGGCTTTTTCTATGACGTGATGCCACCGTTCTGTT
TAGGCGTTGGAGCGACGGCAATTGGTGATTTCGGCAGTGCGGCAGGAGAGCTGCCCGTGC
CTGTGGAGCTGGCGGAGGCCTGTGCGCATGCCGTCATGAAGAGCGGGATCGATCTTGCCG
TTTCTTACTGTATGCAGGTGGACCACGGGTTCGCCCAGCCGCTGGAGTTCCTGCTCGGTG
GGCTGGATAAGGTGCCAGTTCTGCCTGTGTTCATCAACGGTGTCGCCACGCCGCTGCCCG
GTTTCCAGCGTACCCGCATGTTGGGTGAAGCCATTGGACGTTTCACCAGCACTCTCAATA
AACGCGTGCTGTTCCTGGGTTCCGGTGGGCTTTCCCATCAGCCGCCGGTGCCCGAACTGG
CGAAAGCCGATGCCCATATGCGCGACCGTCTGTTGGGGAGCGGGAAAGATTTACCCGCCA
GTGAGCGCGAATTGCGTCAGCAACGGGTGATTAGCGCCGCTGAGAAGTTTGTTGAGGATC
AGAGAACGCTGCATCCGCTCAACCCGATTTGGGATAACCAGTTCATGACTTTGCTGGAGC
AGGGACGCATACAGGAACTGGATGCCGTCAGTAACGAAGAGCTTTCCGCCATTGCCGGAA
AGTCGACACATGAAATCAAAACCTGGGTCGCCGCTTTTGCCGCTATTTCTGCGTTTGGCA
ACTGGCGTAGCGAAGGGCGTTATTACCGCCCAATCCCGGAGTGGATTGCCGGATTTGGCT
CGTTAAGCGCCAGAACAGAGAACTGAATATGCAGGAGAAGATGATGAGTTATCAGCCACA
AACCGAAGCCGCCACCAGCCGTTTTCTGAATGTAGAAGAAGCGGGTAAAACGCTGCGCAT
CCATTTTAATGACTGCGGACAAGGCGACGAAACCGTTGTCCTGCTGCATGGTTCCGGCCC
GGGTGCTACTGGCTGGGCGAACTTCAGCCGCAATATCGATCCGCTGGTAGAGGCGGGCTA
TCGGGTGATCCTGCTGGATTGTCCGGGTTGGGGCAAGAGCGATTCGGTCGTTAATAGTGG
TTCGCGATCGGATCTTAATGCACGAATCCTGAAAAGCGTGGTGGATCAACTGGATATCGC
CAAAATCCACCTGCTGGGCAACTCGATGGGGGGCCATAGTTCTGTGGCGTTCACCCTTAA
ATGGCCGGAGCGCGTCGGCAAACTGGTGCTGATGGGCGGCGGTACGGGCGGCATGAGTTT
GTTTACGCCGATGCCAACCGAAGGTATTAAGCGACTGAATCAGCTTTATCGTCAGCCGAC
TATCGAAAACCTGAAGCTGATGATGGATATCTTCGTTTTTGATACCAGCGATTTGACCGA
CGCCCTGTTTGAAGCGCGCCTGAATAATATGCTGTCGCGCCGCGATCACCTGGAAAACTT
CGTTAAGAGCCTGGAAGCTAATCCGAAACAGTTCCCGGATTTTGGCCCACGTCTGGCGGA
AATCAAAGCGCAAACCCTGATTGTCTGGGGGCGCAACGACCGCTTTGTGCCGATGGATGC
GGGTCTGCGTCTGCTGTCCGGCATTGCCGGTTCTGAACTGCATATCTTCCGCGACTGTGG
TCACTGGGCGCAGTGGGAACATGCCGACGCTTTCAATCAACTGGTGCTGAATTTCCTCGC
ACGCCCTTAAGGAATGGTCATGACGAAGCATACTCTTGAGCAACTGGCGGCGGATTTACG
CCGCGCCGCAGAGCAGGGCGAAGCGATTGCACCGCTGCGCGATCTGATTGGTATCGATAA
CGCTGAAGCGGCTTACGCCATTCAGCACATAAATGTGCAACATGACGTTGCGCAGGGGCG
TCGCGTGGTAGGGCGTAAAGTGGGCCTGACACATCCGAAAGTGCAACAACAACTGGGCGT
TGATCAACCGGATTTTGGGACGTTATTTGCCGACATGTGTTATGGCGATAACGAAATCAT
TCCTTTTTCCCGTGTTCTGCAACCCCGCATTGAAGCGGAGATCGCACTGGTGTTGAACCG
CGATTTGCCCGCAACCGATATCACCTTCGACGAATTGTATAACGCCATTGAATGGGTACT
TCCGGCGCTGGAAGTGGTGGGGAGCCGCATTCGCGACTGGTCGATTCAGTTTGTCGATAC
CGTGGCAGATAACGCCTCCTGTGGGGTGTATGTCATCGGCGGTCCGGCGCAACGTCCGGC
GGGGTTAGACCTGAAAAACTGCGCCATGAAGATGACGCGTAATAACGAAGAGGTTTCTAG
