MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download OCL38(-Km).seq
 Deletion OCL38(-Km)
 Length 25450
 Fasta Format

>OCL38(-Km)
GAGTGTAAATAATATCATCGCGTCTTATTGCCGGATGCGGCGTGAACACCTTATCCAGCA
CACATCTGGCAGCGGCTATAGGTCTGATAAGACGCGTTAGCGTCGCATCAGACATTTATT
GCCTTTGTAGGCCCGATAAGCTTGCGCATCGGGCATGGCAACGTCACAAACGCCCTTCCC
CCACCCGGTGCTGATAACTCTGCTGAAACGTTATCATCCCCACCTGCTGCCCGGTTTGAA
TAACATGCGGTAACTGGTGGGTTTTCCCTTCGCGAATCAAATTCCCCACCGCGGGTGTGT
TAATCAGCAATTCAAATAGCGCCACGCGTCCTTCCTGTTTATCCACTTCCAGCTTTTGTG
ACAGCACTGCCCGTAAACTACCTGCCAGTTGATTACGCACGGGGTCTTTTTCCTGCGCCG
GAAATGAATCCACCAGTCGCTCAACTGCCTGCGCGGCACCACGCGTATGTAATGTTGCCA
GCACCAAATGCCCGGTTTCTGCCGCCGTCAGTGCCAGACGGATTGTCTCGCTGTCACGCA
GCTCTCCGAGCAAAATCACATCAGGATCTTCCCGCAATGCGGCCCGCAATCCCGATGCGA
ACGTCATACAGTGCAAACCAATTTCCCGCTGCTGGATCAAACATCGCTGGCTGGCATAGA
GATATTCAACAGGATCTTCCAGCGTCAGAATATGCGCATCGGCATGTTGATTGAGATAGC
CAACCATCGCCGCCAGCGTGGTAGATTTGCCACTCCCCGTCGCCCCCGTCACCAGAATCA
GGCCATTCTCGCTCTTGAGTAATTCCGGCAATACCGTTGGTGCGCCAAGCTGTTCGAGCT
GCGGGCAGTGCGAAGGTAACAGCCGTAACGCCAGCGAAATGCCATGCCGTTGCGCGAATG
CGCTGCCACGCAATCGCTGGTTTTCCGCCAGCGACACGGCAAAATCCAGCTGACCATTCT
CCAGCAATATTGCCCGCTGATCGTCATCCAGCCACTCCCGCAGTAGCTCTTCGACGTCCG
GCGTATCAAACGGCGCAGCTTCCATTCTGCCGCGAATGCGCCATCGTGCGGGCCAGGCGC
TGCACAGGTGTAGATCCGAGACGTTATGCTTTACACTAAGGGCCACAATTTCTTCCATAT
TCATACTAAGATCCTCGGAAAATGAACGATATTGCGCATAACCTGGCACAGGTCCGGGAC
AAAATCTCAGCGGCTGCAACGCGTTGCGGCCGTTCTCCAGAAGAAATTACGCTGCTTGCA
GTCAGTAAAACAAAACCTGCGAGCGCCATCGCAGAAGCCATTGATGCCGGGCAGCGTCAA
TTTGGTGAAAACTACGTTCAGGAAGGGGTAGATAAAATTCGCCACTTTCAGGAACTGGGC
GTAACAGGATTAGAATGGCATTTTATTGGCCCGTTGCAGTCTAATAAAAGCCGCCTGGTG
GCAGAGCATTTCGACTGGTGTCATACCATCGACCGTTTGCGCATCGCTACCCGTCTCAAC
GACCAGCGCCCGGCAGAACTTCCCCCTCTTAACGTTCTGATTCAAATTAACATTAGTGAT
GAAAACAGTAAGTCCGGGATTCAACTGGCTGAACTGGACGAGCTGGCAGCTGCGGTCGCT
GAACTACCGCGTTTACGTCTGCGCGGGTTGATGGCAATCCCTGCGCCTGAGTCAGAATAT
GTAAGGCAGTTTGAAGTTGCACGCCAAATGGCTGTAGCATTTGCCGGACTGAAAACGCGC
TACCCGCATATCGACACGCTCTCTCTGGGAATGTCGGACGATATGGAAGCCGCCATTGCG
GCAGGTAGCACGATGGTTCGTATCGGCACTGCAATTTTTGGTGCGCGTGATTACTCTAAA
AAATAAGGAATTAAAGGAACGCCATGAATACGTTGACTTTCCTGCTTTCAACGGTCATTG
AGCTGTATACCATGGTGCTGTTATTACGCATCTGGATGCAGTGGGCTCATTGTGATTTTT
ACAACCCCTTCTCACAGTTTGTAGTGAAGGTAACGCAGCCAATTATCGGGCCACTGCGCC
GCGTTATTCCGGCAATGGGGCCAATTGACAGCGCCTCGCTGCTGGTTGCCTATATTCTCA
GTTTTATCAAAGCCATCGTGCTGTTTAAAGTGGTGACCTTCCTGCCAATCATCTGGATTG
CCGGTTTACTGATTCTGCTGAAAACCATCGGCCTGCTGATTTTCTGGGTCCTGCTGGTGA
TGGCGATTATGAGCTGGGTAAGCCAGGGGCGTAGCCCGATTGAATACGTGCTGATTCAGC
TGGCCGATCCGCTGCTGCGCCCGATTCGCCGCCTGCTACCGGCAATGGGTGGGATTGATT
TCTCGCCGATGATCCTCGTTCTGCTGCTGTATGTCATCAATATGGGTGTCGCAGAAGTAT
TACAGGCAACCGGAAATATGCTGCTGCCAGGGCTGTGGATGGCGTTATGAATGCCGTAAC
AGTTAATGATGACGGTCTGGTTTTACGGCTCTATATTCAGCCGAAAGCCAGCCGTGATTC
TATTGTCGGTTTACATGGCGACGAAGTTAAAGTCGCCATTACCGCGCCGCCGGTTGACGG
CCAGGCCAACAGTCATCTGGTGAAGTTTCTCGGTAAGCAATTCCGGGTTGCCAAAAGCCA
GGTGGTGATTGAAAAAGGCGAACTTGGCCGCCACAAACAAATTAAAATCATTAATCCGCA
ACAAATCCCGCCAGAAATCGCGGCGTTAATTAATTAGGTATCCTATGCAAAAAGTTGTCC
TCGCAACCGGCAATGTCGGTAAAGTGCGTGAGCTGGCGTCGCTGCTTAGCGACTTCGGTC
TTGATATCGTGGCCCAAACAGACCTCGGCGTTGATTCCGCTGAAGAAACCGGCCTGACCT
TTATCGAAAACGCGATTCTGAAAGCGCGCCATGCGGCAAAAGTGACCGCTTTACCGGCAA
TTGCCGACGACTCTGGTCTGGCGGTAGATGTGCTTGGCGGCGCGCCGGGCATTTACTCCG
CGCGTTATTCCGGTGAAGACGCGACCGATCAAAAGAATCTGCAAAAACTGCTGGAAACAA
