MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download OCR70,L90-5 (LD 20-1_P/O).seq
 Deletion OCR70,L90-5 (LD 20-1_P/O)
 Length 239225
 Fasta Format

>OCR70,L90-5 (LD 20-1_P/O)
ACCGGAGCAGGCTGCGGCAGGGGGGGCGCTTTTCCCCTCACCCTAACCCTCTCCCCAGAG
GGGCGAGGGGACCGTATTGTGCAAATATTGTTACCCCAGCAACAAACAGGCTCATACAGC
CCCTAACCCTTTCATGGCGATGGCTGGGACGGTTCAGACCTTGCCGAATATTCTCCAGCA
CCGTCTCCATGTTTTCACCACAACAGCTATTCGGCTCGGTCTGCCCCCTCGCTCTTTCAG
GGAGAGGGTGACCGGCGGTTCAGTTCCTGCAGAATATTCTCCAGCACCGTCTCCTCATTA
CAATCAATCTCGTTATTCCAGAAACGCAGCACGGTCCAGCCCTGCGACTCAAGCCAGCTA
GTGCGCCTGGAATCATAGGCAACTGCTAAATCATGCTGCCCACCATCCAGCTCAACGACT
ACACGCGCCGAGCAGCAAGCAAAATCGAGAATGTAGCTCCCCACTGGATGTTGACGGCGA
AATTTGAAATCACTAAAACGTCGGCTGCGAAGATATCGCCAGAGCTTTCGTTCCTGCAAA
GTGAGATTGCGTCTTAAATCACGCGCATTTGATTTAATTTTATCTATCACCTCATTCTGA
CAAGATTTAATCTTTTGTCAGAATGAGGTGAATAATCTGGAAGGAGGATTCAGAAAATTA
GCGATCTTTACGCCACGCATCCGCCGTCAATGCCTCGCCAAAATGACCGGCAATCAGCCG
TTTGGTGAGTTCATGCAGCGGCGATGCCAGCACATCCGCGGTGCTGCCTCGCTCGACAAC
CTCGCCCTGATGCATCACCAGCACCTGGTCGCTAATGTGCTTCATCATTCCGATATGCTG
GGTAACATAAATATACGAAATGCCCTGTTTTTCCTGTAATTCCAGCATCAGATTAATCAA
CTGCGAACGCATCGACATATCCAGTGAAGCGAGGGCTTCATCGGCAATAATGACTTTTGG
GCGCAATATCAGCGCGCGCGCCAGACCCAGACGCTGTTTTTGTCCGGGTGCCAACATATG
CGGATAGTAACTGACGTGATCCGGTAGCAGCCCAACCATACGCATCGTTTCAATAATCTG
TTTGCGACGCTGTTCCGGTTCCAGGTCGGTGTTCAGGCGCAGTGGAAAATCCAGAATTTG
CGAGATACGTTGACGGGGATTCAACGAGGTCGAAGGATCCTGAAAAATCATGCGAATACG
CTGACTGCGGAAGGAATAATCGCCAAAATGCAGTGGATGATCGTCAATCAATAACTCGCC
GCTGGTAGGCTCTATCATTCCCGCCAGCATTTTTGCCAGCGTGGATTTACCCGAACCATT
CTCGCCAATAATCGCCAGTGTCTGGCCTTCACGTAGCGTAAAGCTCAAGGGTTTTACCGC
TTCTACGGTCTGACGACGAAACCAGCCGGTCCGGTAGCGGAACGTTTTACTTAAATTACG
CACTTCAAGCAGCGTTTCGATCATCTCACTCTTTCTCCATGTTCAGCGGGAAATGACAGG
CATAGAGATGATTTTTCGCCCCCGTCAAACGTGGCGTCACAATGCATTCTCGTTGTGCAT
ACGGGCAACGTGGCCCCAGACGACAACCAATCGGTAACTGTTCCAGCAGTGGGATAGCGC
CGGGCAGCGTATTGAGGCGACTTTTATGCGGCATCGCGCTGCCGAAGTCTGGTATCGCGC
GGATCAGCGCCTGGGTATAAGGATGATGTGGCATCGTCACCAACTCCTTACTCGGCGCGG
TTTCCACTGTTTGACCGCAGTAAAGCACGTTAATTTTATCCGCCCATTGGCTAAGCATTT
GTAAGTCATGGCTGATAAGCAAAATAGTGGTATTGCTGTTTTGGTTGAGACGCGTCAGCA
GGCGAAAGATTTGCGCCTGGGTTGTTGGCTCCATTGAGTTGGTCGGTTCGTCAGCAATCA
GCAGACGCGGTTGATTCGCCAGTGCAATGGCTATCATCACTTTCTGACATTCACCTTCGG
TCAACTCATAGGGAAAACTGCGCATCGCATCTTTGTGATCTTTAATCCCCACGCGGTGCA
GCAGTTCAATGGCACGGCGTTTGCGCCAGCCAAAACGCTGCCACCAACGGCCTTTATAGG
TCCAGGCTGGGATGTTTTGCATCAACTGGCGGCCCACACGTTCTGAAGGGTCAAGACACG
ACTGCGGTTCCTGGAAAATCATCGACACGTTATGGCCAACCAGTTTGCGCCGTTCGCGTG
CGGAGAGACGCAGCAAATCGATATCATCAAAACGCATACGGTCAGCAGTAACACGCCAGT
TATCTTTATTCACCCCACAAATCGCTTTCGCAATCAAACTCTTGCCGGAACCGGATTCAC
CAACAAGACCGCGGATTTCACCTTCGGTTAAGGTCATACTTACCCGGTCGACGGCTTTAA
CCCACTCATCACCGGTTTTAAATTCAATGGTCAGGTTACGAATATCGAGTAATGGCATTA
TTCCACCCCCGCAATAATCGCACGACGAACGCCATCGCCAAGGAGGTTAACCAACAACAC
GCTAATCATAATTGCCGCACCTGGCAGCATGACAGTCCACGGGGCGACATAAATCAGTTC
CAGCGCATCACCGAGCATCGCTCCCCATTCAGGCGAGGGGAGTTGTGCGCCGAGATCGAG
AAAGCCCAGCGCGGCGATATCGAGAATTGCCATCGACAGTGCGCGGGTGATCTCGGTGAC
CAGCCCGGCGGTGATGTTTGGCATCACAGCAAACCAGAGAATATTCAGCGTTGATGCGCC
ATCCAGACGGGCGGCGATAACGTACTCTTTTTCCAGTTCGTCATGCACCATGCTGTAAAT
CGAACGTACCATACGCGGCAGCAATGCCAGCCAGACAGCAAACATAGCGTGGGACAAACT
CGGTCCGGCAAACGCTACAACGATAATTGCCAACAGCAGCGAAGGGATCGCCAGTAAGGT
ATCCAGAATATGGTTAAGCACCGCTGAGCGGAGGCCGTGTGTCGCCCCGGCGAAGGTGCC
CAGTACCAGGCCACAGATCGTCGCGGCAAGCGTCACCACAAATGCGCCACCCACGGTTGG
CGCAGCTCCGCTCAGTAAACGGCTTAAAACATCGCGTCCGAGGTCGTCAGTCCCCAGGAA
GAAAGAAACTTCGCCATAGCGCGACCATGACGGCGGCAATAATTGATAACCGAGAAATTG
CTGGTCGATGCCGTAAGGCGCAAACCAGCCGCCAAAAATACACAGTACAGCCAGCCCCGC
GCAGCCGTACAGGCCGACCATCGCAGAGGCGTCACTATAAAATTTGCGCCAGGCGGTACG
CAGCGTGCCCGGCGGGCGCTTTTCGCTGTATACGCTATCGTAAGGCATACCATTCCTTAT
GTTTCAGAGGGTTAGCCATGGCACCCAAAATATCAGAAATCACGTTAACAATAATGACCA
GTGAGCCACACACCATCACTCCGGCGGAAATGGCTGCGTAATCCTGCTGGCGGATGGCGT
TAATTAACCAGCGCCCTAAACCCGGCCAGCTAAAAACCATTTCGGTGATCATCGCCAGCG
TCAGCATGGTGGAAAACTGTAAGCCCAGGCGAGGAATAACCGGCGGTAACGCGTTATGCA
GAACGTGGCGACGCAAAATAGTAAAGCGCGACAAACCGCGGGTCGCCGCCGCTTTTACAT
AGTTCTGGTCATACACTTCGATAGTGCTGATACGCATCAGGCGGATCACTTCAGTTGTTG
GCGCAACCGACAGGGTGATCACGGGCAATATCATATGGCGGATTGCGCTCATGATCATTT
CATCCCGCCATGGTGAGTCCGAAAGCCAGGCATCAATCAACGCAAAACCGGTAATCGGTT
TCACTTCGTAGAGCAGATCGAAACGCCCTGAAACGGGCAACCAACCTAGCGTGAGTGAAC
AAAACAGCGTCAACAGAAGCGCCAGCCAGAACACCGGGATTGAAAAGCCCAGTAAGGCGA
TGGCGTTGATCAAGTTATCCTGCCACTTATGGCGCGTAATCCCGGCAATCATCCCCACGG
GGATGCCAACAATCAGCGCAAAACCGAAGGCGAGGATGCACAGTTCCATCGTCGCCGGGA
AGACCTCTTTTAACTGTTCGGCAATCGGTTGACCGTTAATGCTGGAAACACCAAAATCCC
AGTGGATCAGGCCGTTAAACCAGAACACCCAGGCATTCCACAGTGACGCGCCTTGTAACG
GCGCATGAGGGGTGAAATAGCTCAAGCTGAAGCCAACGAAGGTCAGCAGGAACAAGGTGA
CAATCAATAACAAAATGCGGCGTAAGGTGAAGATAATCATGGTTTTTTCACCTCATCCTG
TTTCTCGCGATACACCCCAGCAAAGGAGGCGTTACCAAACGGGCTAAGTACCAGACCTTT
GATATCGTACCGATAGGCCTGCAAACGCAATGACGACGCCAGCGGCAAAATGGGCAATTC
CTGCGCCAGAATACTCTGCGCTTCGTCATAGGCTTCAATACGCGCCGCCAGCTGCTGCGA
AGAGAGCGCCTTACGCAATACGCTGTCGAATTTCGGATCGCACCAGTGGGCGAGGTTGGT
CTGCGAATGAATTGCCGCGCAGCTCAGTAACGGACGGAAGAAACTGTCCGGGTCGTTACT
GTCCGTCGCCCAACCGGATAACGTCAGATCATGGCTCATATCCATCAACCGCGCCTCCTG
AAAGCGACCTTCTACCGGCACAATCACCACTTTTACGCCAACCTGCGCCATATCCGCCTG
AATCAGTTCGGCAGTTTTCAGTGGACTGGGGTTCCACGCCTGCGAACGTGTGGGCACCCA
CAGTTTCAGCGTTAAATTTTCCAGCCCCAACGACTTCAACTGTTCGCGCGATTTCGCCGG
ATTGTATTCAGTAATTTTAGCCTCGTTGTCATAGGCCCACGAGGCGCGCGGTAAAATAGA
GGCCGCCGTTTCAGCCGTACCATAATAGATGGATTGCATCAGGCGCTGGTTATTAATCGC
CAGTGCCAGCGCATGGCGGACAGCGGGATTATTTAGCGGCGGTTTGGCGGTGTTAAATGC
CAGATAGGCGACGTTCATCCCAGGACGCAGCGTTAAACGCAAGCGCGGGTCGTCACGCAA
AATGGATAGCTGGCTGGCAGCAGGCCAGGCCAGAACGTCGCATTCCCCGGTCAGGAGTTT
CGACAGACGTCCGGTGCCGCCGGAGCCTAAATCCACCACTACCTGCGGCATTAACGGTTT
ACCGCGCCAGAAGTCATCATGACGTTGTAGGCGAATAAATTGCCCGGCGCGGTATTCCGA
CAACTGATACGGACCGGTGCCGACCGGTTGACGGTCGAGTTGCTCCTGGCGATCTTCTTT
CTCTAACTTCCGGGCATATTCTGCCGACATGACCGAAGCATAATGGGTTGCGAGGTGCCA
CAAAAAAGAAGCATCCGGCTGGGCGAGTCGGAACTCAACGGTATGATTATCCAGTTTGCG
GACGCTTTTCACGTTATCGGCAAATTGCAGGCTGTCGAAGTAGGGGAAGTTGCTGCCGTT
GACGTTATGCCACGGGTTGTTGCGGTCAAAAATTCGCTGGAAGGTAAACACCACATCGTC
GGCATTCATTTTACGAGTGGGAGTAAACCAGTCGGTTTTTTGAAACGGAACATCGCGACG
CAGGTGGAAGCGATAGGTCGCGCCGTTGTCGAGTACTTCCCAGCTTTCGGCAAGTTCCGG
CATCAGGCGATAGGTATAGGGATCGACATCCAGCAGTCGATCATAAAACTGGGCGGCAAG
GGTATCGACAATTAACCCACTGCTCGCTTTGGATGGGTTAAAGGTGTTGACTTGCCCGCT
GACGCAATAGACAAAACCGCTGTCGCGGATATCAGCATGCGGGGGAGATTCAGGCGCGGC
GATTGCCTGACCACTCACAAGTCCAGCAATCACCAAAAGAGACGATAATACCTGGCGCAT
AATATTAAGGGATTTTATGTAAAGAGGCTATCTTACTAATATTTAATGACATTTGCCATT
ACCGTTTGTGTTCAGGGGTCGTAATGAGGGCCGTGTGGTTGGTCGTTGAACAGGTGACGT
CGCCATCTGTTCAACATTCGTACCCGTGATTTCTCTATAACTATAACTCACAGAACAACT
TAGCGAGGAGCAGAGCGGTACGATCGTGAGAAACCCATTAAAGCACGCTGCAGTGCGTGT
CATTGTTAGCCAGATGCGGCGTGAACGCTTTATCCGGACAACGATACTGACCGATCGTCT
GCAATTAAATCATTACTCATTACCCCATTGATTCAAAAACTCTGCGATCTCATCAATGCG
TACGGGATTAATCCCCGCTTCAGCAGCCATTTCATGTTGGGCTTCTTCGCTGATCTCTTC
ATTGTTCATCAAACGGGTGAGCAGTAACTGGAAGTAGTGGGCCAGCGGTGTGCGTTCAGC
CTCTGCGACAGGCTCTGCGCATTCGGTCGCGTACTCATCGGCAATATCAAAATATTTTAG
CGGGATATCGTGGTTCATTATTTGCCCCTGGGGTTAATGCGCTAAGCATAAGGGCGGATG
ATAGCACTCGTGATCCGGGTCATACATCTTTTTATAGTTAATGGCGCGGCGCGTTACCCT
CAGGCAGGATAATGCGCCGCGCATCCGACTATTACGTTTCACTCACCGGCGTTCTGTCAC
CATCATACAACGGCACTTTGCGATAGCGGCGGATCAGATACCATAAATATGCGCCGCCTA
ACGAAGCCCATACCAGACCGAGTGTCAGTGACGTTGACTCGAGGTTAACCCACAGCACAC
CCACCGTCAGCGCGCCAACCAGCGGCATCAGCAAATAGTGGAAGTGATCCTTCCAGCTTT
TATTCATTCCTTTACGCCGCCAGAAATGATTAAACACCGACAGATTCACGAAGGTAAACG
CCACCAGAGCACCGAAGTTAATTAACGCTGTGGCGGTAACTAAATCGAAGAACAGCGCCG
ACAACGCGACAATCCCGACCATAATGACGTTGAGTGCCGGAGTCCGCCATTTTGGGTGCA
CATAGCCAAACACGCGCTCCGGAAACACATTGTCACGCCCCATCACATACAGCAGACGCG
ACACGCTGGCATGTGAAGCCAGGCCAGAGGCTAACGTGTTCACAAACGTGGTGCAGAGGA
AAATCGACTGGAAGAGCTTGCCGCCGACGTACAGCGCAATTTCAGGCAGTGCGGCATCCG
GATCTTTAAAGCGGCTGATATCGGGAAAGAACAGCTGCATAAAGAACGACGCCGCGATAA
AGATAACGCCACCGTAGACCGCCGTCAGGAAGATGGCTTTCGGGATCACGCGTGCGGCGT
CCGGCGTCTCTTCCGAAAGCGTGGTCACCGCATCGAAACCGAGGAAGGAGAAACAGACAA
TCGTCGCCCCGGTAATAATCGGGATCAGGTGCGCGTTCTCGCTGATAAACGGCTGAAGTG
ACCAGACGGTGCCAACGCCTTCTCCTTTATGCAGTCCCTGAACTACCAGGAAGATAAACA
CCACCATGATGGAGATTTGCACCAGTACAAACAGGGTATTGAAGTTAGCGACCAGGTTGA
CGCTCTTCAGATTCGCGGCGGTTAAAATGGCGACGAAGGTTACCACCCACACCCACGGCG
GCACTTCCGGGAAGAGGGCGGAGAGATAGATTTTCGCCAACAAGACGTTAATCATCGGCA
AAAAGAGATAATCCAGCAGCGATGACCAGCCGACCATAAATCCGACGTGCGGGTTAATCG
ACTTTTGCGCGTAGGTATAGGCCGAACCGGCCTCCGGAAACTGGCGAACCAGTTTGCCGT
AGCTGATAGCGGTAAACAGCACACCCGCCAGCGCCAGCAAATAGGACGCCGGAACGTGAC
CGTCGCTAATGCCGGAGACAATACCAAAAGTATCAAATACGGTCATCGGCGTGAGATAGG
CCAGACCCATCATCACCACCTGCCACAATTTCAGTGATTTTCGCAGACGGGTTTTGCCGG
GTTGCGCAGCAATATTCAGTGGTGAATTAATAGCCATAATTGCTGCCTCCCCTGCGTAAT
AAGGTTTGCGGTCGTGTCGACCTGAAATCAAACCTGTTTAGCAAGGGAAGCAAAGGGGGC
GGAGTCCAGTCAGTAGCAGGAGGGGCGCATACGCAGCCTCCCTCGCCATGCGGGGATTTA
ATCATCGGCATCATCTCATTTCCTCGTCACAGTCTTAATCGTTAACGGAAGCCCGTTGCC
GCCCGCGCTCCATAACGCGACATCCGGGAAATGTCTGGATTACCAGCAAATGTCAGGCCT
GGCTCCGCTCAGGCCGATGAAACAACCCCGCAAGGGGTATTACGCGTTTTTCAACATCCA
CTCAATTTCTGTTTCTGTGATGAGGCGCTCAAACTGCAACAGCTCATCATTTTTACAGGC
GTGATAGACATGGCAGAAGCGTTCGCCTAAATAGCGGCGCAGGTGATCATTCTCGATAAA
CTCACCCAGGGCATCGCTCTGGCGAATCGGAAAGGGTAAGCCTTCCTGTTCCAGCCCGTT
GCCTTCGACTTCTTCCTGCAACGGCAGCTCGTTATCAAGGCCATGCAAAATACCGGCAAA
AATCGCTGCCATCACCAGATATGGGTTGGCATCGGCACCCGCCACGCGATATTCCACGCG
GTGATTATGACGGTCGCCGCACGGAATACGCAGGGCGACGGTGCGGTTGTTATGGCCCCA
CGACGCCTGCGTCGGCACATACATTCCCGGCTGGAAGCGGCGATACGAGTTCACGTTTGG
TGCCAGCAACGCCATCGACGACGGCATCAGGTCAATCATCCCGGCGAGCATCTTTTTCAG
CAGCGGCGAATCTTCGCCTTCCGCGTCAGAAAGCACGTTCTCGCCACGATTATTTTGCAT
ACTGATATGGATATGCATTCCGCTGCCCGCGTGCTCTTCATACGGCTTCGCCATAAAAGT
GGCGTGCATCTTATGCTTTTCTGCCATCAGACGCACCAGGCGTTTTAGTGCCAGCGCATC
ATCGCAGGCTTCCAGCACGTTATCAGTATGGTAAAGGTTGATTTCAAACTGACCCGGCGA
GGCCTCAGCGACCGCGCCATCTGCCGGAATCAGCTGTAACTGCGCCAGTTCATCAATATC
ATTGAGCACGTCGGCGAAGTGGTTGAGGTTATCAACGGAGTAAACCTGGCTTTGTGTATT
GCGGTCATCGGTGCCAGGCGCGCAGGGCGGTTGCAGATACCCTTCAGCGTCGCGCTGGCG
ATCCAGTAAATAGAACTCCAGCTCTACCGCTACGACCGGGAACAATCCGCGCTGGCGCAG
CTGCTGCCACAGGCGGTTAAGAACGTTCCGCGGCTCAACGTCAAAGGGAGCGCCATCTTC
ATCGACCATGGTCAGGAGCATCTGACCGATAAACTCTGGATCGGCGGCAGAAGGAGTTAA
GGAACCGAGAACAGGAACACAGGTACGATCCGGCTCGCCCATTTCCTGACCCAGACCTGC
TTCTTCTACTACGTTGCCCAGAATATCCATTGCAAATACCGAGGCCGGGAAATAACACCC
TTTCTCGAGCTTCTTCAGGCTTGAAACAGGAATACGCTTTCCACGGAAGCAACCATTTAA
ATCGGTAAGTAAAACATCAACATATTGCGTATTCGGGTAGCGCTCCAGGTAGCGTTTCAC
TTCCTGCGTAAAGGCGCTACCCCGCCTCTCTTCTGACTGCTGAACAAAGTTCTCTACTTC
AACGATATTGGTTTCCATGATTCTTCGCCTTTGGTTTGTTTTCCGCTCGTTATCAAAGCG
TAAAATATAATGACCACCATTCGAATCTGTATGCAAACTAAATGTTTGTCAAATGTTAAA
TTGAGTTTGCAAAAATGAAAACCCACTGCTAGATTGAAAAAATATTGAACATAAAGGTCA
TTTAAAGCGCAGTAATGGCGATAATTTAGTCCACTTTGTGAGATTGAGCATGGAAAATAT
AATGAACAATCCGGTTATCGGTGTCGTAATGTGCAGGAACAGGCTTAAGGGTCATGCGAC
CCAGACTCTGCAAGAAAAGTACCTGAATGCCATCATCCATGCAGGCGGCTTGCCTATTGC
GCTACCACATGCGCTGGCGGAACCGTCATTACTTGAACAACTTTTGCCGAAACTCGATGG
CATTTATCTTCCTGGTAGTCCCAGCAATGTGCAGCCGCACCTATATGGTGAAAACGGCGA
TGAGCCTGACGCCGATCCCGGGCGTGATCTTCTGAGCATGGCGATAATTAATGCCGCACT
CGAAAGGCGCATCCCCATTTTCGCCATCTGCCGGGGTTTACAAGAACTGGTGGTGGCAAC
CGGTGGTTCGTTGCATCGCAAGCTGTGCGAACAGCCTGAATTGCTGGAACATCGGGAAGA
TCCCGAACTGCCGGTGGAACAGCAATATGCACCGTCGCATGAAGTTCAGGTTGAAGAGGG
GGGATTACTGTCTGCGTTGTTACCTGAATGTAGCAACTTTTGGGTAAACTCTCTACATGG
ACAAGGGGCGAAGGTCGTTAGCCCACGGTTGCGTGTTGAAGCTCGCTCGCCGGATGGCTT
AGTTGAGGCGGTTAGCGTCATCAATCATCCTTTTGCGCTGGGCGTACAGTGGCACCCGGA
ATGGAACAGTAGCGAGTACGCGCTTTCGCGTATATTGTTCGAGGGCTTTATCACCGCTTG
TCAGCACCATATCGCTGAAAAACAGCGACTCTGACCACTACAGTTTAAGGAAATGCAAAT
ATGAGTGATGAGGGACTGGCGCCAGGAAAACGCTTGTCGGAAATCCGCCAGCAGCAGGGG
CTTTCACAACGTCGTGCCGCCGAACTCTCCGGGCTGACTCACAGTGCTATCAGTACGATA
GAACAAGATAAAGTCAGCCCTGCCATCAGTACGCTGCAAAAGCTGCTGAAGGTGTATGGT
CTGTCACTCTCGGAATTCTTTTCCGAGCCGGAAAAACCTGATGAGCCGCAGGTCGTCATT
AATCAGGACGACTTAATTGAGATGGGTAGTCAGGGTGTGTCAATGAAGCTGGTTCATAAC
GGTAACCCGAATCGCACGCTGGCGATGATCTTTGAAACGTACCAGCCGGGCACAACCACT
GGGGAAAGAATTAAGCATCAGGGTGAGGAAATAGGCACTGTACTGGAAGGTGAAATTGTT
CTGACGATTAATGGTCAGGATTACCACCTCGTCGCGGGGCAAAGTTATGCCATTAATACC
GGCATCCCGCACAGTTTCAGTAATACGTCGGCAGGTATTTGCCGAATTATCAGCGCCCAT
ACGCCCACCACGTTTTAATCTTTTTGTTCTGTAAGCCGGGTAAGCGCAATGCGCCCGGCA
ATCTATACACAAAATCATTCAAGTTGCATCAAGGCGGCAAGTGAGCGAATCCCGATGAGC
TTACTCAGGTAAGTGATTCGGGGGAGCGAACGCAGCCAAGGCAGAGGCGGCTTGAAGGAT
GAAGTGTATATAAAGAATGTCGCCAGAAATAAACGGGCATACGGCCCGGGGATCTCTGCG
CCCTGACGTTCACAAACTGCATATATCTGATAGACGTGAAACAGGAGTCATAATGAATTT
TCATCATCTGGCTTACTGGCAGGATAAAGCGTTAAGTCTCGCCATTGAAAACCGCTTATT
TATTAACGGTGAATATACTGCTGCGGCGGAAAATGAAACCTTTGAAACCGTTGATCCGGT
CACCCAGGCACCGCTGGCGAAAATTGCCCGCGGCAAGAGCGTCGATATCGACCGTGCGAT
GAGCGCAGCACGCGGCGTATTTGAACGCGGCGACTGGTCACTCTCTTCTCCGGCTAAACG
TAAAGCGGTACTGAATAAACTCGCCGATTTAATGGAAGCCCACGCCGAAGAGCTGGCACT
GCTGGAAACTCTCGACACCGGCAAACCGATTCGTCACAGTCTGCGTGATGATATTCCCGG
CGCGGCGCGCGCCATTCGCTGGTACGCCGAAGCGATCGACAAAGTGTATGGCGAAGTGGC
GACCACCAGTAGCCATGAGCTGGCGATGATCGTGCGTGAACCGGTCGGCGTGATTGCCGC
CATCGTGCCGTGGAACTTCCCGCTGTTGCTGACTTGCTGGAAACTCGGCCCGGCGCTGGC
GGCGGGAAACAGCGTGATTCTAAAACCGTCTGAAAAATCACCGCTCAGTGCGATTCGTCT
CGCGGGGCTGGCGAAAGAAGCAGGCTTGCCGGATGGTGTGTTGAACGTGGTGACGGGTTT
TGGTCATGAAGCCGGGCAGGCGCTGTCGCGTCATAACGATATCGACGCCATTGCCTTTAC
CGGTTCAACCCGTACCGGGAAACAGCTGCTGAAAGATGCGGGCGACAGCAACATGAAACG
CGTCTGGCTGGAAGCGGGCGGCAAAAGCGCCAACATCGTTTTCGCTGACTGCCCGGATTT
GCAACAGGCGGCAAGCGCCACCGCAGCAGGCATTTTCTACAACCAGGGACAGGTGTGCAT
CGCCGGAACGCGCCTGTTGCTGGAAGAGAGCATCGCCGATGAATTCTTAGCCCTGTTAAA
ACAGCAGGCGCAAAACTGGCAGCCGGGCCATCCACTTGATCCCGCAACCACCATGGGCAC
CTTAATCGACTGCGCCCACGCCGACTCGGTCCATAGCTTTATTCGGGAAGGCGAAAGCAA
AGGGCAACTGTTGTTGGATGGCCGTAACGCCGGGCTGGCTGCCGCCATCGGCCCGACCAT
CTTTGTGGATGTGGACCCGAATGCGTCCTTAAGTCGCGAAGAGATTTTCGGTCCGGTGCT
GGTGGTCACGCGTTTCACATCAGAAGAACAGGCGCTACAGCTTGCCAACGACAGCCAGTA
CGGCCTTGGCGCGGCGGTATGGACGCGCGACCTCTCCCGCGCGCACCGCATGAGCCGACG
CCTGAAAGCCGGTTCCGTCTTCGTCAATAACTACAACGACGGCGATATGACCGTGCCGTT
TGGCGGCTATAAGCAGAGCGGCAACGGTCGCGACAAATCCCTGCATGCCCTTGAAAAATT
CACTGAACTGAAAACCATCTGGATAAGCCTGGAGGCCTGAAATGACCGAACATACCAGCA
GTTACTACGCCGCCAGTGCGAATAAATATGCACCATTCGACACGCTGAATGAGTCAATCA
CCTGCGACGTTTGCGTGGTTGGCGGCGGCTATACCGGGCTCTCCTCCGCGCTGCATCTGG
CGGAAGCGGGCTTTGACGTAGTGGTTCTCGAAGCCTCACGCATCGGCTTTGGCGCAAGCG
GGCGCAATGGCGGACAGCTTGTGAACTCCTACAGCCGCGACATCGACGTGATCGAAAAAA
GCTACGGCATGGACACCGCCCGTATGCTCGGCAGCATGATGTTCGAAGGTGGTGAGATCA
TCCGCGAACGTATCAAACGTTATCAGATTGACTGCGACTACCGCCCCGGCGGCCTGTTTG
TGGCGATGAATGATAAACAGCTCGCCACACTTGAAGAGCAGAAAGAGAACTGGGAACGCT
ACGGCAATAAACAGCTGGAATTGCTGGACGCCAACGCCATTCGCCGTGAAGTAGCCAGCG
ATCGCTATACCGGTGCGCTGCTGGATCACAGCGGTGGGCATATTCATCCGCTAAACCTTG
CCATTGGCGAAGCGGACGCCATCCGCCTCAACGGCGGGCGCGTGTATGAACTTTCTGCCG
TGACGCAGATCCAGCACACCACGCCAGCCGTTGTGCGAACTGCCAAAGGTCAGGTGACGG
CGAAGTATGTGATTGTCGCCGGGAATGCGTATCTGGGCGATAAAGTAGAGCCGGAACTGG
CGAAACGCAGCATGCCGTGCGGCACGCAGGTGATCACCACCGAACGGCTGTCGGAAGATT
TAGCCCGTTCGCTGATCCCGAAAAACTACTGTGTGGAAGACTGTAACTATCTGCTTGATT
ACTACCGTCTTACCGCCGACAACCGCCTGCTGTACGGCGGCGGCGTGGTCTACGGCGCGC
GCGACCCGGATGACGTTGAGCGCCTTGTGGTGCCGAAACTGCTGAAAACCTTCCCGCAGC
TGAAGGGCGTGAAAATTGATTACCGCTGGACGGGCAACTTCCTGCTGACCCTGTCGCGTA
TGCCGCAGTTTGGTCGCCTCGATACCAACATCTATTACATGCAGGGCTACAGCGGCCACG
GCGTGACCTGTACTCATCTAGCCGGACGTTTGATTGCCGAACTGCTGCGCGGCGACGCCG
AACGTTTCGATGCCTTCGCCAATCTGCCGCATTACCCGTTCCCCGGCGGGCGCACGCTGC
GTGTGCCGTTTACCGCGATGGGCGCGGCGTATTACAGCCTGCGCGATCGTCTGGGCGTTT
AATTTCCGATTAACCGTGAAGAGTCAAAAGGTGTGAAACATGAGCAACAATGAATTCCAT
CAGCGTCGTCTTTCTGCCACTCCGCGCGGGGTTGGCGTGATGTGTAACTTCTTCGCCCAG
TCGGCTGAAAACGCCACGCTGAAGGATGTTGAGGGCAACGAGTACATCGATTTCGCCGCA
GGCATTGCGGTGCTGAATACCGGACATCGCCACCCTGATCTGGTCGCGGCGGTGGAGCAG
CAACTGCAACAGTTTACCCACACCGCGTATCAGATTGTGCCGTATGAAAGCTACGTCACC
CTGGCGGAGAAAATCAACGCCCTTGCCCCGGTGAGCGGGCAGGCCAAAACCGCGTTCTTC
ACCACCGGTGCGGAAGCGGTGGAAAACGCGGTGAAAATTGCTCGCGCCCATACCGGACGC
CCTGGCGTGATTGCGTTTAGCGGCGGCTTTCACGGTCGTACGTATATGACCATGGCGCTG
ACCGGAAAAGTTGCGCCGTACAAAATCGGCTTCGGCCCGTTCCCTGGTTCGGTGTATCAC
GTACCTTATCCGTCAGATTTACACGGCATTTCAACACAGGACTCCCTCGACGCCATCGAA
CGCTTGTTTAAATCAGACATCGAAGCGAAGCAGGTGGCGGCGATTATTTTCGAACCGGTG
CAGGGCGAGGGCGGTTTCAACGTTGCGCCAAAAGAGCTGGTTGCCGCTATTCGCCGCCTG
TGCGACGAGCACGGTATTGTGATGATTGCTGATGAAGTGCAAAGCGGCTTTGCGCGTACC
GGTAAGCTGTTTGCCATGGATCATTACGCCGATAAGCCGGATTTAATGACGATGGCGAAA
AGCCTCGCGGGCGGGATGCCGCTTTCGGGCGTGGTCGGTAACGCGAATATTATGGACGCA
CCCGCGCCGGGCGGGCTTGGCGGCACCTACGCCGGTAACCCGCTGGCGGTGGCTGCCGCG
CACGCGGTGCTCAACATTATCGACAAAGAATCACTCTGCGAACGCGCGAATCAACTGGGC
CAGCGTCTCAAAAACACGTTGATTGATGCCAAAGAAAGCGTTCCGGCCATTGCTGCGGTA
CGCGGCCTGGGGTCGATGATTGCGGTAGAGTTTAACGATCCGCAAACGGGCGAGCCGTCA
GCGGCGATTGCACAGAAAATCCAGCAACGCGCGCTGGCGCAGGGGCTGCTCCTGCTGACC
TGTGGCGCATACGGCAACGTGATTCGCTTCCTGTATCCGCTGACCATCCCGGATGCGCAA
TTCGATGCGGCAATGAAAATTTTGCAGGATGCGCTGAGCGATTAATAGCCCAACGCAATA
ATGTCTGATGCGCTGCGCTTATCAGGCCTGCAAACGACGTATTGATTATGTATGCCGAAT
AAAGCATTCACGCCGCATCCGGCAAGTTGTATTGCTCAACTTCGCTAAATCTGGTGCTTT
TTCAACAACGCGCGGAACTGATGATAAGTTAACCCCAGTAATTCAGCCGCGCGCTTCTGG
TTATATTTCCCTTGTTGCAAACTGAGTTGCAGCAACTCTTTTTCCTGCTGCATCTGAAAC
TCACGTAAATCCAGCGGCAGTGTTGGAAGCGAGGTGGTTTCTGAAACGGCGATAGCGTCT
TCAGGCGGACGCCGTTTAAAGGGATCAATAATGATGTCATCAAGCGGATAATCGCTGGTG
CCGTGGCGATACACTGAACGTTCCACCACGTTTTTCAATTCACGAATATTTCCCGGCCAA
CGATAATTCAGCAATGTTTCTCTGGCGCGCTCCGTAAACCCCGGGAACAGAGGCAGCTTG
ATTTCCCGACACATCTGGATGGCAAAGTATTCTGCCATCAACATTATGTCGCTTTCGCGC
TCGCGCAGTGGTGGCAGTTGTACAACATCAAAAGCCAGTCGGTCGAGCAGGTCAGCGCGA
AAAGTGCCTTCATTGACCATCGCCGGGAGATCGGCATTCGTCGCGCATACCAACCGCACA
TTCACCTGCAATGGTTGGCTGCCGCCAACGCGCTCCAGTTCACCGTACTCAATCACGCGC
AATAATTTCTCCTGCACCATCATCGGTGCCGTAGCGAGTTCATCAAGAAATAGCGTACCG