CGGGCGCGGCAGCGAATGCCTGGGACATCCGCTTAATGCGGCCGTCTGGCTGGCACGCAA
AATGGCCAGTCTGGGTGAACCGCTGCGCACCGGAGATATCATTCTTACCGGGGCATTAGG
TCCGATGGTGGCGGTGAATGCGGGCGATCGTTTTGAAGCCCATATTGAAGGCATAGGTTC
AGTTGCTGCGACATTTTCAAGCGCAGCCCCAAAAGGAAGTCTGTCATGAGTAAGCGTAAA
GTCGCCATTATCGGTTCTGGCAACATTGGTACCGATCTGATGATTAAAATTTTGCGTCAC
GGTCAGCATCTGGAGATGGCGGTGATGGTTGGCATTGATCCTCAGTCCGACGGTCTGGCG
CGCGCCAGACGTATGGGCGTCGCCACCACCCATGAAGGGGTGATCGGACTGATGAACATG
CCTGAATTTGCTGATATCGACATTGTATTTGATGCGACCAGCGCCGGTGCTCATGTGAAA
AACGATGCCGCTTTACGCGAAGCGAAACCGGATATTCGCTTAATTGACCTGACGCCTGCT
GCCATCGGCCCTTACTGCGTGCCGGTGGTTAACCTCGAGGCGAACGTCGATCAACTGAAC
GTCAACATGGTCACCTGCGGCGGCCAGGCCACCATTCCAATGGTGGCGGCAGTTTCACGC
GTGGCGCGTGTTCATTACGCCGAAATTATCGCTTCTATCGCCAGTAAATCTGCCGGACCT
GGCACGCGTGCCAATATCGATGAATTTACGGAAACCACTTCCCGAGCCATTGAAGTGGTG
GGCGGCGCGGCAAAAGGGAAGGCGATTATTGTGCTTAACCCAGCAGAGCCACCGTTGATG
ATGCGTGACACGGTGTATGTATTGAGCGACGAAGCTTCACAAGATGATATCGAAGCCTCA
ATCAATGAAATGGCTGAGGCGGTGCAGGCTTACGTACCGGGTTATCGCCTGAAACAGCGC
GTGCAGTTTGAAGTTATCCCGCAGGATAAACCGGTCAATTTACCGGGCGTGGGGCAATTC
TCCGGACTGAAAACAGCGGTCTGGCTGGAAGTCGAAGGCGCAGCGCATTATCTGCCTGCC
TATGCGGGCAACCTCGACATTATGACTTCCAGTGCGCTGGCGACAGCGGAAAAAATGGCC
CAGTCACTGGCGCGCAAGGCAGGAGAAGCGGCATGAACGGTAAAAAACTTTATATCTCGG
ACGTCACATTGCGTGACGGTATGCACGCCATTCGTCATCAGTATTCGCTGGAAAACGTTC
GCCAGATTGCCAAAGCACTGGACGATGCCCGCGTGGATTCGATTGAAGTGGCCCACGGCG
ACGGTTTGCAAGGTTCCAGCTTTAACTATGGTTTCGGCGCACATAGCGACCTTGAATGGA
TTGAAGCGGCGGCGGATGTGGTGAAGCACGCCAAAATCGCGACGTTGTTGCTGCCAGGAA
TCGGCACTATTCACGATCTGAAAAATGCCTGGCAGGCTGGCGCGCGGGTGGTTCGTGTGG
CAACGCACTGTACCGAAGCTGATGTTTCCGCCCAGCATATTCAGTATGCCCGCGAGCTCG
GAATGGACACCGTTGGTTTTCTGATGATGAGCCATATGACCACGCCGGAGAATCTCGCCA
AGCAGGCAAAGCTGATGGAAGGCTACGGTGCGACCTGTATTTATGTGGTGGATTCTGGCG
GTGCGATGAACATGAGCGATATCCGTGACCGTTTCCGCGCCCTGAAAGCAGAGCTGAAAC
CAGAAACGCAAACTGGCATGCACGCTCACCATAACCTGAGTCTTGGCGTGGCGAACTCTA
TCGCGGCGGTGGAAGAGGGCTGCGACCGAATCGACGCCAGCCTCGCGGGAATGGGCGCGG
GCGCAGGTAACGCACCGCTGGAAGTGTTTATTGCCGCCGCGGATAAACTGGGCTGGCAGC
ATGGGACCGATCTCTATGCGTTAATGGATGCCGCCGACGACCTGGTGCGTCCGTTGCAGG
ATCGACCGGTACGAGTCGATCGCGAAACGCTGGCGCTGGGATACGCTGGTGTTTACTCGA
GCTTCCTGCGTCACTGTGAAACGGCGGCGGCGCGTTATGGCTTAAGTGCGGTGGATATTC
TCGTTGAGCTGGGCAAACGCCGGATGGTTGGCGGCCAGGAGGATATGATCGTTGACGTGG
CGCTGGATCTGCGCAACAACAAATAATGATGACTGCCGAGAACGTGCATTTTGTATGCCC
ATCCCAGCACGACTGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACGGATGGCGTGAG
AATTTGTAGGTCTGATAAGACGCGTTAGCGTCGCATCAGGCATCTGCGCACGACTGCCGG
ATGCGGCGTGAACGCCTTATCCGGCCTACGGATGGCGCGGGAATTTGTAGGCCTGATAAG
ACGCGTTAGCGTCGCATCAGGCATCTGCGCACGACTGCCGGATGCGGCGTGAACGCCTTA
TCCGGCCTACGGGTGGCGCGAGAATTTGTAGGCCTGATAAGACGCGTTAGCGTCGCATCA
GGCATCTGCGCACGACTGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACGGATGGCGC
GGGAATTTGTAGGCCTGATAAGACGCGTTAGCGTCGCATCAGGCATCTGCACACGACTGC
CGGATGCGATAAACGTCTTGTCCGGCCTACATTTCGCCCGTAGGCAGTCATTAAATAGTT
CTGATTACGCGGCTGGCAATGTATCAGTCGCGATTCACCTGCACTCGCAACGAGGTTCAT
CTTATGTCGACTCGTACCCCTTCATCATCTTCATCCCGCCTGATGCTGACCATCGGGCTT
TGTTTTTTGGTCGCTCTGATGGAAGGGCTGGATCTTCAGGCGGCTGGCATTGCGGCGGGT
GGCATCGCCCAGGCTTTCGCACTCGATAAAATGCAAATGGGCTGGATATTTAGCGCCGGA
ATACTCGGTTTGCTACCCGGCGCGTTGGTTGGCGGAATGCTGGCGGACCGTTATGGTCGC
AAGCGCATTTTGATTGGCTCAGTTGCGCTGTTTGGTTTGTTCTCACTGGCAACGGCGATT
GCCTGGGATTTCCCCTCACTGGTCTTTGCGCGGCTGATGACCGGTGTCGGGCTGGGGGCG
GCGTTGCCGAATCTTATCGCCCTGACGTCTGAAGCCGCGGGTCCACGTTTTCGTGGGACG
GCAGTGAGCCTGATGTATTGCGGTGTTCCCATTGGCGCGGCGCTGGCGGCGACACTGGGT
TTCGCGGGGGCAAACTTAGCATGGCAAACGGTGTTTTGGGTAGGTGGTGTGGTGCCGTTG
ATTCTGGTGCCGCTATTAATGCGCTGGCTGCCGGAGTCGGCGGTTTTCGCTGGCGAAAAA
CAGTCTGCGCCACCACTGCGTGCCTTATTTGCGCCAGAAACGGCAACCGCGACGCTGCTG
CTGTGGTTGTGTTATTTCTTCACTCTGCTGGTGGTCTACATGTTGATCAACTGGCTACCG
CTACTTTTGGTGGAGCAAGGATTCCAGCCATCGCAGGCGGCAGGGGTGATGTTTGCCCTG
CAAATGGGGGCGGCAAGCGGGACGTTAATGTTGGGCGCATTGATGGATAAGCTGCGTCCA
GTAACCATGTCGCTACTGATTTATAGCGGCATGTTAGCTTCGCTGCTGGCGCTTGGAACG
GTGTCGTCATTTAACGGTATGTTGCTGGCGGGATTTGTCGCGGGGTTGTTTGCGACAGGT
GGGCAAAGCGTTTTGTATGCCCTGGCACCGTTGTTTTACAGTTCGCAGATCCGCGCAACA
GGTGTGGGAACAGCCGTGGCGGTAGGGCGTCTGGGGGCTATGAGCGGTCCGTTACTGGCC
GGGAAAATGCTGGCATTAGGCACTGGCACGGTCGGCGTAATGGCCGCTTCTGCACCGGGT
ATTCTTGTTGCTGGGTTGGCGGTGTTTATTTTGATGAGCCGGAGATCACGAATACAGCCG
TGCGCCGATGCCTGACGTGCCTTATTAGGCAGGGGCGAAAGGGACTTCACCCCAATACAC
CTACGGCGTTTACAGGTATACTCGCTAAAAATTATTCAGCGGGTTTGGAAACAAAGATGG
CAAAACTTACCTTACAAGAGCAGTTGCTCAAAGCAGGATTAGTCACCAGCAAAAAAGCGG
CGAAGGTGGAGAGAACGGCGAAAAAATCGCGCGTTCAGGCGCGTGAAGCTCGGGCGGCGG
TAGAAGAAAATAAAAAGGCACAGCTTGAGCGTGATAAACAGCTTAGCGAACAGCAAAAAC
AAGCGGCGTTGGCGAAAGAATATAAAGCTCAGGTGAAGCAGCTTATTGAAATGAACCGAA
TCACCATTGCCAATGGCGATATTGGTTTTAACTTCACTGACGGCAATCTGATTAAGAAGA
TTTTTGTCGATAAGCTCACACAGGCGCAGTTGATTAATGGTCGTCTGGCGATTGCCCGCT
TGTTGGTCGATAACAATAGCGAAGGTGAATACGCCATTATTCCCGCCAGCGTTGCCGATA
AAATTGCTCAGCGCGATGCCAGCAGTATAGTGTTGCACAGCGCGCTCAGCGCCGAAGAGC