TGAAAGACGTACCGGACGACCAACGTCAGGCGCGTTTCCACTGCGTGCTGGTATATCTGC
GTCACGCGGAAGATCCCACTCCGCTGGTATGCCACGGTAGCTGGCCGGGCGTGATTACTC
GTGAACCAGCGGGCACTGGTGGCTTTGGTTATGATCCAATCTTCTTCGTACCTTCCGAAG
GGAAAACCGCCGCCGAACTGACCCGCGAAGAAAAGAGCGCCATTTCCCACCGTGGTCAGG
CGTTGAAACTGCTGCTGGACGCTTTACGTAATGGTTAAATTACCTCCGCTGAGTCTCTAC
ATTCACATCCCGTGGTGCGTGCAGAAATGCCCGTACTGCGATTTCAACTCTCACGCGTTG
AAAGGAGAAGTGCCGCACGACGATTATGTTCAGCATCTGCTTAACGATCTGGACAACGAT
GTGGCTTACGCTCAGGGCCGTGAAGTAAAGACAATCTTTATTGGCGGTGGTACGCCGAGC
CTGCTTTCCGGCCCGGCGATGCAAACGCTGCTGGACGGCGTGCGTGCGCGTTTGCCGCTG
GCAGCGGATGCAGAAATTACTATGGAAGCGAACCCTGGCACGGTAGAAGCCGATCGCTTT
GTCGATTATCAGCGTGCTGGTGTGAACCGCATCTCTATTGGTGTGCAGAGTTTTAGCGAA
GAAAAGCTGAAACGACTTGGGCGTATTCATGGCCCGCAAGAAGCGAAACGCGCGGCGAAG
CTGGCGAGCGGTTTAGGGTTACGTAGCTTTAACCTTGATTTGATGCATGGGCTGCCGGAT
CAATCACTGGAAGAGGCGCTTGGCGATCTACGCCAGGCCATTGAACTGAATCCGCCGCAT
CTTTCCTGGTATCAACTGACCATCGAACCCAATACGCTGTTTGGTTCGCGACCACCGGTG
CTGCCGGACGATGACGCGTTGTGGGATATATTCGAACAGGGGCATCAGTTATTAACCGCA
GCGGGTTATCAGCAATATGAAACTTCCGCTTACGCCAAACCCGGTTATCAGTGCCAGCAC
AATCTCAACTACTGGCGCTTTGGTGACTACATCGGTATTGGCTGCGGCGCACACGGCAAA
GTGACCTTCCCGGATGGGCGCATTCTGCGTACCACCAAAACGCGTCATCCGCGTGGTTTT
ATGCAAGGAAGGTATCTGGAAAGCCAGCGTGATGTCGAAGCCACAGATAAGCCGTTTGAG
TTCTTTATGAATCGCTTCCGTCTGCTGGAGGCCGCGCCGCGCGTGGAGTTTATTGCGTAT
ACCGGGCTTTGCGAAGATGTGATTCGCCCACAGTTAGACGAGGCGATTGCCCAGGGTTAT
CTCACCGAATGTGCGGATTACTGGCAGATAACGGAACATGGGAAGCTGTTTTTAAATTCG
CTGCTGGAGCTTTTTCTGGCTGAGTAAACTTGTATTGCCGGATGCGGCGTGAACGCCTTA
TCCAGCCGACATGTGGCAGCGGTTGTAGGTCTGATAAGACGCGCAAGCGTCGCATCAGAC
GTTGATTGCCGGATGCGGGGTCAACGCCGCATCCTGCTACAAATCGTGCACTATATCAAA
CTTACTTAATCACCCCATTGCGCCGCAGTTGTTCGGTATCTTTTTTCCAGCGTTCATTAG
CTTGGTTGATATCGTCAATTTTCATCAAAATCGCGACTTTTTTACTGTTTATTTCTGAAA
CTTTCATCGTTAACGGATATTGCCCTTTTTCGAGCGTTACCCAGTCATCCTGCAATTTAC
GGCTAAGTTTTTGTGATTGCAGAAAAGTCTGTCGCCGTTGTTCGTTGATATCGAAATCTC
GTTTCTGCTGAATCGGCACTTCATAACACTCTTCACTCTGTTTATGACATGCCGCAATCG
CCGGTTGATAAACCTCTTTGTCATATTTAACCGCGAACGCCTCGCTATCGTTCTGTTTAT
TAAACTCATCACGCTGTTGGTGAATTTTTTTAAAGGCGTCTTCGCGGGTCATTTGCTTAC
CGTTTGCATCTTTTCCCCAATATGCATCCGCTGCTTTCTGCGCCGCCACCATTTGCTTAT
CAAGCGCTTTCACTTCCTTTTCCAGCGCAGGAATCGAGTTCTTCTGGGTATTCAACGCAG
ATTCAAGCTGACTAAAGCGATAATTGAAATCTTCGCTATTCACGATCAGATATTTATTAT
TCGTTTTGATATCGTCGACCACCCGCCCACGATCGCTGGCTGCCGCCTGAAAAGAGTAAA
AGTTCACCGACCAGCCAGACGCGGGCGTTCCTTTACTGGTTAACATCGCCGAGAATTTTA
CCGGTTTATCTTTCGTCCAGGTCTGTTCGAGCAGTTCGTAATCTGCCAACTGACCGACCC
AGGTATAGAGATCGTCACTGGAAGAGACATCGCCTTCCGCTGACCAGGTGGCCTGATTAC
CCTTAGCATCAAGATTTTTTAAGGTGATAGCATCAAGCTTGAGAATGCCGTGATACTGCT
TTTTGAATTGATCTTTTAAGATATTTTCAGTTGGCGGTTCGCCATCTGCCCAGGCATTAC
CAGTCATCAACATAAGCAGTGCCGTGCCAACAATCCATTGCTTTTTCACCCGAAAAACCT
CACGCGGAATAATTTATTCCGGTGATTATCATTAGGGTAATTAAAATTGGCAATGGACGT
GAGTCTGAAGTGAAAAAGCCCCGGCACGATACCGGGGCGAGGCGATTAGTACTGATTGAA
GATCTGCTGGATCTGCTGCGGATCTTTGGTTTGCGTCAGAGCCAGTTGCAGCAGAACGCG
CGCTTTTTGCGGGTTCAGCGTGCCAGAGGCGACGAAGCCGTATTTCGCATCATCCACTTC
GGCATCCTGAGTGGTAGCGCCCGTCGGTACGCGGGAAGAACGCACGACTGCAGTACCGGT
TTTCGCGGCGGTCGCCAGCGTGTCGAACACAGATTTATACAGGTTGCCGTTACCCACACC
AGCGCTAACGATGCCATCATAGCCCGCATCTACCAGTGCTTTAGCCGGAAGATCGGATGC
GTTAGCGTAGTTATAAACAATGCCGACTTTCGGCAGTTCATTCAGCTTAGAGACATCGAA
TGGCGTGTCGCTGGTATGCTTACGTGCCGGGGTACGCTGGTAGTCAATCTTACCGTTGTG
AATGTAACCCAGAGGACCGTAGTTAACAGACTTGAAGGTCGCTACGTCGGTGGTGTTGGT