CCGTCGGCACGTTCAAATCTCCCTGGATGACGTTTTTGCGCACCGGTAAACGCCCCCGCT
TCGTGACCAAACAGTTCGGAATCCAGCAGATTTTCATTTAACGCCGCGCAGTTAAGGGAA
ATAAACGGCCCTTGCCAACGGGAGGAGAGATAATGCAGGCGGCTGGCAATCAGCTCTTTA
CCGGTGCCGCGTTCGCCGATGATGAGCACCGGTTTGTCCAGCGGTGCGAGATGCGAAACC
TGTTCCAGCACTTCGAGAAAGCTGTTCGCCTCACCAAGTAAATTATCTTTGTATTCTGCC
ATGATGAAATTCGCCACTTGTTAGTGTAATTCGCTAACTCATCCTGGCATGTTGCTGTTG
ATTCTTCAATCAGATCTTTATAAATCAAAAAGATAAAAAATTGGCACGCAAATTGTATTA
ACAGTTCAGCAGGACAATCCTGAACGCAGAAATCAAGAGGACAACATTATGGGTATTTTT
TCTCGCTTTGCCGACATCGTGAATGCCAACATCAACGCTCTGTTAGAGAAAGCGGAAGAT
CCACAGAAACTGGTTCGTCTGATGATCCAGGAGATGGAAGATACACTGGTTGAAGTACGT
TCTACTTCGGCGCGCGCGTTGGCAGAAAAGAAACAGCTGACTCGCCGTATTGAACAAGCG
TCGGCGCGTGAGGTTGAATGGCAGGAAAAAGCCGAACTGGCGCTGCTGAAAGAGAGAGAG
GATCTGGCACGTGCAGCGTTAATTGAAAAACAGAAACTGACCGATCTGATTAAGTCCCTG
GAACATGAAGTGACGCTGGTGGACGATACGCTGGCACGCATGAAGAAAGAGATTGGCGAG
CTGGAAAACAAATTGAGCGAAACACGCGCTCGCCAGCAGGCATTGATGTTACGTCATCAG
GCGGCAAACTCGTCGCGCGATGTGCGTCGTCAGCTGGACAGTGGCAAACTGGATGAAGCA
ATGGCTCGTTTCGAATCTTTCGAACGTCGTATTGACCAGATGGAAGCGGAAGCAGAAAGC
CACAGCTTCGGTAAACAAAAATCGCTGGACGATCAGTTTGCCGAACTGAAAGCCGATGAT
GCAATCAGCGAACAACTGGCACAATTAAAAGCCAAAATGAAGCAAGACAATCAATAATAA
CATCCAGGCGGCGTCCGAACGCGCCGCCGCTCATCGTCTAAGGAGTACTTATGAGCGCGC
TATTTCTGGCTATTCCGTTAACCATTTTTGTGCTGTTTGTTTTACCGATCTGGTTATGGC
TGCATTACAGCAATCGTTCTGGTCGCAGTGAATTGTCGCAAAGTGAGCAGCAGCGATTAG
CGCAACTGGCTGATGAAGCAAAACGGATGCGCGAACGTATTCAGGCGCTGGAATCTATTC
TTGATGCAGAACATCCGAACTGGAGGGATCGCTAATGGCGGGCATTAATCTCAATAAAAA
ATTATGGCGTATTCCACAGCAGGGCATGGTCCGCGGCGTCTGCGCCGGGATTGCCAACTA
TTTTGATGTACCGGTAAAACTGGTGCGTATCCTGGTGGTGCTGTCGATTTTCTTCGGTCT
GGCGCTGTTTACCCTGGTTGCTTACATCATTTTGTCATTTGCGCTTGATCCAATGCCGGA
CAACATGGCCTTTGGTGAGCAGCTACCTTCCAGCAGCGAATTGCTGGATGAAGTCGACCG
TGAACTGGCGGCAAGTGAAACGCGTTTACGCGAGATGGAACGTTATGTCACTTCCGATAC
TTTCACGTTACGTAGCCGTTTCCGTCAACTGTGAGGAAAGTTATGAATACTCGCTGGCAA
CAGGCCGGGCAAAAGGTAAAGCCTGGTTTCAAATTAGCAGGCAAGCTGGTACTTCTTACC
GCACTGCGCTATGGCCCGGCGGGTGTGGCGGGCTGGGCGATAAAATCAGTTGCTCGCCGA
CCGCTGAAAATGTTGCTGGCTGTGGCGCTGGAACCGCTGTTAAGTCGGGCTGCTAATAAA
CTGGCACAGCGTTATAAAAGGTGAGGGGAGTTTCGCAAAAATTGTTAAATCTCAGGCGTA
TAATGGATGGCAATTTTCATCCATAGAAGGACGCTTACATGTTTAAAAAAGGCTTACTTG
CTCTGGCACTGGTGTTTTCACTGCCCGTTTTCGCCGCTGAACACTGGATCGATGTTCGTG
TTCCAGAGCAGTATCAGCAAGAGCACGTTCAGGGGGCCATCAATATTCCCCTGAAGGAAG
TGAAAGAGCGCATTGCCACCGCCGTTCCGGATAAAAACGACACCGTGAAAGTGTATTGCA
ATGCCGGACGCCAGTCAGGGCAAGCAAAAGAGATCCTTAGCGAGATGGGATATACCCACG
TTGAGAACGCCGGTGGCCTGAAAGACATCGCAATGCCGAAGGTCAAAGGTTAAAAGAATT
CACCATGAGCGGCGCTTATGCGCCGTTTTTTTTTCTGTCACACCTTATTTACATCCCCAT
AGATTATTTGCGTCAGCTCACAAATACGCTTTTTCCCTGGTAAAAAATGATTTCCTGCGT
GACTAAAACCCTTGTGCTCAATTGACAGTTTATTTTCTGCGGAGTAGTCTCTCGTTTCAT
GGGACCGCTACCACGGAAAGGCAACATGAAACAGAAAATTACGGATTACCTGGACGAAAT
CTACGGTGGAACATTTACCGCAACTCATTTACAGAAACTTGTAACGCGTCTTGAGAGTGC
GAAACGATTAATTACACAGCGACGTAAAAAACACTGGGATGAAAGTGATGTCGTGTTAAT
TACCTATGCCGATCAATTTCACAGCAATGATTTAAAACCATTACCCACATTTAATCAGTT
TTACCATCAATGGCTGCAAAGCATTTTTTCACATGTTCATTTGTTGCCGTTTTATCCATG
GTCATCTGATGATGGCTTTTCGGTAATTGATTATCATCAGGTCGCCAGTGAAGCGGGGGA
GTGGCAGGATATTCAGCAACTCGGTGAATGCAGTCATTTAATGTTTGATTTTGTCTGCAA
CCATATGTCGGCAAAAAGTGAATGGTTTAAAAACTATTTACAACAGCATCCAGGTTTTGA
AGATTTTTTTATTGCCGTTGACCCGCAAACCGATCTCAGCGCCGTCACTCGCCCGCGTGC
GTTACCGTTATTAACGCCATTCCAGATGCGCGATCATTCAACGCGCCATTTATGGACCAC
CTTTAGTGACGATCAAATTGACCTGAATTACCGTAGCCCTGAAGTGTTGCTGGCGATGGT
GGATGTTTTACTCTGTTACCTTGCGAAAGGTGCTGAGTATGTCCGCCTGGATGCCGTTGG
CTTTATGTGGAAAGAGCCGGGAACAAGCTGCATCCATCTGGAAAAAACACATCTGATTAT
CAAACTGTTACGGTCGATTATTGATAACGTTGCGCCAGGTACAGTGATCATTACCGAGAC
CAATGTTCCGCATAAAGACAACATTGCTTACTTTGGCGCAGGCGATGACGAAGCACATAT
GGTGTACCAGTTCTCGCTGCCGCCACTGGTGCTGCATGCGGTGCAAAAACAGAACGTTGA
GGCGCTTTGTGCGTGGGCGCAAAACCTGACACTACCTTCCAGCAACACCACCTGGTTTAA
CTTCCTCGCCTCTCACGATGGCATCGGGCTAAACCCGCTACGGGGCTTGTTGCCTGAAAG
CGAAATATTAGAGCTGGTCGAGGCGTTACAGCAGGAAGGTGCATTAGTAAACTGGAAAAA
TAATCCCGACGGTACACGCAGTCCGTATGAAATAAATGTGACCTATATGGATGCGTTAAG
CCGCCGTGAGAGTAGCGATGAAGAACGTTGCGCCAGGTTTATCCTTGCCCATGCGATTTT
GTTAAGTTTCCCCGGTGTGCCAGCGATATATATTCAAAGTATTCTTGGCTCGCGTAATGA
TTACGCAGGTGTCGAAAAACTCGGATATAACCGTGCGATTAACCGTAAAAAATATCACAG
TAAAGAGATAACCCGAGAACTGAACGATGAAGCTACATTAAGGCATGCGGTATATCATGA
GTTGTCGCGTTTAATTACACTTCGTCGCAGCCATAACGAGTTTCATCCGGATAATAATTT
TACCATTGATACGATTAATTCATCCGTAATGCGTATTCCAAGAAGTAACGCTGATGGTAA
TTGTCTGACTGGATTGTTTAATGTCAGTAAAAATATTCAGCATGTAAATATTACTAATCT
GCATGGTCGGGATCTGATTAGTGAAGTTGATATATTGGGTAATGAAATAACGCTGCGCCC
CTGGCAGGTTATGTGGATTAAATAAAAAGGAACATCTCATGATTAAATCAAAAATCGTGC
TGTTATCAGCACTGGTTTCATGCGCCCTGATTTCAGGCTGTAAAGAAGAAAATAAAACGA
ATGTATCCATCGAATTTATGCATTCTTCGGTGGAGCAGGAGCGCCAGGCCGTTATCAGTA
AATTGATTGCCCGTTTTGAAAAAGAAAACCCTGGCATCACCGTTAAGCAAGTGCCCGTGG
AAGAAGATGCCTATAACACTAAAGTCATTACTCTTTCACGTAGCGGTTCGCTGCCGGAAG
TGATCGAAACCAGCCATGACTACGCCAAAGTGATGGACAAAGAGCAGCTTATCGATCGCA
AAGCGGTTGCCACAGTCATCAGCAACGTTGGTGAAGGCGCGTTTTACGATGGCGTACTGC
GTATTGTGCGTACCGAAGATGGTAGCGCATGGACCGGTGTTCCTGTCAGCGCCTGGATTG
GCGGTATCTGGTATCGCAAAGATGTGCTGGCAAAAGCGGGGCTTGAGGAGCCGAAAAACT
GGCAACAGCTGCTGGACGTTGCACAGAAACTGAATGACCCGGCGAATAAAAAATACGGCA
TTGCGCTGCCTACAGCAGAAAGCGTGTTGACGGAACAATCCTTCTCCCAGTTTGCGTTAT
CCAACCAGGCTAACGTCTTTAACGCCGAAGGCAAAATCACCCTTGATACACCAGAGATGA
TGCAGGCACTGACCTATTACCGCGACCTTACTGCCAACACTATGCCGGGTTCTAACGACA
TCATGGAAGTGAAAGACGCCTTTATGAACGGCACCGCGCCGATGGCGATTTACTCCACCT
ATATCCTTCCGGCTGTGATTAAAGAAGGCGACCCGAAAAACGTCGGTTTCGTGGTGCCAA
CCGAGAAAAACTCTGCGGTCTACGGCATGTTGACCTCGCTGACCATTACCGCCGGGCAAA
AGACCGAAGAGACGGAAGCAGCAGAAAAATTTGTCACCTTTATGGAGCAGGCAGACAACA
TTGCCGACTGGGTGATGATGTCGCCAGGTGCTGCGCTGCCGGTGAATAAAGCGGTGGTGA
CTACCGCCACCTGGAAAGACAACGACGTTATTAAGGCGCTGGGTGAACTACCGAATCAGC
TAATCGGTGAACTGCCAAATATTCAGGTTTTTGGCGCAGTAGGGGATAAAAACTTTACCC
GCATGGGTGATGTGACGGGTTCTGGCGTGGTGAGTTCAATGGTGCATAACGTCACCGTGG
GTAAAGCCGATCTCTCTACTACGCTGCAAGCGAGCCAGAAAAAACTGGATGAACTGATCG
AACAGCACTAAACCCAGGACAGGAATCCGCAATGAACAGGCTTTTTTCAGGTCGTTCCGA
TATGCCCTTTGCGCTGCTGCTTCTCGCGCCCAGCTTATTACTGCTGGGCGGTCTGGTGGC
GTGGCCGATGGTGTCGAATATCGAAATCAGTTTTTTACGTCTGCCGCTCAATCCCAACAT
CGAGTCAACGTTTGTTGGGGTGAGCAACTATGTGCGTATCCTCTCCGATCCCGGCTTCTG
GCATTCGCTGTGGATGACGGTCTGGTATACCGCGCTGGTGGTGGCGGGCAGCACCGTGCT
CGGGCTGGCGGTGGCGATGTTTTTCAACCGCGAGTTCCGCCTGCGCAAAACCGCGCGTTC
GCTGGTGATCCTCTCCTACGTAACGCCGTCCATTTCGCTGGTGTTCGCCTGGAAATACAT
GTTCAACAACGGCTACGGCATTGTTAACTACCTCGGCGTCGATCTTCTGCATCTCTATGA
GCAGGCACCGCTGTGGTTCGATAATCCGGGCAGTAGCTTTGTGCTGGTGGTGCTGTTCGC
CATCTGGCGCTACTTCCCGTATGCCTTTATCTCGTTTCTGGCGATTTTGCAGACCATCGA
CAAATCGCTGTACGAAGCGGCAGAGATGGATGGCGCTAATGCCTGGCAACGGTTTCGTAT
CGTCACGCTGCCCGCAATTATGCCGGTCCTGGCGACGGTGGTGACACTGCGCACCATCTG
GATGTTCTACATGTTCGCGGATGTTTATTTGCTGACGACCAAGGTCGATATTCTCGGTGT
ATATCTCTACAAAACCGCCTTTGCCTTTAATGATTTAGGAAAAGCGGCGGCGATCTCGGT
GGTGCTCTTCATCATTATTTTCGCTGTCATTCTGCTGACCAGGAAACGGGTGAACCTCAA
TGGCAACAAATAAACGCACACTCAGTCGCATCGGTTTTTACTGCGGGCTGGCGCTGTTTC
TCATCATCACGCTGTTTCCATTTTTTGTGATGCTGATGACCTCGTTCAAGGGCGCGAAAG
AGGCGATCTCACTGCATCCTACGCTGCTGCCGCAGCAGTGGACGCTGGAGCATTACGTCG
ACATTTTTAACCCGATGATTTTCCCGTTTGTCGACTACTTCCGTAACAGTCTGGTGGTGT
CTGTGGTTTCATCCGTGGTGGCGGTATTCCTCGGCATTCTTGGGGCTTACGCGCTTTCCC
GCCTGCGCTTTAAAGGTCGGATGACCATCAACGCCAGCTTTTACACGGTGTATATGTTCT
CTGGCATTTTGCTGGTGGTGCCGCTTTTCAAAATCATCACCGCGCTTGGCATTTACGACA
CTGAGATGGCGCTGATCATCACCATGGTGACGCAAACTCTGCCCACCGCCGTGTTTATGC
TGAAAAGCTACTTCGACACCATCCCCGATGAGATCGAAGAAGCGGCGATGATGGATGGCC
TCAACCGTCTGCAAATTATCTTCCGCATCACCGTGCCGTTGGCGATGTCCGGGCTGATAT
CCGTGTTCGTCTACTGCTTTATGGTGGCGTGGAACGACTATCTGTTTGCGTCGATTTTCC
TCTCCAGCGCCAGCAATTTCACCTTACCGGTGGGCCTGAACGCGCTGTTCAGTACGCCAG
ATTACATCTGGGGACGGATGATGGCGGCCTCACTGGTGACCGCATTGCCGGTGGTGATTA
TGTATGCGCTTTCGGAACGTTTTATTAAGAGTGGTTTGACCGCCGGTGGCGTGAAGGGCT
AAAGCGGCCAGTTTCTTTACAAGGAGTTTTAAATGAAAAAGTTAGTAGCCACAGCACCGC
GTGTTGCTGCGCTGGTTGAGTATGAAGATCGGGCGATTTTAGCTAATGAAGTGAAGATCC
GCGTGCGTTTCGGCGCACCGAAACACGGAACGGAAGTGGTCGACTTCCGCGCCGCCAGCC
CGTTTATTGATGAAGACTTTAACGGCGAATGGCAGATGTTCACTCCGCGTCCGGCAGATG
CGCCGCGCGGCATTGAGTTTGGCAAATTCCAGCTTGGCAACATGGTGGTTGGCGACATTA
TCGAGTGCGGCAGCGACGTTACCGACTACGCGGTGGGCGACAGCGTATGCGGCTACGGCC
CGCTCTCCGAGACGGTCATCATTAACGCAGTGAATAACTACAAGCTGCGCAAAATGCCGC
AAGGCAGCTCCTGGAAAAACGCCGTCTGCTACGACCCGGCGCAGTTTGCCATGAGCGGCG
TGCGCGATGCCAACGTGCGCGTAGGGGATTTTGTGGTGGTGGTAGGGCTTGGCGCAATCG
GTCAAATTGCCATCCAACTGGCTAAACGCGCTGGCGCTTCTGTGGTGATTGGCGTCGATC
CTATCGCCCATCGCTGTGATATTGCCCGTCGCCACGGCGCGGATTTCTGCCTTAACCCCA
TCGGCACTGATGTAGGTAAAGAGATCAAAACGCTGACCGGCAAGCAGGGTGCCGATGTGA
TTATCGAAACCAGCGGCTACGCCGACGCGCTGCAATCGGCGCTCCGCGGTCTGGCTTATG
GCGGCACCATCTCCTATGTCGCGTTTGCCAAGCCGTTTGCCGAAGGTTTTAACCTCGGAC
GCGAAGCGCATTTCAATAACGCCAAAATTGTCTTCTCTCGCGCGTGCAGCGAACCGAACC
CGGATTATCCGCGCTGGAGCCGCAAGCGTATTGAAGAAACCTGTTGGGAACTGCTGATGA
ACGGTTATCTCAATTGCGAAGATTTAATCGACCCGGTGGTGACCTTTGCCAATAGCCCGG
AAAGCTATATGCAGTATGTCGACCAGCATCCGGAACAGAGCATCAAAATGGGCGTTACGT
TTTAATTCAAAGGAATGAAAAAAATGAAAATCGGCACACAGAATCAGGCGTTCTTTCCGG
AAAACATTCTGGAGAAATTTCGTTATATCAAAGAGATGGGCTTCGATGGTTTTGAGATTG
ACGGCAAACTGCTGGTTAACAACATCGAAGAAGTCAAAGCGGCGATCAAAGAAACCGGTT
TACCGGTGACCACCGCCTGCGGTGGCTATGACGGATGGATTGGCGACTTTATCGAAGAGC
GTCGTCTTAATGGCTTAAAGCAGATCGAGCGCATTCTCGAAGCGCTGGCAGAAGTGGGCG
GTAAAGGCATCGTCGTTCCGGCTGCGTGGGGCATGTTTACCTTCCGCTTACCGCCGATGA
CCTCGCCGCGTAGCCTGGACGGCGACCGCAAAATGGTGAGTGATTCCCTGCGCGTACTGG
AACAGGTCGCCGCGCGTACCGGAACCGTGGTGTATCTCGAACCGTTAAACCGCTATCAGG
ATCATATGATCAACACCCTCGCCGATGCCCGCCGTTACATCGTCGAAAACGATCTTAAAC
ATGTACAGATTATCGGCGATTTCTATCACATGAATATCGAAGAAGATAACCTGGCGCAGG
CGCTGCATGACAACCGCGACCTGCTCGGTCATGTGCATATTGCGGATAACCATCGCTACC
AGCCGGGCAGCGGCACCCTGGATTTCCACGCGCTGTTTGAACAGCTGCGCGCGGATAACT
ATCAGGGCTATGTAGTGTACGAAGGGCGTATCCGGGCGGAAGATCCTGCCCAGGCGTACC
GTGATTCGTTGGCCTGGTTGCGTACCTGCTAAGAGGTCTTTGTGAAAAGTGCAATGACAA
GCTCTCCGCTGCGGGTCGCGATAATAGGCGCAGGCCAGGTGGCGGATAAGGTTCATGCTT
CGTACTACTGCACCCGCAACGATCTGGAACTGGTGGCTGTCTGTGACAGCCGCCTTTCCC
AGGCGCAGGCGCTGGCAGAAAAATACGGGAATGCATCCGTGTGGGACGATCCGCAGGCCA
TGCTGCTGGCGGTGAAACCTGATGTGGTTAGCGTCTGCTCACCTAACCGTTTTCATTACG
AACATACCCTGATGGCACTGGAAGCGGGCTGCCATGTGATGTGCGAAAAACCGCCCGCCA
TGACGCCAGAACAGGCGCGGGAAATGTGCGATACCGCGCGCAAACTGGGCAAGGTGCTGG
CCTACGACTTTCACCATCGTTTTGCGCTCGATACGCAACAGCTGCGTGAACAGGTGACCA
ACGGCGTTTTGGGAGAGATTTACGTTACCACCGCCCGCGCCCTGCGTCGCTGCGGCGTTC
CCGGCTGGGGTGTCTTTACCAATAAAGAACTGCAGGGTGGTGGCCCGCTGATCGACATCG
GCATTCATATGCTGGATGCTGCGATGTATGTGCTGGGCTTTCCGGCGGTGAAAAGCGTGA
ATGCGCATAGCTTTCAAAAGATCGGCACGCAAAAGAGCTGTGGTCAATTTGGTGAGTGGG
ATCCGGCAACTTACAGCGTCGAAGATTCGCTGTTTGGCACCATTGAATTTCATAACGGCG
GCATTCTGTGGCTGGAAACGTCATTTGCACTCAACATCCGCGAACAGTCGATTATGAACG
TCAGCTTTTGTGGTGATAAAGCTGGTGCGACGCTGTTTCCAGCACATATCTACACCGATA
ACAACGGTGAATTAATGACGCTGATGCAACGGGAAATAGCAGACGACAACCGCCATTTGC
GCAGCATGGAAGCCTTTATCAATCACGTACAGGGCAAGCCCGTGATGATAGCCGACGCCG
AGCAGGGGTACATCATCCAGCAACTGGTGGCGGCGTTGTATCAATCCGCAGAAACAGGGA
CGCGTGTGGAATTATGACCAGGCCAGTAACGTTATCAGAACCCCATTTCAGCCAGCATAC
CCTGAACAAGTATGCATCGCTGATGGCGCAGGGGAACGGCTATCTTGGGCTTCGCGCCAG
CCATGAAGAAGATTACACGCGCCAGACGCGAGGGATGTATCTGGCGGGGCTGTATCATCG
GGCGGGAAAAGGTGAAATCAACGAACTGGTGAACCTGCCTGATGTCGTGGGGATGGAGAT
TGCCATAAATGGTGAGGTTTTCTCGTTATCCCACGAAGCCTGGCAGCGTGAGCTTGACTT
TGCCAGTGGCGAATTACGCCGCAATGTTGTCTGGCGTACCAGCAACGGCTCAGGTTACAC
CATCGCCAGCCGTCGCTTTGTTTCGGCAGACCAACTGCCGCTCATTGCGCTGGAAATCAC
TATTACGCCACTGGACGCCGACGCGTCAGTGCTGATTTCAACAGGCATTGACGCCACGCA
AACCAATCACGGTCGCCAACATCTCGACGAAACCCAGGTGCGGGTGTTTGGTCAGCATCT
GATGCAGGGGAGCTACACCACCCAGGATGGACGCAGTGATGTGGCCATCAGCTGTTGCTG
TAAGGTGAGCGGTGATGTGCAGCAATGCTATACCGCCAAAGAGCGCCGTTTACTGCAACA
TACCAGTGCGCAGCTTCATGCAGGCGAGACAATGACGTTGCAAAAACTGGTGTGGATCGA
CTGGCGGGATGACAGGCAAGCTGCTTTAGACGAGTGGGGCAGCGCGTCGCTTCGCCAGCT
TGAAATGTGCGCGCAGCAGAGTTACGACCAACTTCTTGCAGCATCAACAGAAAACTGGCG
TCAATGGTGGCAGAAACGTCGTATCACGGTAAATGGCGGCGAAGCGCACGATCAGCAAGC
GTTAGATTATGCGCTTTATCATCTGCGCATCATGACGCCTGCCCACGACGAGCGCAGCAG
CATTGCGGCAAAAGGCTTAACCGGCGAAGGCTACAAAGGCCACGTTTTCTGGGATACAGA
AGTATTTTTGTTACCGTTTCATCTGTTTAGCGATCCGACGGTTGCCCGAAGTTTACTGCG
TTATCGCTGGCACAACTTGCCAGGCGCGCAGGAGAAAGCGCGACGCAACGGCTGGCAGGG
CGCGCTATTTCCGTGGGAAAGCGCGCGCAGCGGCGAAGAAGAGACGCCGGAATTTGCCGC
CATTAACATTCGCACCGGGCTGCGGCAAAAAGTGGCCTCGGCGCAGGCGGAACATCATCT
GGTGGCCGATATCGCCTGGGCGGTTATTCAATACTGGCAGACCACGGGGGATGAAAGTTT
CATTGCGCATGAAGGCATGGCGCTACTTCTGGAGACGGCAAAGTTCTGGATTAGCCGCGC
GGTGAGAGTTAACGATCGTCTGGAAATTCATGATGTTATTGGGCCAGACGAATATACCGA
ACATGTCAATAATAATGCATACACCAGCTATATGGCCCGCTACAACGTTCAACAGGCGCT
GAATATTGCCCGCCAGTTCGGCTGTAGCGACGATGCGTTTATCCATCGCGCCGAAATGTT
CCTCAAAGAGCTATGGATGCCAGAAATTCAGCCCGACGGCGTTTTGCCGCAGGATGATTC
GTTTATGGCTAAGCCGGCGATTAATCTGGCGAAATACAAAGCGGCGGCGGGGAAGCAAAC
CATACTGCTGGATTATTCACGCGCAGAAGTGAACGAGATGCAGATCCTCAAACAAGCTGA
TGTGGTGATGCTCAATTACATGCTGCCGGAGCAGTTCTCAGCGGCATCGTGTCTTGCCAA
TCTGCAATTTTATGAACCGCGCACTATTCACGACTCGTCATTAAGTAAAGCAATCCACGG
CATTGTTGCCGCACGCTGTGGCCTGCTGACCCAAAGTTATCAGTTCTGGCGCGAGGGGAC
TGAAATCGATCTTGGTGCTGATCCGCATAGTTGTGATGATGGTATCCATGCTGCCGCAAC
TGGCGCTATCTGGCTGGGGGCGATTCAGGGTTTTGCCGGGGTGAGCGTGCGTGACGGTGA
ATTGCATCTCAATCCGGCGTTACCTGAGCAGTGGCAACAGTTGTCTTTCCCTCTGTTCTG
GCAGGGCTGCGAATTACAGGTCACTCTTGACGCGCAGCGTATTGCGATTCGAACTTCTGC
GCCCGTTTCACTGCGTTTGAACGGTCAGCTTATAACCGTGGCTGAAGAATCTGTTTTCTG
TTTGGGTGATTTTATTTTGCCCTTCAATGGGACCGCTACCAAACATCAGGAGGATGAATG
AAACTGCAAGGGGTAATTTTCGATCTGGATGGTGTAATCACCGATACCGCGCATCTGCAT
TTCCAGGCGTGGCAGCAGATTGCCGCTGAAATTGGCATCAGCATTGATGCGCAGTTTAAC
GAATCCCTAAAAGGGATCAGCCGCGATGAGTCTCTGCGGCGCATTCTGCAACACGGGGGC
AAAGAGGGCGACTTTAACTCGCAGGAGAGGGCGCAACTGGCGTATCGCAAAAATCTGCTC
TATGTCCACTCACTACGCGAGTTGACGGTCAACGCTGTTCTACCCGGCATTCGCTCTTTG
CTGGCAGATCTCCGTGCACAGCAGATCTCGGTTGGGCTGGCTTCTGTCTCCCTGAATGCG
CCGACGATTTTAGCGGCGCTGGAGCTGCGCGAGTTTTTCACCTTCTGCGCGGATGCTTCC
CAACTTAAAAACTCGAAACCGGACCCGGAAATCTTTCTCGCCGCCTGTGCAGGGCTGGGC
GTGCCGCCGCAGGCATGTATCGGCATTGAAGATGCGCAGGCGGGCATTGACGCCATTAAC
GCCAGCGGTATGCGCTCGGTGGGGATCGGCGCGGGCTTAACCGGGGCGCAATTACTGTTG
CCTTCAACGGAATCACTCACCTGGCCGCGGTTATCGGCCTTCTGGCAAAACGTATAGCAA
AGGAATCAACATGGCTCAGCTTTCGTTACAACATATTCAAAAAATCTACGATAACCAGGT
GCATGTGGTGAAGGACTTCAACCTGGAAATTGCCGATAAAGAGTTCATCGTGTTTGTCGG
CCCGTCGGGCTGCGGTAAGTCGACCACCCTGCGCATGATTGCCGGGCTTGAGGAGATCAG
CGGCGGCGATCTGTTGATCGACGGCAAACGAATGAATGACGTTCCAGCCAAAGCACGCAA
TATAGCGATGGTGTTCCAGAACTACGCGTTGTATCCGCATATGACGGTTTACGACAACAT
GGCGTTTGGTCTGAAGATGCAAAAAATCGCCAAAGAGGTGATTGATGAGCGGGTGAACTG
GGCGGCGCAAATTCTCGGCCTGCGTGAGTACCTGAAACGTAAGCCGGGGGCGCTTTCCGG
CGGGCAACGTCAGCGAGTGGCGCTTGGGCGGGCGATTGTACGCGAAGCGGGCGTGTTTTT
AATGGATGAACCGCTCTCTAACCTTGATGCCAAGCTGCGCGTGCAAATGCGCGCAGAGAT
CAGCAAGCTGCATCAGAAACTGAACACCACCATGATCTACGTGACCCACGATCAGACCGA
AGCGATGACCATGGCGACGCGGATTGTGATTATGAAAGACGGGATTGTTCAGCAAGTAGG
TGCGCCGAAAACCGTTTATAACCAACCCGCGAATATGTTTGTTTCCGGATTTATTGGATC
ACCAGCGATGAATTTTATTCGCGGCACGATCGATGGCGATAAATTCGTTACGGAAACGCT
TAAATTAACCATTCCCGAAGAGAAATTAGCGGTTCTGAAAACACAGGAAAGTTTGCATAA
GCCCATCGTGATGGGAATACGACCGGAAGATATTCATCCGGACGCGCAAGAGGAAAATAA
CATTTCCGCCAAAATTAGCGTGGCAGAATTAACCGGTGCGGAATTTATGCTCTACACCAC
GGTTGGGGGCACGAGTTAGTGGTCCGTGCTGGTGCGTTAAATGATTATCATGCAGGAGAA
AATATCACTATTCATTTTGATATGACGAAATGTCATTTCTTTGATGCAGAAACGGAAATA
GCAATTCGCTAAATACAGGGGGAAGGCATTCCCCCAGGATAATACAAGGAACAATAATGA
AAAAGTTATTACCCTGTACCGCACTGGTGATGTGTGCGGGAATGGCCTGCGCACAGGCCG
AGGAAAGGAACGACTGGCACTTTAATATCGGCGCGATGTACGAAATAGAAAACGTCGAGG
GTTATGGCGAAGATATGGATGGGCTGGCGGAGCCTTCAGTCTATTTTAATGCCGCCAACG
GGCCGTGGAGAATTGCTCTGGCCTATTATCAGGAAGGGCCGGTAGATTATAGCGCGGGTA
AACGTGGAACGTGGTTTGATCGCCCGGAGCTGGAGGTGCATTATCAGTTCCTCGAAAACG
ATGATTTCAGTTTCGGCCTGACCGGCGGTTTCCGTAATTATGGTTATCACTACGTTGATG
AACCGGGTAAAGACACGGCGAATATGCAGCGCTGGAAAATCGCGCCAGACTGGGATGTGA
AACTGACTGACGATTTACGTTTCAACGGTTGGTTGTCGATGTATAAATTTGCCAACGATC
TGAACACTACCGGTTACGCTGATACCCGTGTCGAAACGGAAACAGGTCTGCAATATACCT
TCAACGAAACGGTTGCCTTGCGAGTGAACTATTATCTCGAGCGCGGCTTCAATATGGACG
ACAGCCGCAATAACGGTGAGTTTTCCACGCAAGAAATTCGCGCCTATTTGCCGCTGACGC
TCGGCAACCACTCGGTGACGCCGTATACGCGCATTGGGCTGGATCGCTGGAGTAACTGGG
ACTGGCAGGATGATATTGAACGTGAAGGCCATGATTTTAACCGTGTAGGTTTATTTTACG
GTTATGATTTCCAGAACGGACTTTCCGTTTCGCTGGAATACGCGTTTGAGTGGCAGGATC
ACGACGAAGGCGACAGTGATAAATTCCATTATGCAGGTGTCGGCGTAAATTACTCGTTCT
GATAATGGGCTAAATTGCCGGATGCGGCGCGAGTACTTTATCCGATCTATAAATGTAGGC
CGGATAAGATGCGCTAGCATCGCATCTGGCATTCAGGCAAGGTAGCTGGTATTTATTTCA
GCGTCATATGCGTGGCAACGGTAATATTCTGTGGTGACGGTTTTCCAGAAATTAAGCGGA
ATAATAACTCGCAGCTTTGTTGACCTAACTCCTGCGTCGGAACATCGATGCCGCCCGGTG
CAGGCGTTAAAATAAATGACAGCGTTTCATTGCTATAACCCACCACCGCTAACTGCTGCG
GAATAGCAATATTTTTCTCTGCTGCCGCACGATAAATGCTCATTAATTTCAGGCTGTCAG
TGGCAAACACCGCCTCAGGCAACGGTGACTGGCTTAATAATTGCCGTGCTGCTTTTAATG
CAGTTTCATGGGTATAACCGCCATCAACAATCCATTCATCACGCACTGCAATATTATGCG
CAGCCAGGCTCTGCTTATAACCATTAACGCGATCAACCGAAACATGGACATCAAGCGGAG
CATGCAGGCAGGCAATATTTTGATGCCCACTTTCAATTAATGCATCGGTCAACGCAATGC
TGTCGCCAAAATTATCGGTATCGACAGAATAAACATGGGCATATTGACCTTCAACTTTGC
CAATCACCACCACCGGAATATCATATTTATCGAGTTGGGCAAAAAATGACTCATCCGCTG
GCGAACTGAGCATAATAATGCCTTTAATCATTTTCTGCTTAATTTTGCTTTCGCATTTTT
GCAGATCTTCTGCCGGATTGTGCGACGTTTGTAATATCACGTCGAAACCTTCTTCTTCAG
CTTTGGCGGTGATGGCATGCAAAACTTCAGAGAAAAACGGATTACCCGCCGTAGTTTTGG
TCGAACGGGTAGAAATCACCATAATGGCATCAAAACCCGAAGAGGTCAGCGCGCGGGCCA
GCTTGTTTGGCTGATACTGTAATTCTTCAATGGCCCGTAACACTTTTTCGCGCGCTTCCG
GGGAGATATTAGTTTGCTTATTCAGCACGCGTGATACGGTGGATTTTGATACGCCTGCAA
CCCTGGCAATATCATAAATAGTAGGGGACATAGGTCAGGAACTCCGTCCGAACGTGAATG
CTGCACATCTTATGGAGTTCGCCGGTCGATGACAACACGGGCAGTTGATAATCAATGGCC
TGGCCCCCACATTCATATCCTTACGAATGATTTTTTTTCTGGTCTTCAGAGCAGCACAGG
ACAGCAATGAAGCGACTTAAAAATGAACTCAATGCGCTGGTGAATCGGGGTGTCGACAGA
CATCTGCGCCTCGCTGTAACCGGACTTAGCCGCAGCGGCAAAACAGCGTTTATCACCGCG