AGGATGAAGACGACCCGTATGCCGACTTCAAAGTGCCTGATGATTTGATGTGGTAAACAT
AGATAAGTCGTGCGCAGATGCCTGATGCGACGCTATGCGCGTCTTATCAGGCCTACGGTT
TATGGGCGAAGTGTAGACCGGATAAGGCGTTCACGCCGCATCCGGCAGTCGTGCGCCATG
CCTGATGCGACGCTTTGCGCGTCTTATCAGGCCTACGGCTTACGGGCGAAGTGTAGGCCG
GATAAGGCGTTCACGCCGCATCCGGCAGTCGTGCTATTATCAACGCATATTCAGTTTATT
GGCGTGGTAGGCAATATGCTCGCCAATAAAACTGGAGACAAAATAATAGCTGTGATCATA
ACCCTCGTGATAACGGATTAACGTCTTGATATTCATCTCCTGGCAGATCTTTTCAAGATT
TGGAGTCCGCAGCTGTTCTGCGTAAAAATCATCACTCAACCCCTGATCAACCATGATTTC
CGCAACGCGTTGACCTTGTGAAATAAGACTCACCGGGTCGTAATCCAACCAGGCATCTTT
ATTTTCAGCAAGATATGCAGCAAAGGCTTGCTGTCCCCACGGCACTTGCGATGGGGAGAC
AATGGGCGAAAACGCCGAGACGCTGACATATTCATCTGGGTTACGTAACGCCAGCACCAG
CGCGCCCAGCCCGCCCATAGAATGACCAGAGATAGACTTTTTGGCCGTTGCCGGAAAATG
ATGCATCACTAAATCCGGCAGCTCGTTGCGGATATAGTCATACATTTTGTAATGTTCATT
CCACGGCGCTTGCGTCGCGTTCAGGTAAAACCCGGCACCTTGCCCGAGATCGTAACGGTC
AGCATCTGCGACATGACTGCCTCGCGGACTGGTGTCCGGCGCAACAACAATAATGTTGTG
CTCAGCCGCGTAACGCTGCATCCCCGATTTAGTAATGAAATTCTGCTCGTTGCAGGTCAG
GCCTGAAAGCCAGTACAGCACCGGCAATTTTTCATTCGCGGCTTTTGGTGGGAGATAGAC
GCCGACATTCATTTCACATTTCAGTGATTGGGAATAATGCCGATACATATTTTGCCAGCC
GCCAAAGCTGACATGTTTTTCAATGAGTTCCATCAGTCATTATCTCAGGGTTAATCCCCC
GGACGGCTGCCCGGGGAGAGTATTAAGAACCCCCGCCTGAAGTGGACGGGGTAAACCTGC
GGGAAATCAGTAACGAATTACGGTTCGAATGGATTTGCCTTCATGCATCAGGTCGAAGGC
GTCATTAATTTCATCCAGGCTCATGGTATGCGTGACAAACGGTTCCAGATCGATATCACC
TTTCATCGCATCTTCAACCATGCCCGGTAACTGGGAACGACCTTTCACGCCGCCAAACGC
GGAACCTTTCCATACGCGACCAGTGACCAACTGGAATGGACGGGTGGAGATTTCCTGACC
GGCAACCGCGACCCCGATGATCACCGACTGACCCCAGCCGCGGTGCGCACTTTCCAGCGC
CGCACGCATCACGTTGACGTTACCGATGCATTCAAAGGTATGGTCGATACCCCATTTGTT
GATATCCAACAGGACATCTTTTATCGGTTTGTCGTAGTCATTCGGGTTAATGCAGTCGGT
AGCACCGAAGCGACGCGCCAGATCGAATTTCTTCGGGTTGGTATCGATAGCGATAATCCG
ACCCGCTTTCGCCTGACGCGCGCCCTGAACCACTGCCAGACCAATCGCGCCAAGACCAAA
CACGGCAACAGAATCACCTGGCTGGACTTTAGCTGTGTTGTGTACCGCGCCAATACCGGT
GGTCACGCCACAGCCCAGCAGGCAGACGTGTTCATGGTTTGCTTCTGGATTAATTTTTGC
CAGAGACACTTCCGCGACTACGGTGTATTCACTGAATGTAGAGCACCCCATGTAGTGATA
AAGCGGCTGCCCGTTGTAAGAAAAACGGGTGGTGCCGTCTGGCATCAGGCCTTTACCCTG
GGTTTCGCGAACCGCAACACAGAGGTTAGTTTTGCCAGAACGACAGAACTCACACTCGCC
GCACTCCGCGGTGTAAAGCGGGATCACATGGTCGCCAGGTTTGACGCTGGTTACGCCTTC
ACCGACTTCAACCACAACGCCGGCCCCTTCGTGACCGAGAACCACCGGGAATACACCTTC
CGGGTCATCGCCGGAGAGGGTAAATGCGTCGGTATGGCAAACGCCGGTATGGGTGACTTT
AATTAGCACTTCACCTTTTTTCGGTGGTGCAACGTCAATTTCAACGATTTCCAGCGGTTT