TTTGGTGACGTCACGGCCATCAAGCACGGTGTCATTCATCACTACCAGCACGCCACGGTT
GGCGGAGGCTTTATCAGCTGCGGTCACTACCGCGTTATACAGGTTGAATGGACCGTCTGC
GCTCATAGACGTGGACGGACGCATTGCGCCGACCATCACCACCGGTTTGTCGCATTTCAC
CGTCAGGTCGAGGAAGTAAGCAGTTTCTTCCATCGTGTCGGTACCGTGGGTAATGACGAA
GCCGTCGGTCTTATCGCAGTCGGTGTTAATTTTTTTCGCCAGTGTCAGCCAGACATTATC
GTTCATGTCCTGGGAGCCGATATTCACTACCTGCTCGCCTTTAACGTTCGCAATGTCTTT
TAGTTGCGGCACCGCATTAACCAGATTTTCTACGCCAACTTTACCCACTGTGTAGTTAGA
TTTGGTTGCGGAGTCACCACCACCGGCAATGGTCCCGCCGGTTGCTAAAATGGTGATATT
GGGTAATGCCAATGCTGCACCACTAAAACCCATAACCAGTGCGGCAAGTGCCGTCTTTTT
GAAAAACTCCATTTCATTCCTCCAGTTACGTGAACGCTACGCATTATCCCTTAGCTCTGT
ATGGGAAATTTGACGTTAAACAATTTACAACGTGAATATATTTTGGAGATCTACAAAGTT
AGAGGCAGGTAACAAAACGAAGAATTAAACGGCATAAAAAAGTATTATGCCGTCTTAAAA
TAGAGGATTATTTTAAATTCCCGACCAGGGCTTTGCGGCTATCTTCCAGAGTCACAACGC
GGCTACAAACATCTTTGCCAAACTGCTGGAAATCTTTTTCCTGCTTTTTCCACTCGGTTT
GGATTGAGGATTGCAGCCCCCCCAGGCTTCCCAGCACATTCTGTAATGGGTTACCGCCGC
TTTTCAGCACCGCTTTCGCGCCCATTTCATTAATGCTGTCCTGTAAAATTCCACCCATTG
CCTGATTCACTAATTGCTGGCCTTCGGCGCGAACCTGATCAATGGCTTTATAGTGAAACG
TCAGGCCATCGCTGCGCGTTTCAATAATGCGGTTCATCTGCTCTTTCAGCTGCGCATCAA
GTTTGGTCAGACGGCTGCGCATTTTGCTGCTTTCGCCCATCTCCTGAACGATAATTTTAT
CCAGAGCAATACGGGCTTTCTCGACGCGGCTTTTCGCGCCTTCATCAATCCACGGCAGCG
TGCTGCGTAGTTCAGCCTGATAATCCTTCGCCTGCTCGCGCTGGGCGGCATTCAGGGAAT
ATTGCTTACCGTTATACATCACGTTGCCGTCTGGCGTGATCACCAGATTGCCGTTTTCGC
CCTTCACCTGCACGGTTTGCGGGCTGACAATCACATCGTCACGCGGCGTGACGCTGCACT
GGTAGTCGGCGTGAGCGGTCATTGCCGTCACTGAAAGTGCTGCCGCCAGCAGCATTTTGC
GCATCATAGTCTTCCCTCAAGAAAAAATCAGGCCAGCATTTGCTGGCCCCAGATTGATAA
CAAAGTACGCGTTTTCCATGCCGGATGCGGCGTAAACACCTTATCCCGCCTACTCGATCG
TGCATCTTTCCAGGCCTGATAAGCGTAGCGCATCAGGCAGTTTTGCATTTGTCATCGCCC
GTATGCTTTCTTAGTCCCACCAAACGTCGAAAAGTTCGCTGGTGCGTACCTCATCCAGTT
TGCGCTCTTCCAGCCACTTACGCACAATCGCCTGATGTTCTTCGGTGCATTTGCCGATTT
CCTGCATGCAGATCAGACCTTCCCAGGCCAGATAACCGCTGCCGTCAAAGGCCAGTTTGT
TCGGTTCGATAACCTCGTTAATAAAATCATCAACGGTTTTATCAATCTGTTCTTCCGATG
TACCTTCCGGGAATCGCCATGCCACCGAAAATCCTAATTCCTGGAATTCGTCGATGTGCA
TTTTTTTACGCAGACGACGGCTACGGTTCTTTGCCATTATTTCACCCTCTCGAACATTAA
GTCCCATACTCCGTGACCAAGACGATGACCACGTTGTTCAAATTTCGTCACCGGACGTGA
TGCCGGACGCGGTACGTAATCATTGCTCTCTGACAGGTTTTTATAACCGTCAATAGAAGA
CATCACTTCAAGCATATGTTCCGCATAAGGTTCCCAGTCGGTCGCCATATGGAATACGCC
CCCCAGCTGCAGTTTGCTTTTTACCAGTTCGGCAAACGGCACCTGAACGATACGGCGTTT
ATTATGGCGCGCTTTGTGCCACGGGTCAGGGAAAAAGAGCTGCACCATGCGCAATGAATT
GTCAGGAATCATTTTATGCAGCACTTCAACCGCATCGTGACACATCACGCGCAGGTTGCT
TAAACCTTCTTCATGCGCAGAAGCCAGGCACGCACCAACGCCCGGTGAATGCACTTCAAT
GCCGAGGAAGTCCTGCTCAGGGCGATCTTTAGCCATTGCCACCAGCGACGCCCCCATGCC
AAAACCAATCTCAAGCGTCACCGGCGCTTCACGGCCAAAAAGCGCGGGGAAATCCAGCAT
ATCTTCGCTGAACTCAACGCCCATCACCGGCCAGTAGTTTTCCAGCGCATGTTCCTGGCC
TTTGGTCAGTCGCCCCTGGCGGCGCACAAAACTACGGATACGGCGCAGTGGGCGGCCGTT
TTCATCAAATTCCGGTGAAATGACGTCGTTTTTCATAAAGGTTTAGTCGCTTGTGAAAGT
GTTCTGAAAACGGGCATTATCCAAAGTTAGTTGCCGGATGCAAGCATGATAAGGCCGTGG
CTGCGGAAAGTTCCGGTTTACACCCTGCCGTCGCTGTGCTGCAATCTTGCCCCCAACAAC
AGTGAATTCGGTGACCATGCAAGCGTCGCAATTTTCAGCCCAGGTTCTGGACTGGTACGA
TAAATACGGGCGAAAAACTCTGCCCTGGCAAATTGACAAGACGCCCTACAAAGTATGGCT
CTCAGAAGTGATGTTGCAACAAACTCAGGTTGCGACCGTTATCCCCTATTTTGAACGCTT
TATGGCGCGCTTCCCGACGGTGACCGATCTCGCCAATGCGCCGCTCGACGAAGTTCTCCA
CTTGTGGACCGGGCTTGGCTATTACGCCCGCGCGCGCAATCTGCATAAAGCGGCACAACA
AGTGGCGACCTTACACGGCGGTAAATTCCCGGAAACCTTTGAGGAAGTTGCAGCACTGCC
GGGCGTCGGGCGTTCCACCGCAGGCGCGATTCTCTCGCTTTCTCTGGGTAAGCACTTTCC