ATGGTTAATCAGTTGCTTAATATTCACGCCGGAGCACGTTTGCCGCTGTTAAGTGCGGTG
CGTGAAGAGCGCCTGCTGGGCGTGAAACGCATTCCCCAGCGTGACTTTGGCATTCCGCGC
TTCACCTATGACGAAGGGCTGGCGCAGTTATATGGCGATCCACCCGCCTGGCCAACGCCA
ACGCGCGGCGTCAGTGAAATCCGCCTGGCGCTACGTTTTAAATCGAATGATTCGCTGCTA
CGCCACTTTAAGGATACCTCCACGCTGTATCTGGAAATTGTGGATTATCCCGGCGAATGG
TTGCTCGACCTGCCGATGCTGGCGCAGGACTATTTAAGCTGGTCGCGCCAGATGACGGGC
TTACTCAATGGTCAGCGCGGAGAATGGTCGGCGAAATGGCGAATGATGAGCGAAGGGCTG
GACCCGCTAGCGCCTGCCGACGAAAACCGGCTGGCGGACATTGCCGCCGCGTGGACCGAT
TATCTCCACCACTGTAAAGAGCAGGGGCTGCACTTTATTCAGCCTGGGCGCTTTGTCTTG
CCGGGAGATATGGCAGGTGCGCCCGCGCTGCAATTCTTCCCGTGGCCGGATGTCGATACC
TGGGGCGAGTCCAAACTGGCGCAGGCCGATAAGCATACCAATGCCGGAATGCTGCGCGAG
CGCTTTAATTATTACTGCGAGAAGGTGGTGAAGGGGTTCTATAAGAATCATTTTCTGCGC
TTTGACCGCCAGATTGTGCTGGTGGATTGCCTGCAACCTCTCAACAGTGGGCCACAGGCA
TTTAATGATATGCGTCTGGCACTGACGCAGCTGATGCAAAGTTTTCACTACGGGCAGCGT
ACCCTGTTCCGGCGTTTGTTTTCGCCGGTTATCGATAAGCTATTGTTTGCTGCCACTAAA
GCGGACCATGTGACCATCGATCAGCACGCTAATATGGTTTCATTACTGCAACAACTGATT
CAGGATGCCTGGCAAAATGCGGCGTTCGAAGGGATCAGCATGGACTGCCTGGGGCTGGCG
TCAGTTCAGGCGACCACCAGCGGCATTATTGATGTTAACGGTGAGAAAATCCCGGCGCTG
CGTGGTAATCGACTTAGCGATGGCGCACCGCTCACTGTTTATCCTGGCGAAGTTCCCGCA
CGTTTGCCTGGTCAGGCGTTCTGGGATAAGCAAGGCTTCCAGTTTGAGGCATTTCGTCCG
CAGGTGATGGATGTCGACAAACCACTACCGCATATTCGTCTTGATGCTGCGCTGGAATTT
TTAATAGGAGATAAATTGCGATGACCGAACCGTTAAAACCACGTATTGATTTCGACGGTC
CTCTGGAGGTCGATCAGAATCCTAAATTCAGGGCGCAGCAGACCTTTGACGAAAATCAGG
CGCAAAATTTTGCCCCGGCCACGCTCGACGAAGCGCAGGAAGAAGAGGGGCAAGTCGAAG
CGGTAATGGACGCAGCGTTACGTCCGAAACGCAGCCTGTGGCGCAAAATGGTGATGGGAG
GGCTGGCTCTGTTTGGCGCAAGCGTTGTCGGGCAGGGTGTACAGTGGACAATGAATGCCT
GGCAAACCCAGGACTGGGTGGCGCTGGGTGGATGTGCCGCTGGGGCATTGATTATCGGCG
CTGGCGTAGGTTCTGTGGTAACAGAGTGGCGGCGCTTATGGCGCTTGCGACAGCGCGCCC
ATGAACGCGACGAAGCGCGTGATTTATTGCATAGCCACGGCACGGGCAAAGGCCGCGCAT
TTTGCGAAAAACTGGCGCAGCAGGCGGGTATTGATCAGTCGCATCCGGCGCTGCAACGCT
GGTATGCCTCAATCCATGAAACGCAAAACGACCGTGAAGTGGTCAGCCTGTATGCGCATT
TGGTCCAGCCAGTTTTAGATGCCCAGGCGCGGCGCGAAATCAGCCGTTCGGCGGCGGAAT
CAACGTTGATGATTGCGGTCAGCCCGCTGGCGTTGGTCGATATGGCGTTTATCGCCTGGC
GCAATCTGCGTTTAATTAATCGCATCGCCACGCTGTATGGCATTGAACTGGGGTATTACA
GCCGTTTGCGTCTGTTTAAGCTGGTATTGCTGAATATCGCTTTTGCCGGAGCCAGCGAAC
TGGTGCGCGAAGTGGGGATGGACTGGATGTCGCAAGATCTCGCTGCTCGTTTGTCTACCC
GCGCAGCTCAGGGGATTGGTGCAGGACTTCTGACGGCACGACTCGGGATTAAAGCTATGG
AGCTTTGCCGCCCGCTGCCGTGGATTGACGATGACAAACCTCGCCTCGGGGATTTCCGTC
GTCAGCTTATCGGTCAGGTGAAAGAAACGCTGCAAAAAGGCAAAACGCCCAGCGAAAAAT
AATGCAATATCGGGTGCTGACCGGATATCTTTACGCCGAAGTGCCCGTTTTTCCGTCTTT
GTGTCAATGATTGTTGACAGAAACCTTCCTGCTATCCAAATAGTGTCATATCATCATATT
AATTGTTCTTTTTTCAGGTGAAGGTTCCCATGCGTCTGGAAGTCTTTTGTGAAGACCGAC
TCGGTCTGACCCGCGAATTACTCGATCTACTCGTGCTAAGAGGCATTGATTTACGCGGTA
TTGAGATTGATCCCATTGGGCGAATCTACCTCAATTTTGCTGAACTGGAGTTTGAGAGTT
TCAGCAGTCTGATGGCCGAAATACGCCGTATTGCGGGTGTTACCGATGTGCGTACTGTCC
CGTGGATGCCTTCCGAACGTGAGCATCTGGCGTTGAGCGCGTTACTGGAGGCGTTGCCTG
AACCTGTGCTCTCTGTCGATATGAAAAGCAAAGTGGATATGGCGAACCCGGCGAGCTGTC
AGCTTTTTGGGCAAAAATTGGATCGCCTGCGCAACCATACCGCCGCACAATTGATTAACG
GCTTTAATTTTTTACGTTGGCTGGAAAGCGAACCGCAAGATTCGCATAACGAGCATGTCG
TTATTAATGGGCAGAATTTCCTGATGGAGATTACGCCTGTTTATCTTCAGGATGAAAATG
ATCAACACGTCCTGACCGGTGCGGTGGTGATGTTGCGATCAACGATTCGTATGGGCCGCC
AGTTGCAAAATGTCGCCGCCCAGGACGTCAGCGCCTTCAGTCAAATTGTCGCCGTCAGCC
CGAAAATGAAGCATGTTGTCGAACAGGCGCAGAAACTGGCGATGCTAAGCGCGCCGCTGC
TGATTACGGGTGACACAGGTACAGGTAAAGATCTCTTTGCCTACGCCTGCCATCAGGCAA
GCCCCAGAGCGGGCAAACCTTACCTGGCGCTGAACTGTGCGTCTATACCGGAAGATGCGG
TCGAGAGTGAACTGTTTGGTCATGCTCCGGAAGGGAAGAAAGGATTCTTTGAGCAGGCGA
ACGGTGGTTCGGTGCTGTTGGATGAAATAGGGGAAATGTCACCACGGATGCAGGCGAAAT
TACTGCGTTTCCTTAATGATGGCACTTTCCGTCGGGTTGGCGAAGACCATGAGGTGCATG
TCGATGTGCGGGTGATTTGCGCTACGCAGAAGAATCTGGTCGAACTGGTGCAAAAAGGCA
TGTTCCGTGAAGATCTCTATTATCGTCTGAACGTGTTGACGCTCAATCTGCCGCCGCTAC
GTGACTGTCCGCAGGACATCATGCCGTTAACTGAGCTGTTCGTCGCCCGCTTTGCCGACG
AGCAGGGCGTGCCGCGTCCGAAACTGGCCGCTGACCTGAATACTGTACTTACGCGTTATG
CGTGGCCGGGAAATGTGCGGCAGTTAAAGAACGCTATCTATCGCGCACTGACACAACTGG
ACGGTTATGAGCTGCGTCCACAGGATATTTTGTTGCCGGATTATGACGCCGCAACGGTAG
CCGTGGGCGAAGATGCGATGGAAGGTTCGCTGGACGAAATCACCAGCCGTTTTGAACGCT
CGGTATTAACCCAGCTTTATCGCAATTATCCCAGCACGCGCAAACTGGCAAAACGTCTCG
GCGTTTCACATACCGCGATTGCCAATAAGTTGCGGGAATATGGTCTGAGTCAGAAGAAGA
ACGAAGAGTAAGCGCGAATATGCCTGATGGTGCAACACCATCAGGCATATTAAATTATGC
TTTCAGTACAGCCAGAGCTGCTTCGTAATCCGGCTCGGTGGTGATTTCATCCACCAGCTG
GCTGAAAATCACATTGTCATTTTCGTCAATAACCACAACGGCACGCGCTGCCAGACCTTT
CAGTGGGCCATCAGCAATTGCCACACCGTAAGCTTGCAGAAATTCAGCGTTACGGAAAGT
GGAGAGGGTGATAACGTTGTTCAGACCTTCTGCGCCGCAGAAACGAGACTGGGCGAACGG
CAGATCGGCAGAGATACACAGCACAACGGTGTTGTCGATCTCAGTTGCCAGTTGGTTAAA
CTTACGTACTGATGCGGCGCAAACACCGGTATCAATACTCGGGAAAATGTTCAGCACTTT
GCGTTTACCCGCAAACTGACCGAGGGTGACGTCAGACAGATCTTTTGCCACGAGAGTAAA
AGTCTGCGCTTTGCTACCCGCCTGCGGGATGGAATTGGCGACTGTAACCGGGTTGCCCTG
GAAATGAACGGTTTGTGACATGATTATCTTTCCTGTTTACATATAGTTAACGTCACACCT
AGTTTATGCTAACTGTCAATAACACAGCAAACGCTATTTGCGCTTAATCCGCAGACCACC
GCGACAACAAGGAGTAAAGATGAGAACCGTTAAGGTATTCGAGGAAGCCTGGCCCTTACA
TACCCCGTTTGTGATTGCCCGGGGAAGTCGCAGTGAAGCGCGCGTGGTGGTGGTTGAACT
GGAAGAAGAGGGTATTAAAGGCACCGGCGAATGCACGCCGTATCCGCGTTATGGGGAAAG
TGATGCCTCGGTAATGGCGCAAATTATGAGCGTCGTGCCGCAACTAGAGAAAGGGCTGAC
ACGGGAGGAGTTGCAAAAAATTCTCCCTGCCGGCGCAGCACGTAATGCGCTGGATTGTGC
ATTGTGGGATCTGGCCGCGCGAAGACAGCAGCAATCGCTGGCTGATTTGATCGGCATAAC
GCTTCCCGAGACAGTTATCACTGCACAGACGGTTGTCATCGGTACGCCTGATCAGATGGC
CAATAGTGCATCAACACTCTGGCAGGCAGGCGCGAAATTACTGAAAGTGAAGCTGGATAA
CCATCTTATCAGTGAGCGGATGGTGGCAATTCGCACAGCTGTGCCCGATGCGACGCTGAT
CGTTGATGCAAATGAATCCTGGCGTGCAGAAGGGTTGGCGGCGCGTTGCCAGCTATTGGC
GGATTTAGGCGTTGCGATGCTTGAACAACCGCTTCCTGCGCAGGACGATGCGGCGCTGGA
GAATTTTATTCATCCGTTGCCGATTTGTGCTGATGAAAGTTGTCATACTCGTAGCAATTT
GAAGGCGCTGAAAGGGCGCTATGAGATGGTTAATATTAAGCTCGATAAAACCGGGGGTCT
GACGGAAGCGCTGGCGCTGGCGACTGAAGCGCGTGCACAAGGTTTCAGTCTGATGCTGGG
CTGCATGTTGTGTACCTCTCGTGCCATTAGCGCCGCTTTACCGCTGGTGCCGCAGGTCAG
TTTCGCCGATCTTGACGGACCGACCTGGCTGGCGGTAGATGTGGAACCGGCGCTTCAGTT
CACGACGGGCGAATTGCATCTTTAGGATGCCAGCGCAGCAAGTTTGCCATCGCAAAGAGA
TATTTTTCGCTGGCTTCGTCGGAGGAGATGGGCGGAAACTCTGCGGTGATGCAATGCAAG
TTCAGATCTGCACACCAACTGCCGAAAGAGCCAGGCGTTTCATAACCGACGCTGGTTACC
AGAGGCAATTCAAACGCCTGAGCCAGCCATTCGCCTAATTCGCTGTGTCTGGGATCTTCA
ATACAGGCCAGTGGATCGTGGAATGAGACCACCCAGGCAGGTTGAATGCGGTGTATAAGC
TGGCACAGCGCCTGGGTTTCAGGTTCGGAGCCAGGTTTGTCACCTGTCAGTAATACGACA
TCGCGTTCTTCAGCGGCGCTGTTCCAGCGATAAACGGTTTCACCTTCCTTCCAGTTCGCC
GCCGGAAAGTTTCTGTTTAAATCCACACCATTAGCATTGGCCCGTAACCCCAACTGGCAG
CCGTCAGGATTCACACACAGCACCACATGATGACGGCGCAAAGAAGGTGTCAACGTCCGC
AGAGCACAGGAGAGCGTGACGACCGAAGAGTTTTCATCACCGTGAGTGCCAGCCAGAATC
AAACCACTTTCGCGGCTGGCTGCAGGGGCAGGAAACCAGATTAACGGCGCGCCCAATAAT
GAACGTCCGTAATGTTCTGTTCCGGGCGGAAATGCGCCGCGTTCGGCGCGTGGGCGGGTT
ACGGTCATGATCGTCTCTGGTTCAGGAAGTATTACAGGCAGTGTTGTGCAAATTTTGCGG
ATTATCAAATCCTTTTCTTCAACGCTATGTCATCGATCTTGTATCACTTTTTTGCCGGAA
GTTGTTTGCATTTTATTAGTTGGATAGGGTTTGTGGATTTTTGCTGGCTGACGGGCAAAT
AAAGTTTGTTTAATGGTTTGCTTATCTGCCAGTTGATTAATCACATGGCGGGCTATCTGA
CCGCCAGCACCAAGAATCAGTACATTTTTCATGAAAATTATCCCAGATTATTGGCAGCAA
TATGCCAGTCCATATCACTATTGCGGATTTGAATATGTTTCATTACAGAGTTTCCTCAAA
GAACGGAGCTAATACTGAAATTGCTTCAGCCACATAGGCTTTGCCGTCATAAAGATCCAT
ATGGTTTGCGCCTTCAACAATGTGATAGCGTTTATCCTGGCTTGATGCTCGATCGTACAG
GTCGTCACTCATCCATTTGCTCCCTGCCTGGCTGCCCGCCACAATCTGCGTCGGCTGAGT
CAGGTACACTTCCGCCATATGGTAAGCATCATAGGTAATAATCTGGTTAAGGCTGCGCAA
AGTAGCGTAACCCGGTGCTGTTGGATACTGCGCGCGAGGGGTGTGGTAATACTCCCAGGC
CTGACGCAGTTCTTCGTTCGGCGCATCGGACTCCTTCATTGGTGCCAGTGGCATAATGGC
GTATTCTCCGCTGCTAATATCGCTGGTTCTGGCGTTTGAACCCGCTTCAACGTATGGCAG
GGCATCAATAGATTTCACATTGTTTTCCCAACCATTACGGAATATCGAACCAATATTGAC
CGCACTAACGGTACCGATGGCCTTGATGCGGCGATCCTGAATTGCAGCATTGGCTGTATA
TCCTGCACCGGCACAAATTCCCATCGCACCAATTCGGGTATTGTCGACATAAGAAAGCGT
TGTCAGGTAATCAATCACGGCACTGATGTCTTCAGTACGAATGTATGGGTTTTCTAACTG
ACGCGGCTCGCCGCCACTTTCACCTTGATAAGATGCGTCATAAGCAATAGTGACAAATCC
CTTTTCCGCCAGTTTTTTGGCATAGGTTCCGGCCGTTTGTTCTTTAACGCCCCCACCTGG
GTGAGATAACACAATTGCCTGATACTGACGGGTTTCATCAAATTTTGGAGGGAAATAGAT
CACTGCAGACAAAGAGATGGTTGGATTATTGCTGTTAGTGAAGCTGACTTTATTATTCAT
CATTCCGTTCCTCATGGAGTTGTCGGTTCGTTTTAACGGTTGGTGATATCACTATAGATA
TTGATCATTAAGTTGATTAGACCCAAAATCATGATTAGACCTATCATTTAAATGATTAAT
AGATTGCATGGAGATACTGAATGAAGCGTGAAGAAATCGCTGATCTGATGGCGTTTGTCG
TCGTTGCAGAGGAGCGTAGCTTCACTCGTGCAGCAGCCCGCCTGAGCATGGCGCAGTCAG
CTTTAAGCCAGATAGTGCGTCGTATAGAAGAACGATTGGGATTGCGGCTTCTGACGCGAA
CCACGCGCAGCGTTGTTCCAACTGAAGCGGGCGAGCATCTTTTGTCTGTTCTTGGCCCTA
TGTTGCATGACATAGATTCAGCCATGGCATCCCTGAGCGATCTGCAGAACCGCCCATCCG
GGACAATACGTATTACTACTGTAGAACATGCAGCAAAAACGATATTGTTACCAGCAATGC
GCACATTCCTGAAATCGCATCCTGAAATTGATATTCAGCTCACCATTGATTATGGTTTGA
CCGATGTCGTTTCTGAACGTTTTGATGCAGGCGTCCGTCTGGGTGGGGAGATGGATAAAG
ATATGATCGCCATTCGAATCGGGCCAGATATACCAATGGCTATTGTTGGCTCACCGGATT
ATTTTTCTCGCCGAAGTGTTCCAACGTCAGTGTCACAATTAATAGATCATCAGGCAATTA
ATTTGTATCTTCCCACATCGGGTACAGCAAATCGCTGGAGATTAATACGCGGTGGACGTG
AAGTTCGTGTTCGCATGGAAGGTCAGCTTTTACTGAATACGATAGACCTGATCATTGATG
CTGCAATTGATGGGCATGGATTGGCGTATCTACCTTATGATCAGGTTGAGCGGGCTATTA
AAGAAAAAAAACTGATACGTGTTTTGGATAAATTCACACCAGATTTACCCGGTTATCACC
TGTACTATCCACACCGTCGACATGCTGGCTCGGCATTCTCATTATTTATAGATAGGCTGA
AGTATAAAGGTGCTGTTTAGCACTACTTGCTGATACATTAATTTAATTCTTCTCTTAACG
TATTCTCAGTTCCTTTCAACGTTTTGGTCATTTTTTATTCTTCGTACAATGGCGACAGAT
GCTGATTATGATACCGAAAACGGGTTTGAACGTGCGAAGCCCGAACGTAGTGTTCGGAGT
TCTATGTGCTTTACCGCATTTTGGAGACTATTATTTACACTAAATCTGATTTGATATATT
GATACTTAAAACATTTGATGCTTCCTTTGTCACTTTTTTGATGGAAGTTGTTTGCATTTC
TTTAAGGCGAAACAAATAATTACGCATCAATTTTAATGTCGGTTAGAGGGAAACTTATGA
AGCACTCTGTTTCAGTCACGTGTTGTGCGCTGTTGGTCAGCAGCATTTCTCTTTCGTATG
CTGCAGAAGTTCCGAGCGGCACAGTACTGGCAGAGAAGCAGGAGCTGGTGCGCCACATTA
AAGATGAGCCTGCGTCGCTGGATCCCGCTAAAGCCGTGGGCCTGCCAGAGATTCAGGTCA
TTCGCGATCTGTTTGAAGGTCTGGTGAATCAGAACGAAAAAGGGGAGATTGTCCCCGGCG
TTGCGACTCAGTGGAAAAGTAATGACAACCGTATCTGGACTTTTACCCTGCGCGATAACG
CAAAATGGGCGGATGGCACACCGGTAACGGCGCAAGATTTTGTCTACAGCTGGCAACGTC
TGGTGGACCCAAAAACATTGTCGCCATTTGCATGGTTTGCCGCGCTGGCGGGAATCAACA
ACGCACAGGCGATTATTGATGGTAAAGCTACGCCTGACCAGCTTGGCGTCACCGCAGTTG
ATGCCCATACTTTGAAAATTCAGCTTGATAAACCGTTGCCGTGGTTTGTGAATTTAACCG
CTAACTTTGCCTTCTTCCCGGTGCAAAAAGCCAACGTAGAAAGCGGTAAAGAGTGGACGA
AACCCGGAAATCTGATCGGCAATGGCGCTTATGTTCTTAAAGAGCGCGTAGTCAATGAAA
AACTGGTCGTGGTACCGAATACCCATTATTGGGATAACGCCAAAACGGTACTGCAAAAAG
TGACCTTCCTGCCAATTAATCAGGAATCCGCAGCCACTAAGCGTTACCTCGCGGGGGATA
TTGATATCACCGAATCCTTCCCGAAAAATATGTATCAGAAGCTGTTGAAGGATATTCCGG
GGCAGGTTTATACGCCGCCGCAGCTCGGGACCTATTATTATGCGTTTAACACGCAAAAAG
GGCCGACGGCAGATCAGCGCGTTCGTCTGGCATTAAGTATGACGATAGATCGCCGCCTGA
TGACCGAAAAAGTATTAGGGACGGGCGAAAAGCCAGCGTGGCATTTTACACCAGATGTTA
CCGCGGGATTTACGCCGGAACCTTCGCCGTTTGAACAAATGAGTCAGGAAGAACTGAATG
CGCAGGCAAAAACTTTGTTGAGCGCAGCTGGTTATGGTCCGCAAAAACCGCTGAAGCTGA
CGCTTTTGTATAACACTTCAGAAAACCATCAAAAAATTGCGATTGCTGTAGCATCGATGT
GGAAAAAGAACCTTGGCGTAGATGTTAAATTGCAAAATCAGGAATGGAAAACCTATATCG
ATAGCCGTAACACCGGCAATTTTGATGTTATCCGCGCCTCGTGGGTGGGGGATTATAATG
AACCCTCCACTTTCCTGACATTATTAACGTCAACGCATTCAGGAAATATTTCACGCTTTA
ACAATCCGGCATATGACAAAGTTCTGGCCCAGGCATCGACGGAAAATACCGTTAAAGCGC
GTAATGCCGATTACAACGCGGCAGAAAAAATCCTCATGGAGCAAGCACCGATTGCACCAA
TTTATCAATATACCAATGGACGATTAATCAAGCCGTGGCTGAAAGGTTATCCCATTAATA
ATCCTGAAGATGTGGCGTACAGTCGGACTATGTATATTGTGAAGCATTGATGTGATGGGA
ACTGGCGTTACCCTTGTGCATAACGCCAGTGATGTCTGATTTAGCGACCCTGTTCCGGCG
GTGTAATGTTATCCATATACAGCGTCTGGCTGGGGAAGGCAAAGTCCGCGCCGTGTGACT
GTACAATATCGATAATCTTCAAATAAACGTCTTGCTGTGCAGCAAGCCATTCAGCCCATA
CCGTGGTTTTGGTAAAGCAATAAACCATAATATTCAATGAAGAGTCAGCAAACTGGTTGA
AATAAACCAGTAAGGTTTGTCGCTGGTCGATGGCCGGGTGATTTTTCAGCATCTCACGTA
CAGCTTCGACAATAACGCCCACTTTTGCCGCATCCTCATAACGTAAACCAATGGTCGTGG
TAATGCGGCGGTTGGTCATTCGTCCTGGGTTTTCTACGCTGATCGACGAAAACAGCGAGT
TCGGTACGTACAATGGACGATTATCAAAGGTCGTAATTTTGGTAATTCGCCAGCCAATTT
CCGCTACTGTACCTTCGATATTTCTGTCCGGTGAACGGATCCAGTCGCCAATACTGAAAG
GACGGTCGAAATAGAGCATAATCCCGGAAAAGAAGTTACTCAGAATATCTTTACCGGCCA
TACCGACAGCCAGACCACCAATACCACCAAAGGTCAGCAAGCCAGAAAGGCTCATGCCGA
AATGTTCGCCATAAAGCAGAACAAGCACCACAATAATGGTGATTTTGATGATACGCGACA
TAATCCGCGCACTGGTGATATCGCGACCTTTTTTAATCTGCTGTTTTTCAAACTGATTAA
TCAGCAGAAATAGCTTAATCGTCAGAATAACCGCAATCAGGGACGTACAGATAAAATCGA
TAACGCCTGGGGTGATAAATTTGAGTTTATAGTTTTCTATAACATAATTAATAATGCTAC
CAACAGCACTGATAATTATGGTGTAGATTAAAAATTGCACCGCATGGAATAAAAATCCTT
TTCTTTTACGATTTCCACGGCGAAACCAAAAGCTCATCAGAATCAATGCTGCGCAGCTAC
CGAAAATAATGACCAGATTAAGCGCATTATTTGTAAACAGTTCAGCGATCATTGTTTTAT
CAGGCTCCTCCAGATAATTGTCGTCATGCCGGAAACCCCTGGCGGGGCTATTTTACCGCG
ACAATTCATTCAGATCATCAATAGTCAGGGAAGGAAGTAGCAACATTAGCTAAGGAAGGT
GCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTTCAT
CATGAGTCATCAACTTACCTTCGCCGACAGTGAATTCAGCAGTAAGCGCCGTCAGACCAG
AAAAGAGATTTTCTTGTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGT
CATCGAGCCGTTTTACCCCAAGGCTGGTAATGGCCGGCGACCTTATCCGCTGGAAACCAT
GCTACGCATTCACTGCATGCAGCATTGGTACAACCTGAGCGATGGCGCGATGGAAGATGC
TCTGTACGAAATCGCCTCCATGCGTCTGTTTGCCCGGTTATCCCTGGATAGCGCCTTGCC
GGACCGCACCACCATCATGAATTTCCGCCACCTGCTGGAGCAGCATCAACTGGCCCGCCA
ATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACTCAAGGCAC
CTTGGTCGATGCCACCATCATTGAGGCACCCAGCTCGACCAAGAACAAAGAGCAGCAACG
CGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCA
CATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTGGTCACCACCGCGGCCAACGA
GCATGACCTCAATCAGCTGGGTAATCTGCTGCATGGAGAGGAGCAATTTGTCTCAGCCGA
TGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCT
GATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTGAAACAGCATCCACGCAAGAACAAAAC
GGCCATCAACATCGAATACATGAAAGCCAGCATCCGGGCCAGGGTGGAGCACCCATTTCG
CATCATCAAGCGACAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGTTGCTGAAAAACGA
TAACCAACTGGCGATGTTATTCACGCTGGCCAACCTGTTTCGGGCGGACCAAATGATACG
TCAGTGGGAGAGATCTCACTAAAAACTGGGGATAACGCCTTAAATGGCGAAGAAACGGTC
TAAATAGGCTGATTCAAGGCATTTACGGGAGAAAAAATCGGCTCAAACATGAAGAAATGA
AATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTATTCGCACCTTCCCTAACTAATCAA
TGCGTTGATTGTAAATCCAGCTAAGAGGTGAGGTTTTCAGAGCAGACAACGGTGAAATGT
CATGGTATTGTTACGTTTAGGTAACAAGAAATTTGTCTGCACAAGGATTACATCATGATT
ATGGCGAAACTGAAGTCAGCGAAAGGGAAGAAATTTCTCTTTGGTTTGTTGGCGGTTTTC
ATTATTGCGGCGTCGGTTGTGACTCGCGCGACCATCGGCGGCGTTATAGAACAGTACAAT
ATTCCGCTGTCTGAGTGGACGACATCAATGTATGTGATTCAGTCATCGATGATTTTTGTT
TATAGCCTGGTCTTTACTGTGTTGCTGGCAATCCCGTTGGGAATTTATTTCCTTGGCGGC
GAAGAGCAGTAAGTAAAAAATAGGCCCGATAACTCGGGCCTTGTCAGTTATTGAAGAGTC
GTTAATCGTCTTCTTCGTCATCCAGTTCAACGGGTGTCTGATACTGGTCAGGTTTAATGA
CCAGCAGGTCGCAGCGAAGATGATCAATCACCTGTTCCGCCGTGTTGCCGAGGAATGCTG
CTGAAATACCGGTGCGTCCTACCGTGCCCAGAACCACAATCCCCGCCTGTAAGTGCTCCG
CCAAATCAGGAATCACCTCTTCTGGCAGACCTTTTTCTACGTGCGTCATGTTTTCATTAA
TGCCGAATTTCTGCCGCAGGGCTTTCATTGCCAGCAAATGTTGCCCACGAATGGCATCGT
TATAAACGCTCGGGTCAAATTCCGGCAGTTCAATCGCGATATTAATTGGCGTTACCGGAT
AAGCGCCAACCAGATGAACTTCGGTATGGTTGACTTGTTCTGCCAGTTCGATCGTCTCTT
TGACCAGTTTTTCATTGAGCGCATTATGATACGGCTCTTCACTGGCGAGATTCACCGCCA
CCAGCGCCTTGCCTCCTTCCGGCCACGGCTGGTCTTTCACCATCCACACCGGGCTTGGGC
ATTTGCGTAACAGATGCCAGTCCGTTGGCGTAAAAATCACCGCTTCCAGACGGTCATGTT
GGTGCGCCATTTTTAGCACCAAATCGTGTCCGCCGCTGATCACTTCCTGAATGATGGCTT
CGAAAGGACGGTTATGCCAGACCACTTTAATTTCAATGGGAACGCCAGCATTGAGATAAT
ATTTTGCCTGCTCGTGGATCCAGGCTGTACGCTGGCTGATGACGCCCTGACGCATAGCGG
TACGTTCGTCCGGGGAGAGCAGGGTGGTCATTTCGTATGAGAAGTCATAGATCGGCAAAA
AGGCTTTAATTTTGCCACCAATCCGTTGATGTAAATAAACAGCTCGCCGCAATGCTGGTT
GGTCGTCCTGGTTAGGATCGATAACAACGAGCATGTTCTGATACATAGCCATACAGGGTC
TCCTTACAACAACTGTCAACGCAGTTTGTAATTAAAAGATTAACCCATATCTGGTGAATG
AAACAGTGATGAACCTTCTGCCAGATCAATAAATCAGAAAAATTTAATGATATGACAGAA
GGATAGTGAGTTATGCGGAAAAATCAGGCAACGTTACGCGTATGACCAGCAAGCTGGGCC
AGCGCATCGTTATTTTCGATGGTGATGTATTTACCTTTGACTGCCAGCATGCCGCTTTTC
TGGAAGCGACCCAGCAGACGGCTGATGGTTTCTACCGTCAGGCCCAGATAGTTACCGATA
TCGCCACGAGTCATCGTCAGGCGGAATTCACGAGGGGAGAAGCCGCGTTGGGCAAAACGA
CGGGACAGGTTGTAGATGAATGCAGCCAGACGTTCCTCGGCATTTTTCTTCGACAACAGC
AGGATCATGTCCTGATCGCCTTTGATTTCACCGCTCATCAGACGCATCATCTGCTGACGC
AGATTCGGCATTTTACCGGACAAATCGTCCAGCGTTTCGAACGGGATTTCACATACCATC
GAGGTTTCCAGCGCCTGCGCGAAGCTCGGGTGATGGCCGCTGCCGATGGCGTCAAATCCC
ACCAGGTCGCCTGCTAAATGGAAACCAGTGATTTGCTCGTCGCCTTGCTCAGTGATGGTA
TAACTTTTAATCGTACCGGAGCGGATGGCATAAAGCGATTTAAGTTCATCACCAGCCTTA
AACAGCGTCTGGCCTTTCTGAATAGGCTTCTTCCGCTCAATGATATTATCAAGCTGATCA
AGCTCATGTTCGTTGAGTGTGAACGGGATGCAAAGCTGGCTGATGCTGCAATCCTGGCAA
TGGATAGCACAACCGCCAGACTGAATGCGCCGTATAATTCGCTTTTCCGGGATCATAGGT
CTGCTCAAGCCGTAATTGATATTTGTCAATTTTAACATCTTTTTAGGGAGCAAGTAAGTC
TAAGCAAACCTTAACAGCAGAGAATTCCGATATTAGATGTAAATATATGTCTATCTATTT
GAAAACCCTTAAGTTGTTAAGGGTAACTTTACATAAAAGTGTGAACAAGCTGGCACAAAT
TGTTTAATGTTTACAGCAAAAGATAACCTTCATGGCGCAATAACCACTCTTTTCGCTGAA
CTCCGCCTGCATATCCGGTCATGGTGCCGTTTCGGCCAATAACCCGATGGCAAGGTACGA
CGATGCTGATGGGATTCGATCCGTTTGCCGCACCAACGGCACGCGCCGCGCCAGGACGGC
CCAATTGCTCAGCCAGTTGGCCGTAATGCATTACCTGCCCGCAGGGGATAGTGCGTAGTG
TTTTCCAGACTTCGCGCTGAAATGGCGTCCCCCCCGTAGCAGTGGGAAGCGTATCAATAA
TGCTAAGATTACCGGCAAAATATTCACGAAGCTTGTCGCTTAAACCGCCTGGATTGGTGG
CAGAAATGCGCTCATAGCCTTCTTTGCGATAATGGATGTCCAGCAGCTGCACCATGCGTT
CGCTGTACTCTTCCCATTCAACCGCCCGCAGGCGAAATTGCTCATCGCAAATCACCCACA
GTGGACCCAGTGGCGTGGCAATTTTTTCTTCAAGTAATCTCAGCATCCGTTCTCTCTTAA
GACAAACGTGGGTAAATACCCGGACCTATCGGCAGACCGACAAGATACCACGCCAGCAAC
ATCAGCAGCCATACCACCAAAAAGATAAGTGGATAGGGCAAGACTAACGAATAGTAAGTA
CCCAGTTTCGCGTCTGGTTTGTAGCGTTGCAGGAATCCAAGAAACAGTGGAACAAAAGGA
GATACCGGCGCTAAAGGCAATACGGATGAGTCGGCAATACGAAAGAGGATTTGCGCAAAT
GCCGGGTGAAAGCCAAGTAGCATAAACATTGGTACGAAAATGGGGGCGAGAATCGACCAG
ATTGCGGAACCGCTGGCAATAAACATGCATAAGAAAGAGGAAAGCAACGCCAGACCGACA
AACGCCGGGATGCCGCTAAGCCCTGAACTTTCCAGTATATCGGTCAGCCCCACGGCGATG
AATTTCCCCATGTTGCTCCAGTTAAACATGGCGACAAATTGGGCGAGGGGAAAAACCATC
ACGATAAATCCCGCCATCTCTTTCATCGGTTCAATCATTAAATGCGGTAAATCCGCCTGA