ACCGGGAGCAAATGCAACGGCAGCACGTGATTTCATCTCTCGCTCTTCCTCAATATGGTA
ATAGATTCAGCTATTTAAGATAGGCACGAACCAGTTCAATAGTGTCGTCAACGGATTGGC
TGACTTCGCGGCTGTAGCAGTCATTTCGGTCAAACGTTTCCCGGATATGGCTTTCAAGCA
CTTCTGCCATCAGCCCATTAGCCGCGCCCCGAACGGCAGCGATCTGTTGGAGTATGGCAC
GGCATTCGGCATCACCCTCCAGCGACCGTTCCAGAGCATCAATCTGCCCCCGAATACGAC
GAACTCGAGTAAGGACCTTTTTCTTCTCTTCCGGAGTACTGGGCATTTCGCACCTCATCA
TCTGCATGCAATATACTATAGGGGGGTATTCTATATGTCAATGCATACCCCCCTATAGTA
TATAACACTGGAGAATAAAATTTATCCGGTGAATGTGGTCGGAAAACAAAGAGGAAAGGG
GGGGGGGCTAATCGGCAGGGAAGGCCGCCCCGGATAGCGGGCGGCAGAAGGAATCAGAAT
TTCCAGGTCAGACGGGCTGCAAGTTGCAGACCGTTAAAATCATCGGTTGGGGTGTCGTAC
CACACTTTACCTGCCGTCAGCCCGAGATTAAGTTGCTCAGTCAGCGGTTGAATACGTTGC
AGACTGACGCTCTTCATGCTGCCGTAGCGTGTTTCTGGCGTCCAGTCATAGGTGTAAGCA
CCTGTTCCGCGGCTTAGCCATAGTTGCGTATAACCAGTGCCGCGCGGGTCATTCAGACGC
ACGGAAATCATATTGCTATAACTACCACCTGCATCGCTGGAGTCATAATGGGTATAGCGG
TAGCTGGTGATCACCGGGCCAGTATAGAGTGATACGCCGCCTTGCCAGGCATCGACTTCG
ACATCATCGTAATATTTAGTGTAGCGATAACCGGTCGTGAAAAGCGTTTTTGGTAACAGG
GCCAGGTTAATATCCTGACGAAAATCCTGGCGGGCAAAGACCGGCGTATTATCCGCAAAG
GCAATACCCGTTCGGGTTGTCAGCCAGTTATTCCATTTATACCAGACCGCACCCTGACCG
CGAGTGGCATTGAAATGTTCAGTTTCATAATCACGACGCCCCTGGGAAAGATTAAAAAGC
AGCGTTGCGTTTTCAACTTTCGCCACCAGTTCAGCATACGCTAAATTACGGTTGCCATGA
TCGCCAGAATAATCGGTAAAATCGTAGCCCGCGGTAATGGAAGTTAACCCGGCATAAGCG
GGCAATGCGCTAAAAATGGCCGCCGCTAATAACGTCCGTTTTATCATTTTAATCTCCTGT
ACGGATAAGTTCTTGTCGGAGTGAATAAGTTCCGGTAGGTAAATTACGTTCTACAATCAC
GCGCGGGCCAAGTTGCGTGTTCGGGGAAATAATTCGCCCAGGCAAAATAATAACTTGTAC
GCCAAGGCGTGAACGCTGCCCGATATAACAACCTAATTTATCGCATCCGGTAGCGATAAT
TCCCTCTGGAGTTCGAACAGACACGGGCTGTTCATCCAGACGATGATTACTGGTACGTAC
TTGTGCGCCTAAATATGCCTGGTTTGCAACTACCGAGTCGGCAATAAAACATTGCGGACC
AATCGTTGCTTCCGCTTCAATAACCGCATTTTTAATCTCGGTGGCAAAACCAATTTTTAC
GCCATTGCTGATTATTGTGCCAGGACGAATAAACGCATAATTACTAGACTGGCCCCCTGA
ATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTA
GTCATTGGAGAACAGATGATTGATGTCTTAGGGCCGGAGAAACGCAGACGGCGTACCACA
CAGGAAAAGATCGCAATTGTTCAGCAGAGCTTTGAACCGGGGATGACGGTCTCCCTCGTT
GCCCGGCAACATGGTGTAGCAGCCAGCCAGTTATTTCTCTGGCGTAAGCAATACCAGGAA
GGAAGTCTTACTGCTGTCGCCGCCGGAGAACAGGTTGTTCCTGCCTCTGAACTTGCTGCC
GCCATGAAGCAGATTAAAGAACTCCAGCGCCTGCTCGGCAAGAAAACGATGGAAAATGAA
CTCCTCAAAGAAGCCGTTGAATATGGACGGGCAAAAAAGTGGATAGCGCACGCGCCCTTA
TTGCCCGGGGATGGGGAGTAAGCTTAGTCAGCCGTTGTCTCCGGGTGTCGCGTGCGCAGT
TGCACGTCATTCTCAGACGAACCGATGACTGGATGGATGGCCGCCGCAGTCGTCACACTG