GATTCTCGACGGTAACGTCAAACGCGTGCTGGCGCGCTGCTATGCTGTAAGCGGCTGGCC
TGGGAAAAAAGAGGTCGAGAATAAATTATGGAGTTTGAGCGAGCAGGTGACGCCCGCGGT
TGGCGTGGAACGGTTTAATCAGGCGATGATGGATTTGGGTGCGATGATTTGTACGCGCTC
GAAACCGAAATGTTCGCTCTGTCCGCTACAAAACGGATGTATTGCCGCCGCCAACAATAG
CTGGGCGCTTTATCCGGGCAAAAAACCGAAACAGACGCTGCCGGAGCGCACCGGCTACTT
TTTGCTATTACAGCACGAAGATGAAGTATTGCTGGCGCAGCGTCCGCCGAGCGGATTGTG
GGGCGGTTTATACTGTTTCCCGCAGTTTGCCGACGAAGAAAGTTTGCGGCAGTGGCTGGC
GCAACGGCAGATTGCTGCCGATAACCTGACGCAACTGACCGCGTTTCGGCATACCTTCAG
CCATTTCCACTTAGATATTGTGCCTATGTGGCTTCCCGTGTCGTCATTCACCGGCTGCAT
GGATGAAGGCAATGCGCTCTGGTATAACTTAGCGCAACCGCCGTCAGTTGGCCTAGCGGC
TCCCGTGGAGCGTTTGTTACAGCAGTTACGCACTGGCGCGCCGGTTTAGCGCGTGAGTCG
ATAAAGAGGATGATTTATGAGCAGAACGATTTTTTGTACTTTCCTGCAACGTGAAGCAGA
AGGTCAGGATTTTCAGCTGTACCCCGGCGAGCTGGGAAAACGCATCTATAACGAGATCTC
CAAAGAAGCCTGGGCGCAGTGGCAGCACAAGCAAACCATGCTGATTAATGAAAAGAAACT
CAACATGATGAATGCCGAGCACCGCAAGCTGCTTGAGCAGGAGATGGTCAACTTCCTGTT
CGAGGGTAAAGAGGTGCATATCGAGGGCTATACGCCGGAAGATAAAAAATAAAAACAGTG
CCGGAGCACGCCTCCGGCAACTTGCATAAAAACAAACACAACACGCACCCGGAATGATGA
AAAAATATCTCGCGCTGGCTTTGATTGCGCCGTTGCTCATCTCCTGTTCGACGACCAAAA
AAGGCGATACCTATAACGAAGCCTGGGTCAAAGATACCAACGGTTTTGATATTCTGATGG
GGCAATTTGCCCACAATATTGAGAACATCTGGGGCTTCAAAGAGGTGGTGATCGCTGGTC
CTAAGGACTACGTGAAATACACCGATCAATATCAGACCCGCAGCCACATCAACTTCGATG
ACGGTACGATTACTATCGAAACCATCGCCGGGACAGAACCTGCCGCGCATTTGCGCCGGG
CAATTATCAAAACGTTATTGATGGGTGACGATCCGAGTTCGGTCGATCTCTATTCCGACG
TTGATGATATTACGATTTCGAAAGAACCTTTCCTTTACGGTCAGGTGGTGGACAACACCG
GGCAGCCGATTCGCTGGGAAGGTCGCGCAAGCAACTTCGCGGATTATCTGCTGAAAAACC
GTCTGAAGAGCCGCAGCAACGGGCTGCGTATCATCTACAGCGTCACCATTAACATGGTGC
CGAACCACCTTGATAAACGTGCGCACAAATATCTCGGCATGGTCCGCCAGGCGTCACGGA
AATATGGCGTTGATGAGTCGCTGATTCTGGCAATTATGCAGACCGAATCTTCCTTTAACC
CGTATGCGGTCAGCCGTTCCGATGCGCTGGGATTAATGCAGGTGGTACAACATACTGCCG
GGAAAGATGTGTTCCGCTCGCAGGGGAAATCCGGCACGCCGAGCCGCAGTTTCTTGTTTG
ATCCTGCCAGCAATATTGATACCGGCACCGCGTATCTGGCGATGCTGAACAATGTTTATC
TCGGCGGAATTGATAACCCAACATCGCGGCGTTATGCCGTCATCACCGCCTATAACGGCG
GCGCAGGCAGCGTGCTGCGAGTCTTTTCGAATGATAAGATTCAGGCTGCCAATATTATTA
ACACCATGACGCCGGGCGATGTTTATCAGACGCTGACGACCCGCCATCCCTCTGCGGAAT
CTCGCCGTTATCTTTATAAAGTGAATACCGCGCAAAAATCCTACCGCCGCCGATAATTCC
ATTAACCGCCCCTGACGATGCTCAGGGGCAAAAATGTTATCCACATCACAATTTCGTTTT
GCAAATTGGGAATGTTTGCAATTATTTGCCACAGGTAACAAAAAACCAGTCCGCGAAGTT
GATAGAATCCCATCATCTCGCACGGTCAAATGTGCTTTTTCAAACACTCATCCGCATCAC
GATGTGAGGAAATTAACATGAATCTTAAGCTGCAGCTGAAAATCCTCTCTTTTCTGCAGT
TCTGTCTGTGGGGAAGTTGGCTGACGACCCTCGGCTCCTATATGTTTGTTACCCTGAAGT
TTGACGGTGCTTCTATTGGCGCAGTTTATAGCTCACTGGGTATCGCAGCGGTCTTTATGC
CTGCGCTGCTGGGGATTGTGGCCGACAAATGGTTAAGTGCGAAATGGGTATATGCCATTT
GCCACACCATTGGCGCTATCACGCTGTTCATGGCGGCACAGGTCACGACACCGGAAGCGA
TGTTCCTTGTGATATTGATTAACTCGTTTGCTTATATGCCAACGCTTGGGTTAATCAACA
CCATCTCTTACTATCGCCTGCAAAATGCCGGGATGGATATCGTTACTGACTTCCCGCCAA
TCCGTATCTGGGGCACCATCGGCTTTATCATGGCAATGTGGGTGGTGAGCCTGTCTGGCT
TCGAATTAAGCCACATGCAGCTGTATATTGGCGCAGCACTTTCCGCCATTCTGGTTCTGT
TTACCCTGACTCTGCCGCATATTCCGGTTGCTAAACAGCAAGCGAATCAGAGCTGGACAA
CCCTGCTGGGCCTCGATGCATTCGCGCTGTTTAAAAACAAGCGTATGGCAATCTTCTTTA
TCTTCTCAATGCTGCTGGGCGCGGAACTGCAGATTACCAACATGTTCGGTAATACCTTCC
TGCACAGCTTCGACAAAGATCCGATGTTTGCCAGCAGCTTTATTGTGCAGCATGCGTCAA
TCATCATGTCGATTTCGCAGATCTCTGAAACCCTGTTCATTCTGACCATCCCGTTCTTCT
TAAGCCGCTACGGTATTAAGAACGTAATGATGATCAGTATTGTGGCGTGGATCCTGCGTT