CGTCGAATTGTGCGGGTAGCGATGCCATAAGCCAGCGAGACAACAAAGAAAAAAAGAATG
ATCAGTGGCACGATACCTTTAATAAAGGGTGATGGCATCACGGTGTGATTAATCGGATCG
CGCAATATCCCGTTTTGCGGGATCACCATCAGCGCAATCGCAGCAATAAAAAGTAGCGAT
ACGACACCTGCTATGCGTAAACCAAAACGCTGACTTTCGGTCAATGTCTGCAGTTTCTCA
TCGCTGTTTCCCTGCCATTGACCTAACCGTGGCTCGATGATTTTGTCGGTTATCAGGCCG
CCAACAATCGTCAGTACGACTACGGAGCTGGCCATAAAATACCAGTTATCAATTACACTG
ACGTGCATTTGCGGATTGAACGCAGCTGCCGCTTCCGTGCTGATCCCCGACAGCAACACG
TCGGTTGTGACAATCAGTAAATTAGCCGTAAAGCCGCAACCTACGCCTGCAATGGCAGCC
AGTAAACCTGCAACTGGATGCCTGCCCACCGCCAGAAAAATCAGCGCACCCATCGGTGGC
ATGATCACTAACGCCGCATCGGAAGAAATGTGGCTGAAAAAAGCAATAAACAGCACCATA
TAACTGGCGTAGCGGGCATTAACATGCGATGCCATTTTAACCATTAGTGCTGGCAGTAAG
CCGACGCGCTCCGCCAGACCGGCACCTAAAACCAGCGCCAGGATCGCACCAAGTGGAGCA
AAACCGCTAAAGTTTTTAATAACATTGGGTAAAAACCAGTGTAATCCTTCCACACTGAGC
AGGTTTTTCACCACGACCGGCGTACCATCGGTCGGGTTTTTCGCACTGACGCCAAAGGCC
GACAAAATTGCCGTCGTCACCATGAGTACGATAATCAAATAGATAAAGAGCAGAAAAGGA
TGGGGAACCTTGTTACCAATTCTTTCGACCCAGCCATAGAGCTTCCCGGATTGGGAGGAC
GACGGTATGGATGACATACTCATGGGCATTCCTCGGTTGTTGTGTTTGCGTTGTTGTTGT
TATTTTAAAGGTGACGGTGTCACGTTTTTCGGGATAGGGCAGTGATACGGTTGCGTGTCC
GTTACTTGCTGATGCTCTTGTTGGCATTCTTGCAATAGCCCTGAATCAAGGAAGAGATTG
ACTGTGGTTGCTGCCATAGTTTTCGCCGCCAGCAGCATTCCTTTATGAGCAATAGATGTT
CGCCCCTGGCTAACCAGTTGCCACGTATGTAGCGGTGTACCGACGGCAAAACAGGGGCTG
AAACACTGGGCAACAGGCAGTTTCCAACTGACGTCGCCGACATCAGTCGATGCCGCAAGC
ACGTTATCGGTGGCGGCATATGGAGCGACTTCATTCGCCAGTACCGTTTCACGATGACGT
AGTGCAAAAACCTTGCCGTTTTCGCCACCGGTTGCGGCGATATTATTCAGACTGTTTTGC
CGATCGTTGGAGGTGAGCGTAGCCTGAATTTGTTTCGCAAAAGCCAGTTCTTCGGAGTTC
CATTCCGGGGTACCAAAATGGGATAGGGCCTGGTACATGGCATTTTCTAAGGTGCGATTC
GGGAGATAACTGGAACAGGCTTTGTCGAAGCGGCATTCAACCGTGGTTTCGGTCATCAAT
GCCGCACCTTCGGCGATTTTGGCGACCCGATCATAAATATGCTGCACGTCGGTCATTTCG
GGGGCGCGGATAAGATAAAGCACTTCTGCCTGCGCCTGGACCACGTTGGGCGAGATCCCG
CCGCTATTTGTGATGGCATAGTGTACGCGCGCTTTTTCAATAATATGTTCGTTGAGGAAG
TTGGTGCCAGTGGTCATCAACGTTACGGCATCAAGGGCGCTGCGTCCCAAATGAGGGGAA
TTCGCGGCATGTGCTGCGATCCCTTTAAAGCGCCATGATGCCTGAATGTTTGCCAGCGTG
CGGGTATTGAACATACCGGCAAAGGCTTCCGGGTGCCAGGTGAGTGCCGCATCCACATCA
TCAAATACCCCCTCGCGAACCATGAACGTTTTACCCGAGCCGCCTTCTTCGCCAGGACAA
CCATAAAAGCGCACCGTGCCGCCTTGCCCATATTGTTCCAGCCATTTCTTGACGGCTATT
GCAGCGGCAAAGGCGGCGGTTCCCAGCAAATTGTGTCCGCAACCGTGACCATTTTCACCG
GGCGTCACGGATGTAGGTTGCGCGCAACCTGCTTGCTGACTTAAACCTGCCAGGGCGTCA
TATTCTCCCAGCAGGGCGATAACCGGTTTGCCTTGACCAAACGAAGCAATAAAGGCATTT
GGGATATTGCCTACGTTGCGGGTAACGGTGAAGCCTGCAGATTCCAGCGCCGAAGCCAGA
TGCTCCGCTGACCAGAACTCTTCAAAACGTGTTTCTGGATGATCCCAGATTTGATCGGCA
ATATCGGTATAACGTTGGCGATCGGCTTCAATCGCATCGTCGATAAAACGATAGATTTCC
TGCATCAGATACCTCGCGTCCAGGGAAAATTGAGCGCGGTGCGCGCCAGCGTTTCGACGG
CAATAGCGAGAACCTGCTCGTCAAAATCGAATTTTTCGTTGTGATGACCTGCCGCCAGCT
GTGTGCCAAACACCACGTAGGAGGCTTGCCCTTGATGTTGCTGCACGCGGGCCATCATTA
ATGTGGCATCTTCGGAACCCGCAGGCGCTTCAACACGTTCAATGGCCTGATTGACCCCCG
CGACCTGAGCCGCCTGACTTTGCAACCATGCGACCCATTGCGGCGAAGGAGAACTGGCGG
TAGCTGCACCCATCAGACGAGTTTCAACGCCGACACCATACATGGTTGCTGCGCCCTGAA
TCGCTTGTTGTGCACGGTCAAAAACATATTGATTAATGACGTCGCTGGCCCCGCGTGTTT
CCACTTTCAGCAACGCCGAGGCAGGAACAACGTTACGACCGCTTCCTGCCTGCATAACGC
CCACGTTTACTCTGGAAGCTCCTTCGCTGTGCGGGGCGATTGCATGCAGTGCAAGAGTGG
CTTGTGCTGCCGCCAACAAGGCATTGTGACCGTCTTCTGGTTTTGCGCCTGCGTGAGCGG
CGGTACCGGTGAAGTGCGCGTCAAATTTGGTGGTTGCCATAAAATTATCACTGCCGCACA
CCACGGTGCCCGCAGGTACGCCAGTGCCAATGTGCACGGCAGTAAAATAATCAACATCAT
CTACGACACCTGCATCGACCATCGCCCGCGCGCCACGCGTACCTTCCTCTGCAGGCTGAA
AAATCAGTTTGATGACGCCATGTAGTCCGGACTCGAACTGTTTAAGGGTATGCGCCAGCC
CAAGCCCAATGGCGGTATGTCCATCATGACCACAGGCATGCATCATTCCGGCGTTACATG
ACGCAAAACCGTCGCGGTAGGGGCGATGGCTGACATCCTGCTCTTCACTGAGATCCAGCG
CGTCCATATCGACACGGAAAGCCATCACCGGACCGGGGCGACCGGTATCCAGGGTGGCGA
CGATACCAGTGAAACCACCTTCAAAAGCCGCAATCCATTGTGCTAGCGCACCCTGTTGAC
GAGCGCGCTCGAATTCGCGTTGTAGAGTGAATTCATCAGGTAATCCCATCCGGCTACTTT
CATTAACTACTTCGCGACCCAGCGCCAGTGAATAGCCGAGCTGGTGCAATTCTTCCGCAA
CAAGGGTGGCAGTGCGGAATTCCACCCAGCCAGACTCTGCATAGTGATGAAAATCACGTC
GCCAGTGCGATAATTTTGGGGCAAGCGAATTAACAAATTGATTCAAAGACTCCATAACCT
TTCCCGTCATCAGTAAAAAGTGTGACCCGGTTCACGTAGCGATAGTTTTTACTTATCACT
AACTGATTTTTCACAGTTTTAACCGTTCATAAATTACCCTGACACAATCATCTGCATTAA
AGTAGATGCCAGTTTCTTTGGTCTGATAAATAACGGTTATCGGTGGCGTCATGGCTTTTC
AGGTAAAAATTCATCAAATTCGGGCTTTTGTTGAAGTGGCTCGTCAGGGCAGCATTCGCG
GAGCGAGCCGAATGTTGAATATGTCGCAACCGGCACTGAGTAAATCTATTCAGGAGCTAG
AAGAAGGGTTAGCGGCGCAACTCTTTTTTCGCCGTAGTAAAGGCGTGACGTTAACTGATG
CCGGTGAAAGTTTTTATCAGCACGCCAGTCTAATTCTTGAAGAGCTGCGCGCAGCCCAAG
AGGATATTCGCCAACGACAAGGGCAACTGGCAGGGCAGATTAATATCGGCATGGGGGCCA
GTATTTCCCGCAGTCTGATGCCAGCTGTCATATCTCGTTTTCATCAGCAGCATCCGCAGG
TAAAAGTACGCATTATGGAAGGGCAACTGGTGTCGATGATTAATGAATTGCGTCAGGGAG
AATTGGATTTCACCATCAATACCTATTATCAGGGACCGTACGACCACGAATTTACTTTTG
AGAAATTACTGGAAAAGCAATTCGCGATCTTTTGCCGCCCGGGACACCCCGCCATTGGTG
CCCGTTCGATCAAACAGTTACTGGATTACAGCTGGACAATGCCGACGCCACACGGCAGCT
ACTACAAACAGTTGAGTGAATTGCTTGACGATCAGGCGCAAACGCCACAGGTCGGTGTAG
TCTGCGAGACGTTCTCAGCCTGTATCAGTCTGGTGGCAAAAAGCGATTTTCTCAGCAAAC
TGCCTGAAGAAATGGGCTGCGATCCCTTGCACGGACAGGGGCTGGTGATGTTGCCGGTTA
GCGAAATTTTACCGAAAGCGGCCTATTATTTGATTCAGCGGCGTGATAGTCGCCAGACAC
CACTGACCGCGTCATTAATCACGCAATTCCGGCGAGAATGCGGCTATCTGCAAAGTTAAA
ACTGCATAAAAAAATAGAGTCTGTCGACATCCGCCAGACTCTACAGTACACACAGCAGTG
CATCCGCGTCTTAAATCCGGCATTGTCTCCTCTGCGCCGGTGACTGTGTTATAACGGTTT
TAACCTTTAGTTGCCAATTTTCTTCAGTGACAGATTTCACGAAAATATAAGTTACATTAT
TAATATCGTGAATGAATAATCATGCATAAGTATTTTGCTTAAAATATCGGCAATATTTGG
AACTTATTACTGGAAATTTGGGTAATACGTTGTTGGACCGACCCGGTCTGGTTATCATAT
CGCGCTCTTAATTGCGGGAGGATGTAACATGAACCTTGACGACAAATCGCTGTTTCTTGA
CGCCATGGAAGATGTCCAGCCGCTGAAACGTGCTACCGATGTCCACTGGCATCCAACGCG
TAACCAACGTGCGCCGCAGCGTATCGACACGCTGCAGCTTGATAATTTCCTCACCACCGG
ATTTCTCGACATCATCCCACTAAGTCAGCCGCTGGAGTTTCGGCGGGAAGGGTTGCAACA
TGGGGTGCTGGATAAGCTGCGCAGTGGTAAATATCCGCAACAGGCGAGCCTGAATCTTTT
GCGCCAGCCGGTGGAAGAGTGCCGCAAAATGGTGTTCAGTTTTATTCAACAAGCCCTGGC
GGATGGTTTGCGTAACGTGCTGATTATTCATGGTAAAGGGCGGGATGATAAATCGCATGC
CAATATTGTCCGCAGCTATGTGGCGCGCTGGCTGACCGAATTTGATGATGTTCAGGCATA
TTGCACCGCGCTACCGCATCATGGCGGCAGCGGGGCGTGTTACGTCGCACTACGTAAAAC
GGCGCAGGCGAAGCAAGAAAACTGGGAGCGCCACGCTAAGCGCAGTCGTTGATCTCGAGA
CGCATCCGCGGCTTATGCCGCCAGCACGCGGTTGCGTCCATCATTTTTCGCCCGATACAA
AGCATCATCAACGCGTTTAAACAGTTCATCGATGCTTTCATTTCCTTCGTGATGCGCCAC
ACCAATGCTGACGGTAAAGCGTGGTAAGCCCGAAATACTCACTTTTGCCACGCTTACGCG
GATAGTTTCAGCCAGCGAAAGCGCGGTATCCAGTGGGGTTCTTGGTAGCAATAAGACAAA
CTCTTCGCCTCCCCAACGAAACACCAAATCGCCTTTGCGAGCGCAACTTTCGAGGGTGCG
GGCGAGGGCGCATAACACCTCATCACCTTTAGAATGCCCATAGAGATCGTTAATGTGTTT
AAAACGATCGGTGTCGATGAGCAACAAGCTGTAATCCTGAGCGATGGCGAGATGCTGCAT
TTGGCCTGGTTCCGTAATGTGATAAAACTGTCGCCGATTCAGTAATCCGGTCATCGCGTC
ATGGTGAGCAGCATGTTCCAGCTGCTCCTCCAGCCGTTTTTGCTCAGTAATATCATGCAC
AATACATAACATGAGCTTGTCGCCATAAATTTCAATCGGTCCGGCATAGGTCTGCACATG
ACGAGTCGAACCATCCGCCAGTTTATGAACAAAATTCAAAGGTTTATGACCACCGGGTAA
ATGCGAGATTTCATGCATGATAGGCATGACGCGACGCCCGAGCATATTTATTTCCCAGGT
ATGTTTCTGGCACATCGTTTCATGGTTATAACCATAGAAATTGAGCGCGGCGAGGTTAGC
ATCGACGATTTGTCCATCTCGTGACGGGTCAATCAACAACATTGGTGCAGAGTTAGTCAG
AAAAAAGCGCGCATAAAAACCTTGTTTTTTGCGCTGATAATTTGCCGAGCGACTGGCTTT
TAAACCCAGCGTTGCCGGCGCTTCGATACCTTCGAAAATAATCACCGGTTCTGTTTCTGT
CAGCTTTCGCAAAACAAGCCGACAGCTCAATGCTGTTTCCTCTTCTTTACGCTGAACAGT
GAGGATTTCGATAATATCGTGTTGGTTTTGCAGATCGGAGAGGTATTTCGGCAGTTCTTT
TTGTGAGGAGACGGAATAGGGTCCGGTTCGTAGCTGACTAAACGTGAGGTCTTGCATCAA
CAGTTTCGCCGCGCTATTGGCATAAATTAACTGTTCCTCAAAGGGCGAAACGATCCAGAC
AGGACTGGTGAGTAAGTCCAGGGTATTGAAGTTGTGCGTAATCATTGAGATCCCGTTATT
TTTATCAATTTTTGTTGCTATCCGATCGCAAAAAAGCCACGTCATATGATCAGATAATTC
TGATAATGATAGACGCTATTTAACACTTCACACGGTTTGTATACGGAAAAGCATTTTGCT
TTTTGTATTCAATTTAGACAGAATTTTATTAATCATTTCAGGGTAATGGGGTGATGAGAT
GTTGCGTAACAGGGCCAGAAGGCTAGACTACAAAATAATGCGTTGATGATGGAGGCACTG
TGGAAGCGATTAAGGGATCGGACGTTAATGTCCCGGATGCAGTATTTGCCTGGATGCTGG
ATGGTAGAGGCGGCGTTAAACCGCTGGAAAATACAGATGTGATTGATGAAGCGCATCCCT
GTTGGCTCCACCTTAATTATGTACACCATGATAGCGCCCAATGGCTGGCGACAACACCGC
TGCTTCCCAATAACGTACGTGATGCGCTGGCGGGCGAGAGCACGCGTCCCCGAGTCAGCC
GTCTCGGTGAAGGCACGCTGATTACATTGCGCTGTATAAACGGCAGCACCGATGAACGCC
CCGATCAACTGGTCGCCATGCGTGTATATATGGACGGGCGGTTAATTGTTTCGACCCGAC
AACGCAAAGTGCTGGCGCTGGACGATGTGGTGAGCGATCTGGAAGAGGGCACGGGTCCGA
CCGATTGCGGGGGATGGCTGGTGGATGTGTGCGATGCGTTGACCGATCATTCCAGTGAAT
TTATCGAGCAGCTGCACGATAAAATTATCGACCTTGAAGATAATCTCCTTGATCAGCAAA
TTCCACCGCGTGGATTCCTGGCTCTGCTGCGCAAACAATTAATTGTGATGCGTCGCTATA
TGGCACCGCAACGTGATGTTTATGCTCGTCTTGCCAGTGAACGTTTGCCGTGGATGAGCG
ATGACCAACGCCGTCGGATGCAGGATATTGCCGATCGCCTTGGGCGCGGCCTTGACGAAA
TCGACGCCTGTATAGCACGGACTGGCGTGATGGCGGATGAAATCGCTCAGGTGATGCAGG
AAAATTTAGCTCGTCGTACCTATACAATGTCGTTGATGGCAATGGTCTTTTTACCCAGTA
CCTTTCTGACCGGGTTATTTGGCGTCAACCTTGGTGGGATCCCTGGCGGCGGGTGGCAAT
TCGGATTTTCAATTTTTTGTATTCTGTTAGTTGTTCTTATTGGTGGTGTTGCTTTATGGT
TGCATCGTAGTAAATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAAACG
CCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCTTGC
AGGTGAATGCAACGTCAAGCGATGGGCGTTGCGCTCCATATTGTCTTACTTCCTTTTTTG
AATTACTGCATAGCACAATTGATTCGTACGACGCCGACTTTGATGAGTCGGCTTTTTTTT
GCCTGTTATTTATCAGCGTCTACCCTTTAAGAGTCCACCCAATGACCAGAGGGAAATATG
ACGACACTTATTTATTTGCAAATTCCTGTCCCTGAACCGATTCCTGGCGATCCTGTTCCA
GTGCCCGATCCGATCCCTCGCCCGCAACCCATGCCTGACCCACCACCCGATGAAGAACCG
ATTAAATTGTCGCATCGTGAGCGTAGATCTGCGAGGATACGCGCCTGCTAACTTTGCGTC
GATGACCACGAGAATAGATTGTGACCGCTTTTTCTACCCTGAATGTTTTGCCTCCCGCCC
AACTCACGAACCTTAATGAGTTGGGTTATTTAACCATGACGCCGGTGCAGGCCGCCGCGC
TTCCGGCGATCCTTGCCGGAAAAGATGTTCGCGTGCAGGCGAAAACCGGCAGCGGCAAAA
CGGCGGCTTTTGGCCTCGGCTTGTTACAGCAAATTGATGCGTCGCTATTTCAAACCCAGG
CTTTAGTGCTGTGTCCTACGCGTGAACTGGCGGATCAGGTGGCAGGTGAATTGCGTCGGC
TGGCGCGTTTTCTGCCAAATACCAAAATTTTGACGTTGTGCGGTGGTCAACCGTTCGGTA
TGCAGCGTGATTCGTTGCAACATGCGCCGCATATTATCGTGGCAACGCCGGGGCGTTTGC
TGGATCACCTGCAAAAAGGCACGGTATCACTGGATGCGTTGAATACGCTGGTGATGGATG
AGGCCGACCGCATGCTGGATATGGGATTTAGCGATGCCATTGATGATGTCATCCGTTTTG
CGCCTGCATCTCGACAGACGCTTCTGTTTTCGGCAACCTGGCCGGAAGCCATCGCTGCAA
TCAGCGGACGAGTGCAACGCGATCCTTTGGCGATTGAAATTGACTCAACAGATGCTTTGC
CACCCATTGAACAACAATTTTATGAGACATCCAGCAAAGGCAAAATTCCTCTGTTGCAAC
GGTTATTAAGCTTGCATCAGCCATCCTCTTGCGTGGTGTTTTGCAATACCAAAAAAGATT
GCCAGGCTGTCTGCGACGCGCTGAATGAAGTAGGGCAAAGTGCATTGTCATTACACGGCG
ATTTGGAGCAACGCGATCGCGATCAGACCCTGGTACGTTTTGCTAACGGTAGCGCCCGTG
TACTGGTCGCGACTGATGTTGCTGCGCGTGGTCTGGATATTAAATCGCTTGAGCTGGTGG
TGAACTTTGAGCTGGCGTGGGACCCTGAAGTTCATGTACATCGCATCGGTCGTACAGCTC
GTGCAGGAAATAGCGGTCTGGCGATCAGTTTCTGTGCTCCGGAAGAAGCACAGCGGGCCA
ATATCATTTCTGACATGTTGCAGATAAAACTTAACTGGCAAACGCCGCCAGCTAATAGTT
CCATTGCGACGCTGGAAGCAGAAATGGCAACGTTGTGTATCGATGGCGGGAAAAAAGCCA
AAATGCGCCCGGGTGATGTATTAGGTGCACTGACAGGAGATATCGGGCTTGATGGCGCAG
ATATTGGCAAAATCGCCGTGCATCCGGCGCATGTCTATGTCGCGGTCCGTCAGGCTGTTG
CTCATAAAGCATGGAAACAGTTACAGGGCGGGAAGATTAAAGGAAAAACGTGCCGGGTGC
GGTTATTAAAATAATGAAATGTTGAATTGCCGGGTGCAAGAGTAAACATCTTATTCGGGA
TTGCCGGATGCGACGCTGGCCGCGTCTTATCCGGCCTCCATAAGAGTAGCCCGATACGCT
TGCGCATCGGGCGCTATCCTGGTTATTTCACTTCAACCACATTCAGCCGTAACTCATCCA
ACTGATTTTCATCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGAT
CAAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATGCCTTTGAAATCGA
ACAGGTTGGTATCGCACAGATGCGACGGCACCACATTCTGCATCGCGCTGAACATCGTCT
CGATACGCCCTGGATAACGTTTATCCCAGTCACGCAACATGTCAGCAATCACCTGACGTT
GCAGGTTAGGCTGTGAACCGCACAGGTTGCACGGAATAATCGGGAACGCTTTTGCATCGG
CAAATCGCTGAATATCTTTCTCGCGGCAGTAGGCCAGCGGACGAATAACGATATGTTTGC
CATCATCGCTCATCAGTTTCGGAGGCATACCTTTCATCTTACCGCCGTAGAACATATTTA
AGAACAACGTTTGCAGGATATCGTCACGATGGTGACCCAACGCGATCTTCGTCGCCCCCA
GTTCCGTTGCGGTACGATAAAGGATACCGCGACGAAGGCGAGAACACAGTGAGCAAGTGG
TTTTGCCCTCTGGAATCTTCTCTTTCACGATACCGTAAGTATTCTCTTCAACAATCTTGT
ACTCAACGCCCAGCTTTTCAAGATACTCGGGCAGAACGTGTTCCGGGAAGCCCGGTTGCT
TTTGATCGAGGTTAACAGCCACCAGCGAAAAATTGATTGGCGCGCTTTGCTGCAAATTGC
GCAGAATCTCCAGCATGGTATAGCTGTCTTTACCCCCGGAGAGGCAAACCATGATGCGAT
CGCCTTCTTCAATCATATTGAAGTCAGCAATGGCTTCGCCCACGTTACGACGCAGACGTT
TTTGTAATTTGTTCAGGTTGTATTGTTCTTTCTTTGTAATTTGTTGATTTTCTTGCATTA
TTTCAGTTCTCTGGTACTAAATGGGGCAAATTGGGGGCAAACTTTGCAACTACGATAACC
GCGCATTCAACATGGCTATCTGTTCGTCGTTCATGTCATCAATCCACATACCGTAAATTT
CATACACCATCTGCGCAGTTTCATGCCCCATTTGGCTGGCTATAAATGCCGGGTTCGCTC
CTGCCGTCAACAGCCAGCAGGCAAAAGTATGCCGCGTATGGTACGGATTACGGCGGCGAA
TACCAGCACGTTTTACTGCTGCATTCCACCTTGCCCCCAAACTGCTTACCGAGTAATAAG
GTTTTTGTTTTCCGTTACACACCCTGGGCATGAAAACAAAATGCAGTTTTTGCTTTTCGG
TTCTGCCGTACTCCCGATGATAAAAGGTGATTTCGCTTTTGCGATGATGCCCGGTCAGTT
TGTATTGCTCCTTCAGTGCTTCAAGAGCAGGCTGCAGTAGTGTTACTGTTCGGATCCCGG
CATTTGTTTTTGGGGGACCGAACATATCAAGTATCGTCAGGTTTCTTCTGACATTCACTA
TTCCCTTTTCGAGATCCACATCCTCCCACGCCAGAGCTGCCAGTTCCCCGTGACGAAGTC
CTGAGTAAACGGCAAATTTCCACAAGTTCTGGCTCTGTCCTTTTTCACTTTCCATTAATG
CATTGAATTCTGTTTTAGATAACGGATCAGGCTTTATTCTGTTTCGCTGTAATTTTTTTA
CTCCTTCAAATGGTTTGGTTGATATAAATCCCGACTGATACGCAAAACGCAACAGCGAAC
AGAGCAGGGCGATATAGTTATCAACTGTGCGCACGGTTCTTCCTTTTTTGTTGGATCTTG
GATTATCCAGGTAAAGCGTTTCTCCATGCAGCAGTTCATTCCGGTAGTTTAAGATATCGC
TATAACGAATATGTGATATCGGGGTACTTTCACAAATTATTATTCTGAGTGTTTTTAATT
GTGATTTCGTTTTCTTCATTGTGTTTGTTGTTAACTCTGTCTCTTTAATTTTTGTCCAGA
TATCACAAAGCTCTCCGAACGTTTTTATGACTCTCGTTGTCACCATTTTTGCCCCAGTGC
TGGACTGGGGAAAACGTCTTAAATACTCAAATTCACCGGAGTTTATTTCATGAACTATCA
GCGCTCTTAAATTTCCGGCCTTTTTAATATTACTGTTTGTAATCTCCCAGCCTTTTAATG
TTTCCCGACATCGTTTTCCTCGAAACATGAACCAGATGCGAATGTATCTACCTCTAATCT
CGACACCTGTTGGTAATTTAGACATATCATGAGTCTTTGATAAACTGATTTATCTTTGGA
TAGTTGTACCAGATAATCCCTCGTTTGCTGTCTGGCTTACCTAAAGGAGATACTCGTTTG
AAGTGGAAGCCCTCCACCCAACAGTTCTGGCGGTATGCTTCAATTTGTCTGGCCCCCAGA
CCAGTGCGAAGCATCAGGCCGTATTCAACCATCCACTCTTCATTAAAGATTACTTGTGCC
ATCGCATCACCTCTGGCAGGCGCCAATGTTAGACTGAAATTGACGCCCGATGTTGATTAT
TAATAATCAGCTATGAAGTTTTAATTTGAATACAATGCAATTCTCGAGGACTGAAGTTTC
TCGCAATTAAAATTTATCAGTTTTACTTTCTGCTCTCTGGAAACGCCTGCTTCTTTTTTA
CCTGAGAGCATTTTTTCGCATTCTGATTTCGTTAGTTTAGATTTTGAATATCTTGTCCAG
TTAGTAGGAGTGCCACCTTCCTTTTCAATAGTGGCGGTAATTTTATACATGAACACCTCC
ATTATTATTTCCAGTGGTTCGTTTATTCCATCTTTCGAGTGCTTCTTTTTCACTTCCACC
ATAACCGGTTCGGGATTCGCATCCGTTACACTTCGCTCGGTAATATCCTGAAATGGCTTT
CACCGTTACTGATGGACAACCACAAAATGGACATGGTTTAACATTGTCATATCTCATAAT
TTTTCTCATAAAAAATATTTCAAGTTGGCGGTGCATTACACCGCCAGGCTGAATTATTCC
TCTGAATTATCGATTACACTGTATTCCCCGGTTAATACAGAGGAATCTGCAGGATCGATT
GTCAGTGGTTCCTTTTCATCCATTGATACTGCACGCTGGATCTCAATTGATACGGGCAAA
TATTTGAACAGGCGACGAATAGCCGTTTTCTTTGCCATTTCTTCCCAGTGAGTTACCCAC
GGCCCGTTATTACCAGCTTTACTCAGGCTGCGCACCAGCTCAATCTGTTTGCGCGTCATA
ACTTCAAACTGAGTACCTCCGTCTTTCAGTCTTGCGACAGCATAGACGTGGGTAACCGGG
GCATCTTCGTTTTCTCCCGGGCGGTGTATTAACTTTTCATCAAGGCCAAATTCGAAGCTA
AACTCGTCACCTTCACGGACAACACGGGCTGACAGGCTGGCGATTTGACCAGAACGGCGA
GCCAGATCAATCATGCCGCGATAGCCAATGATTAGCTGAACGTTCTTTTTACCGCTCTTT
TCGTTTTTATTACCAAAAGGCAGTAAATATGCATGACCGAGGGCGCTACCTGGCTCAAGT
CCGAGCTGTGAACACTGTACGATCGCACTGACAAAACTCATAGTGTCACAGTTTCCTAAC
GCCGGAACTTTACGAATTTCTGTGGTGGCGATACGGATCATACGTTCAGCCGTCATATGG
CGTGGAAGAGCTGCTGCCAGTTGCTCTTTCATTGATGGCTGGTTAATAAAACTAATCACG
TCGCTATTTTTAACTGCTGCTGGTGCACGGTTTCCCTGAGTTTTTTGCAGATCGGCTTTT
GCGATTGGTGGTTGCTTAGTCATTTGCATATTCCTTAGCCCAGCGGGGCAGTGATAATGT
CTTAATAGCTGGCCATTCATCGGTATTCAGGCAGTCAGACAGGGTTCGCAGATTGCGGTG
ATATTCCTGTTGACCTGCCAGTTTTGCTTCTTCGCCCATCATGAAAATTTCAACCGGATA
ACGTCCGCATTCAATAGTTGTGCTGGCAACCAGAAAAACGAAAGTTGGCTGCACTCCAAA
CTGTGCTTCATAACCGTCACTGTAGAATGCATCCTGAACGTGATAGCGGTAGTCGTAATA
AGCGGTTTTGAATCGTTGAATATCCGCCGTAGTTTTCACGTCCATGATCCAGTGAAATTC
AGGGATAATTTTGTCCGGACGGCACCGACACAAAATTCCTGTTTCAGGATCTTCCCAGTA
AATTGATGATTCAGCGTGTCCGGCGCTTTCAACAAGCCATTGCCCCAGCGGCAAAGCCAT
AACGCTTTGATACATGAGTTCAATTTTCCGGCCTTCTTCCGCAGTGATAACCGTTTTTCC
TGTGCTTGCGCATTCCATCAGAAACGCTTTCTCTTCTTCTTTTCCGGCGTTTGTACGGCG
GTTAAATTCAGGTGCTACGATAAAGCGGTTACTGAATTCTTCCGGTTCAAGTACCCGGCA
GTGGAAAGCAGTTCCTAAATCGAGCGTTTTTGTCTTTGTGGTGTCCACGGGGGCATTTTT
ACGCCACAAATATAGTGCCGGAGTATCAGCAATGTCATCGAGCTGAGACTTACTGATACC
GGGACCCGCGTGGTAATTCTCATTCGAAATTCCGTAATAAATACCTGGCTCTATGTCTTC
TACGATTACGGGATCTGCGACTTCGCCAGTTTCATCACTGCAATCGCGATGCGGATCGCT
GCCAGCATTCTCATTGTGCGGATGTTCAGCGCCTTCCATTTCCTCCGGATCATTTTCCTT
AGCTTCAACCTGACTCTCTTCATCGAATGTTTCCTGGTATGTTGCGTCGCCCATCACCGC
ACCACAGTCAGGGCAGTTATCCCCGCCAGTCTGGCCGCAGGCATTGCAGGCTATTTCCGG
TTCCTGTTGCACTACTGGCTCAGGTTGATTCATATCTGGGCTGGTTTTTTCCGTTTCTGG
CTGGTTCTGGTACACACAATCGCGAGTCTGGATCCCCTTTACCCATTTCGGATCGTTCGG
GTCGCTAATTCCGTCAACAAATTCACCACGTGATGCAGCAAGCAATTTATCGTCATCGAC
AGGATTTTTTGATGGAATGTTTTTCCGGGCTTCATGGAGTTCTGCCCGCAGTTCCTGATA
TTTCGCATCAACAGAATTTACCTGTGACTGAGCATCCAGCGGCTGCGTGTCCTGATGATG
TTCAGTTGCGTCCGGTTCCATTGTTTCAGCCTCTCCCTGTTCAACTGCCGTTGTTCCAGA
TGGTTGCGGTTTTTCTTCATCATCCTGTTTTCCTTCTTCTGTTACTCGCTGCGGCATCGG
GGCAGAGGAGCGACCGCAGGCAATATCCACGATTTCCGGATCAGGGTTGGCATGATCGGT
TTCAGTCAGTACTTTGTTCAGATATTCAGTGACGTGCGCGGGGATGACCTCGATCCCAAT
TGGTGCTTCTTTTACGGACGCAACCACGATGGCGCGGGAATAATCCAGCCCGCCAGGCAT
GGTGATGAATTTGTCGCGGAAAACAGAAAAGGGCGGTTTATTTTCAGCGATAATTTCCTC
AATGCGTTTAGCGTGTGCCGGATGAAGGTTATAGATGTCCAGATCCATTGAACGGGCCAG
TACGCCAGTGGCTACGTCGCGCGCCAGTGACGTCAGATCGTGTACGAAACCTTCGCCGCG
ATCGGTGAGGTTTCCGCCGCCAGCATTAGCACCGGAAGCCGTGCGAGTGATGTGTGAAAC
ACGATTACCCTTCATCCACTCTTTTGTCAGCAGTCCTCGATCGGTGTAGTCAGCGTTCAG
GTATGCTTCGAAAAAAGCAGTTATCAGTCCCAGGTTTGAATTACCAGGATTAGGGAAAAC
TTTGTCAGTGTCACGAACCAGTTTGTGGAGTTCGCGAATTTCCAGCGGGTCGAGCAGGCT
GGTTTTGTGGGAAACAGCCAGGGCAGTAACAGCCGGTAGTTCTTCAGCCCGAGCAATGTG
TAATGCCTGGAGTCCGTCGCGTGAAACGTGCGTTACCGGTTTTTCGCTGCCGTGTTGAGC
AAGCCAACGAATGGGCAGTTCCTGGCCAGAAATTGGGAGTAGCATATTCTCCTCAATCTC
AGTCATGTCTTCGCCGTTGACGTTGGTATTGCCTTGATAGTGAGCGTTGTCTGGTGCTGC
TCCCGGTTTTAGTTCCCATGTCATGGAGTCTTTGCTGAGTTGATAGCGTTCACTCCAGGT
AAAATCGATCTCACCTTCAGCGGGCAGGTCATTAACGACAGGAAAATTCGTGGCAACAGC
TTTAAAATAGCTGCTCAGTTTTTTACCTGACTTAACGATCAGGTAGTCCAGAGTGGCACA
GGTCGATTCAAAATCGTTGCTTGCCCACAGGACGACGTCAGGTTCACCGGATGATTTTTT