ATGATACGGATGTGCTTCTCCGTATACACCATGTTATCGGAGAGCTGCCAACGTATGGTT
ATCGTCGGGTATGGGCGCTGCTTCGCAGACAGGCAGAACTTGATGGTATGCCTGCGATCA
ATGCCAAACGTGTTTACCGGATCATGCGCCAGAATGCGCTGTTGCTTGAGCGAAAACCTG
CTGTACCGCCATCGAAACGGGCACATACAGGCAGAGTGGCCGTGAAAGAAAGCAATCAGC
GATGGTGCTCTGACGGGTTCGAGTTCTGCTGTGATAACGGAGAGAGACTGCGTGTCACGT
TCGCGCTGGACTGCTGTGATCGTGAGGCACTGCACTGGGCGGTCACTACCGGCGGCTTCA
ACAGTGAAACAGTACAGGACGTCATGCTGGGAGCGGTGGAACGCCGCTTCGGCAACGATC
TTCCGTCGTCTCCAGTGGAGTGGCTGACGGATAATGGTTCATGCTACCGGGCTAATGAAA
CACGCCAGTTCGCCCGGATGTTGGGACTTGAACCGAAGAACACGGCGGTGCGGAGTCCGG
AGAGTAACGGAATAGCAGAGAGCTTCGTGAAAACGATAAAGCGTGACTACATCAGTATCA
TGCCCAAACCAGACGGGTTAACGGCAGCAAAGAACCTTGCAGAGGCGTTCGAGCATTATA
ACGAATGGCATCCGCATAGTGCGCTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGC
GGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCAATTAC
CTATCAGGCAGTTTGCGCCAATCACTACCGGACCCTGAATAACGGCACCATGACAAATAC
GGGTATTCGCGCCGATAACAACTTCACCTGCAGTTTCATCAATAATTACCTGGTCTGCAA
TCTGAATATTTTTCTCTTTAACATTAAGCTTCAGATAGTTTTTCAGTTCCTGTGACAGAA
GGTTGGGAATAAGCGGTTGACGCTTCCACCAGTGCGGAATAGCGGGTGGGTTTGTCGCGC
TGAGGTTCGCGTCCAGTAAAAAAGGCAATAAGTCCATAAATAATCCAGATGGCATAAGCT
AATAATACATACACAACGGAAAGCGGCGCTAAAGGCACCAACAACCAGCAACGATGAAAC
CAGGCGCTAAAAGCACCAATAACACAAACTACGCCGACCCAGATAAGCGGAAACATTGCC
AACACCACTCCATGCGGCCCGGTGGTGATGAATTCATTAAACCAGGTAGTGAGATAAATC
CCAACGCCATAAAGCACAACCAACAGCATAGGAAATATACTGAAGATACCGAAGCGGCTA
AATAAAAGTCTTTTATGCAGGCGCATACAGACCGCGTATCCCACAATCCAACGCCGCCAG
CGACGCCACTCCTCACGCGGGCTGTTGCATTCCTGTGGGTATACGATGCAGCGATTCGCC
TGCCGAATACGGTAGCCGTTTGCCACCAATGTCCAGGTGAGATCAAGGTCTTCGACTTTA
GTACGATCCGAGAAACCGAACTTACGCAATACATCAGTACGGAACATCCCGCAGGCACCG
CTGATAATAAACGGTGCGCCACCCAGGAGCTGCTGTAGCGTGCGCTTCATAACAATCATC
GGCAACTTTACGGTCGCGCGGATGTGCGGTAACAGACCCGCGCCTTTCAACGCAGTAGAG
GGAATGCCGCCTACGGCATCGGCACCGCGCTCAATTTCTGCCAGCATATAGCCCATTCCG
TCTTGATCGGGCGGAACATAGGTGTCGGCATCACTTAAAAAAACCTGGTCGCAGGTGGCG
TAATTGAGGCCATTCATCAGCGCACCACCTTTACCGGTATTTTTTTGCGTGACGGCAACA
AAGCGGTCGCCCCATTTGCGTTTGACTTCCGCCATGACCGCTTCGGTATTGTCCGTGGAG
CCGTCGTTAACGCAAATTACCCGGCAAAAATAAGGGTTACGCAGTAGATTATCCAGTGAC
TGCGCCAGACACGGGCCTTCGTTATACGCAGGTATAATGGCGTCAATACAGCCTTTCTTT
TGACTGGGTTTACGTCTTAGCGTACTTAAAAACCATAGCAACATTGCTATGGACATACAG
ATAAATATCCAGGTTTTCATGCAATTTGCTCAAAGAATCATTTTATGAATTACAAAGCCT
TCACCCAGATCGCTATTGACCTGTTGTCCGCGAAATTGTGCAACTGCACGCAGGCGATCA
TGACGCATATAATCGCGTCGTTCCTAGCTTTTATGTTTTTTTAATGCAGCAAGTTTGACT