TTGCGCTGTTTGCTTACGGCGACCCGACTCCGTTCGGTACTGTACTGCTGGTACTGTCGA
TGATCGTTTACGGTTGCGCATTCGACTTCTTCAACATCTCTGGTTCGGTGTTTGTCGAAA
AAGAAGTTAGCCCGGCAATTCGCGCCAGTGCACAAGGGATGTTCCTGATGATGACTAACG
GCTTCGGCTGTATCCTCGGCGGCATCGTGAGCGGTAAAGTTGTTGAGATGTACACCCAAA
ACGGCATTACCGACTGGCAGACCGTATGGTTGATTTTCGCTGGTTACTCCGTGGTTCTGG
CCTTCGCGTTCATGGCGATGTTCAAATATAAACACGTTCGTGTCCCGACAGGCACACAGA
CGGTTAGCCACTAATTACGCAAAGAAAAACGGGTCGCCAGAAGGTGACCCGTTTTTTTTA
TTCTTACTTCAACACATAACCGTACAACCGTTTCACGCCATCCGCATCGGTTTCGCTATA
AACACCTTGCAGCTCCGGCGAAAATCCCGGCAACAAATTCACCCCTTCTTCCAGTGCAAG
GAAATAACGTTGAACCGCCCCACCCCAGACTTCCCCGGGTACCACGCAAAGCACGCCAGG
TGGATAAGGCAACGCCCCTTCTGCCGCAATTCGCCCTTCGGCATCACGAATCCGCACCAA
CTCCACGTCACCGCGAATATAAGCGCTATGCGCATCCTGGGGGTTCATCACCACTGACGG
GAAACTCTGCTGGCGGAACATCGCTTTTTGTAGGTCTTTGACGTCGAAACTGACATACAG
ATCGTGCATCTCCTGACACAACTGGCGCAGGGTGTAGTCGCGATAGCGCACCGGATACTT
GTTATAAACGCTCGGCAACACCTCAACCAGCGGCGAGTCATCCTCAATATGCTGTTCAAA
TTGCGCCAGCATCGCCACCAGTTGTGCCAGCTTCTCGTGGCTTTCCGCCGGAGTTAATAA
AAACAGAATGGAGTTGAGATCGCACTTCTCCGGCACAATGCCGTTCTCACGCAGATAGTG
CGCCAGAATCGTCGCCGGAACGCCAAAGTCGCTATATTCGCCGGTTTCGGCATCGATACC
TGGTGTAGTGAGTAACAGCTTGCACGGATCAACAAAATACTGATCCGCGGCATATCCTTC
AAAGCCGTGCCACTTCGCCCCCGGCTCAAAACTGAAAAAACGGCGGTCGCTGGCTAACAC
TGATGTCGGATAATCCTGCCACAATTTGCCATCAACAACGGGCGGGATAAACGGGCGGAA
CAGCTTACAGCGCGCAAGAATAGCCTTGCGCGCTTCAATCCCTATCTCAACACACTCAGC
CCACAGCCGACGCCCACTCTCCCCTTCATGAATTTTGGCGTTAACATCCAGTGCAGCAAA
CAGCGGATAGAAAGGGCTGGTAGAAGCATGGAGCATAAAGGCGTTATTCAACCGCTTATG
CGGGCAAAAACGCGCCTGTCCGCGGATATGGTTATCTTTTTTATGGATCTGCGACGTCTG
TGAGAATCCCGCCTGCTGTTTGTGCACCGACTGAGTCACAAAGATCCCCGGATCGTTTTC
GTTAAGTTCTAACAGCAGCGGCGAGCTATCCGCCATCATCGGGATAAATTGTTCATAACC
GACCCACGCGGAATCAAACAGAATGTAATCACACAGATGCCCAACGGTATCGATCACCTG
ACGGGCGTTATAGACAGTGCCGTCATAGGTTCCCAGCTGAATAATCGCCAGGCGATACGG
GCGCGGCAGGTCGGCTTTTTCTGGCGCAACGTCGCGAATTTGCTGGCGCAGATACTCTTC
ATTAAAACAGTGCGCATCAATACCGCCAATGAAACCAAACGGGTTGCGTGAAGCTTCCAG
ATAGACCGGCGTCGCCCCCGCCTGAATCAGCGCGCCGTGATGATTCGACTTATGGTTGTT
ACGGTCGAAGAGCACCAGATCGCCACGCGTTAACAGCGCATTCGTCACCACTTTATTCGC
TGCCGATGTGCCGTTCAGCACAAAATAGGTTTTATCGGCATGAAAGACTTTGGCTGCGAA
TTTCTGCGCATCTTTCGCCGATCCTTCATGAATAAGCAGATCGCCCAATTTTACGTCAGC
GTTACACATATCGGCGCGAAAGACGTTCTCACCAAAGAAATCGTAAAAATGGCGTCCGGC
AGGATGCTTTTTAAAAAACGCACCATGTTGATGTCCAGGGCAAGCAAAGGTGCTGTTGCC
CATCTCAACGTACTGCGTCAGCGTGTCATAAAACGGTGGCAGCAAATTCTCTTCATACTG
ACAGGCTGCGGATTCCAGCTCCAGCCACTGCTGCTCGTTGCCGTTGATTACCGCCGTAAC
GCCCGCAGGTAATTCAACAGCATGTTCGGAATACAAAAACACCGGTAGATGAAAACCGGT
GCGCTTAAGCAACGCAAGAATGCCACTGCGACTATCCGCAGCGGTAATGACGACTGCCGC
GACGTCCGTAAAATCAGTATCTCCCAACGCCACCACGCGACGATGAGAAGAAAGTCGGGA
TACCAGTTCACTACTGGCGGCAATATTCATTGATTTCATAAGCGCAAACCCGTTTCGGGG
AAGTAAGAATACCGGACAAGGTGGAAAACCCTGCCCCATGAGATATGGGTCAAACTGGTC
ACCAGCTCCGACCGCCAGACATCAGTAAAAGCAGAAACGCTCTGATTTTACTGTTGTCCT
GCAGTGAGCGTGCGTTAACTTCACCGCATGAGCAGTAACATAGAAAGGGAAACGTTTCGC
GCGAAACGGCGATAAGCGAGAGAATGTAAGGAGATGGCGTGCATCGGGCAAACTCCGTAC
AGAGAGGAGAAAATTCGCGCAATCATGGCACCTTTCGCTAAAGCGTGCAAGCCAGGACTT
TGCGAACAAACAAGCCATCGACGGCACCAAACGGTCATAATAAGAAAATCAAACAATACA
GCTAACAGGAACTCTTGTGGTCATCGGCCCTTTTATCAACGCTAGTGCAGTCTTACTGGG
TGGCGTTCTCGGCGCACTGCTCAGCCAACGCTTACCGGAACGTATCCGCGTCTCCATGAC
ATCAATTTTTGGTCTGGCATCGCTGGGGATTGGTATTTTACTGGTGGTGAAATGTGCCAA
CCTTCCAGCGATGGTTTTAGCTACGCTACTTGGCGCTCTAATTGGCGAAATTTGTTTGCT