CGCTTTCCGTAACAGGAAGAGTGGTTTTGTGCTCATTGTTTTTTAACCTCAACTCAGATT
AAAATTCGTTTTGTTCAGTGAATGATCTTGCCGGATACACACTGTTCATAGCCTGCGCCA
TACGCAGGCTATTTCTTTCAGATTTCACCTTTTAATTTCATTGCAATTAGAGTTGCCAGA
AATTCGGCTTTTTTTTCTGCGGGCAGATTCTTTCCGATATGCACCAGGCACATTTTTTTG
ACACCTTCATCAAGTGTTTTTACGTTGCCTGATGGACCATCGATATCAACCACAGTGAAT
GGGGTTTCTTTATTTTCTGTTTTAATTACGTAGCCAATGCGCTTTCCTTCCAGATTCACC
TCGTGAACAATGTCATCGGTAGTTACAACAGTGGCTTCATAATTGGTAATCATGTTTTTC
TCCTTAATTAAGGTTGAGCGAATACCTGCCATTTCTGGCATAAATTCAGTTTCGAATAGT
CAATTAATTAAAGTTCATGTGCCATCTGGTCTTTTTCGGCACAAGCTTCACTGCAATATT
TTCTCGGTTCGTCTTTTGATAAAATCCCGTGCATGAAGTGAAGCATTCTTTCAATAGCTT
TGCTTTCTTCAACGTCTTTTTTGCAAAGGTGGTAAGCACATTTTATTTTCTTAGTCATCA
CCATGACTCCGCCTTTACAGGTAAACCATCACGACCGAGGAAGACTTTAATCATGCGGTC
AGTAATGAATGTTTTTGTGGTCAGGTTACGAATATATAGTTTTCGCTTTTTAATATTGTT
TGCCGAGGCAATATATGTCCGGCCTTCATGAAGAACATAATCGCCAGGAGTCACACACTG
ACGTGGTATTTCATCAGTTCCGAAGTGATGTGCAATCATAATTATCTCCATTTTTACAAA
TGAACTTTGTTGATGCGGTGTCTGGTGCCTCCAGGTGACTGCAACCAGTTAACAATTACA
GTCGGCTTTCCCACCCAAACCAATAAGGACTAACATGACTTTTAACTGTGCCACGTGCGC
TTAGCCGCATTCACCGCATCACAAAATTCACTTTAAAAAGGGCGGACATCAGCCGAACTT
CAAGAAAAAAACTGATGCCGCCAGGACTACACACAGCAATGTCGTTATTTACAACCGGAG
GCGCACTCCCACCATTTAAATTTAACAGACAAGACCGACTCTTTATGGATATCGGAAATG
CGCCTTCGTGTTGTGCCCGGTTTTATTTCACCACCTCCGGGCTTCGGTGGTCTCGGCTAT
ACCCCTACAGCGAGAGCTTGTGTTAACATTTCAATACCCTTACAGTTGAGAGTTATTGAT
ATGTTGGATGTATTTACTCCATTGTTGAAACTTTTTGCTAACGAGCCACTCGAAAGACTT
ATGTATACGATTATCATTTTTGGTCTCACTCTCTGGCTGATACCGAAAGAGTTTACTGTC
GCATTCAATGCTTATACTGAAATACCTTGGCTCTTTCAGATTATCGTTTTTGCCTTTTCT
TTCGTGGTCGCCATTTCCTTCTCAAGATTGCGAGCACATATTCAAAAGCATTATTCATTA
CTACCAGAGCAACGAGTATTGCTTCGTTTATCTGAGAAAGAAATCGCTGTATTTAAAGAT
TTCCTTAAAACAGGAAATCTTATTATCACTTCTCCTTGCCGTAACCCGGTTATGAAAAAA
TTAGAACGGAAGGGCATCATTCAACATCAGAGTGATAGCGCAAACTGTTCTTATTATCTC
GTCACCGAAAAATACTCCCATTTTATGAAGTTATTCTGGAACAGCAGGAGTAGACGTTTT
AATCGTTAGCTTACTGTGTGCTTCTCCAACCATCGGCGCGCACCAGTTTCGGTTTTAAAT
GTTTTGCTTTTGGTATACGTCATGGCAGTGAACGTTCCATCCTGGTTGGGGAACACGCCG
CACACCAGGGATTCGTTGTTGCCGAGGTCGATTTTTTGCATTTTGCGAATCTCACATCTT
GTTGCTACGTATAGCGACTTCTGCCTGCCAGAGATCCCAGTCGTTGCTGCGTAAAGCCTG
CACAGCCTGGTTGTAAGTGATACCGCAACAATCCATCAAATACTGAACTACTTCGTAATG
CACCATCTTATCTCTCCCCTTAACGCCGGGTGGCGGAACTAACTGCTGCACTGCAAAATT
TGAATCCCGCCGTCATGTTCATACGCCTCGGGCTGGCTACTTAACCCCTTACCACTGCCT
GGTAACTCGAAGTATTGCCCGGCGTTCTGTGGGGCGGGGTGGGTGGTATGCTGGAACTAT
AGGTAATGCCTAATTGATTGTCAATAGGCTATGCCTAATGTTTTGAGCGTAACCTAATAG
GTGATGGCGACAGCAGAAAGTGATGGGGGGGTTAAATAACGGAATCCAGGAGTTTTCCGT
CAGACCATATAAGTTTAAGTTCCAGTTTTTGTGATGTTCTGGCTTTTCCGTTCAGATTCA
AGAGCTTTCAGATACTTACCCACTTTCATTTCCATCGCTGCTATGTAGGCGCGAACATCG
TGGTCAACCCAATCTGGTTCTGTAGCATTTCCAGATAACAGGAAAGCTACAATCGCTCTT
ATTTCATCAGAGGCTGCTTGATAAAGGTTGTTTATATCTAAAAGTTCACTTTTTGTATCT
GAATTGGTGGGGGTTGGTATGGGGTATTCGTTAAGCCCCCAATGCTCTGGACCAACAACA
TCAGAAAAGAAACGCCATAATTCTGGAAGTTTATCTTTACTTATAGAGCCTTTCTTAATC
CAGTCATAAATTGATGGTGGTTGGACTTTAAAGTGGCGTGCGACCTCCGCCTTTGATTTG
ACGGATCCCGATGCGATTTTTTTGTTAATGGCCTGCTCTATCGCTCGGCCTAAGTCTTTA
CCACTAAGCATTGCTTAATATTCTCCTATGCGCATTACATTAGGCAATCCCTACCCTTAC
TGCATTAGGCACAGCCTATTGACAATTGCGTTAGGCGTCGCCTAATATTTCTGTGTGTTT
TTGGAGTTCATTCGATGAAAAAAGAGAACTATTCATTCAAGCAAGCTTGTGCTGTTGTCG
GTGGGCAATCAGCAATGGCTAGGCTTTTAGGTGTATCACCTCCAAGCGTAAATCAATGGA
TCAAAGGGGTACGTCAATTGCCTGCCGAGAGATGTCCAGCAATTGAACGTGCAACAAGAG
GTGAGGTTCTGTGCGAAGAACTTCGTCCTGATATTGACTGGTCATATTTACGACGTTCGG
CATGTTGTTCGCAGAATATGTCAGTGAAGCAACTAAATGACAGTAACAAATCCTCATTTG
ATCATACCTGAAACATCAAGAGGCAAATGATTCATGAAAATCAAGCATGAGCACATCGAA
TCAGTGTTGTTTGCCCTAGCAGCCGAAAAAGGGCAGGCATGGGTAGCCAATGCAATTACT
GAAGAATATCTGCGCCAGGGGGGCGGCGAATTGCCCCTGGTTCCAGGCAAGGACTGGAAC
AATCAGCAGAATATCTATCACCGTTGGTTGAAAGGTGAAACGAAAACGCAAAGAGAAAAA
ATTCAGAAGCTGATCCCAGCAATTCTGGCAATCCTTCCGCGCGAGCTGCGTCACCGACTC
TGCATCTTCGATACCCTGGAACGCCGTGCATTACTGGCGGCGCAGGAAGCGTTAAGTACG
GCAATTGATGCGCATGATGATGCAGTCCAAGCCGTTTACCGGAAAGCGCATTTCAGCGGC
GGCGGTTCTTCCGACGATTCTGTCATTGTTCATTAAGCAAAAGTTTCCATGCTGTTTGTG
CTTATTCTAAGCCACCGGGCAGCATCATACGGGGCAATTATGGCCGCATTACCATACATG
CAACTGTACATAGCTGATTACCTGGCTGACACCATGCATTTGTCAGCAGAGGAGCATGGT
GCGTATTTGTTGCTGATGTTCAATTACTGGCAAACAGGAAAGCCAATACCTAAAAACAGG
CTGGCAAAAATTGCCCGTCTGACTAACGAGCGATGGGCTGATGTTGAACCATCCTTGCAG
GAGTTTTTTTGCGATAACGGCGAGGAATGGGTGCATCTTCGGATTGAGGAAGATCTGGCA
TCAGTCAGGGAAAAATTAACCAAAAAATCAGCCGCAGGAAAAGCATCTGTTCAGGCCAGA
AGAAGCAGAAAGGAAGCAGATGTTCAAACAAAACAAGAGAGAAATTTAACAGGTGTTCAA
ACAGATGTTGAAGTGGTGTTTGAACATGATGTCAACACAAAGGCAACTAATAAAGATACA
GATAAAGATCTAAAAACAGATCCCCCCCTAAATCCCCCCCGGGGGAATCGAGGTGTCAAA
AAGTTTGACCCTCTGGATATTACTTTGCCGAACTGGATTTCTGTCTCGCTTTGGCGTGAG
TGGGTTGAATTTCGCCAGGCATTGCGAAAACCGATTCGAACGGAGCAGGGCGCTAACGGG
GCGATACGGGAGCTGGAAAAATTCCGCCAGCAGGGTTTTTCACCTGAGCAGGTGATTCGA
CACAGCATCGCCAATGAATACCAGGGCTTGTTCGCGCCGAAAGGTGTTCGACCTGAGACG
TTACTCCGACAGGTTAACACCGTCTCGTTACCGGATAGTGCGATCCCGCCAGGCTTCAGG
GGGTAACTGACCATGAAAAATATTGCGACAGGCGATGTTCTTGAACGTATCCGCAGACTG
GCCCCGTCACATGTAACCGCGCCATTCAAGACGGTAGCGGAGTGGCGCGAGTGGCAACTT
TCCGAAGGCCAGAAACGTTGTGAGGAGATCAACCGTCAGAATCGTCAGTTGCGGGTGGAA
AAAATTCTGAATCGCTCTGGCATCCAGCCATTGCACCGCAAATGCTCGTTTTCGAATTAC
CAGGTGCAGAACGAAGGGCAGCGATACGCGTTGAGTCAGGCGAAATCCATCGCTGATGAA
CTGATGACCGGGTGTACAAATTTTGCGTTCAGCGGAAAACCTGGTACCGGGAAGAACCAC
TTAGCGGCAGCTATCGGGAATCGCCTGCTGAAAGACGGTCAGACAGTGATTGTGGTTACC
GTGGCTGATGTTATGAGTGCCCTGCACGCCAGCTATGACGATGGGCAGTCAGGCGAAAAA
TTTTTGCGGGAACTGTGCGAAGTGGATCTGCTGGTTCTTGATGAAATTGGCATTCAGCGC
GAGACGAAAAACGAGCAGGTGGTACTGCACCAGATTGTTGATCGCCGGACAGCGTCGATG
CGCAGCGTGGGGATGCTGACAAACCTGAACTATGAGGCCATGAAAACATTGCTCGGCGAG
CGGATTATGGATCGCATGACCATGAACGGCGGGCGATGGGTGAATTTTAACTGGGAGAGC
TGGCGTCCGAATGTCGTCCAGCCAGGAATTGCGAAGTAATTTTTACCGGGAGAAAAATTT
AATGGAGACTGTTTTTGACGCACTGAAAGCAATGGGAAAAGCCACATCCATAGAACTTGC
TGCGCGACTTGATATCAGTCGTGAAGAAGTGCTGAACGAACTATGGGAACTGAAAAAGGC
TGGTTTTGTTGATAAAAGCGCGTACACCTGGCGTGTGGCTGATAACAATGTTCAGCAGGA
ACAGCCAGCGCAGGCAGAACTGCCGGAAGAAATCACCACAGCAACAGTAGCGAAAATCTC
AGAGTGCGATTTAACCGCGACGATTGAACAACGAGGACCACAAACGGCTGATGAGCTGGC
TACATTGTTTGGTACCACATCACGCAAAGTGGCTTCAACGCTGGCAATGGCAATCAGCAA
AGGTCGTCTGATTCGCGTAAATCAGGGCGGTAAATTTCGTTACTGCATACCGGGCGATAA
TTTACCAGCAGAGCCGAAAGCAGCATCGGTATCTCCGCTCTGGTTATCTGCATCGTCGTC
TGCCTGTCATGGGGTGTTAATCATTACCGTGATAACGCCATCGCCTACAAAGAACAGCGC
GACAAAAATGCCAGAGAACTGAAGCTGGCGAACGCGGCAATTACTGAGATGCAGATGCGT
CAGCGTGATGTTGCTGCGCTCGATGCAAAATACACGAAGGAGTTAGCTGATGCGAAAGCT
GAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCACATCAAAGCA
GTCTGTCAGTCAGTGCGTGAAGCCACCACCGCCTCCGGCGTGGATAATGCAGCCTCCCCC
CGACTGGCAGACACCGCTGAACGGGATTATTTCACCCTCCGGGAACGACTGGTAATGATG
CAGGCCCAACTTGAAGGTGCTCAGCAATACATAACCGAGCAGTGTTTAAAGTAAAATCTT
AACTACAATATGATTCATTTTGATGATTGTTTCATAAGGAACAGTGAAGTAAGATCTAAG
AGGAGTTAAATTTTATACAGTATAATCATAATATTGCAGCAAGGTGGTTATAATTGAAAG
AATATTTAGATATGAATACATCTCATGTAAGAGTTGTTACTCATATGTGTGGGTTCCTGG
TTTGGCTCTATAGTCTTTCAATGTTGCCACCAATGGTTGTAGCATTGTTTTATAAAGAAA
AAAGCCTGTTTGTTTTCTTTATAACTTTCGTTATATTTTTTTGCATTGGTGGCGGAGCGT
GGTATACAACTAAGAAATCTGGCATTCAATTACGTACCCGTGATGGGTTTATTATAATTG
TAATGTTTTGGATTTTGTTTTCTGTTATTAGTGCATTCCCTTTATGGATTGACTCAGAAC
TTAATTTAACGTTCATTGATGCTCTGTTTGAAGGGGTTTCTGGAATAACAACAACAGGAG
CAACTGTAATTGATGATGTTAGTTCATTACCTCGGGCATATTTGTACTATCGGTCACAGT
TAAATTTTATAGGTGGTTTAGGAGTTATTGTTCTGGCGGTTGCTGTATTGCCATTATTGG
GTATTGGTGGTGCAAAGCTTTATCAGTCAGAAATGCCGGGGCCATTTAAGGATGACAAAC
TCACTCCCCGCCTGGCCGATACGTCACGGACACTGTGGATAACTTATTCTTTATTAGGTA
TTGCTTGTATTGTCTGTTATAGACTTGCAGGAATGCCTTTGTTTGATGCTATTTGTCACG
GGATTTCCACAGTTTCGCTTGGTGGTTTCTCAACTCATAGCGAGAGTATCGGATATTTTA
ATAACTATTTGGTTGAGCTGGTGGCTGGTTCTTTTTCCCTGCTATCGGCTTTCAACTTCA
CTCTTTGGTATATTGTTATTAGCAGGAAAACGATAAAACCTTTAATCAGAGATATTGAAC
TTCGTTTCTTTCTGTTAATAGCCTTAGGGGTGATCATTGTTACCTCTTTCCAGGTCTGGC
ATATAGGTATGTATGACTTGCATGGAAGTTTTATTCATTCGTTTTTTCTTGCCAGCTCCA
TGCTCACTGATAATGGTTTAGCTACGCAGGATTATGCAAGTTGGCCCACGCACACGATAG
TGTTTTTGCTGTTGTCAAGTTTCTTTGGGGGATGTATAGGTTCAACTTGTGGTGGAATTA
AGTCACTTCGATTTCTTATACTTTTCAAACAAAGCAAACACGAGATAAATCAGCTTTCTC
ATCCCAGAGCGTTGTTGAGTGTAAATGTAGGAGGGAAGATAGTTACAGATCGTGTAATGA
GGTCTGTATGGAGTTTCTTTTTTCTTTATACTCTCTTCACGGTGTTTTTTATACTGGTGT
TAAATGGTATGGGATATGATTTTCTTACATCATTTGCAACAGTGGCTGCATGTATTAATA
ATATGGGATTAGGTTTTGGGGCTACTGCATCGTCATTCGGAGTGCTTAATGACATTGCAA
AATGCTTAATGTGCATAGCTATGATTCTTGGTCGCCTTGAAATTTATCCTGTTATTATAT
TGTTTTCAGGTTTTTTTTGGCGCTCCTAATATATGGCTGATTTATAATTGTGAGTTTAAT
ATTATGTTGACTCACTCATTGATCCAATACCTAACTTTACCAGCAACACCTCCGTCCCCA
GTAGCACTGGCTGCTGGGGTGCGTTTTATTCATAAAGCAAGGCTGTATGAGCGAGAAATT
AAAGATAGTCTATCGCCCATTACAAGAATTGTCACCGTATGCGCACAACGCCAGGACGCA
CAGTACTGAGCAGGTGGCACAACTGGTAGAAAGTATTAAGCAATTCGGCTGGACTAATCC
GGTGCTGATTGACGAAAAGGGCGAAATTATTGCGGGTCACGGTCGTGTTATGGCGGCTGA
AATGCTCAAAATGGATTCTGTTCCGGTCATTGTTCTGTCTGGCCTGACGGATGAGCAGAA
GCAGCGATAACGATCAGTATCGCTCCCGTAATGCATTAATCCGTCGCCACATTGAGAAAA
TGGATGCCAGTTTGCACGTCGGAACGAAGGAGTTTGATATTTCAAAGGTTTCCGAGGTGG
ATTCTGTTGATGATTTACTCATTGATAATGCCGCTCGTTATCTGCTGAAAGACTGGAAAG
GGGTTGGTGAACTGGTTAATGGTGTTGAGGTTGCACTGGAATATACGGCAGAACGAGGGA
TCGCGCTGCTTAAGCAGAATCCAGAGTTGTACTGGCAGATCCTTGCAGAAGCAGCCAGCA
TCGCCCAGGGTAAAGAGCAGCAGAAGCAGGATACGATAAAAAAGCCATAGCTGCCCAGCG
GTGGTTATCGGAGTTCGGGGGAGAAAGGGGGGAAAAGGCAAGATGGAAGCGAGAAAAACT
CAGGTTGCCACCGATACCGGAACCAGAAATAGACCCGGTGCTTAAGGAGTTGTTGTACGC
CTATTCGGTAATATCCCGTGCCCGACGTTATGCTGGAATGGCTGGGGTGCCTTTGCCTTT
ATCTCTGACAGAGATAAATGAATATTTAGCCACTCATCCGGTATTGATTGAGCGCGATGA
ATTTGAAGCAGTGATCTTTGCACTGGATGACCAGTATTTTCAGGAGCAGTGTGTGTAGTT
GTTAATTACGTACACTCTGTTACAGAGATGTGATGGTGTCTTTAATTAAATCGATGATGC
TCCTGGAGAAAAGCATTGCGTGGCCTCGTAATCGCTATATCTACTATTATGTCGCCTGAA
ACCCACTTCGCGGTGGGTTTTTTGTTGTCAGGAGTTTTAATAAATGGCAGAGCAAACCTC
GCGTCTCGCAATAATTATTGATAGCACTGGAGCGAAAAATAATGCTGACAATCTGACCTC
CTCATTAGTCAAAATGACGCAGGCTGGGGAAACTGCTGCAAATAGCGCAGGGAAAGTGAC
TAAGGCAACAGAAGATGAGAAGAACGCGCTCGCAAAATTAAAAGCAGCTATTGATCCAGT
TGGTGCCGCAATTGATACTGTCGGTCGACGCTATTCTGAATTAAAGAAATTTTTCGATAA
AGGGCTTATTGATAAAGAAGAATATGAATTTCTTGTCCGTAAACTTAATGAAACCACAGA
GGAATTGAGCGGGGTTGCGCAAGCGCAGAGAGAAGCCGAGAAGGCCGGAAAACTTGCTGC
CGCTCAGCAGGAAGCGCAGGCTCAGGCCTTTCAAAGAATGCTGGACAAGATCGACCCTCT
GGCTGCGGCGCTAAGAAATCTTGAACAACAGCATGATGAACTTAATGCTGCGTTTGCATC
CGGGAAAATAAATGGTTCTCAGTTTGAGAATTATAGCCGAAAAATACAGGAAACACGGCG
AGAGCTTACCGGAGAGGCTCAGGCAGAGCGAGAAGCAGCAAAAGCGCATGATGAACAGGT
TGTTGCTTTGCAACGTCTGATTGCTCAACTTGATCCTGTCGGAACTGCTTTTAATCGTCT
GGTAGAACAACAGAAACAGCTCAATGAAGCAAAAGCTAAGGGGATGCTTTCTCCTGAAAT
GTATGAGGAGCTTTCTGGAAAACTTCGTGCTATGCGGAGTGAGCTTGAGGTTACTCAATC
ACAATTAAGCAAAACCGGAATGTCGGCAAAACAAACGGCTTTTGCTATGCGCATGTTGCC
TGCACAAATGACGGATATTGTTGTTGGGTTGTCCACTGGTCAGTCGCCATTTATGGTGTT
AATGCAGCAGGGCGGCCATTCAGCTATGCAGGAGACAAGAATCGCCAGCTTACCCGTTAC
AGCGATACCCGCTGGCATGAAGATTCCGTGCGTAACCGCTGGTTCAGCGTGATGGTGGGG
CCGTCTGTGCGCGTGAATGAATGGTTCAGCGCGTATGCGATGGCGGGTATGGCTTACAGC
CGTGTGTCGACTTTCTCCGGGGATTATCTCCGCGTAACTGACAACAAGGGAAGGTGCGAA
TAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCGGATCTGGGCCGA
TTTTTTTCCCGCAAACACATCGAATCAGCCTATTTAGGCTATTTTTTCCACCATTTCTGG
CGTTATTTCCGGTTTTTACTGAGATCTCTCCCACTGACGTATCATTTGGTCCACCCGAAA
CAGGTTGGCCAGGGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAGCCCCTTGTA
TCTGGCTTTCACGAAGCCGAACTGCCGCTTGATGATGCGAAACGGGTGCTCCACCCTGGC
ACGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGCGGATTCTG
CTTCAAGGTTTTTACCTTGCCGGGACGCTCGGCGATCAGCCAGTCCACATCCACCTCGGC
CAGCTCCTCGCGCTGTGGCGCTCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTC
TCCATGAAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAG
GCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCA
CTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGT
AGAGCTGGGTGCCTCAATGATGGTGGCATCCACCAAAGTGCCTTGGGTCATCATGACGCC
TGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGACGGGCCAGTTGATGCTGCTC
GAGCAGGTGGCGGAAATTCATGATGGTGGTGCGATCCGGCAGGGCGCTATCCAGGGATAA
TCGGGCAAACAGGCGCATGGAGGCGATTTCGTACAGGGCATCTTCCATGGCACCGTCGCT
CAGGTTGTACCAATGCTGCATGCAGTGAATACGCAGCATGGTCTCCAGCGGATAGGGCCG
TCGGCCATTGCCCGCCTTGGGATAAAACGGCTCGATGACAGCGGTCATATTCTGCCATGG
CAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCT
GAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTCCCTCTGGGATGCGCTCCG
GATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCCCAAGGGGAAAACGCAC
GACGTGCTGACCGGAAGTGATGACGGTCGCCACAGCAACACGTCTCTGGCGTGGGGAGCT
GGCGTGCAGTTTAACCCGACCGAATCCGTGGCCATTGATATTGCTTATGAAGGCCCCGGC
AGTGGCGACTGGCGCACTGACGGTTTCATCGTGGGTGTCGGTTATAAGTTCTGATTAGCC
AGGTAACACAGTGTTATGACAGCCCGCCGGTTCAGGCGGGCTTTTTTGTGGGGTGAATAT
GGCAGTAAAGATTTCAGGTGTACTGAAAGACGGCACAGGAAAACCGGTACAGAACTGCAC
AATCCAGCTGAAAGCAAAACGTAACAGCACCACGGTGGTGGTGAACACGCTGGCCTCAGA
AAATCCGGATGAAGCCGGGCGTTACAGCATGGACGTTGAGTACGGTCAGTACAGCGTTAT
TCTGTTGGTGGAAGGATTCCCGCCGTCACATGCCGGGACCATTACCGTGTATGAAGATTC
TCAACCCGGTACGCTGAATGATTTTCTCGGTGCCATGACGGAGGATGATGCCCGTCCGGA
GGCACTGCGCCGTTTTGAACTGATGGTGGAAGAGGTGGCGCGTAACGCGTCCGCGGTGGC
ACAGAACACGGCAGCCGCGAAGAAGTCAGCCAGTGATGCCAGCACATCAGCCCGTGAGGC
GGCAACCCATGCGGCTGATGCTGCGGACTCAGCACGCGCAGCCAGCACGTCAGCCGGACA
GGCCGCGTCGTCGGCTCAGTCAGCGTCTTCCAGCGCAGGAACGGCATCAACAAAGGCCAC
TGAAGCATCAAAAAGTGCTGCCGCTGCAGAGTCCTCAAAAAGCGCGGCGGCCACCAGTGC
CGGTGCGGCGAAAACGTCAGAAACGAATGCTTCAGCGTCACTACAATCAGCAGCCACATC
TGCATCCACCGCGACCACGAAGGCATCAGAAGCTGCGACCTCGGCCCGGGATGCGGCGGC
CTCAAAAGAAGCGGCAAAATCATCAGAAACGAACGCATCATCAAGCGCCAGTAGTGCAGC
TTCCTCGGCAACGGCGGCAGGAAATTCCGCGAAGGCGGCAAAAACGTCCGAGACGAACGC
CAGGTCTTCTGAAACGGCAGCGGGACAGAGCGCCTCGGCTGCGGCAGGCTCAAAAACAGC
GGCTGCGTCGTCTGCCAGTGCAGCGTCAACAAGTGCCGGGCAGGCCTCAGCCAGTGCCAC
CGCCGCCGGAAAATCGGCAGAAAGCGCCGCATCGTCTGCTTCAACAGCCACAACGAAGGC
TGGCGAAGCCACTGAACAGGCCAGCGCAGCAGCGAGGTCTGCTTCCGCAGCGAAGACATC
CGAAACGAACGCGAAAGCGTCGGAAACAAGCGCAGAATCCTCAAAAACGGCTGCCGCATC
GTCAGCCAGTTCGGCGGCGTCATCGGCATCATCGGCGTCTGCTTCAAAAGATGAGGCGAC
CAGACAAGCGTCAGCAGCGAAGAGCAGCGCCACGACGGCATCCACGAAGGCGACAGAGGC
TGCTGGCAGTGCGACGGCGGCAGCTCAGAGCAAAAGTACGGCGGAATCCGCGGCAACGCG
CGCCGAGACAGCAGCTAAACGGGCAGAGGATATTGCATCCGCCGTGGCGCTTGAGGATGC
AAGTACGACGAAAAAGGGGATAGTACAGCTCAGCAGTGCGACCAACAGTACGTCTGAAAC
GCTGGCGGCAACGCCAAAGGCAGTAAAATCAGCCTATGACAATGCAGAGAAACGTCTGCA
GAAAGACCAGAACGGCGCTGATATACCCGATAAGGGATGCTTCCTGAACAACATTAACGC
GGTCAGTAAAACAGACTTTGCTGATAAGCGTGGTATGCGTTATGTGCGGGTTAACGCTCC
TGCAGGTGCAACATCTGGAAAATATTACCCTGTTGTTGTTATGCGTTCTGCTGGCTCAGT
AAGCGAACTGGCATCAAGAGTCATTATCACCACGGCAACGCGAACCGCAGGCGATCCGAT
GAATAACTGCGAGTTTAACGGATTTGTTATGCCTGGTGGCTGGACTGACAGGGGGCGTTA
TGCTTATGGCATGTTCTGGCAATATCAAAACAATGAACGAGCCATTCACTCAATAATGAT
GAGTAATAAGGGCGATGATTTGCGCTCTGTGTTCTATGTTGATGGCGCTGCTTTCCCTGT
TTTTGCGTTTATTGAAGATGGCCTGTCAATATCCGCACCTGGTGCTGATCTCGTTGTTAA
TGATACGACCTATAAGTTTGGGGCAACAAATCCGGCGACTGAATGTATCGCGGCGGACGT
TATCCTTGATTTTAAGAGTGGGCGTGGTTTTTATGAGTCTCATTCGTTAATCGTTAACGA
TAACTTGTCGTGCAAAAAACTTTTTGCCACAGACGAAATTGTAGCGCGTGGTGGTAATCA
GATTCGAATGATAGGTGGGGAGTATGGTGCATTATGGCGTAATGATGGCGCTAAAACTTA
CCTGCTGCTTACCAATCAAGGTGATGTTTATGGTGGCTGGAATACATTAAGACCGTTTGC
TATTGATAACGCAACCGGCGAACTGGTTATTGGAACCAAACTGTCCGCAAGTCTGAACGG
TAATGCATTAACAGCAACAAAGCTGCAAACGCCAAGACGGGTTTCTGGTGTTGAGTTTGA
TGGTTCCAAAGATATTACTTTAACCGCCGCGCATGTGGCTGCTTTTGCCAGAAGGGCAAC
GGATACATATGCCGATGCGGATGGTGGCGTTCCATGGAATGCCGAATCTGGCGCTTACAA
TGTCACCCGCTCTGGCGACAGCTATATTCTGGTTAACTTCTATACCGGAGTCGGAAGTTG
CCGGACCCTGCAGATGAAGGCGCATTACAGAAATGGTGGTCTGTTCTACCGTTCTTCAAG
AGACGGTTATGGTTTTGAGGAAGACTGGGCAGAAGTTTATACCTCGAAAAATCTTCCACC
AGAAAGCTACCCAGTCGGCGCACCAATCCCGTGGCCATCAGATACCGTTCCGTCTGGTTA
TGCCCTGATGCAGGGGCAGGCTTTTGACAAATCTGCTTACCCGAAACTTGCAGCCGCTTA
TCCGTCAGGCGTGATCCCTGATATGCGTGGCTGGACGATTAAGGGCAAACCTGCCAGTGG
TCGGGCCGTATTGTCTCAGGAACAGGACGGCATTAAATCGCATACCCACAGCGCCAGCGC
ATCCAGTACAGATTTGGGGACGAAAACCACATCGTCGTTTGATTACGGCACTAAATCCAC
GAATAACACCGGGGCACATACACACAGTGTGAGCGGCTCTACAAACTCGGCTGGAGCACA
CACACACTCACTAGCCAACGTGAACACGGCTAGTGCTAACTCCGGTGCTGGTAGTGCATC
AACAAGATTGTCTGTTGTGCATAATCAAAACTATGCAACATCATCTGCTGGCGCACATAC
CCACTCACTGTCCGGCACTGCTGCAAGCGCAGGTGCACACGCGCATACTGTCGGTATTGG
TGCTCATACGCACTCCGTTGCGATTGGTTCACATGGACACACCATCACCGTTAACGCTGC
TGGTAACGCGGAAAACACCGTCAAAAACATCGCATTTAACTATATTGTGAGGCTTGCATA
ATGGCATTCAGAATGAGTGAACAACCACGGACCATAAAAATTTATAATCTGCTGGCCGGA
ACTAATGAATTTATTGGTGAAGGTGATGCATATATTCCGCCTCATACAGGTCTGCCAGCA
AACAGTACCGATATTGCACCGCCAGATATTCCGGCTGGCTTCGTGGCTGTTTTCAACAGT
GATGAGTCATCGTGGCATCTCGTTGAAGATCATCGGGGTAAAACGGTTTATGACGTGGCT
TCCGGCAACGCGTTATTTATTTCTGAACTCGGTCCGTTACCGGAAAATGTTACCTGGTTA
TCGCCGGAAGGGGAGTTTCAGAAGTGGAACGGCACAGCCTGGGTGAAGGATACGGAAGCA
GAAAAACTGTTCCGGATCCGGGAGGCGGAAGAAACAAAAAACAACCTGATGCAGGTAGCC
AGTGAGCATATTGCGCCGCTTCAGGATGCTGCAGATCTGGAAATTGCAACGGAGGAAGAA
ATCTCGTTGCTGGAAGCATGGAAAAAGTATCGGGTATTGCTGAACCGTGTTGATACGTCA
ACTGCACAGGATATTGAATGGCCAGCACTGCCGTAGGGTAAAACATATAAATTCTATAAT
TAGATGTATCTTTCCATTTACGGCAAGGAAGGGGGCTTGGAAGACGTAAAGCATCTCACA
CCGAGATTATTTTTTATATGTCAGGTGTCTGAAGTTTTGCTTTGGCTCTTAAAATGGTTT
GCCGCGAGGTTTTGAATTCCCGGGCAATGGCACTTATACTTACACCTGACTTAATTCGTT
CGAATACCACCTGTTTCTGTTCTTCATTTAACACAGGAGGTCGACCAAAACGTTTCCCTG
CGCCGCGGGCTCTTACTATCCCGGAATGAGTGCGTTCAAGTAAAAGGTCTCGTTCAAATT
CAGCGACTGCTGAAATTACTTGCATCATCATTTTTCCTGTTGGACTGGTCAGGTCAATGC
CACCCAATGCTAAGCAATGCACTCTGATACCTGTTTCGGTCAGTTGTTCCACTGTTTTCC
TGATATCCATTGCATTACAACCAAGGCGATCCAGTTTTGTCACAATCAATTGATCACCAC
ATTTCAGGCGAGCAAGCAACCGGTTAAAACCAGGACGCTCACTGGTTGCTGCTGAGCCGC
TAATGTGTTCTTCGATTATTTGCTGAGGTTTGATTTTAAAACCTGCACTTTCGATTTCCC
GGCGTTGATTTTCGGTGGTCTGATCCAGCGTTGATATCCGACAGTAAGCAAAAATTCGAG
ACATAGTGAGACTCTATACGAAATTGGTGTTCATATCATAATGCATCTCAGAAAATAATT
ATGATTATTTTTGTGCATATTTGTATGTACACGTTCGAAAATAAACGAATGCGTATGCAA
CCCCGTAATTTTGGTGAGACCCAAAATCGATTTTGTGAAAAATGGCTTTAACTCGGTTTG
TTTTTCGAGTTCCGGGCGGACTCAAGGAAGAAGAATAGTGTTGCGTGTTATTTTAACCAG