GTGAAATATTCTTCTTTAACGGATTCAAAAACCTGAGGCATAAATGAAAGCCAGGTACTT
GGGGTTTCGTAGCCGAGAATTTGCGGAATAGTTCGGCAGGCAACCATTGAAGCTTGATAA
ACAGCAAGATGATCCTGATGGCGGTCGGCATCATGCATGGTATATACCCGCATGATTTCA
ACATCAGAAGGAATTTGATTTTTAATGATGTCTTCCAGGGCGGAAATCATATCATTGAGC
TGTAAATGAGCGCGGGTGTCAGCAAAATTAAGATGAATAGTTTGGTGGCACCCTAATATC
TTTAGGGCGTTGCGCGATTCTTCATGGCGATCGATTATTCCATCTGTGCCAGAGTTGCCG
GTAGTCATCACCACGGCTGCGATATAAATTCCTTTTTGCGCAAGACGAGCAAGCGATGCG
CCACAGCCTAATTCTATATCGTCAGGATGTGCGCCAATAGCAAGGATACCCTTTCTTTTA
TTTGCCGAAGAAAGGAGGGCTGAATCTAAAACCTTATCCACTTAATGACACTCCATTTTA
TTTATTATACTACAAGCACAACGATGCACTCAGAGACGTAATCTCTGGCGCAGCCAGATG
TTAATTTATAAATGTTAAATGTTGCTAATAACTGAAAAGCAAGGGCTTTCAGACCCGTGG
GTTCGACTGGGTAATGTTTCTATGCAATTCATATGTTAAGTGTTTGTATGTTTGGTATGT
ATAGTTATTTTGTTTTATACATTGTATTTAGATGTGATTTAGTTTGTCAATTAATTGCAT
TTAAAAAATATGTTCTGTGAACAAGCATTGTTTATATACATTATGTGAATGTAATATGCG
AGTGATTGAGAATGATACAGTGATATATACAATGCGAATATAATAGTTTTATTATATGTA
TTGATATTGATAGAAATAATGAAGTAATAAATCTCGTAATGTGGTTGTTTATGCATCACT
AAAATGAAGTGTAGTAATTTTCCCAATTGTTAGAACGGAGTAATTGCATATTTAATCTTT
CCTTAGCCGTTTTTTTGCTAAGAATAAAATCATCTGTGCGATAACGACTAATTCTTTTAA
TGAATGTTTTTATTCCTGAATACTGCTCCCATAACAAGACAGGGGAGCAGACAATCATGG
CAATTTCATCGCGTAACACACTTCTTGCCGCACTGGCATTCATCGCTTTTCAGGCACAGG
CGGTGAACGTCACCGTGGCGTATCAAACCTCAGCCGAACCGGCGAAAGTGGCTCAGGCCG
ACAACACCTTTGCTAAAGAAAGCGGAGCAACCGTGGACTGGCGTAAGTTTGACAGCGGAG
CCAGCATCGTGCGGGCGCTGGCTTCAGGCGACGTGCAAATCGGCAACCTCGGTTCCAGCC
CGTTAGCGGTTGCAGCCAGCCAACAGGTGCCGATTGAAGTCTTCTTGCTGGCGTCAAAAC
TGGGTAACTCCGAAGCGCTGGTGGTAAAGAAAACTATCAGCAAACCGGAAGATCTGATTG
GCAAACGCATCGCCGTACCGTTTATCTCCACCACCCACTACAGCCTGCTGGCGGCACTGA
AACACTGGGGCATTAAACCCGGGCAAGTGGAGATTGTGAACCTGCAGCCGCCCGCGATTA
TCGCTGCCTGGCAGCGGGGAGATATTGATGGTGCTTATGTCTGGGCACCGGCGGTTAACG
CCCTGGAAAAAGACGGCAAGGTGTTGACCGATTCTGAACAGGTCGGGCAGTGGGGCGCGC
CAACGCTGGACGTCTGGGTGGTGCGCAAAGATTTTGCCGAGAAACATCCTGAGGTCGTGA
AAGCGTTCGCTAAAAGCGCCATCGATGCTCAGCAACCGTACATTGCTAACCCAGACGTGT
GGCTGAAACAGCCGGAAAACATCAGCAAACTGGCGCGTTTAAGCGGCGTGCCTGAAGGTG
ACGTTCCGGGGCTGGTGAAGGGGAATACCTATCTGACGCCGCAGCAACAAACGGCAGAAC
TGACCGGACCGGTGAACAAAGCGATCATCGACACCGCGCAGTTTTTGAAAGAGCAGGGCA
AGGTCCCGGCTGTAGCGAATGATTACAGCCAGTACGTTACCTCGCGCTTCGTGCAATAAA
AGGAGGCGCAGATGCTGCAAATCTCTCATCTTTACGCCGATTATGGCGGCAAACCGGCAC
TGGAAGATATCAACCTGACGCTGGAAAGCGGCGAGCTACTGGTGGTGCTGGGGCCGTCCG
GCTGCGGTAAAACCACCCTGCTGAATCTGATTGCCGGTTTTGTGCCTTATCAGCATGGCA