GGAGAAAGGTGTCAATACAGCAGTCGCCAAAGCACAAAATCTGTTTCGTCACTCACGTAA
GAAGCCAGCGCATGAATCTTTTATTCAGAATTATGTCGCGATTATTGTCCTGTTTTGCGC
CAGCGGCACCGGGATCTTCGGGGCGATGAACGAAGGGATGACCGGCGATCCGAGTATTTT
AATCGCCAAGTCATTTCTTGATTTCTTTACGGCGATGATCTTCGCCTGCTCGCTGGGTAT
TGCGGTATCGGTGATTAGTATCCCATTACTGATCATCCAGTTAACGCTGGCGTGGGCTGC
CGCGCTGATTTTACCGCTGACCACACCGTCGATGATGGCAGACTTCAGCGCCGTAGGCGG
TTTATTGCTGCTGGCAACCGGATTACGCATCTGTGGCATTAAAATGTTCCCGGTGGTCAA
CATGCTTCCAGCACTCCTTCTGGCAATGCCGCTTTCCGCCGCCTGGACCGCCTGGTTTGC
CTGACAATGCGTGCAATATCGGCAAAGTGATGATAGATTGTGCAGTCTGCAGTAAATTGA
AGAAATTTGATTGACGAGACGAGGCGAATCAGGTTTAATGCGCCCCGTTGCCCGGATAGC
TCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGG
CACCACTAATTCTTAAGAACCCGCCCACAAGGCGGGTTTTTGCTTTTGGATCTGACAATA
ACCTTCACGAAAAAAATTAGCTTATAAAGTCTGGGGGAATTACTCTCGCCACGTTAACGA
GAGTAATTTTATTGATATTAATCTCCTGATACTTTACCCCCGTCCAAACTCCAGCCGCTG
CACATTCACCATCCCAGGCTTCTCAGCAGCACTGACATCAATTTGTGTCACCCGCAGCGC
ATATTTTTCATCCAGTGCGTTTAACCATTTCAGCAGGTCATTAAACACCACAGGTTCTAT
CCAGACCTGAATATTCTCCCCACGATCGGCTATCCGCCTGATGACCACCGAGTGCGCGGA
AGCACTGTCACTGATGACCCGCGATACCTGCGCAGGCGTTGTTGTGGCAGATTTTCGCGC
TGCAATAATATCCGGCGCGGCGTTCTTCAGTCGGGTGTTCATCGCCACCAGCTGCTGCAA
TATTGTCTCCTGTTGCTCAATCCGTTCGCTCAACGGCTGCCAGATGAGGACGTAATATCC
GACGCTAAACAGGAACACCACCGCTGCCAGTAACATGCCCTTTTCACGCGGAGAACGCCC
CGCCAGGTGTTGTGCCAGCCAGTGTTCGCCACGGCTTAACTGGCGTTCACGCCATTGCTG
AAAATAGTGAATAAATTTATCGCGTAACATGTTATTTCCTCCGCAACGTTACGCCGCCGG
AAACCGCATCACCCTCTTTCTGTAACGCGTCCTGTTGCACAACATAATCGGTTGCCAGTA
CACTACGCAGTTTGTCGAAACTGGCAAAGTTCGCGGCCCGTAGCTGGAGGTGAAGTATCT
GGCGTTTTTGATCAAAGGTAAAACCACGCATTTCGATGTCGGAAAGTGACGCTGATTTCA
GGGTGCTGGCTATCGCTGACAACTCGGCGAGCAGCCGGGTATCGTCGGCCTGTGGGCGAT
ATTTTTTCAGCGCCATCGTCACCTGAGAGCGTAAATTCACAATCCGCTTCTGCTCCGGGA
ACAACGTTAAGAACTGTTCCTCCGCCTGGGTGCGGCTTTGCGCCACCTGTTCGCTGACGC
TCCATAACGTCACGCCCCGCTCCACTGCCAGCGCAACCAGAATCAGCAATATCGGCAGAA
TCATCACCCGCCAGCGCGCCCACTGTTTTCGGTAGCTGACGCGAGGCTGCCACGGCCCTG
TCAGCAGGTTCCCTTCCGGTTCGCCATAAGTGGTAATGGCGGGCAGAGCTGTAACGGTCA
GGCGTTCAGCGTCTGCGCCAGCCCATGCTGATAGCTTTTCCGGTGCAATGCCGACTACGG
TTAGCGAAAGCGGTAAATCCTGCTCATTGAGCTGGGCGCGGAACATGACCGGAGCCAGCG
CCAGCCCGGCGCTCCATCCCCGGCATTCATCGATGCGGCAGATAACCCGTTGCGCATCGC
AAGCCATAAACCCACAAGGAATGGACATCCAGTCCGGCGCGACGGTAGCGCGGGTGATGC
CGTTTTCCTGCAACCACTGCGCAATGTTGCGCATATGCTGTTGGTGAATCACTGCTACGG
TTGCCAGTTGCTGGTCGATATTCAACGGGGCGAAATGCAGTTCATCGATATCCTGGTTCA
GCTCTTCTTCCAGTAAGGCGGGCAGAATAGTCGGTAGCGCAGCGCGATGGAAATGTCGTG
GCGCGCACCCTTGCGTAAAACCGTAAGTTGAATGGAATCCATTGAAGGTAACTGCCGCAT
CAGAGCAATCATTGCTCGTGGATCAGTGAAATCCTGCTGATTTAGCGCAATGGCGATATC
GCCTTCCTTGAAACCGCTGGCATCGAACAGAGAACGATCTGCCCCCGGCTTCGCTGCATA
ACCGACAATCCCCTCCTTACGCACAGGCGTAAGCTGGATATAGTTAAAAATTTTCTGCGG
ATCTTTCGCCAGTGCCTGACGCACGGCAGCCGGGATCTCAACTGGCACACTGACAGCAGG
CTCAGCAACAGCTTGCTTTGCTTCGTCACTGACGGCTTTTTTGTTGGTCACAGCAACAGT
GGAACGTTCCTCTTCTGCCAGACTCAGACGCTCTATTTTTCCCTGATAACGCAGCATCAC
ATGGTCGCGGTTGATTTCCTCAATCACCGCGTTGTGAGAGCCAAGCGTTTCACCCTGCAA
ATAGACCTGCTGTTTACCGCCTTCTTCAATAACCGCGCCGGGTCTGGCACCAAAGGCGAT
CCCACGCAGCACCACATTAAGACGCGTTTCTGCCACAGGCACAGGTTCGGGTTGTTTTAC
CTGCGCGGCGACAGGCTGATATTTGCCAAACCAGTTTTGCTGGCTGATTAATTGCACGTC
ATTTTTATCGAACGTTTTTGCATCCACACGGCTCGGTTTATTCACCGGTTGAGAAACCGC
CGTATATTCCGCAGAAAAGGAGATATAGCGCCAGAGTGAATGCGCCATTTTTGCAGAAAT
AATAAGCAGCATCAGCCAGAACATCCCGCGTGCAATTTTTCGCAGATGCTCTTTGTCTGT
ATTAAGAGATTGTCTCTGGTTAAGAGTGTGACGAATTTTTGTCAGCCATTGAATGAGATA