ATTTCAAGTTGTTTGGTCGTGGAAAAGTGGAGCAAAATGTTGTTAAAGTGGAAAAATGAT
AAAAAAGTAAGTTTATTATATTACATTTTACCATTTAAATTTTGGTTGTCTTTAAGAACT
GATATCGCTGTTTGTAATAATTCTTTGTTATCCAGCCATGATGTTTTCTTTATGTTTCCT
TCAATGTAATCAAGCAATGTTCTGGTATTGATAGGTCTTCCCTGTTTTGCTACTTCCACT
ACAGCATCCCCTAGGATAATTCTTACTTCAGGAAGCTGCGCAGGGAACCACTTTAGGGTG
TCTTTTGATTTCATGAAGATATTCCTTAAAATATTATTGATTTTCATTGCGATATTGTAT
GTCTGATTCAGGATATGTTGACTTATACATCGGTTTTGTCTGGGTTATTGGATATGCCAA
TCCCTAATTTTATTAGAGCATGACTAAAAATGCTGAATATGATAAGGAGCGAAGTGATTA
TCAGTATGCTGTTCATATAGCCTCGAATTAGTAATGTGTTATATATGATATAGTTGACAA
TTTTTATCCTGGGTGTTCTTAAAGTTCGTAGATAAACATTGTCGTTTCAGGTATACAGGA
ATGCTAACAGGTGGCGGCAAAAATCAGGCGGTTTATGGCGCAAGCTGAAGTGGCAACTGC
AAACTATCTTATGCAGAGACTCTACACGGATTGGGTTTAAAAGTATACATAGATAACAGT
TTTTATCTGAAGAAGAAAAATATCAAGGTGATATAGCCTATATGCCTTTGATGCGGAGGA
ATGAATGTGATGGGAGTGATGTATCTGAATAGTTGAAAAACCGCAGTCACGTCGTATGCA
AGAACGTGCTGCGGTTGGTTTGACTTTGATTGAGACGTTTTGGAATTTTTTTCGGTGGCA
AAAATGGGGCAAAACGCTGCAAAAGGGGCAAAAAAGGGGCAAAAAAAGAGTGGATTATCG
TAGCTTATTGTTGTCGCTGATGATATTTAACACATTGAAAAATAAGTAAAATACTTATGA
GTCAGAGAGTTGTGATTTTTGCCCTTACTTGTTCAGGTTGTATTGTTCTTTCTTACTAAT
TTCTTGATTTTGCGACATTTAAAAGCGACTCAATTCGTTATATGGCATCAGAAGAGTATG
CGTCATGCCGGAACGCCCAGCATAAGAAATCTGATATAAAAAACTGTGGCGTGTATGGTA
CGGATTAGAGGGGAAAATGTCAGCACATTTGCGAAATGAATCAAAAAGCCCGCAGCAATG
TGCGGGCGTTAGTGTCAGCGCACAACCAGCACGGAGCACTCTGCGTGACGCACTACAGCT
GCGGCGTTGGAACCGAGCAGATAAGTGGTGATATCCGGTCGATGGGAAGCAATGATGATC
ATATGAGCGGGGATCTTCTTCGCCAATTCCAGAATGCGGTCTTTGGGCGAGCCTTCCTCA
ACATGGACATGCACTCTGTCGGTTGGCAGTTTAAATTTTTTAATGATCTCTTCCAGTTGC
GATTTGGCTTCCGCTTTCAGGTCATCCATTGCCGGTAATTCTGCGGAATACGCTAAACCC
AGAGAGGCATAGTAGGGCAGTGAAGGTATTACCGTCAGGAAATGAACCTCTGCATCATCA
ATCTTTGCCTCTTCCTCAACGTGGCTAATCACGCGTTGAGTTAATTCTGAATCGGAAATA
TCGATAGGGACAAGAATCGTTCTGTTCATAAAACCTCCTGTTTTAGTATCCGCATAAAGT
GTAACGCCAGATGACACTTTTTGTGTAATGACGGAGTTCACATTTTTAATTTAGATCAAA
GGAGGAAGAATAAGCAGAAAAAGCCCGCCATAACAGCGGGCAGGAGGATTTAGAACTGAT
AAACCAGACCTAAAGCGACAATATCATCGGTAGAGATGCCATTGGCAGCGTAGAAGCTGT
CATCTTCATCCAACAGGTTGATTTTATAGTCAACGTAGGTGGACATGTTTTTATTGAAAT
AGTAAGTCGCGCCAATATCGGCGTATTTAACCAGATCTTTATCATCAACACCTGCCGGGT
TGTCTGCACCACCCGCAGCGTGCAGGTCACGGCCTTTAGACATCAGGAAAGAGACTGCCG
GACGCAGACCAAAATCAAACTGGTACTGTGCAGTGACTTCAAAATTCTGGGTTTTGTTTG
CCACAGCATAATCGCTGTCGCCAAACGGGGTCATATTACGCGTTTCTGAATACATGGTTG
CCAGGTAAATATTGTTAGCATCGTATTTTAGCCCAGCAGTCCACGCGTCTGCTTTATCAC
CACCCGCCGCAGTATGGTTAACCTGGTCATTGGTGCGGTCAGAAGAGGTGTATGCCGCAC
CAGCGCTAAAGCCCATGCCTAAATCATATGTTGTGGAAAGACCCCAGCCGTCACCGTTTT
CATGGCGAACATCACGTCCGTTGTTGGTGCCTTCCTGACCATTACTGGCTCCTTCGTTGT
TACCTTGATACTGCACCGCGAAGTTCAGACCATTTACCAGACCGAAGAAATCAGTATTAC
GATAAGTCGCGACGCCATTGGCTCGACCAGTCATAAAGTTGTCTGCATTGGTATAAGAGT
CACCGCCAAATTCAGGCAGCATATCGGTCCAGCCTTCGATGTCGTACATTACGCCATAAT
TACGTCCGTAATCGAAAGAACCGTAATCTGCAAATTTCAGCCCGGCAAATGCCAGACGGG
TCCATGACTGGTTTTTTGAAGATTCAGTGTTGTTTGCCTGAATATTGTATTCCCATTGAC
CGTAGCCAGTGAGTTGATCGTTAATTTGGGTTTCGCCTTTAAAACCCAGACGCGCATAGC
TCTGGTCGCCATCTTTCGCTGAATTATCAGAAAAATAATGCAGGCCATCAACTTTGCCAT
ACAGATCTAATTTGTTGCCGTCTTTATTATAAACTTCGGCTGCATGTGCAGCACCTGCGG
CGAGCAGGGCAGGAATTAAAAGTGCCAGTACTTTGCTTTTCATTGAATAAATCCTTTAGT
TATTTTATTTGCCTTTTATCCCCATTTCGGGGAGTGAAAACATCCTAAAGGAGAAGTTCA
GTTAGCCGATAAATATCATTTGTTACGCCTTAAGTAAAACCTTAATCAAATAATTCCTCT
GAAATGATAATAAGTCTGGTGAATGTATCGAAGATAATACATACAAAATAAAAATTATAC
TTTTAATTTGCTATACGTTATTCTGCGCGGGTTATATGCCTTTATTGTCACAGATTTTAT
TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAAC
AGTCGTCCGGGCTTTTTTTTTAGAATTGGATAATCCTTATCCAGAGCATTTAATCGGTGT
TGCTTTTTTCCGCTTTTCCGGCCATTTGTGCCAGGAAGTCATAGCGTTTTTGCAAATCAG
CTGCAGCATCTTTCCATAACTGTTCTGCCACTTCTGGCTGCTGCGAATTCAGCCGACGGA
AACGTTGCTCGTGAAGTAACGTTTCTTCCGGTGCTTCTGACGGCGGGCGTGAATCCAAGG
CCAGCGGCAGTTTGCCTTCATCGGCACGACGCGGATCAAAGCGATATAGCGGCCAGAAGC
CGGTAGCTGTGAGTTGGCGCATCTGGTCGTGGCTGAGTGCCAGATCGTAACCATGCTCTT
CACACGGGCTATAAGCAATGATCAGCGATGGCCCCGGATACGCTTCCGCTTCCTGAATCG
CTTTCACCGTCTGGTTCAGCTGCGCGCCGAGAGAAATCTGCGCCACATAAACATGACCGT
ACATCATCATACTGACGCCAAGATCTTTACGCGCTTTACGTTTGCCGTGCTCGCCAAATT
TAGTTACTGCACCCAGCGGTGTCGCTTTCGACGCCTGACCACCGGTGTTGGAATAGCATT
GCGTATCCAGCACCAGAATGTTGACGTTTTCCGTCAAACTCAATACATGATCCAGACCGC
CAAAGCCGATATCGTAAGCCCAGCCATCACCACCAATCAGCCAGATTGATTTTTCCACCA
GTGCATCTGCATCACGTAGCAGTTCATGTGCTTCGGCAACATCGTTGAGTTGCTGGCGTA
AAGCTGCAACCTGTTCACGACGAACCTCTGGCGTGGCGTCTGATTTCAACGCCGTCAGTA
ATTCCGCCGGGATTTTATCGGCAAATTGATCCAGCAGACGCAGCACGCGGACACGGTGTT
GATCGACCGTCAGGCGGAAACCAAGGCCAAATTCGGCATTATCTTCAAATAGAGAGTTCG
CCCATGCCGGCCCACGACCGTTGGCATCGGTGGTATACGGTGTAGAGGGCAGGTTACCGC
CATAAATTGAAGAACAGCCAGTGGCGTTAGCGATCAACATCCGGTCGCCATAGAGCTGAG
TCAGTAATTTAATATACGGCGTCTCGCCACAACCGGAGCAAGCACCTGAATATTCAAACA
GCGGTGTAATCAGCTGCGATGTACGAATATCAATACGTTCCAGTTTGCTACGGTCGATTT
CTGGCAGGTTGAGGAAGAAATCGTAATTGATTTTCTCTTCTTCGACATGTTCCAGGCGAG
ACATCATATTGATGGCTTTAATCTCTGGATTCTGACGGTCTTTCGCCGGGCAAACTTCGA
CGCACAGGTTACAACCGGTGCAATCTTCCGGTGCCACCTGCAAGACATATTTCTGCCCGC
GCATATCACGCGATTTCACATCCAGCGAATGCAGGCTGGCAGGGGCGTTTTCCATCGCTT
CAGGCGGCACCACTTTTGCGCGAATAGCTGAGTGTGGGCAAGCGGCAACGCAGTGGTTAC
ATTGGGTACAGAGTTCCTCTTTCCAGATGGGGATCTCTTCGGCGATATTGCGTTTTTCCC
AGCGCGTAGTGCCCATCGGCCAGGTGCCGTCTGGCGGCAGCGCCGAAACGGGGAGGGCGT
CACCAAGCCCGGCGAGCATCGCAGCGGTTACGGTTTTCACGAAATCAGGGGCGGCATCGG
AAACCACTGGCGGTCGATTGGCGCTGTGCGGATTTACCGGTTGCAACGGAACTTCTTCTA
CGGATTCACGCGCCAGCGCCAGAGCCTGCCAGTTGCGTTCCACCAGATCCTGGCCTTTGC
TACTGTAACTTTTGGCAATCGCACCCTGCAATTCTGCGAGGGCGCTATCGCCAGGCAGAA
TTTGCGTCAGATGGAAAAAAGCCATCTGCATGACGGTATTAATACGGGCCGCCAGGCCAC
ATTCGCGGGCGATTTTCGCCGCGTTAATCACATAGAAGCGCGCTTTTTTCTGGTTTAACA
CGGCCTGAACTTCTTGCGGCAAGCGCGACCACACTTCATCTGCGCTGTACGGCGTGTTGA
GCAGGAAAATGCCGCCAGGTTTTAAACGCTCAGCCATCTGATATTTATCGATAAACTGCA
ACTGGTGGCAGCCAACAAAATCAGCCTGGGAAATGAGATAAGCGGAACGAATCGGCTGTT
CGCTCACTCGAAGGTGAGAAACCGTCAGGCCGCCCGCCTTTTTGGAGTCGTAAACAAAAT
AGCCCTGTGCGTACCACGGCGTGGAATTACCGATAATCTTGATATTGTTTTTGGTCGCGG
AAACGCTGCCATCACTACCAAGGCCATAAAACAAGGCTTCCAGTTTCGCCGAGTTTGGCA
GGGTGTTTTCCGGCAACGGCAGTGACAGATTGGTCACATCATCGTAAATACCAACCGTAA
AGCGCGCTTTCGGTTTAGCCGCGTTGAGCTCGGCAAATACCGCCAGTACACAGTCTGGGC
CAAATTCTTTGGATGAAAGACCATAGCGCCCACCAATGACACGGGGCAGAGTTTCGCGCT
CGCCATTATTAAAGGCTTCTGCCAGTGCGGTCATTACATCCAGATAGAGCGGTTCTGCCT
GGGCACCGGGTTCTTTGGTTCTGTCCAGTACCGCCACGCTGCGTACGGATCCCGGCAGAG
CTTGCAGTAAATGTTTAGCGGAGAAGGGGCGGTACAGGCGAACTTTCAGCACGCCAACTT
TTTCGCCACGGGTTAGCAATTCATCAACCACTTCTTCACAGGTGCCAATGGCAGAGCCCA
TCAGGATAATCACCCGTTCCGCTTGCGGATGCCCGTAATATTCAAACGGCTGATACTGAC
GACCTGTCGCGGCAGAGAAATCATTCATCGCCTGTTCAACATGGTCATAGACCGCGTTGT
ACCATGGGTTGGTGGCTTCGCGAGACTGGAAATAAGTGTCAGGATTGGCGGACGTACCGC
GGATCACCGGATGTTCCGGGTTGAGTGCCCGGGCGCGATGAGCATCAATTTCGACCTGCG
GCATGAGATCAAGAATCGTGTCATCGGCCAGCGGGACAATTTTATTGATTTCGTGGGACG
TGCGGAAACCATCAAAGAAATGAATAAATGGCACGCGGCTTTTCAGCGTCGCGATTTGCG
AAATGAGAGCAAAGTCTTGCGCTTCCTGGACGTTTGCTGCACACAACATCGCGCAACCCG
TCTGGCGCACCGCCATAACGTCGGAATGATCGCCAAAAATAGAGAGTGCATGTGTGGCAA
CGGTACGTGCCGCTACATGCAGGACAAACGGTGTTAGTTCGCCTGCCAGTTTGTACAGCG
TCGGGATCATCAGCAGCAAACCCTGCGATGACGTAAACGATGTTGAAAGGGCACCCGTCT
GCAAAGCGCCATGCACGGTAGCGATAGCACCCGCTTCCGACTGCATTTCAACCACGCGTG
GTGTGTCTCCCCAAACGTTCTTTAAGCCGTTTCCGGCCCAGGCATCAGCCTGTTCTGCCA
TCGTGGAACTGGGGGTAATAGGGTAGATGGCGATAACTTCACTGGTGCGAAATGCGACCG
AAGCAACCGCGCCATTACCGTCAATAGTAATCATATGACACCCTTACATTGCGCAAATGA
GGGGCGCACGAAATTGCTGCGCGCCCAGTAGTAATCTTTCAATTTTAGCAAATGGCTTTC
TTCTGCATTTTCGCTTTTGTGTCCCCCACATCAGCGTAATGAATGTTTTGATCAAACAGA
GGGCAAAAAAATAGCCATAAAAAAGTAAAAATGCGGGGCAACGCGCAGGACAGCTCTCGA
CGCCGCCCTCTGTGCTGCCTATTATTTATGGCGGTGTCGTTTGGCTTGAAGATCAGAGGA
AGAAAAGATGCGAGCAGCGTTTTGGGTAGGGTGTGCCGCTTTATTGTTGTCGGCGTGTAG
TAGTGAACCTGTTCAGCAGGCGACTGCCGCGCACGTAGCGCCAGGTTTAAAAGCGTCGAT
GTCCAGTAGTGGAGAAGCAAATTGTGCAATGATCGGCGGTTCGCTTTCTGTTGCCCGTCA
ACTGGATGGTACGGCGATTGGGATGTGTGCATTACCCAACGGCAAACGCTGTAGCGAACA
GTCACTTGCCGCCGGGAGCTGTGGCAGCTATTAATTCATTAAATCCGCCAGCTTATAAGT
TAATGTCTGTTTTGCGGTCGCCAGCGTTAACTGGTTCGCGGTCAGATCCACTTGTGCACC
TTCTTTCAGCATTTCGCTAATGGTGTTATCGAGTTCATTAAGCTGCGGGTTAGCGCACAT
CATACGGGTCATTGCCAGCCCTTTGGCTGTCAGTTCACCATTAGACAGTTTGCCTTCACC
GCTAAAGCGGTTACACATGCTGCCGGAAATCATCATTTTTTCACCAAAGCTGATTTCTGG
CGGATTTTTATCGCTGGTCACGGGCTTACCGTTTACGCTTTCCAGCACAAAGCGATGATG
CTGTAGCTGTTCTGGCGTAACAGCAATTTTGTCATTACTTACACATCCCGCCATCAGCAG
GCTTAGCGCAACAAACGCGGCTACTTTCTTCATTGTGGTTCTCAATTACAGTTTCTGACT
CAGGACTATTTTAAGAATAGAGGATGAAAGGTCATTGGGGATTATCTGAATCAGCTCCCC
TGGAATGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTTTCC
AGATTGCTTAAGTTTTGCAGCGTAGTCTGAGAAATACTGGTCAGAGCTTCTGCTGTCAGG
AATGCCTGGTGCCCGGTAAACAGCACGTTGTGGCAGGCAGACAGGCGACGGAATACGTCA
TCCTGGATCACGTCGTTGGATTTATCTTCAAAGAATAGATCGCGTTCGTTCTCATACACG
TCCATACCCAACGAACCAATTTTCTGATTTTTCAGCGCTTCAATTGCTGCCTGAGAATCA
ATCAATGCACCGCGACTGGTATTGACGATCATCACGCCATTTTTCATCTGTTCGAAGGCG
GCTTCGTTCAACAGATGATAGTTTTCCGGTGTCAGCGGGCAGTGCAGAGAGATAACGTCT
GATTCAGAGAACAGGGTTGGCAGATCGACATACTCCACACCGAGTTCCAGCGCCGCTGCA
CTTGGATACGGATCGAACGCCAGCAGACGCATACCAAAACCTTTCAGAATGCGCAGCATC
GCCACACCGATTTTACCGGTACCGATAACGCCTGCCGTTTTGCCATACATAGTAAAGCCG
GTCAGACCTTCCAGAGAGAAGTTAGCATCACGGGTACGCTGATACGCGCGGTGAATACGG
CGGTTCAGCGTCATCATCATACCGATGGCGTGTTCAGCAACGGCCTCTGGATCATAGGCT
GGAACACGGACTACTTTCAGCCCCAGTTCTTTTGCCGCGTCAAGGTCGACGTTATTGAAA
CCGGCACAGCGCAGGGCGATATATTTAACGCCGTGCTTTTTCAGCTCTTCCAGCACCGGG
CGGCTGCCGTCATCGTTTACGAAAATACATACCGCTTCGCAGCCATTGGCAGTTTTAGCG
GTTTTTTCCGTCAGCAGAAAGTCAAAAAATTCCAGCTCAAAGCCAAAGGACTCGTTCACC
TGTTGCAGGTACTTCTTGTCGTACTGTTTTGTGCTATAAACGGCGAGTTTCATAAGACTT
TCTCCAGTGATGTTGAATCACATTTAAGCTACTAAAAATATTTTACAAAATTTCAAATTT
AATTGAAAGCTATGGCGATATTGAAAAATTCATCAACAACTATGCTTAGTGTAGGCGCAA
CCTTCAACTGAACGGTTAAACATGCCACAATACCCGTATTGAATGCTTAATTTTTCGCTA
AATCAGGATATTAACTACCCATGCTGGGTAAATATAAAGCCGTTCTCGCGCTGTTATTAC
TGATTATTCTTGTGCCGTTGACGCTGCTGATGACGCTCGGGCTGTGGGTTCCCACGCTGG
CGGGCATCTGGCTACCGCTCGGGACACGTATTGCATTAGATGAAAGCCCACGCATTACGC
GTAAAGGTTTAATCATTCCCGATCTCCGTTATCTGGTGGGAGATTGTCAGCTTGCGCATA
TCACCAACGCCAGCCTTTCACATCCCAGCCGCTGGTTATTGAACGTCGGCACGGTAGAAC
TTGATTCTGCTTGTCTGGCGAAATTGCCGCAGACGGAGCAATCGCCAGCCGCTCCAAAAA
CACTCGCGCAGTGGCAGGCCATGCTGCCTAACACCTGGATCAATATCGATAAACTGATTT
TTTCTCCCTGGCAGGAATGGCAGGGAAAACTCTCTCTCGCATTAACCTCTGATATCCAGC
AACTGCGTTATCAGGGCGAAAAAGTTAAATTTCAAGGCCAGCTGAAAGGGCAACAACTTA
CAGTCAGCGAACTGGATGTCGTCGCGTTTGAAAATCAGCCGCCGGTAAAACTGGTGGGGG
AATTTGCTATGCCGCTCGTGCCGGATGGACTTCCTGTAAGTGGGCATGCTACTGCGACGT
TAAACTTGCCGCAGGAACCGTCACTGGTGGATGCCGAGCTGGACTGGCAGGAAAATAGCG
GGCAATTGATCGTGCTGGCACGGGATAACGGCGATCCGTTGCTCGATTTGCCGTGGCAAA
TTACTCGTCAACAATTGACCGTAAGCGATGGTCGCTGGAGCTGGCCGTATGCAGGTTTTC
CTTTGAGTGGCCGACTGGGTGTCAAAGTCGACAACTGGCAGGCAGGGCTTGAGAACGCTC
TGGTCAGCGGACGACTGAGTGTGCTGACCCAGGGGCAAGCGGGTAAGGGCAACGCGGTGC
TTAATTTTGGCCCAGGAAAATTAAGCATGGATAACAGTCAGCTGCCTCTGCAGCTGACCG
GTGAAGCGAAACAGGCGGACCTCATTTTATATGCCCGTTTACCTGCGCAGCTAAGTGGAA
GTCTGTCTGACCCAACGCTGACCTTTGAGCCAGGCGCGTTACTTCGTTCAAAGGGAAGAG
TCATCGATTCGCTGGACATCGATGAAATCCGCTGGCCTTTAGCGGGTGTAAAAGTCACCC
AACGTGGTGTTGACGGACGTTTGCAGGCCATCTTGCAGGCGCATGAAAATGAACTGGGCG
ATTTCGTGCTGCATATGGATGGGCTGGCGAATGATTTTCTCCCTGACGCTGGCCGCTGGC
AGTGGCGCTACTGGGGAAAAGGGAGTTTTACACCGATGAATGCCACCTGGGATGTCGCAG
GAAAAGGTGAGTGGCATGACAGCACGATTACGCTGACCGATCTCTCCACCGGTTTCGACC
AGTTACAATACGGTACGATGACGGTAGAAAAGCCGCGATTAATTCTCGACAAGCCCATCG
TCTGGGTACGTGACGCACAGCATCCCTCCTTTAGCGGCGCGCTGTCACTGGACGCCGGGC
AAACGCTGTTCACTGGCGGCAGTGTGTTACCGCCATCAACCTTAAAATTTAGCGTCGATG
GGCGCGATCCTACCTATTTCCTCTTTAAAGGCGATTTACATGCTGGTGAGATTGGCCCGG
TTCGGGTAAATGGTCGCTGGGACGGTATTCGTCTGCGCGGTAACGCCTGGTGGCCTAAAC
AATCACTGACCGTATTCCAGCCGCTGGTGCCACCCGACTGGAAGATGAACTTACGCGATG
GTGAACTGTATGCTCAGGTTGCATTTTCTGCTGCGCCTGAACAAGGATTCCGCGCGGGAG
GACACGGCGTGTTGAAAGGCGGTAGTGCCTGGATGCCAGATAATCAGGTTAACGGTGTCG
ATTTTGTCCTGCCTTTCCGTTTTGCCGATGGAGCCTGGCATCTGGGGACTCGCGGCCCCG
TTACGTTGCGAATTGCCGAAGTGATTAATCTGGTGACAGCGAAAAATATTACGGCTGATT
TGCAAGGGCGTTATCCGTGGACTGAAGAAGAACCCTTGCTGTTGACTGATGTTAGCGTCG
ATGTGTTAGGCGGTAACGTACTGATGAAACAATTACGTATGCCGCAACATGACCCGGCGC
TGTTGCGGCTGAATAATCTCTCATCCAGCGAACTGGTTAGCGCCGTCAATCCGAAACAAT
TCGCCATGTCCGGGGCATTTAGTGGTGCACTGCCGTTATGGCTGAACAATGAAAAATGGA
TTGTGAAAGATGGCTGGCTGGCGAATAGCGGGCCGATGACATTGCGACTGGATAAAGACA
CTGCGGATGCGGTGGTAAAAGACAATATGACTGCGGGTTCAGCAATTAACTGGTTGCGCT
ATATGGAAATTAGCCGTTCATCGACAAAAATTAATTTAGATAATCTCGGTTTATTAACCA
TGCAGGCCAACATTACAGGTACCAGTCGCGTTGATGGTAAAAGCGGTACGGTAAACCTTA
ATTACCATCATGAAGAGAATATTTTTACGCTGTGGCGCAGTTTACGCTTTGGCGATAATC
TCCAGGCATGGCTGGAGCAGAACGCACGTCTGCCGGGAAATGACTGTCCGCAAGGAAAAG
AGTGTGAGGAAAAACAATGAAAATTTTACTGGCTGCGTTGACGTCATCTTTTATGCTGGT
TGGCTGTACGCCTCGCATTGAAGTCGCTGCACCTAAGGAACCGATCACTATCAATATGAA
CGTTAAAATTGAGCATGAGATCATCATCAAGGCAGACAAAGATGTCGAAGAGCTGCTTGA
AACTCGTAGCGATCTTTTCTGAGGTGATGATGAAGAAAACATTACTTCTTTGTGCGTTTC
TTGTTGGGCTGGTAAGCAGCAATGTAATGGCATTGACTCTGGATGAAGCCAGAACTCAGG
GGCGGGTAGGTGAAACATTTTACGGTTATCTGGTTGCGCTGAAAACGGATGCTGAAACAG
AGAAATTAGTAGCCGACATTAATGCCGAACGTAAAGCGAGTTACCAACAACTGGCAAAGC
AAAATAATGTGTCGGTAGATGATATCGCGAAACTCGCCGGGCAAAAGCTCGTAGCTCGGG
CCAAACCGGGGGAATATGTACAAGGGATAAACGGTAAATGGGTGCGAAAATTTTAATAGC
AAAACCGCAATATCGGGATAACGCTACAGGAGAAGGCGATTGATCTATTTTCCTGAAACA
AGGTGAATATTCAAAAACTCCTGTCAAATTGCCTTTTGCCCTGAAAAATGCATAGTCAAA
TATCTGTTTTAACTAATTGGCGTTGCAGTACATGCAACGCCAATTAGTTAGCGGAATTTA
CGTCGATACTCGCCTGGCGTCATCCCAAAGCGTTGCTTAAATACCGTTGAAAAATGACTC
TGGTCAGAAAATCCCCAATGAAAGCCGATGCCTGCCAGTTTTTCATCATCTGCGGCATGG
CGAATCGCATCTGCACAAAAATCGAGACGACGGTTACGAATATATTGCGCGACTACCAAA
CCTTTATCGGCAAACATTCGGTACAAACTACGTACTGACATACCTGTCTCTCCGGCTATC
CACTCCGGGCGTAATATCTCTTCGCGAATATTATCGTCTATCAACGTAACCACTTTTTGA
AACTGACGTTCACGACGAGGTTGAACAGATTCCCGCTGATGAAGTACCGGGCGCAGCAGA
CACACCATCGCCTGTAGCGCAGCTTCACTTTCTGTTTCAGAAAGTGCCGGATTATTCATG
CTCTCCTGTAACAGGCGATGACTGAGTTGCACCATGGGTAAGTCAGCGTCCAGTCTTTCT
GCGCAGATAGGTTTTTGATGGGGAAAATATTGTTCCAGCAGAGTGCGTGGCAAAAGTAAT
GAAATCTGTTTAGAAGACTCCTGCCAGTAAAGCGAACAGGGGCGTGAGGCATCGAGTAAC
GTAATATCGCCAGCGCCAATCTGCACCTGACGCTCATCCTGCTCCATTATTGCCTGACCA
CTAAGCTGAAAAACGGTGTAAAACCAGGCATCGTCGCTGCCTTTTACTTCCTGCCAGGTG
CGGGATAAATTCACCCCGCTGGTTGTCACGGTACTCAGCTTTAGTCCTTTGGCAAAATGC
GTGTCCAGTACACCCGTGTAACGCTCAGTCAGCAGGCGTCCGGTAAAATTTCCGCATACC
TGATTGATTTGGGAAAGCCATTGCTGAAACTCATTATCCACTGCGGGGTTCATGGCACGT
TTTCGCTCTGTGAAATGTATTTTTATTGTTGCATTTGTGTTGCAATAAACGAAGCTAATG
AGCCTGACTATAGGAAATAAGTCTTGTCAGGCATAGAGACATAAGCGGTTATTGTCACGA
TTTGCGGAGCTTGTCACAGCTGACAAAGCGAATGTCACAGCGAAAAAAGTGACTTTTCTT
GTCGCTGCGTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTGATGACAGAGCCG
CATGTAGCAGTATTAAGCCAGGTCCAACAGTTTCTCGATCGTCAACACGGTCTTTATATT
GATGGTCGTCCTGGCCCCGCACAAAGTGAAAAACGGTTGGCGATCTTTGATCCGGCCACC
GGGCAAGAAATTGCGTCTACTGCTGATGCCAACGAAGCGGATGTAGATAACGCAGTCATG
TCTGCCTGGCGGGCCTTTGTCTCGCGTCGCTGGGCCGGGCGATTACCCGCAGAGCGTGAA
CGTATTCTGCTACGTTTTGCTGATCTGGTGGAGCAGCACAGTGAGGAGCTGGCGCAACTG
GAAACCCTGGAGCAAGGCAAGTCAATTGCCATTTCCCGTGCTTTTGAAGTGGGCTGTACG
CTGAACTGGATGCGTTATACCGCCGGGTTAACGACCAAAATCGCGGGTAAAACGCTGGAC
TTGTCGATTCCCTTACCCCAGGGGGCGCGTTATCAGGCCTGGACGCGTAAAGAGCCGGTT
GGCGTAGTGGCGGGAATTGTGCCATGGAACTTTCCGTTGATGATTGGTATGTGGAAGGTG
ATGCCAGCACTGGCAGCAGGCTGTTCAATCGTGATTAAGCCTTCGGAAACCACGCCACTG
ACGATGTTGCGCGTGGCGGAACTGGCCAGCGAGGCTGGTATCCCTGATGGCGTTTTTAAT
GTCGTCACCGGGTCAGGTGCTGTATGCGGCGCGGCCCTGACGTCACATCCTCATGTTGCG
AAAATCAGTTTTACCGGTTCAACCGCGACGGGAAAAGGTATTGCCAGAACTGCTGCTGAT
CACTTAACGCGTGTAACGCTGGAACTGGGCGGTAAAAACCCGGCAATTGTATTAAAAGAT
GCTGATCCGCAATGGGTTATTGAAGGCTTGATGACCGGAAGCTTCCTGAATCAAGGGCAA
GTATGCGCCGCCAGTTCGCGAATTTATATTGAAGCGCCGTTGTTTGACACGCTGGTTAGT
GGATTTGAGCAGGCGGTAAAATCGTTGCAAGTGGGACCGGGGATGTCACCTGTTGCACAG
ATTAACCCTTTGGTTTCTCGTGCGCACTGCGACAAAGTGTGTTCATTCCTCGACGATGCG
CAGGCACAGCAAGCAGAGCTGATTCGCGGGTCGAATGGACCAGCCGGAGAGGGGTATTAT
GTTGCGCCAACGCTGGTGGTAAATCCCGATGCTAAATTGCGCTTAACTCGTGAAGAGGTG
TTTGGTCCGGTGGTAAACCTGGTGCGAGTAGCGGATGGAGAAGAGGCGTTACAACTGGCA
AACGACACGGAATATGGCTTAACTGCCAGTGTCTGGACGCAAAATCTCTCCCAGGCTCTG
GAATATAGCGATCGCTTACAGGCAGGGACGGTGTGGGTAAACAGCCATACCTTAATTGAC
GCTAACTTACCGTTTGGTGGGATGAAGCAGTCAGGAACGGGCCGTGATTTTGGCCCCGAC
TGGCTGGACGGTTGGTGTGAAACTAAGTCGGTGTGTGTACGGTATTAATCTGGTTCGCTC
ATAAGTAAAAAACGGCACCTGGTGCCGTTTTTTTGTCTGAAACAATCACTTATCTTTCTT
CAGCGCCCCTAGCGTTGGCGTTTCGTCAAAGAAGTTCCATGGTTTCAGCAGAGTATGTAC
CCATTCGGTCGGCATAATCGGCCACTCTTCGGCGCGGGCCACATGTGTGGTGCCGGTGGT
CATCCAGACAACGGCGTCGGTGTTGTCCAGCGACTCGTTATCCTTACTGTATTGTCCAAG
ACCGGTGTCATGAGTAGAACGGTTCGGATATTTGCCTTCCGGGAAACGCTCGCCAGGATG
ATAACGCGTTACCCAGAGCTGCTTGTCCATAAAGCTTAAACGATGATAGATCCACTCGTC
CGGCGCGAACTGGGCACCTTTTGCTACCGGGTGAGTACCACCTGCATAAGGAATAATTTG
ATAGGAAACCGGATTGCCCATGCGGTTCTCTTTGTTCGGGTTACTCAACAGACGAATCGT
GCCCGGATCAAATTTCTGTGCGGCATCCTGTTCATTGCCGATGTTGTACTGATTAACTTG
CATGGTACTGGTGCGTGGGCCACCGGCAGTATTCGGTTTTACCACTGGGTCCATCGCCAC
CAGGCTGTTATTCTCGCCATCTACATCCAGATCGAGGCGGAAATTATAAATATGTTGGTG
TGTAGTACCCACGATATTGTGATCGATAAGCGTGCCGTAGCGCGTGTCATCTTTCGCCGT
CTCATCGTGCATGGTTTTCGCTTTAACACCTTTCACCGCTTCGATGCCCGTAGCACCGGC
ATCGATGCCAATAGTGCCGTTTTCATGGAAGATCCAGTCAAAAATGTAGTCATAGTTACC
CACTGTACTGATCCAGCGCACCACTAACTCCCGGCGTTCGGTACTGACGTTGGGCTGGCC
CATTTCCTGATGCTTATACTCCGGCCCGGCATAACGTTCAAATACCGCGATAGCGCGAGG
GATCTCCATCGGCACGCCAGTGTAGTCGGCGATGGTTTCATTAAGGAGCACTGCGTTAGA
CGGGGCATCTTTACCACGAGCAATTGGTGAGGTTAGCGTGCCCATACCGTAGTCACCAGA
GTCCAGATACGCTTTAAAGTACCAGCCAATATCAGGATCACCGTAAGGCACAATCATGCC
GCCGAGAGAACCTTCGTACATGACTTTGCGTTTGGTGCCATTGTCGTTATAAGTCACGGT
GGAGATCATCGGCCCGACGCGAGAGTTCATGCTGAGGTGAAAATCCCAGTTCCGCCAGTG
AATCATATCGCCAGTAATGGTGTAATTTTTACCTTCAGGCTCAATGATTTGCATAGGCTT
AACTGCCGGAGCAACGCGGTCACGGCCATCAAATGGGCGTGCGGTCATTGGCACCGGAAC
TACCGGACCTTCTTCAATCTTAACGATTTTTTTCTGTTCTAAATCAACGACCGCCACCAG