GCATTCAACTGGCGGGTAAGCGTATTGAGGGACCGGGAGCAGAGCGTGGCGTAGTTTTTC
AGAATGAAGGGCTACTACCGTGGCGCAATGTACAGGACAACGTGGCGTTCGGCCTGCAAT
TGGCAGGTATAGAGAAAATGCAGCGACTGGAAATCGCGCACCAGATGCTGAAAAAAGTGG
GGCTGGAAGGCGCAGAAAAACGCTACATCTGGCAGCTTTCCGGTGGTCAACGTCAGCGGG
TGGGGATTGCTCGTGCGCTGGCGGCGAATCCCCAGCTGTTATTACTCGACGAACCGTTTG
GTGCGCTGGACGCCTTCACCCGCGACCAGATGCAAACCCTGCTGCTGAAACTCTGGCAGG
AGACGGGCAAGCAGGTGCTGTTGATTACCCACGATATAGAAGAAGCGGTGTTTATGGCGA
CTGAACTGGTTCTGCTTTCATCCGGCCCTGGCCGTGTGCTGGAGCGGCTGCCGCTCAACT
TTGCTCGCCGCTTTGTTGCGGGAGAGTCGAGCCGCAGCATCAAGTCCGATCCACAATTCA
TCGCCATGCGCGAATATGTTTTAAGCCGCGTATTTGAGCAACGGGAGGCGTTCTCATGAG
TGTGCTCATTAATGAAAAACTGCATTCGCGGCGGCTGAAATGGCGCTGGCCGCTCTCGCG
TCAGGTGACCTTAAGCATTGGCACGTTAGCGGTTTTACTCACCGTATGGTGGACGGTGGC
GACGCTGCAACTGATTAGCCCGCTATTTTTGCCGCCGCCGCAACAGGTACTGGAAAAACT
ACTCACCATTGCCGGACCGCAAGGCTTTATGGACGCCACGCTGTGGCAGCATCTGGCAGC
CAGTCTGACGCGCATTATGCTGGCGCTATTTGCAGCGGTGTTGTTCGGTATTCCGGTCGG
GATCGCGATGGGACTTAGCCCTACGGTACGCGGCATTCTGGATCCGATAATCGAGCTTTA
TCGTCCGGTGCCGCCGCTGGCTTATTTGCCGCTGATGGTGATCTGGTTTGGTATTGGTGA
AACCTCGAAGATCTTACTGATCTATTTAGCGATTTTTGCACCGGTGGCGATGTCGGCGCT
GGCGGGGGTGAAAAGCGTGCAGCAGGTTCGCATTCGTGCCGCCCAGTCGCTGGGTGCCAG
CCGTGCGCAGGTGCTGTGGTTTGTCATTTTGCCCGGTGCGCTGCCGGAAATCCTCACCGG
ATTACGTATTGGTCTGGGGGTGGGCTGGTCTACGCTGGTGGCGGCGGAGCTGATTGCCGC
GACGCGCGGTTTAGGATTTATGGTTCAGTCAGCGGGTGAATTTCTCGCAACTGACGTGGT
GCTGGCGGGGATCGCGGTGATTGCGATTATCGCCTTTCTTTTAGAACTGGGTCTGCGCGC
GTTACAGCGCCGCCTGACGCCCTGGCATGGAGAAGTACAATGAGTGAACGTCTGAGCATT
ACCCCGCTGGGGCCGTATATCGGCGCACAAATTTCGGGTGCCGACCTGACGCGCCCGTTA
AGCGATAATCAGTTTGAACAGCTTTACCATGCGGTGCTGCGCCATCAGGTGGTGTTTCTA
CGCGATCAAGCTATTACGCCGCAGCAGCAACGCGCGCTGGCCCAGCGTTTTGGCGAATTG
CATATTCACCCTGTTTACCCGCATGCCGAAGGGGTTGACGAGATCATCGTGCTGGATACC
CATAACGATAATCCGCCAGATAACGACAACTGGCATACCGATGTGACATTTATTGAAACG
CCACCCGCAGGGGCGATTCTGGCAGCTAAAGAGTTACCTTCGACCGGCGGTGATACGCTC
TGGACCAGCGGTATTGCGGCCTATGAGGCGCTCTCTGTTCCCTTCCGCCAGCTGCTGAGT
GGGCTGCGTGCGGAGCATGATTTCCGTAAATCGTTCCCGGAATACAAATACCGCAAAACC
GAGGAGGAACATCAACGCTGGCGCGAGGCGGTCGCGAAAAACCCGCCGTTGCTACATCCG
GTGGTGCGAACGCATCCGGTGAGCGGTAAACAGGCGCTGTTTGTGAATGAAGGCTTTACT
ACGCGAATTGTTGATGTGAGCGAGAAAGAGAGCGAAGCCTTGTTAAGTTTTTTGTTTGCC
CATATCACCAAACCGGAGTTTCAGGTGCGCTGGCGCTGGCAACCAAATGATATTGCGATT
TGGGATAACCGCGTGACCCAGCACTATGCCAATGCCGATTACCTGCCACAGCGACGGATA
ATGCATCGGGCGACGATCCTTGGGGATAAACCGTTTTATCGGGCGGGG