AATTCGTGCGTCACGAAAAACAACCCGCGCCAATTTATATCTACCCGACGTTATGCTTTG
ACTATTCCACAGGTGGTACGATCCAGTTTCCGCTGATACTGGTTACCTGTACGTGTATCA
TTAATCGTTATGCTGTAATTAATTCCCTCAGTGATCATTAATTTCACCGTCGGGTCAGCG
CACATTTGTCGTTGATAGCTGGTTAAAAAGGCGTCAGGCGTCTGCGTGGTTTGTGTACCC
GCTTCGCTGATAATGGTCATTTTTACCGTTGTGCCGCTACTTTGCGCCAGCACTAAGGTA
TATCCCGCAGATTTAATCGGCAGGTTTTGGCTGATATTTTGCGCCTGTTTTTTCGCCAGT
AAACTGGCATTTTCATTATGGCTGGCACAGCCACTTAATAATCCTGTAACGCTCAACAAT
AGCGATATTAATACCCTCCCTGGCATTTGTTTTATCGACATGGTAAATAATCTCTAAGGT
TATTAATAAGAGTTAAAATGTCACTTTGATAATGACGTGGTTATCATTAAAACAATGCCT
GTAGATAAAGTGTTGCTATACCGCCCAGACTTAAACACGGTCCAAAAGGCAGTGTGGTTG
ATCCTCTTTTTGTAATAACGGCATATATCAGGCCGCAGCATGAGGCGATTAAAGCAACAT
TGGGCAGCGACAATGCCCCCACCCAGCCACCTAACGCGGCGAAAAGTAATACATCGCCCA
TGCCTAATGCTTCTTTACGCAGAACTATTCCGGCTATCCAACGCAGAGAGTAAAAAGTGA
TAAATCCCACCAGGACGCCGGTGACTGCATCTTGTAGCGTGAGCGGACTCTGCTGCGCCC
ATGCCGCAATCAGTCCTGTCCACAATACGCCCTGAGTAAAAACATCGGGCAGCCATTGGT
GATCGAGGTCGATGACACTCGCGGCAATCAGCCAGGCGGATAATATCATCACCGCCAGCC
CCCATCCACTTTCTGGCCAGACCAGACTCGCCAGCAAAAAAGCAAGTGCTGTCAATAACT
CCACCAGCGGATAACGCTTGCTGATTTTCGCCTGACAGTCGCGGCAGCGCCCTTTGAGCA
TCAGCCAGGAGAACAGCGGAATATTGTCACGTATCCGGATGGTCTGCTGACAATGTGGGC
AGTGCGAACGCGGTAGCGCAAGGCTTATTTTTGACTGCGCACTCGACATTTCACCGTGAA
ACTCCGCCATTTGTTGGCGCAGCATGATTGGGTAACGCCAAATCACCACATTCAAAAAAC
TGCCGATGATCAATCCTCCGACGGTTGCCAGGACGGGCATCGCCGTGGGGTATTGCTGAA
AAACATCAAAAAGCATGGTTAAAGGTTGTTTGTTGTAACTTGCTGGATGCGGCGTAAAAC
GCCTTATCCGTCCTACGGGTGTCTGCCAGCGCAAATAATCGCGGCTTTCCCCGTCTGTAG
GCCCGATAAGCAGGCGCATCGGGCAAATGTGTTAACCCGGTGCGCCTTATTTCATGCCGG
ATGCGGCGCGAGCGCCTTATCCGGCCTACGGGCTTACTCGGCAGACATCTTATGCTCGGT
AACCTGATTAATGGTTTCCGGTCCCTGTTCCGGTTTCGGCAGATCGAGTGACGCGAGCGT
GTTGTAAGCCGACTGGCTCACACCGCCCTCGAAGCTCATCTCGCTCGCCCCCGGCAGCTG
GTAAGCATTCGCGCCCGGATTCCATTTCTTAAAGAACTCCGAAAGATCCGTCTGGGCGAC
CCAGGAGGCACACAGCATCAGCGTGTCCGCTGCGTTACCGTTGGATTCAGCACAGTAATT
CTTGCCGCCAAACTTGTCATTGCTGACCTCATCGCCGCGTGCTTTACGATGCATCAACTG
GAACAGGTTCCAGCCTTTCATCCCTTCACGCTCGCTGTAAAACTCTGGCAGAGGAGTGCC
ATCTGGATACCATTTCTTGATATCAAAGTTTTTCTCTGCCCATTCCTTCAGCTGTGCGTA
CATCAGCAGACGGTCACCCGCACCGCCGCGTGCCCATGCCTGGTTGTTGCTCTCCTCCAG
ATATTCCGGTGCGACGGTAATATCGTCAGCGACACGGTTCATCTTGCCGAGATAACGATC
CTGCATGTACAGCGCCAGCACGTTGTTAGCGACTTCAGTTGCACCCGGTACAGTCAACGG
CGTTTCTGCGGCGTTATGACCGACTTCATGCCAGATCAGCCAGTCGTTCAGCGGCGTCGT
CGGCAGCGTGGTGCTGTTCGGCGAGAAGCTGCTGTTCATTACCGGATAACCCGAATGCGC
ATCACCGATGGAGATCTGCACATCGTTGGTGAAACGATGTTTGTGGCCCGGCAAGTTTTT
ATAGGTAAACATCCGGTGCTTACCGTCTTCGCTATCACGGCCGTAGAAGTCATTCATCGA
GCTGGCAAAGGTATCCAGATCGTTAGCGAATTGCTCCAGTCCGCCAGTGTAATTGCTGGC
ATTCAGGTTCTTCTTCGGTGTGGTATAGACGAAAGCGTCTGATTCCAGCTCACCCAGCGG
AGCCGGTGAGTTCAGATCGTTTTTCCATGCGCCGTCTTTATAGAACGGTGCTTTTACCAC
GCCAGTAAAGGTGAAGCTGGCAGATTCATTGGTAGAGCTATTGCCCTTGATATAAATCAG
GCCACCGTAAGGCACCTTGAACTTCACCGTACCGCTAGCGTCCAGAGAGTACGTTTTAGT
CACTCTTGGCGGACGGTTCAGCGCAACTTCATGCTTCTCACGTCCGGTCAGGTCGTCAGC
CAGCGCCACGGTGACGGTCACAGGAACGTTCGCATTGGACTTAATGGTGACCTCTTTCTG
AGCCGGTGCCCACAGGCCAGTTGACTGCATGTTACCTGCAAACCATTTGGTCGGATTCGA
GTACAGGCTGATGGTTTCAGTAACGTTCTGTCCCTCTTCCGATACTGCTCCCGGATACTT
CTCGACATCAACTTTGATGTTCAGATCCCACCAGGAACGGCCCAGCATCAGGCGTGTCAG
CGGTTTTTCCATATAGTTGAGCGGGTAGCTCGGGTTCATCATGCCCGCTTTGCTGCTACC
GTCACCGTAGATCATGTTGTTATCGACCAGCGATTTTTTCAGATCTGCAGAACACTTGGT
GCCGCCTGCATAGGCATCATTGGCGTAGCAGTTCAGGAACTCGGTGAACGTTTTAAAGCC