GTTTTCGATGGGATGTGCCCAGTAGTTGCCATCACCGACATCAAGATAGCTGATGACTTT
GAGCAACCGGGCATCTTGTTTCAGGCCATCTTTACCATCGAAATAACCTACGGTCAGCGG
CGTGGTAATCACTTTTTTCGCATCAGTAATACCGCGTTTCTTCACGGCAGCGGCAAATTC
TTCACTGTTGTTAATAATGTTCTGCACACTGGCGAAATCATCCAGCAACACCATACCGTG
GGCGTCTTTAATGGGTTGCCAGGAGAGCAGTTTGTTGTTTTGCAGATCCACCACCGCTTC
GATGATATGTTTGCCGTCGAGCATAATGACGTCGGCTTTGCGCGGCTGGTCAACCGGTTT
GTTTTCCAGCGCAAACGCCCAGACAGCTTCTTTATCTGGCGGTAGCAGGGAGATCTCAGT
AAAACGGGTATTGGGTTTGAAGTCCGCGGAAGCTTTAACAATTTCAACGGCCTGTTTAAT
TTCGTCCGCAGTTAGCGCATTAAGTGGGTGAGGGCGCTTTTCTACCTGAAAGGTTTGATC
CAGCCCGGACTGGAAAACATCGTTAATAAAGGTGTCAGAAACCCAGGCTTTATTGTCTTT
CATCACTACCGGTACTTGCAGTGCCAGAGGCTGACCATTAACAATTGCTGTTTGCGCACC
AGGCTTCACTTTCACGTACGCGCCATCTTTAATCAGGGTAAAGAGCTGGGCGTAGTCGTC
CCACTGCACATCGGCACCAAATTCTTTAAGCGTTTTATCCATTGGCACCATATGCGCTTC
ACCACCGTGGGCAAATACCGGCGCTTGCCAGGCGAAACTTAAGGCGACTGCCAACGCCAG
GGTTGTTTTACGGGCAGAATACAGAGAGGGGCTTCCCATTATTAACCTCGTCAGATGTTG
TGTTCTTGTTAGCAACCGCGCTCTGTGGGCGGTTTAGTCAGGTTCACATTATCAGTACTG
ATGCAAAGGGGATTGCCTGCACCTGCCAGGTTGTTTGGCAGGTGTGCCAGCTTTTCATAC
AGTGGATGCCCTGAAAATAGATGTACACATCATGCATAATGTGACAACGTCACAAAACTT
AGTGAAATAAAAGGGCAACTATTCGCCGTTGCCCTTCATTCACCGATTAATCGACAAAAT
CACCGTGCTGCCTGGCCACCAGCGTCAGAATTGAATACAGCGCCACCGGGGTTTGATGCT
GATTGAATACCTCTACAGCCCATTCCACCACACCTGTTGGTTTTTCTTCTGCGCTACGCT
GTTTTTTCAGCGTCTTGCGCTTACAGGTGAGACGCACCTGGATGGTATCGCCTGGCTTTA
CGGGTTCGATAAAACGCAAGCTTTCCAGCCCGTAGTTAGCAATGACCGGACCGACACCGG
CATCGACAAACAGACCCGCAGCCGCAGAAAGCACAAAATACCCATGCACCACCCGCTCAC
CGAAAATAGATTCGGCAGCAGCAATCTTATCCATATGTGCATAGAAATGATCGCCGCTGA
GGCAAGCAAAGTTAACAATATCGGCCTCTGTCATTGTGCGGCGGGGAGTCAACAGGCTGT
CGCCTGGTTGTAGCTCCTCAAAATATTTGCGGAACGGATGAATACGATCTTCTTCGACTT
TCGCACCGCGCACCCACTGTTTACTGATAGCGGCAAGCATCGTCGGACTACCCTGAACAG
CGGTTCGCTGCATGTAATGTTTCACCGCTCGTAAACCGCCTAATTCTTCACCGCCTCCTG
CGCGACCAGGCCCACCATGTACCAGTTGTGGCAGTGGGGAGCCATGCCCGGTGGATTCTT
TTGCCGACTCTTCATTGAGGATCTGAATTCGCCCATGCGTACGTGCCGCGTCGGCAATAA
ACTGACGCGCAATTTGCGGATCAGCCGTCACCAGCGTTCCCGCAAGGCTACCGCCGCCTG
CACAAGCCAGTTGCAGAGCATGTCGCTGGTTTTGTGCTGGCATCAGCGTTGCGACAGGGC
CAAAGGCTTCTGTTGCATGTACCGCCGGTGTTTCATCCGGCTGCGGACAGTACAATAAGG
TTGGCGGGAAGAAGGCACCCGCAGCAGATAAATCCGCCTGACCACCGAGGCGAATCTCGC
ATCCTGCAGCCAGCAATATGTTCACTTTTTCCTGCACATCGGCACGCTGCTCAGCATTTA
CCAGTGCGCCCATTTTCACGCCTTCCTGAGCAGGATCACCGACCACGACTTTCTGTAATC
GCGCAACCAGAGCATCACTGACAGCATTAACCAATGCCTGCGGCACAATAATCCGCCGGA
TTGCCGTACATTTTTGCCCGGCTTTTGTGGTCATCTCACGCACAACTTCACGAATAAACA
GCGCAAACTCCGGTTGATCCGGGGTGACATCTTCGCCCAGTACGCAGCAGTTCAGGGAAT
CAGCTTCCATAGTGAAGGGGATAGATTTGGCGACGATATTTGGCTGAACTCGCAGCATCT
GTCCGGTCGCCGCTGACCCCGTGAAAGTCACCACATCCTGGCTGTCCAGATGATCCAACA
AGTCGCCAGCACTACCGCAGATCAGACTAATTGCGCCTTCGGGAACAAGACCACTATCGA
CAATTGATTTCACCATCGCCTGAGTCAGTTGGGCCGTCGCGGTAGCTGGTTTGATGATGG
CTGGCATTCCGCCCAGCCACGTTGGTGCCAGCTTTTCCAGCATTCCCCAGCAGGGGAAGT
TAAAGGCGTTAATATGCACTGCCACGCCTGACTTTGAGGTCAGTAAATGGCGCGCGGCAA
ATCCACCTTCTTTCGATAAGGGGATCAATTCATCTTCCGGCCACAGCGTATCGTCAGGCA
GCTCCCGGCTACCGAGGCTGGCGTAAGTAAATAACGTCCCAATGCCACCTTCAATATCAA
CCCAACTGTCTGCCCGCGTTGCGCCTGTTTGCGCAGAAAGAGCATAGAAACGCTCTTTTT
CACTCAGCAGATGTTTAGCGACCGCTTTAAGCATCGCCGCACGTTCGATAAAGGTCATAG
CGCGAAGGGCGGGGGCACCTTTTTCAATGGCAAACTGGCGGGCAGCCGCCATATCAAGAC
CTTCACTGGTCACTTCCCATAACGCCTCGCCGCTAATAGCGTGGTGAATCAAACGGCTAC
GGCCCCGGCCAGACTGCCAGGTACCGGATAAGAAACTGGCTAACTGCTGCATCGCTACTC
TCCAGATGTTTCACATTTCTGTTGCTAATAGTTAAATCGCGAATCATAAAAAGCAAAGGA
TCTTTTAACGAAATGTTAACTATGCGATCTGTATAGCAACTGCGGAAAACATTAATGCAC
TGATAAATAATGATTTATAAAAATAGGGTGCGAAATCCGTCACAGTTCAAACATACAAAA
TTTGTGATTTTACTTAACTATTGTGTAACTTTCATAAAACAATGTGATTCGTGTTTTTAA
TTAATTCACGAAAACTGGAATCGTAAAGGTGATGACGTGACCCAAGAAGAACGCTTTGAG
CAACGGATAGCCCAGGAAACGGCTATCGAGCCACAGGACTGGATGCCCGATGCTTACCGA
AAGACATTGATCCGCCAGATTGGGCAGCATGCGCACTCCGAGATTGTTGGTATGTTGCCT
GAAGGTAACTGGATCACTCGCGCACCAACCTTGCGGCGTAAAGCCATTCTGTTGGCCAAA
GTGCAGGATGAAGCCGGTCATGGTCTGTATCTCTATAGCGCCGCCGAAACACTGGGCTGC
GCCAGAGAAGACATCTACCAAAAAATGCTCGACGGACGGATGAAATATTCCTCCATCTTT
AATTATCCGACATTGAGTTGGGCTGATATCGGTGTTATCGGCTGGCTGGTGGATGGCGCA
GCGATCGTCAATCAGGTGGCGTTATGCCGCACTTCTTATGGCCCGTATGCCAGAGCAATG
GTGAAAATCTGCAAAGAAGAGAGTTTTCACCAGCGTCAGGGGTTTGAAGCCTGCATGGCA
CTGGCGCAGGGCAGCGAAGCTCAAAAGCAGATGTTGCAAGACGCCATTAACCGTTTCTGG
TGGCCAGCCTTAATGATGTTCGGGCCAAACGATGATAACTCGCCAAACAGCGCCAGAAGT
CTCACCTGGAAAATCAAACGTTTCACCAACGACGAACTCCGCCAGCGTTTCGTGGATAAC
ACCGTTCCACAGGTTGAAATGCTCGGTATGACCGTTCCTGACCCGGATCTGCATTTTGAC
ACTGAAAGCGGTCACTACCGCTTTGGTGAGATCGACTGGCAGGAGTTTAACGAAGTAATT
AACGGTCGCGGAATTTGTAATCAGGAGAGGCTCGACGCCAAACGTAAAGCCTGGGAAGAA
GGTACCTGGGTACGGGAAGCAGCGCTGGCCCATGCACAAAAACAACATGCCCGTAAGGTC
GCATAAGGAGATTCAAAATGAGTAATGTTTACTGGCCGTTATACGAAGTTTTCGTGCGTG
GCAAACAGGGCTTATCACACCGCCATGTTGGCAGTTTACATGCTGCCGATGAGCGGATGG
CACTGGAAAATGCCCGTGATGCTTACACCCGTCGTAGCGAAGGATGTTCAATTTGGGTGG
TGAAGGCGAGTGAAATTGTTGCCTCGCAACCGGAAGAACGCGGTGAATTTTTTGATCCGG
CTGAAAGCAAGGTCTATCGCCATCCAACGTTTTACACCATCCCTGATGGCATTGAGCACA
TGTGAGGTCGGAAATGAATCAGTTAACGGCTTACACCTTGCGCCTGGGCGATAACTGCCT
GGTGCTCTCCCAGCGGTTGGGTGAATGGTGCGGTCACGCACCGGAACTGGAAATCGATCT
CGCACTGGCAAACATTGGCCTCGATTTATTAGGTCAGGCACGCAACTTCTTATCGTATGC
CGCTGAATTAGCGGGAGAAGGCGATGAAGATACCCTGGCCTTCACCCGAGACGAGCGCCA
GTTCAGCAACTTATTGTTGGTTGAACAACCAAACGGCAATTTTGCCGACACCATTGCACG
CCAGTATTTCATCGATGCATGGCATGTGGCGCTCTTTACCCGTCTGATGGAAAGCCGTGA
TCCGCAACTGGCGGCGATTTCTGCCAAAGCAATTAAAGAAGCGCGCTATCACCTGCGTTT
TAGTCGTGGCTGGCTGGAGCGACTGGGCAATGGTACTGACGTATCAGGGCAAAAGATGCA
GCAGGCCATCAACAAGTTGTGGCGTTTTACCGCCGAACTGTTCGATGCCGACGAGATTGA
TATTGCACTGAGTGAAGAGGGTATTGCGGTTGATCCACGCACTTTACGCGCAGCGTGGGA
AGCCGAAGTTTTTGCCGGGATCAACGAAGCCACATTGAACGTACCGCAAGAGCAGGCGTA
TCGCACTGGCGGTAAAAAAGGACTGCATACCGAACACCTTGGACCCATGCTGGCAGAAAT
GCAGTATCTCCAGCGTGTCTTGCCCGGTCAGCAATGGTAACAGAGGAGATGGGTATGCAA
CGTCTGGCCACCATTGCACCGCCACAGGTTCATGAGATATGGGCGCTACTCAGCCAGATC
CCGGACCCGGAGATCCCGGTGCTGACCATTACTGATTTAGGCATGGTGCGTAATGTGACA
CAGATGGGAGAAGGATGGGTGATCGGCTTTACGCCGACATATTCCGGTTGTCCGGCAACG
GAACATTTGATTGGCGCGATACGTGAGGCAATGACAACCAACGGGTTTACCCCCGTTCAG
GTTGTGCTGCAACTCGACCCGGCATGGACCACCGACTGGATGACCCCCGATGCCCGTGAG
CGTCTGCGAGAGTATGGCATTAGCCCGCCCGCCGGACACAGTTGCCATGCCCATTTGCCG
CCAGAAGTACGTTGCCCGCGCTGCGCCAGCGTCCATACCACACTTATCAGTGAATTTGGT
TCCACGGCCTGCAAAGCATTGTACCGCTGCGATAGTTGCCGCGAACCTTTCGATTATTTC
AAATGTATTTGAGGATGCCATGACAACGTTTCATTCCTTAACAGTGGCAAAAGTCGAGTC
GGAAACCCGTGATGCGGTGACCATTACCTTTGCGGTGCCCCAGCCTTTGCAGGAGGCGTA
TCGCTTTCGCCCCGGTCAACATTTGACCTTAAAAGCCAGCTTTGATGGTGAAGAATTACG
CCGTTGTTACTCCATTTGCCGCAGCTATCTGCCTGGCGAAATTAGTGTGGCGGTGAAAGC
CATTGAAGGCGGACGTTTCTCCCGCTATGCCCGCGAACACATCCGCCAGGGTATGACGCT
GGAGGTCATGGTGCCGCAGGGGCATTTCGGCTATCAGCCGCAGGCCGAACGCCAGGGGCG
CTATCTGGCAATTGCAGCAGGATCAGGTATTACGCCAATGCTGGCGATTATCGCCACCAC
TTTACAAACCGAGCCTGAAAGTCAGTTCACCCTGATCTACGGTAACCGTACCAGCCAGAG
CATGATGTTTCGCCAGGCACTGGCAGACCTGAAAGACAAATATCCTCAGCGTTTACAGTT
GTTGTGCATTTTCAGTCAGGAAACCCTCGACAGCGATCTGCTTCACGGGCGTATTGACGG
TGAAAAATTACAGTCACTTGGGGCCTCGCTCATTAATTTTCGTCTTTATGATGAGGCATT
TATTTGTGGTCCGGCGGCGATGATGGATGACGCGGAAACCGCCTTAAAAGCACTGGGAAT
GCCAGATAAAACCATTCATCTGGAGCGGTTTAATACGCCTGGCACGCGCGTCAAACGTAG
CGTTAACGTGCAAAGTGACGGACAAAAAGTGACTGTACGTCAGGATGGGCGGGATCGGGA
AATCGTGCTTAATGCCGACGATGAAAGCATTCTCGATGCGGCATTGCGCCAGGGGGCGGA
TCTGCCCTATGCCTGCAAAGGCGGCGTCTGTGCGACCTGCAAATGCAAAGTGCTGCGTGG
CAAAGTGGCGATGGAAACCAATTACAGTCTGGAACCGGATGAACTGGCCGCAGGTTATGT
GTTGAGTTGCCAGGCACTGCCGCTGACCAGCGATGTGGTGGTTGACTTTGACGCGAAGGG
GATGGCATGAGCGAACTGATCGTCAGCCGTCAGCAACGAGTATTGTTGCTGACCCTTAAC
CGTCCCGCCGCACGTAATGCGCTAAATAATGCCCTGCTGATGCAACTGGTAAATGAACTG
GAAGCTGCGGCTACCGATACCAGCATTTCGGTCTGTGTGATTACCGGTAATGCACGCTTT
TTTGCCGCTGGGGCCGATCTCAACGAAATGGCAGAAAAAGATCTCGCGGCCACCTTAAAC
GATACACGTCCGCAGCTATGGGCGCGATTGCAGGCCTTTAATAAACCACTTATCGCAGCC
GTCAATGGTTACGCGCTTGGGGCGGGTTGCGAACTGGCATTGTTGTGCGATGTGGTGGTT
GCCGGAGAGAACGCGCGTTTTGGGTTGCCGGAAATCACTCTCGGCATCATGCCTGGCGCA
GGCGGAACGCAACGTTTAATCCGTAGTGTCGGTAAATCGTTAGCCAGCAAAATGGTGCTG
AGCGGAGAAAGTATCACCGCTCAGCAAGCACAGCAGGCCGGGCTGGTTAGCGACGTCTTC
CCCAGCGATTTAACCCTCGAATACGCCTTACAGCTGGCATCGAAAATGGCACGTCACTCG
CCGCTGGCCTTACAAGCGGCAAAGCAAGCGCTGCGCCAGTCGCAGGAAGTGGCTTTGCAA
GCCGGACTTGCCCAGGAGCGACAGTTATTCACCTTGCTGGCGGCAACAGAAGATCGTCAT
GAAGGCATCTCCGCTTTCTTACAAAAACGCACGCCCGACTTTAAAGGACGCTAATGATGG
AATTCATCCTCAGTCATGTAGAAAAGGGCGTGATGACACTAACGCTCAACCGCCCGGAAC
GCCTGAACAGTTTTAATGATGAGATGCACGCACAACTGGCAGAGTGCCTGAAACAGGTCG
AGCGCGACGACACTATCCGTTGCCTGTTACTTACAGGTGCCGGGCGCGGATTTTGTGCTG
GTCAGGATCTTAACGATCGTAACGTTGATCCCACAGGCCCCGCACCGGATTTAGGGATGT
CAGTTGAACGTTTCTATAACCCACTGGTACGTCGCCTGGCAAAACTGCCAAAACCGGTGA
TCTGTGCAGTCAATGGCGTGGCGGCAGGGGCAGGCGCAACACTGGCACTGGGGGGCGACA
TCGTTATTGCTGCCCGTTCAGCAAAATTCGTCATGGCGTTTAGTAAGTTAGGCTTAATAC
CCGATTGCGGTGGAACCTGGTTACTGCCACGCGTTGCCGGACGAGCGCGCGCCATGGGGC
TGGCACTGCTGGGGAATCAACTGAGTGCTGAACAGGCGCACGAATGGGGGATGATCTGGC
AGGTTGTTGATGATGAAACGCTGGCAGATACCGCGCAACAGCTGGCACGGCATCTGGCGA
CACAACCGACATTTGGTCTTGGACTTATCAAGCAAGCGATAAATAGCGCTGAAACCAATA
CGCTCGATACGCAACTGGATCTGGAACGTGACTATCAGCGACTTGCCGGACGGAGCGCAG
ATTATCGTGAAGGTGTCAGTGCGTTCCTGGCTAAACGCTCACCGCAGTTCACGGGGAAAT
AGCATGATGATAAATGTGCAAACTGTGGCAGTGATTGGGAGCGGCACCATGGGGGCAGGC
ATTGCTGAAGTTGCTGCCAGTCATGGACACCAGGTTTTACTGTATGACATTTCTGCTGAA
GCGCTGACCCGCGCAATCGACGGGATACACGCGCGGCTAAATTCACGCGTGACGCGGGGA
AAACTGACTGCTGAAACCTGTGAACGCACATTGAAACGCCTGATCCCGGTGACCGATATT
CACGCGCTGGCAGCTGCGGACCTGGTCATTGAAGCGGCGTCTGAACGTCTGGAAGTCAAA
AAAGCGCTCTTTGCACAGCTGGCGGAAGTTTGCCCGCCACAAACGCTATTGACCACTAAC
ACTTCGTCAATCTCTATAACCGCGATTGCTGCGGAGATAAAAAATCCTGAACGTGTTGCG
GGGCTGCATTTTTTTAACCCGGCACCGGTGATGAAGTTGGTGGAGGTGGTCAGTGGGCTG
GCAACGGCGGCGGAAGTTGTTGAGCAGTTGTGTGAACTAACGTTGAGTTGGGGTAAGCAG
CCTGTGCGCTGTCATTCGACTCCTGGATTTATCGTTAACCGTGTTGCGCGTCCTTATTAT
TCCGAGGCCTGGCGGGCACTGGAAGAGCAGGTTGCTGCACCAGAAGTGATTGACGCTGCA
CTTCGCGATGGCGCTGGTTTCCCGATGGGGCCGCTGGAATTAACCGATCTGATTGGTCAG
GACGTCAATTTTGCTGTCACCTGTTCGGTGTTTAACGCTTTCTGGCAGGAGCGTCGTTTT
TTACCTTCGCTGGTGCAACAGGAACTGGTGATTGGTGGACGGTTGGGCAAGAAAAGTGGG
CTGGGCGTGTACGACTGGCGCGCGGAACGTGAGGCAGTTGTTGGCCTGGAAGCGGTAAGC
GACAGTTTTAGCCCAATGAAAGTAGAAAAGAAAAGTGACGGTGTCACGGAAATTGACGAT
GTTTTATTGATTGAGACACAAGGCGAGACGGCACAGGCGCTGGCAATACGACTGGCACGC
CCGGTGGTAGTGATCGATAAAATGGCGGGCAAGGTGGTGACCATTGCTGCTGCAGCGGTG
AACCCGGACTCAGCGACCCGCAAGGCCATTTATTACCTGCAACAGCAGGGCAAAACAGTG
CTGCAAATTGCAGATTACCCAGGAATGCTGATTTGGCGAACGGTAGCAATGATCATCAAT
GAAGCCCTTGATGCGCTTCAAAAAGGCGTGGCCTCTGAACAGGATATCGATACCGCCATG
CGTCTTGGGGTGAATTATCCATATGGCCCACTTGCCTGGGGAGCGCAACTTGGCTGGCAG
CGAATATTAAGGCTCCTTGAAAATCTACAGCATCACTATGGCGAAGAACGCTATCGCCCA
TGTTCATTGCTGCGCCAACGGGCGCTTCTGGAGAGCGGTTATGAGTCATAAGGCCTGGCA
AAATGCCCATGCAATGTATGAGAACGATGCCTGCGCCAAAGCGCTTGGCATCGACATTAT
CTCAATGGATGAAGGCTTTGCTGTAGTGACCATGACCGTCACTGCACAAATGCTTAACGG
TCATCAAAGTTGCCACGGCGGGCAGCTATTTTCACTGGCTGATACTGCCTTTGCCTACGC
CTGCAATAGCCAGGGGCTGGCAGCCGTCGCTTCTGCCTGCACGATTGATTTTTTGCGTCC
AGGCTTTGCCGGAGACACCTTAACTGCTACTGCGCAGGTACGTCATCAGGGCAAGCAAAC
CGGTGTTTACGACATCGAAATTGTTAACCAACAACAAAAAACGGTTGCGCTGTTTCGCGG
TAAATCTCACCGCATCGGCGGCACCATTACAGGAGAAGCCTGATGCGTGAAGCCTTTATT
TGTGACGGAATTCGTACGCCAATTGGTCGCTACGGCGGGGCATTATCAAGTGTTCGGGCT
GATGATCTGGCTGCTATCCCTTTGCGGGAACTGCTGGTGCGAAACCCGCGTCTCGATGCG
GAGTGTATCGATGATGTGATCCTCGGCTGTGCTAATCAGGCGGGAGAAGATAACCGTAAC
GTAGCCCGGATGGCGACTTTACTGGCGGGGCTGCCGCAGAGTGTTTCCGGCACAACCATT
AACCGCTTGTGTGGTTCCGGGCTGGACGCACTGGGGTTTGCCGCACGGGCGATTAAAGCG
GGCGATGGCGATTTGCTGATCGCCGGTGGCGTGGAGTCAATGTCACGGGCACCGTTTGTT
ATGGGCAAGGCAGCCAGTGCATTTTCTCGTCAGGCTGAGATGTTCGATACCACTATTGGC
TGGCGATTTGTGAACCCGCTCATGGCTCAGCAATTTGGAACTGACAGCATGCCGGAAACG
GCAGAGAATGTAGCTGAACTGTTAAAAATCTCACGAGAAGATCAAGATAGTTTTGCGCTA
CGCAGTCAGCAACGTACGGCAAAAGCGCAATCCTCAGGCATTCTGGCTGAGGAGATTGTT
CCGGTTGTGTTGAAAAACAAGAAAGGTGTTGTAACAGAAATACAACATGATGAGCATCTG
CGCCCGGAAACGACGCTGGAACAGTTACGTGGGTTAAAAGCACCATTTCGTGCCAATGGG
GTGATTACCGCAGGCAATGCTTCCGGGGTGAATGACGGAGCCGCTGCGTTGATTATTGCC
AGTGAACAGATGGCAGCAGCGCAAGGACTGACACCGCGGGCGCGTATCGTAGCCATGGCA
ACCGCCGGGGTGGAACCGCGCCTGATGGGGCTTGGTCCGGTGCCTGCAACTCGCCGGGTG
CTGGAACGCGCAGGGCTGAGTATTCACGATATGGACGTGATTGAACTGAACGAAGCGTTC
GCGGCCCAGGCGTTGGGTGTACTACGCGAATTGGGGCTGCCTGATGATGCCCCACATGTT
AACCCCAACGGAGGCGCTATCGCCTTAGGCCATCCGTTGGGAATGAGTGGTGCCCGCCTG
GCACTGGCTGCCAGCCATGAGCTGCATCGGCGTAACGGTCGTTACGCATTGTGCACCATG
TGCATCGGTGTCGGTCAGGGCATCGCCATGATTCTGGAGCGTGTTTGAGCATATCAACCT
GCGAGTACCCTACAATGATAACCAATACAAAGCTTGACCCGATTGAAACCGCGTCTGTTG
ATGAGTTACAGGCGTTGCAAACACAGCGTCTGAAATGGACGCTCAAACACGCGTATGAAA
ATGTGCCGATGTATCGGCGCAAATTCGACGCAGCAGGCGTACATCCTGATGATTTCAGGG
AACTTTCAGACCTGCGTAAATTTCCCTGTACCACCAAACAGGATCTGCGCGACAACTATC
CCTTTGACACCTTTGCCGTGCCAATGGAACAAGTGGTGCGCATTCATGCTTCTTCGGGAA
CCACAGGTAAACCGACAGTTGTCGGCTATACGCAAAACGATATTGATAACTGGGCCAATA
TTGTAGCGCGTTCTTTGCGTGCGGCAGGGGGCTCGCCCAAAGACAAAATTCATGTTGCCT
ATGGTTACGGCCTGTTTACTGGTGGGCTGGGTGCGCACTATGGTGCCGAACGTCTGGGCG
CTACGGTGATCCCGATGTCTGGCGGGCAGACGGAAAAACAAGCGCAACTGATCCGTGATT
TTCAACCAGATATGATCATGGTTACGCCATCTTATTGCCTTAACCTGATTGAAGAGCTGG
AGCGGCAGTTGGGCGGTGATGCCAGCGGTTGCTCGCTGCGGGTTGGAGTATTTGGTGCTG
AGCCGTGGACACAGGCCATGCGTAAAGAGATTGAGCGTCGCCTGGGGATCACCGCACTGG
ATATTTATGGCCTGTCAGAAGTGATGGGGCCGGGGGTGGCGATGGAGTGTCTGGAAACTA
CCGACGGCCCAACCATTTGGGAAGATCATTTCTATCCTGAAATTGTTAATCCTCATGACG
GCACACCGCTTGCCGATGGTGAACATGGCGAACTGTTATTCACCACGCTGACCAAAGAAG
CATTGCCGGTCATTCGTTACCGCACGCGTGATTTAACCCGACTGTTACCAGGAACGGCGC
GGACTATGCGCCGCATGGATCGCATCAGCGGACGCAGCGATGACATGTTGATTATTCGCG
GTGTAAATGTCTTTCCGTCACAACTGGAAGAAGAGATTGTCAAATTCGAACATTTATCGC
CGCATTACCAACTGGAGGTGAACCGCCGGGGGCATCTTGATTCACTTTCTGTGAAAGTGG
AGTTGAAAGAAAGTAGCCTGACATTGACGCATGAGCAGCGTTGCCAGGTATGCCACCAGC
TGCGCCATCGGATTAAGTCGATGGTGGGGATCTCTACCGATGTGATGATCGTTAACTGTG
GCAGTATCCCGCGTTCAGAAGGCAAGGCGTGTCGGGTGTTTGATCTGCGCAATATTGTTG
GTGCCTGACGTATCGTCTGGCCCTGGTGGGGTAAAGCGCCAGGGCCAGAAGTCGATACGA
CCTGTGCTATGATTCATAAATCACAACAATAACAACAGACTGAAGCGAATGAGTAAACTT
GATACTTTTATCCAACATGCTGTAAACGCTGTTCCGGTCAGTGGCACATCTTTGATCTCC
TCTCTGTATGGTGATTCGCTTTCCCATCGTGGTGGTGAAATCTGGTTGGGTAGTCTGGCT
GCTTTGCTGGAAGGGCTGGGATTTGGTGAGCGTTTCGTGCGCACCGCTTTGTTTCGTCTT
AATAAAGAAGGCTGGCTGGATGTTTCCCGCATCGGGCGACGCAGTTTCTATAGCCTCAGT
GATAAAGGCTTGCGCCTGACGCGACGGGCAGAAAGTAAAATTTATCGCGCAGAGCAACCT
GCATGGGATGGTAAATGGCTCCTGTTGCTCTCGGAAGGTTTAGATAAATCAACGCTGGCT
GATGTCAAAAAGCAGTTGATCTGGCAAGGTTTTGGCGCACTGGCACCCAGCCTGATGGCA
TCGCCGTCGCAAAAACTGGCCGATGTACAGACACTTTTGCATGAAGCGGGTGTGGCGGAT
AACGTGATTTGTTTTGAAGCGCAAATACCACTGGCGCTTTCTCGCGCAGCACTGCGTGCC
AGAGTAGAAGAGTGCTGGCATTTAACTGAACAAAATGCCATGTACGAAACCTTTATTCAG
TCATTCCGCCCGCTGGTGCCGCTTTTAAAAGAGGCGGCAGACGAGTTAACCCCGGAGCGG
GCATTTCATATTCAGCTTTTACTGATCCATTTTTATCGCCGTGTCGTCCTTAAAGACCCA
TTGTTGCCGGAGGAGTTGCTTCCGGCACACTGGGCAGGGCATACGGCGCGTCAGCTGTGT
ATCAACATTTATCAGCGCGTAGCGCCTGCTGCTTTAGCGTTCGTTAGTGAAAAAGGTGAA
ACCTCGGTCGGTGAACTGCCTGCGCCGGGAAGCCTGTATTTTCAACGTTTTGGCGGCTTG
AATATTGAACAGGAGGCGTTATGCCAATTTATCAGATAGACGGTCTGACTCCGGTTGTGC
CAGAAGAGAGTTTTGTCCATCCGACAGCGGTATTGATCGGCGATGTTATTCTCGGCAAGG
GCGTTTACGTTGGGCCAAATGCCAGCCTGCGTGGCGATTTTGGTCGTATCGTGGTGAAAG
ATGGCGCGAACATTCAGGATAATTGCGTTATGCACGGTTTTCCCGAGCAGGATACTGTTG
TAGGAGAAGATGGACATATTGGTCATAGCGCTATCCTTCACGGCTGCATTATCCGCCGCA
ATGCATTAGTGGGAATGAACGCGGTAGTGATGGACGGTGCGGTGATTGGCGAGAACAGCA
TTGTTGGTGCATCCGCATTTGTGAAAGCCAAAGCAGAAATGCCAGCTAATTACCTGATTG
TCGGCAGCCCGGCGAAAGCGATTCGTGAACTCAGTGAGCAGGAGTTGGCATGGAAAAAGC
AGGGTACGCATGAGTACCAGGTGCTGGTGACACGCTGTAAGCAGACGTTACATCAAGTCG
AGCCATTGCGGGAAATTGAACCTGGCAGGAAACGCCTGGTATTTGATGAGAATCTGCGAC
CGAAACAGTAACAGATGTAAAATTATTTTGTCCCTTTAATTATAAAGCAGAGTTATGTTT
AAGCTCTGCTTTATTTATTTGAGTATTAATTCATACCGTTTTTTCATCATATAATTATTT
ATAATGAGAATGTGGTTTTAATTTGTAATTTATATTATATACACAATTTATATATTTCAT
GGTCTTTTTTTATTCACCTGAATTATAATTGTGAATTATAGGAAAGTATGTTTGATTAGA
TAATAATCTACTGGCAATATTGGATGTCTTCTATGTTTTAAATAACTAATTGGTCGGGTT
AGTGCATCCGGCTTTCTTTATATTCGCCAGAAGGATTTATTATGCAAAGGAAAACTCTAT
TGTCGGCCTGTATTGCATTAGCTCTGAGTGGTCAGGGTTGGGCGGCAGATATCACAGAGG
TAGAAACCACCACAGGTGAAAAGAAAAATACCAATGTGACTTGTCCGGCAGACCCAGGAA
AACTCAGTCCGGAAGAGCTTAAACGCTTACCCTCTGAATGCTCTCCTTTAGTCGAACAAA
ACCTGATGCCATGGCTTTCCACAGGCGCTGCTGCGTTAATCACGGCCTTAGCCGTAGTGG
AACTAAACGACGATGATGATCATCATCATCGCAACAATTCTCCACTCCCACCGACACCCC
CTGATGATGAATCAGACGACACTCCAGTTCCCCCAACTCCTGGCGGAGATGAGATAATAC
CGGACGATCCGGATGATACGCCTACACCTCCCAAACCGGTTTCGTTTAATAATGACGTTA
TTCTCGATAAAACAGAAAAAACGTTAACTATTCGCGATTCAGTTTTTACTTATACCGAGA
ATGCTGACGGGACTATATCTCTGCAAGATAGCAATGGTCGTAAGGCAACGATTAATCTTT
GGCAGATTGATGAAGCGAATAACACTGTTGCCCTTGAAGGGGTGAGCGCAGATGGCGCAA
CGAAGTGGCAATATAATCACAACGGTGAGCTTGTTATTACGGGTGATAATGCCACAGTAA
ACAACAATGGCAAAACCACCGTTGACGGTAAAGATTCCACCGGTACGGAAATCAACGGTA
ATAACGGGAAAGTGATTCAGGACGGCGATCTGGATGTCAGCGGCGGCGGTCACGGTATTG
ATATCACCGGTGACAGCGCGACGGTGGATAACAAGGGCACCATGACCGTCACCGATCCGG
AGTCCATGGGTATCCAGATCGACGGTGACAAGGCCATCGTCAATAACGAAGGCGAGAGCA
CCATCACCAACGGTGGCACCGGCACCCAGATTAATGGTGATGACGCCACGGCAAACAACA
ACGGCAAAACCACCGTTGACGGCAAGGATTCCACCGGTACGGAAATCAACGGTAATAACG
GAAAAGTTATTCAGGACGGCGATCTGGATGTCAGCGGCGGCGGTCACGGTATTGATATCA
CCGGCGACAGCGCAACGGTGGATAACAAGGGCACCATGACCGTCACCGATCCGGAGTCCA
TCGGTATCCAGGTTGACGGCGACCAGGCGGTTGTTAACAACGAAGGCGAGAGCGCCATCA
CCAACGGTGGCACCGGCACGCAGATTAACGGTGATGACGCCACGGCAAACAACAACGGCA
AAACCACCGTTGACGGCAAGGATTCCACCGGTACGGAAATTGCTGGCAATAACGGGAAGG
TGATTCAGGACGGCGATCTGGATGTCAGCGGCGGCGGTCACGGTATTGATATCACCGGCG
ACAGCGCAACGGTGGATAACAAGGGCACCATGACCGTCACCGATCCGGAGTCCATCGGTA
TCCAGATTGACGGCGACCAGGCCATCGTCAATAACGAAGGCGAGAGCACTATCACCAATG
GCGGCACCGGCACTCAGATCAACGGTAACGACGCCACCGCGAATAACAGTGGAAAAACCA
CTGTTGATGGAAAAGATTCCACGGGTACCAAAATCGCGGGCAATATCGGCATTGTAAATC
TGGATGGTAGCCTGACTGTTACAGGCGGTGCGCATGGTGTTGAGAACATTGGTGACAACG