CAGCTCGTCATTTTTGCCTTCTTCATAACGATAGCTCGTATCGTTCCACAGCCAGACCGA
CATGTTCTGGTACAGACGTTCCAGATCGACGCTGCTCAGACGCTCACCTTTGCGACCATT
GGTCCGGAAGTAGAGCTCATGCTGATACAGACGCTGAATGTTGGTGCCTAAATCCGCAGC
CTGCACCATCGCTTTTGCAGTGTCGGCGTTAAGGCTTAGTTGCGTATACTGTGGAACATA
CATGCCACCAGTAACCGGAACCCCCGTGCCAGGACGATATTCCAGGCAGTTGACCTCATA
GTGATATGCCGGATTAGTACACTCTTTCAGCCCCGGGAACGCGGCGAAAATTTTCTCCTT
CGCAGCCTTCAGAGAATCCTCTGTTTTATGATCGGCCTCATCAATAAAGGCATAACGCGT
TTCCTGTTTGCCATCTACATCTTCCAGCCAGCTGGCAACTTCCAGCTTCGGTTTGTCATC
AGGTTTGTTTTCTACCTGATATTTCCACTTAACTTCCCCTGTCTTACTATCGATGGTGTA
CGGCAGCGCACCATCTACGGCAGGATAACGTTCATAGACCCAAATGCCCGTTGCGCGCTG
CTGACGAACGCGGTTCGGATACCCTTGCGGATCGTTATTTACTACCGACTTGTTCAGTGC
CATCGACAGACCTGCGGCATCCAACAGACGCACAAAACCAGACGCGCTCTCTTCCTTAAG
ATTGCTCATCACGTTTTCCATGATCAGCACCGATCCACCTTTGTTCAGATAGGCGATCAG
ATCGGTCACATCCTGCTGAGTCAGCTTCGGTTTGCTGGTATCTGCACGCAGCGGGATTGC
ATAAGGATCGTTACCCACCTGAGTCACATATTCAAAGCCGTTAAGGATCAGCAGCGGCAT
TTCCTGCGGATCGAGATCGCCATAGCTACTTAAATGCTCAACAGAGATGCCCGCAAAATC
CGGATGGAAGTCGAACGCAGCGCTGTTTCCTGTAACCTGACCATGACGTTTAAAATAGAC
AGTATCCAGGTTGGTGCCTACGGTCATGCTGGCTTTCGCGTCCGGCTTCCATTTATCGTC
GGACAGATAGCGCAGCACGTTCTCCATGAAGTTCTTCATGTCATCCGGGTCGCTGTTGAG
CGTACACTGCCCATCTTTATTAACGCCCCCGTTCCAGCTGTAACCGTTCGGGCAACGCAA
AATGCTGTTGTAGTGTGGGTTACCGATAACCATCAGTTTGCCCTCACCGACTTGCCCCAG
CGAAATAAACGGCAGGTTAAAGGTGGCGGTATCGCGCGTAACGTTTTCCGGCTCAACAAG
AGAAGGCGCTTCCGTAATGTACGCCAGCTCGTTTTTATCCCAGGCGCGTTTTTCGCCGAA
GGCCAGCCAGTAGTTTTTATCATTACGCGCCATCAGAATCGGGAAGGCCGCGTTGGAGAT
ATTCACCACCGCCTGACCGCGCGCATTACCCGTGCTGCCATAGAAGTTGGTGGAGTCATG
GAATACATGGAACTTGCTGACAGATTTGTAGTTCGTATCCACGCCCCACAGCTTGTTGAT
AACGCCCTGAATCTGGCCGTCATTAACATTGCGCGTCGTCAGCGAGAACCAGCGAGCCTC
GTTACAACCATCGGTTTTCGCACAAATCGCGGTATCGATCTCTTTGGCCTGACCCGTATT
AAACTGCTCAATAAATTCGTTAGGCAGATTAACGACTTGCTCACCTTCCCCCAGCGTCGC
ACCGTTGGATAACGAGAGATTGATAATCTCGTTGATCACGTTGGGATATTCGGCAAAGAC
CTTGCGTACATCGTCCGGAACAACACGGGTATTATTTTGCCCGGTCGTCGAATAGCGATG
AATAAGCTGATCAATATTCGCCCCGCGAACTTCATCACCCAGTTCAGTCAGCGCAATGGT
CGACTTATTGCCGCGCACTGAACCCAGTTCAAAGGTATCGATACCAAAGGAGATGGTTTC
GCCCCAGCTAAAGGAAAATTCACCATTTTCCCCTGTCACGCCACGGCCTGAATTGGTGTA
GTAGTTGACGCCAGCAACACCATATCCCTGGCTATCGACCAGTCGACCTTCAGAGAGAAT
GATTTCAGTGGGTTGATACTGATAAAACTGTTCCGCGTTAGCCGACACGAAGGAAGCGTT
CAGATCCGGTTTTGTTCCCGGCGTGGTGACGGGCACGACCGGTGAAGTATGAGTGGATGG
CGCTTTATCGGTCGCAGCATTGTTTTCCACCTCTTCATTGACCAGCTTTTTGAACTCTTC
CGGTGCCAGATCGATTTGCTTATACAGCGAGTCGAAGCGTTTACTCTCGATCACCGAGGA
GAACGTCAGACAAACCTGTTCTGTATTCGCCGGACAGCTGTTACTGGACGTTACCAGCGA
AACCGCATTGCTTTTCTTGTCATCGGAGCCCGCCAGTTCTTGCGCGTCCTCAAGGCTAAA
CGACACTTTTTCAACCGCACGCAAGCTACGCGCAGCTTCTGACTGAGTGTTGAAGGTGGC
AATTGTCGTGTTACCCGCCACGCAAGTAACGTCCTCGCCAGGTTTAAATGTAAAGCCATC
GCTGGATTCACCATTACAGGTAGCACCAGTTACCCGCTGGCTTCCGCCCAGGGTCAGATA
ACCCGTTTTCGTAGGAACAGGTTCTGGCTCCGGTTCTGGTGTTGGTTCAGGATCAGGTAT
CGGTTCTGGCGTAGGCTCTGGGTCCGGCGTTGGCTCAGGCGTCGGCTCCGGGTTTGGTGT
TGGATCAGGTTTCACTTCCGGCAAAGACCCTGTTCCAGAATCTACAGGCGGCGTATCGGA
GGAAGATCCGGAACCACCGCCATCACAACCGGCTAACAGGGTTGCGCTCAAAATAGCCGC
TAAAAGCGATTTCTTATATTTAAATTTCTTATTCATTAATAACGCAAGTGACAAAACAAT
GTTAAAAAATTCGTAACTGGGAGAAATAGTTTTATGCTTTATCTTCTCTAATAACTTCCT
CCATTCTTAAGAAAACGACATCATTGATAGAAAACAGGTGAAATTTATAAGAATAACCCC
TATACGATGTCTATCTGGCTATTTTTACGAAATTTCAACAAACAAAAAATTAACAACATT
TCACAACGTAACTATATAAATTTGTTGGTAGTTTTAACGATTAAGATTGCAAAAGCAACA
GATAGAACGG