GCACGGTTAACAACAAAGGAGATATTGTTGTTTCCGATACTGGATCGATTGGCGTGCTCA
TCAACGGTGAGGGGGCAACAGTATCCAATACGGGTGATGTTAACGTTAGCAATGAAGCGA
CAGGGTTCAGCATCACAACCAACAGTGGGAAGGTTTCGCTGGCAGGCAGTATGCAGGTTG
GCGATTTCTCGACCGGGGTAGATCTTAATGGCAACAATAACAGCGTGACGCTGGCGGCAA
AAGATCTAAAAGTGGTCGGGCAGAAAGCGACGGGCATAAACGTTTCTGGCGATGCGAATA
CAGTGAATATCACTGGTAACGTTCTGGTTGATAAGGATAAAACCGCAGACAATGCGGCGG
AATATTTCTTCGATCCATCCGTGGGTATCAACGTTTACGGCAGTGATAATAACGTGACGC
TGGATGGAAAGTTAACTGTTGTATCAGACAGTGAGGTTACTTCTCGTCAGAGTAATTTAT
TTGATGGCAGCGCAGAGAAAACGTCAGGTCTGGTTGTGATTGGCGATGGCAATACCGTTA
ATATGAATGGTGGACTTGAACTGATTGGAGAGAAAAACGCGCTTGCAGATGGGTCGCAGG
TTACTTCCTTGCGCACAGGATATAGTTATACCAGCGTTATTGTCGTTAGTGGTGAGTCGT
CGGTATATCTGAATGGAGATACGACAATCAGCGGAGAATTCCCTCTGGGGTTTGCCGGGG
TTATTCGGGTACAGGATAAAGCTTTGCTGGAAATTGGCAGTGGCGCTACGCTAACAATGC
AGGATATTGACAGTTTTGAACATCATGGGACAAGAACCCTGGATTTGCCCCTATATTTCC
AGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAG
CGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGG
TTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATC
GTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTC
GGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCA
TTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACC
GCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCCCAG
TGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTTA
TCACAGCAGAACTCGAACCCGTCAGAGCACCATCGCTGATTGCTTTCTTTCACGGCCACT
CTGCCTGTATGTGCCCGTTTCGATGGCGGTACAGCAGGTTTTCGCTCAAGCAACAGCGCA
TTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGTTCT
GCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTTGGCAGCTCTCCGATA
ACATGGTGTATACGGAGAAGCACATCCGTATCATCAGTGTGACGACTGCGGCGGCCATCC
ATCCAGTCATCGGTTCGTCTGAGAATGACGTGCAACTGCGCACGCGACACCCGGAGACAA
CGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTT
TTGCCCGTCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGCCGA
GCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCGGCAGCAAGTTCAGAGGCAGGAACAA
CCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGCTTACGCCAGAGAA
ATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCGGTT
CAAAGCTCTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCTCCG
GCCCTAAGACATCAATCATCTGTTCTCCAATGACTAGTCTAAAAACTAGTATTAAGACTA
TCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTAAACCCCAGAA
CTTACTTATGCTGATTCCGGTGCGAAAATTGTTAATAAAGGTACTTGTAGATTCAATTGG
TCAACGCAACAGTTATGTGAAAACATGGGGTTGCGGAGGTTTTTTGAATGAGACGAACAT
TTACAGCAGAGGAAAAAGCCTCTGTTTTTGAACTATGGAAGAACGGAACAGGCTTCAGTG
AAATAGCGAATATCCTGGGTTCAAAACCCGGAACGATCTTCACTATGTTAAGGGATACTG
GCGGCATAAAACCCCATGAGCGTAAGCGGGCTGTAGCTCACCTGACACTGTCTGAGCGCG
AGGAGATACGAGCTGGTTTGTCAGCCAAAATGAGCATTCGTGCGATAGCTACTGCGCTGA
ATCGCAGTCCTTCGACGATCTCACGTGAAGTTCAGCGTAATCGGGGCAGACGCTATTACA
AAGCTGTTGATGCTAATAACCGAGCCAACAGAATGGCGAAAAGGCCAAAACCGTGCTTAC
TGGATCAAAATTTACCATTGCGAAAGCTTGTTCTGGAAAAGCTGGAGATGAAATGGTCTC
CAGAGCAAATATCAGGATGGTTAAGGCGAACAAAACCACGTCAAAAAACGCTGCGAATAT
CACCTGAGACAATTTATAAAACGCTGTACTTTCGTAGCCGTGAAGCGCTACACCACCTGA
ATATACAGCATCTGCGACGGTCGCATAGCCTTCGCCATGGCAGGCGTCATACCCGCAAAG
GCGAAAGAGGTACGATTAACATAGTGAACGGAACACCAATTCACGAACGTTCCCGAAATA
TCGATAACAGACGCTCTCTAGGGCATTGGGAGGGCGATTTAGTCTCAGGTACAAAAAACT
CTCATATAGCCACACTTGTAGACCGAAAATCACGTTATACGATCATCCTTAGACTCAGGG
GCAAAGATTCTGTCTCAGTAAATCAGGCTCTTACCGACAAATTCCTGAGTTTACCGTCAG
AACTCAGAAAATCACTGACATGGGACAGAGGAATGGAACTGGCCAGACATCTAGAATTTA
CTGTCAGCACCGGCGTTAAAGTTTACTTCTGCGATCCTCAGAGTCCTTGGCAGCGGGGAA
CAAATGAGAACACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCC
AATATACTCAACATGAACTAGATCTGGTTGCTGCTCAGCTAAACAACAGACCGAGAAAGA
CACTGAAGTTCAAAACACCGAAAGAGATAATTGAAAGGGGTGTTGCATTGACAGATTGAA
TCTACACTGTTGAAATTCAGAATTTAGGTTTTGCTTTTGTTACTGGTGAAAATACAACAG
GTATAAATAGTGGCACGATCTCGTTATTACAAAATGGTAAAGATCCGGCACCGTCTCCCA
TTGTTTTACTGGCTACTAACGGAGGGAGCGCCACTAATGCAGGTACGATCACAGGTAAAG
TGACGGAACAACATAGCGTATTTAACAAGTATTCAACGGGCACATCGAATTCATTTATTT
TTAATAACGATGTCAGTAGCATAACAGGGTTAGTCGCTCAATCGAATAGCACAATTATCA
ATACTGACAGCGGCATCATTGATTTGTATGGTCGTGGTAGTGTCGGCATGCTTGCTATAG
CAGATTCAACAGCAGAAAATCAGGGTAAAATTACACTGGATTCTATGTGGGTAGATGCAA
ATGACACTACCGCAATGCGAGATATAGCTAGCAACAGCGCCATTGACTTCGGTACAGGTG
TGGGAGTTGGTACTGATAGTTATAGTGGTGCAGGGAAAAATGCAACAGCAATTAACCAAT
TGGGCGGTGTTATAACTATTTATAACGCCGGCGCAGGTATGGCGGCCTATGGCGCCAGCA
ATACAGTTATTAACCAGGGGACGATTAACCTCGAAAAAAATGGTAATTATGACGATAGTC
TGGCAGCAAATACTCTGGTAGGGATGGCTGTTTATGAGCATGGTACTGCTATCAACGACC
AGACGGGTGTTATCAATATCAATGTTGGTACTGGTCAGGCGTTTTATAACGATGGCACAG
GAACAATTGTTAACTATGGTACAATCTGCACTTTCGGCGTGTGCCAATCGGGGAATGAGT
ACAATAATACAGATGATTTCACCTCACTGATCTATACCGGTGGCGATACGATTACACGAA
GCGGAGAAACTGTAACGCTAAATAAATCTGCTGCTGTGACTGATAAGCTGGCTGGGAATG
TTGTTAATAGCGGAACGCTTTCCGGTGATCAAATTACGGTATCAAGCGGTCTTCTGGAAA
ATACCAGCGGTGGCATCATCAATAACTTAGTAAAACTTGACAAGGGTGCCGTCATTAAAA
ATGCCGGGGTGATGACGAATAACGTCGATGTTAGCGGTGGAATCCTCAATAATGCCGGAG
AAATGACTGCGCAAATTACCATGAATGCTGGTGCTGATAGTTCGTTAGTGAACAACACCG
GAACCATCAATAAAATCGTGCAGAACGCGGGGGTATTCAATAATAGTGGCAGTGTAACAG
GGCGGATGATGTCGGCTGGCGGGGTCTTTAATAATCAAACTGACGGGGCGATTATGAGAG
GTGCTGCGCTGACAGGTACTGCAGTGGCAAATAACGAAGGAACCTGGAACCTCGGAAGTA
GTAGTGAGGGTAACAACACCGGGATGCTGGAAGTTAATAATAATTCAGCTTTCAATAACC
GCGGCGAGTTTATTCTTGATAACGACAAGAATGCTGTGCACATCAACCAGTCCGGTACGC
TTTATAATACCGGTCACATGAACATCAGTAATTCTTCCCACAACGGAGCCGTTAATATGT
GGGGCGGAAATGGTCGTTTTATCAATGACGGAACGATTGATGTTTCTGCGAAGTCACTGG
TAGTCAGCGCTAATAATGCCGGCGATCAGAATGCCTTCTTCTGGAACCAGGATAACGGGG
TCATCAACTTCGATCACGACAGCGCCAGTGCCGTGAAAGTCACCCACAGCAACTTTATTG
CCCAGAATGACGGCATCATGAACATCAGCGGCACCGGTGCTGTGGCTATGGAAGGTGATA
AGAACGCGCAGCTGGTTAACAATGGCACCATCAACCTCGGTACCGCAGGCACTACTGACA
CGGGTATGATCGGTATGCAACTCGATGCCAACGCCACGGCGGATGCGGTAATCGAAAACA
ACGGCACCATCAATATCTTCGCCAATGACTCGTTTGCATTTAGCGTACTGGGTACAGTAG
GTCATGTGGTTAACAACGGCACGGTGGTGATTGCCGATGGGGTTACGGGTTCTGGACTGA
TCAAGCAGGGCGACAGCATCAATGTTGAAGGTATGAACGGTAACAACGGTAATAGCAGCG
AAGTGCATTATGGCGACTATACGTTGCCGGATGTGCCGAAGCCCAATACGGTTAGTGTAA
CGTCGGGAAGTGATGAGGCTGGTGGCAGCATGAACAACCTCAACGGCTATGTCGTCGGTA
CCAACGTTAACGGCAGCGCCGGGAAGCTGAAGGTTAACAATGCCAGCATGAACGGCGTGG
AGATTAACACGGGCTTTACCGCTGGTACGGCAGACACCACTGTGAGTTTTGATAACGTAG
TGGAAGGTAGCAACCTGACCGACGCTGACGCCATCACCTCAACGTCCGTGGTATGGACTG
CCAAAGGCAGCACCGATGCCAGCGGTAACGTTGACGTCACCATGAGCAAAAATGCCTACA
CCGATGTGGCAACAGATGCCTCGGTGAATGACATCGCGAAAGCACTGGATGCGGGTTACA
CCAACAACGAACTGTTTACCAGCCTGAACGTCGGCACGACTGCTGAACTGAACAGTGCTC
TGAAACAGGTCAGCGGTAGCCAGGCGACCACGGTATTCCGCGAAGCGCGCGTGTTAAGCA
ACCGCTTTAGTATGCTGGCAGATGCCGCGCCGAAAGTGGGTAACGGTCTGGCGTTCAACG
TTGTCGCGAAAGGCGATCCGCGTGCCGAGTTAGGTAATAATACCGAATACGACATGCTGG
CATTGCGTAAAACTATCGACCTGAGCGAAAGCCAGACGATGAGTCTGGAGTACGGTATCG
CTCGTCTCGATGGTGATGGTGCGCAGAAAGCGGGTGATAATGGCGTTACAGGCGGTTATA
GCCAGTTTTTTGGCCTGAAACATCAGATGTCGTTCGATAACGGCATGAACTGGAATAACG
CCTTGCGTTACGACGTTCACAACCTTGACAGCAGCCGCTCGATTGCATTTGGCAACACGA
ACAAAACGGCTGATACCGACGTGAAACAGCAGTACCTGGAGTTCCGCAGCGAAGGGGCGA
AGACTTTCGAACCGAGCGAAGGACTGAAGGTTACGCCATATGCGGGTGTAAAACTGCGTC
ACACACTGGAAGGTGGCTATCAGGAGCGCAATGCCGGAGACTTTAACCTGAATATGAACA
GTGGCAGCGAAACGGCGGTGGACAGCATCGTCGGGCTGAAACTGGACTACGCAGGTAAAG
ACGGCTGGAGCGCTAGCGCTACGCTGGAAGGCGGGCCGAACCTGAGCTACGCGAAGAGCC
AGCGTACGGCAAGCCTGGCAGGCGCAGGCAGTCAGCACTTTAACGTCGATGACGGTCAGA
AGGGCGGCGGCATCAATAGCCTGACAAGCGTCGGCGTGAAGTACAGCAGCAAAGAAAGTT
CGCTGAATCTGGATGCGTACAACTGGAAAGAGGATGGCATCAGCGATAAAGGCGTGATGC
TGAACTTCAAGAAAACGTTCTAATTTTTAGCATGTGATCCCTAAACCGCAACGCTGATAC
AGGTTGCGGTTTTTTTATTGCCGGATGTGGTACGTGACGCGTTTTGTTTTGTGTCTTTCA
GGACAATAGAGCAACTCATCCAGTAATCTTGTTTACACCTTCGCATTATTTATCTCTTTT
CGTTTCTATACTGATTTTTCTTAATCCGTTTTATTACAGGGCAGGGTGCGATGAGCAGCA
ATACATTTACTCTCGGTACAAAATCCGTTAACCGTCTTGGTTATGGCGCGATGCAACTGG
CAGGTCCTGGAGTTTTTGGCCCCCCACGAGATCGCCACGTCGCTATAACCGTGCTGCGTG
AGGCGCTGGCATTGGGCGTCAATCATATTGATACCAGCGACTTTTATGGTCCGCACGTCA
CCAATCAGATTATCCGCGAAGCGCTTTATCCTTACTCTGACGACCTGACAATTGTCACTA
AAATTGGTGCGCGGCGTGGAGAGGACGCATCCTGGTTGCCCGCATTTTCTCCGGCAGAGC
TGCAAAAAGCGGTGCACGATAATCTACGTAATCTCGGGCTGGACGTGCTGGATGTGGTTA
ACCTGCGCGTTATGATGGGGGATGGTCATGGCCCAGCGGAAGGATCGATTGAGGCCAGCC
TGACCGTGCTGGCAGAGATGCAACAACAAGGCCTGGTAAAACATATTGGCCTGAGCAACG
TCACACCGACGCAGGTTGCAGAGGCGCGCAAGATTGCCGAAATTGTCTGTGTGCAAAACG
AATACAACATCGCGCACCGTGCTGATGATGCAATGATTGATGCTTTGGCCCACGATGGCA
TTGCCTACGTGCCGTTCTTCCCGCTCGGGGGCTTTACACCGCTGCAATCGTCCACACTTT
CCGATGTTGCTGCGAGCCTGGGTGCAACACCAATGCAGGTGGCGCTGGCGTGGCTGTTAC
AGCGTTCACCGAATATTTTGCTGATCCCAGGGACGTCTTCGGTTGCGCATTTACGGGAGA
ATATGGCTGCTGAAAAATTGCATCTTTCTGAGGAAGTGTTGTCTACGTTGGATGGTATTT
CGCGAGAATAACGAATATACAAAAGGGAAAGATGCATTTCCCTTTTTTTCTTTTTTAATG
GCATGGAGTGCATATGTTGAAGGCCAGGAATTGCGGCTGGATACGTTTACTGCCCCTGTT
TATGCTGAGTCTACCAGTACAGGCGGAACTTCGATGTGTTGCAAATGCAGTTGATATTGA
ATCATTTTTTTCTGCGGCTACCGCTGAAGATAAACAACAAGTTGAACAAGCTATCAACAG
TAGCGTGAATCTTGTCCCCTTCGGTTTATCTGCATCGAACTGGAAAGTGCATCGTGGCGA
TTTAGTGGTAGAAGGTAATATAGAGAGTAATCAAAAATTGATTGTTCTTGGGAATTTGAC
AGTCAAAGGTAATATTTCCACTTTCTCTCTTTCTAATCCATGGGTTATTCTCGGTAACGT
GACGGCAACGAATATAGTTGCGGATTCACCACTGTTAATTACCGGTTCGATAAATGCAAG
TGGACTGGTATTTATCGACTCATATTACGATAATCCGTCTACGATTAAGGGGAGTATTAA
TGCGCGTGGGATATTTATCAATGACATAATTGCACCTGTTGTTGCGTCTTCGACAAATAG
TGAATTCATGGTCCGTGCGAGTGACAAACATGACACTGAAAATGTCAAAAAAGCGCTGAT
GATAATAAATCCTGATGCATATTATTGGGGGCTAATTAATGATGAAGATGCTCTGAAAGA
AATTTTTAAGCGAAGCAATATTCGCATGGCAGGGAATGTCTGTAATCAGATGAAAAAAGA
AGCGCTGTTTCGCCCTAAGCCTTCTCCTGAGTTAGTGCAAGAATTGCAAATGCTGGATGA
AGGCAAAGTTGCTGCATTTGAAGGACGAGACATTGCGACATTTGATCTTGCCGTAATGCG
AACTCTCCCAAGGCTTAAAGGAATTTCAGCTAACCTACGCAAACAACTTATTAATAGCAA
TGATGAACAAACGATTGAAAGTATGGCGAGATATATGCCTGACAATGAGATTCTGGAGTT
GACCGATCAGCAATTGGGTTACCAGCCTGTTGTTCTGGGGTTGCTCGACCGTGAACCGCT
CTCTGTCGAAATAATGACGCGAATGAGTCGTCTACCTGATGGTGTCGGTCCGTTGAATCT
TGCGCTACGTGAAAATCTCCCTCTGGATATCGTCATGACTCTGGCGAAAAGAGATTGGGA
TATGATCATTCAGGAGCTTTATAAAGATGCGTGGTTATTGCCTGAATCCATTATTGATGG
CTATATCCGCAGTGATGATTCCTCTATTCGTCAGGTCGGTGCTGGAGGACAACTCACCTA
CAATCAGGCAATGCAGTTGGCGAACGATTCATCAAACAATGTTGTCACAAGCTTAGCGTT
CAAGCTGGCAGAGATGAAACACCATGGTCAATTGTTGCGGATGACGCCACAAGAGAGTGA
CAAAGTTGCAGGCTATTTATACCAAAAATTCGAGAATGACGATGATCTAATACGTGTGTT
ATTTTTAGCATTGCCAGATAACTTACAGTTTAATTTTGTTAAAAGGATGGAGAAAAAATC
CCCGGCCTACTTTTGCTGTCGGGATATGCAGGTAATTCACTCTGACGCTGCTTTACAACG
GTTATTGACACGTTTCAACGATCCTGAAGGGTGGAGTAATCTGGCGAAAAATCAGTATCT
GAGCACGTCGATGAAACAAAAAATTTGGCAACGTGCTTTATCGCATCGGAAAAATAATCC
GAAAGCAGATTCAGATGCATATGAAACCAGCGCTGATATGATTTTGTCTGAGCTGATTAG
CCACGGCGAAGTTGATGACCAGATGCTATTAAATGCCACCGCCCTGATACGTTCGGACGA
CTGGGACTTTTTAGAGAGTGCATTAATTAGTTGGGATAATTTACCCGCTGTTGTTCTCAA
GGAATTACAGCAAAACACGCCACGCAATGATATTTGGGCGAAGTTTTTTCTGAGGCAGGA
AAACAGTTCCCGTGCGCAGGTTGACGAAGCGTTACGTGTTTATTATGCACTAGACCCCGA
TGCGTTAGCACAACTGGATGTACTGGCAAAACAACCGGATCGTATATGGTGGAGTACACT
GGCGAAAAGCAATCTCACATTTTTCAAGTTCGGCGCACTTAACAACCGCCACACACCGCC
TGCAGTACTGGCGGCAGAAATTGATCCCGAGTGGTGGATTGTGGCGATGAATAATCCCCG
TTTTCCAGTTGATGTATTAAAGGCGAGGCTGAAACGTGATCCTTTGCTGGCGTTAGAGCT
TGTTAACCCTGAACTGGATTTAGTCCGCCAGCTGGCGCTTAACGGTAAGACGCGCGCAAT
ACGGGAACAAGCGATGAGAAAACTTGATGAGTTGTATTGATCCACAACGTAATGTTTTTT
AACTATCTGATTAATTGGGGATAATCATTCCTGACAGTGAGTCCCCAATACCTTGATATA
TTCTGAATTTTTAATGAAACGGCGTGTTGCGATATCTCCGTCAGGGGAATTGATGCACCA
TAGCGCAAACCGAATTATCAAGGATTGATAATGACGCTCTACCAGATAAAACCGCTCTTT
CAGTCGCTGTTAAGGCCGACGATGTTTTGGCTTTATAAGCACCACGTTACAGCGAATCAC
ATCACTCTTGCTGCACTGGCGCTTTCTCTTCTTACCGGATTGCTGTTGATGTTGGCGGCA
CAACCCATCCTCTTTTTGCTATTGCCCATCGTGCTTTTTATCCGTATGGCGCTCAATGCG
CTGGATGGCATGTTGGCGCGTGAGTGCAACCAGCAAACACGTCTGGGGGCGATTTTGAAT
GAGACTGGCGATGTTATTTCCGATATTGCGCTCTATTTACCATTTTTATTTTTACCGGAA
AGTAACGCATCACTCGTGATACTCATGTTATTTTGCACCATATTGACCGAGTTTTGCGGT
TTACTCGCGCAGACGATTAACGGTGTTCGCAGTTATGCCGGTCCATTTGGCAAAAGCGAT
CGCGCGTTAATATTTGGTCTGTGGGGTCTGGCCGTTGCCATTTATCCACAGTGGATGCAG
TGGAATAATCTTTTATGGAGCATTGCTTCAATTCTGCTTCTCTGGACTGCGATTAATCGT
TGTCGGAGTGTGCTTCTTATGAGCGCTGAAATATAATGCTGGAAAAATCTCTGGCAACAC
TTTTCGCGTTGTTAATTTTAGCAACGCTGATAAACCGTTTTCTGCTATGGCGGTTACCGG
AGAGAAAAGGGGGTGAGGTTACATTACGTATTCGTACCTGGTGGGGCATCGTCATTTGTT
TTTCAATGGTGATTTCAGGTCCACGCTGGATGACGTTGACGTTTTTTGCGCTGATAAGTT
TTCTGGCATTGAAAGAATATTGTACGCTTATATCTGTACATTTTCCGCGTTGGTTATATT
GGGGTATTCCTCTTAACTATTTGCTTATCGGTTTTAATTGCTTTGAGCTGTTTCTGTTAT
TTATACCTTTGGCTGGGTTTCTGATATTAGCCACCGGGCAAGTTTTAGTGGGTGACCCCT
CTGGTTTTCTGCATACCGTGAGCGCCATTTTTTGGGGCTGGATAATGACCGTTTTCGCCT
TGAGTCATGCCGCCTGGTTATTAATGTTGCCAACCACAAATATCCAGGGCGGGGCGTTAC
TGGTGTTATTTCTTTTGGCATTAACCGAGTCAAACGATATTGCACAGTATTTATGGGGAA
AATCCTGCGGCAGAAGAAAAGTGGTCCCTAAAGTCAGCCCGGGAAAAACATTGGAAGGTC
TGATGGGCGGCGTCATCACCATCATGATTGCGTCACTGATTATCGGACCGTTACTGACAC
CGCTAAATACATTACAGGCATTATTAGCGGGTTTGTTAATTGGTATTAGTGGTTTTTGCG
GCGATGTCGTGATGTCAGCCATCAAACGAGATATTGGTGTTAAAGATAGCGGAAAACTAT
TGCCAGGACATGGCGGACTCCTTGACAGGATTGACTCATTAATTTTCACCGCTCCGGTAT
TTTTTTATTTTATACGCTACTGCTGTTACTGAAGGAAAATAGAGAAAATGGAAAATTCAC
GCATCCCTGGGGAACATTTTTTTACCACCAGTGATAATACAGCGTTGTTTTATCGGCACT
GGCCCGCTTTACAGCCCGGGGCGAAAAAGGTCATCGTCTTATTTCATCGCGGGCATGAAC
ATTCTGGTCGTCTACAACATCTCGTTGATGAACTGGCGATGCCAGATACTGCTTTTTATG
CCTGGGATGCCCGAGGGCATGGAAAAAGTTCGGGGCCGCGTGGTTATAGCCCATCTCTTG
CGCGTTCAGTGCGGGATGTCGATGAATTTGTCCGTTTTGCTGCCAGCGACAGCCAGGTTG
GACTGGAAGAGGTGGTAGTGATCGCGCAAAGCGTCGGCGCAGTGCTGGTTGCCACATGGA
TTCATGATTATGCACCTGCAATTCGCGGGCTGGTGCTGGCTTCTCCGGCCTTTAAGGTTA
AATTGTATGTGCCGCTGGCACGTCCTGCGCTGGCGTTATGGCATCGTCTGCGTGGTCTGT
TTTTTATTAATTCCTATGTGAAAGGACGCTATTTGACCCACGATCGGCAACGGGGGGCGA
GTTTCAATAATGATCCGCTGATCACACGGGCGATTGCCGTTAATATCTTGCTCGATCTCT
ACAAAACGTCTGAACGTATTATTAGAGATGCGGCGGCGATTACGCTCCCCACGCAACTTC
TGATATCAGGCGATGACTATGTGGTGCATCGCCAACCGCAGATTGATTTTTATCAGAGAT
TACGTAGCCCTCTGAAAGAGCTGCATCTGCTGCCAGGCTTTTATCACGACACGTTGGGTG
AAGAGAACAGGGCGCTGGCATTTGAAAAAATGCAAAGCTTTATTAGTCGTTTATATGCTA
ACAAATCGCAAAAATTTGATTATCAGCATGAAGACTGCACAGGACCATCAGCGGATCGAT
GGCGGCTACTTTCTGGTGGACCCGTGCCATTATCGCCGGTTGATTTAGCGTATCGCTTTA
TGCGAAAGGCGATGAAATTGTTCGGGACGCACTCTTCGGGCCTGCATCTCGGAATGAGCA
CCGGCTTTGATTCAGGCAGTTCGCTGGATTATGTCTATCAAAATCAACCGCAAGGTAGTA
ACGCATTCGGGCGTTTAGTCGACAAAATCTACCTGAACAGTGTTGGCTGGCGCGGTATTC
GCCAGCGCAAAACCCATTTACAAATACTGATTAAACAAGCCGTTGCCGATCTCCACGCCA
AAGGTTTAGCCGTCCGCGTGGTTGACATTGCCGCAGGGCATGGGCGCTATGTACTGGATG
CGCTGGCAAACGAGCCTGCCGTAAGCGATATTTTGTTACGTGATTACAGCGAGTTAAATG
TTGCACAGGGGCAAGAGATGATTGCTCAACGGGGAATGTCTGGGCGGGTGCGTTTTGAAC
AGGGCGATGCGTTTAACCCGGAGGAACTCAGCGCGTTAACTCCGCGGCCTACGCTGGCGA
TTGTCTCTGGCCTGTATGAGCTTTTTCCCGAAAATGAGCAGGTAAAAAACTCACTCGCAG
GTCTTGCCAATGCCATCGAACCGGGCGGCATTCTCATCTACACCGGGCAGCCGTGGCACC
CTCAACTGGAGATGATTGCCGGGGTGTTAACCAGTCATAAAGATGGTAAACCGTGGGTAA
TGCGCGTGCGTTCGCAAGGGGAGATGGATTCACTCGTGCGTGATGCCGGATTTGATAAAT
GCACACAACGGATTGATGAGTGGGGTATTTTTACGGTTTCGATGGCGGTGCGTCGTGATA
ACTGAACGTCGGAACGTATTGCTACAAGGCGCTGGCTGGTTATTGTTGCTGGCCCCGTTT
TTCTTCTTCACCTATGGATCTCTTAATCAGTTCACCGCGGTTCAGGACCTTAACAGCCAT
GATATCCCCAGTCAGGTATTCGGTTGGGAAACGGCGATCCCTTTTCTTCCCTGGACTATT
GTTCCTTACTGGAGTCTGGATCTTTTATATGGATTTTCGCTGTTCGTTTGTAGCACGACA
TTCGAACAGCGCCGACTTGTCCACCGGCTTATTCTGGCAACGGTAATGGCCTGCTGCGGT
TTTTTGCTCTATCCGCTGAAGTTTAGTTTTATCCGTCCTGAAGTGAGTGGGGTGACGGGA
TGGCTATTTTCGCAACTTGAACTGTTTGATCTGCCTTATAACCAGTCTCCTTCGCTGCAT
ATTATTCTCTGCTGGCTACTTTGGCGTCACTTTCGTCAGCATCTGGCTGAGAGGTGGCGT
AAAGTCTGCGGCGGATGGTTTTTACTCATCGCCATTTCGACGCTGACGACCTGGCAGCAT
CATTTTATTGATGTCATCACAGGGCTGGCGGTAGGTATGTTGATTGACTGGATGGTGCCC
GTCGACCGTCGTTGGAATTATCAGAAACCTGATCAACGTCGAATCAAAATAGCACTGCCC
TATGTCGTAGGCGCGGGCTCGTGCATTGTATTGATGGAGCTAATGATGATGATTCAGTTA
TGGTGGTCAGTCTGGTTATGTTGGCCAGTATTATCGCTACTCATAATTGGCCGTGGGTAC
GGTGGGCTTGGCGCGATAACAACAGGGAAAGATAGTCAGGGGAAACTACCGCCCGCCGTT
TACTGGCTGACATTGCCCTGCCGCATCGGGATGTGGCTGTCTATGCGTTGGTTTTGTCGT
CGCCTGGAGCCGGTGAGCAAAATGACTGCTGGTGTTTATTTAGGGGCGTTTCCACGACAT
ATTCCGGCACAGAATGCGGTTCTGGACGTCACCTTTGAATTCCCTCGCGGACGAGCCACA
AAAGATCGACTCTATTTTTGTGTACCGATGCTGGATCTGGTGGTTCCGGAAGAGGGGGAG
CTCCGACAGGCCGTGGCGATGCTGGAAACATTACGCGAAGAGCAAGGCAGCGTTCTGGTC
CATTGTGCATTGGGATTATCGCGCAGTGCGCTGGTGGTGGCGGCATGGTTGTTATGTTAC
GGACACTGTAAAACCGTTAATGAAGCGATTAGCTATATTCGAGCCAGACGCCCGCAGATT
GTGCTGACAGACGAGCACAAAGCGATGCTGAGATTATGGGAAAACAGGTAAGTGGATTGA
GATGTGGACTGAATATCTACAGTCCACATCAAGACCGTGTCCGGTTATGCAGAAACAATG
CTGTCGATGGCTGCTTTTGCGTCAGACTGTGCTTTCGCTGCCATTTCCGGACCGTATGCG
ATCCCTTCGGCGAAGACAAATTTCACATCGGTAATGCCGATAAAGCCGAGGAACGTGGAC
AGATACGGCGTCACCAGGTCCGTTGGTCCATCTTTGTGGATCCCGCCGCGGCTGGTAATA
ACGATGGCTTTTTTACCCGTTACCAGACCTTCCGGACCGTTCTCGGTATAGCGGAAAGTA
ACGCCTGCGCGGGCAACCAGGTCAAAATAGTTTTTCAACTGAGTCGAGATGTTGAAGTTA
TACATCGGTGCCGCAATAACGATAACGTCGTGGGCTTTCAGCTCGGCAATCAACTCATCG
GAAAGTGCCAGAGCTTCCTGCTGACGCGGAGTCAGCGGCGCATCGCTCGGACGCAGAGCG
CCAACCAGTTCGCCATCCAGTACCGGAATCGGATTTGCAGCCAGGTCGCGAACGGTGATT
TCATCAGCGGAGTGCTTTTCGCGCCATTGTTCAACAAAATAATCGGACAACTGATTAGAC
TGAGAGTACCCTGCCAGGATGCTGGATTTAAGAACTAATACCTTGCTCATGGTGTTTCCT
TATAGATGTTTGAATGGGCGATGCCCCGTTGCTTGTTGACACTTTATTCACAATCCTGCC
ACAGAGATAGCGCAATAAATCGAAGCCTATGTTCGAATTTATTGAACAACGCATAGAAAG
CCGCGATGTGGTACTCTATATCTATCATTTAAAAGAAAATTAATCAGGCAGACTACTGCC
CACTAACGTTATGACAGAACAACAAAAATTGACCTTTACGGCCTTGCAGCAGCGGCTGGA
TTCGCTGATGCTGCGTGACAGACTGCGTTTTTCTCGCCGTCTGCACGGCGTGAAGAAGGT
TAAAAATCCTGATGCACAACAGGCCATTTTCCAGGAGATGGCGAAAGAGATTGACCAGGC
GGCAGGGAAAGTCCTGCTGCGTGAAGCGGCACGACCGGAAATTACTTATCCTGACAATTT
ACCGGTTAGTCAGAAAAAACAGGACATTCTCGAAGCGATTCGTGATCACCAGGTGGTGAT
CGTCGCCGGGGAAACGGGTTCTGGTAAAACGACTCAGTTACCGAAAATCTGTATGGAGCT
GGGGCGCGGGATTAAAGGACTGATCGGCCATACCCAGCCGCGTCGTCTGGCGGCAAGAAC
AGTGGCGAACCGTATTGCGGAAGAGCTGAAAACGGAGCCGGGCGGTTGCATCGGTTACAA
AGTGCGTTTCAGCGATCACGTAAGTGATAACACGATGGTCAAGCTGATGACCGACGGTAT
CCTGCTGGCGGAGATCCAGCAAGACCGCCTGCTGATGCAGTACGACACTATCATTATTGA
CGAAGCGCACGAACGCAGCCTGAATATCGATTTTTTGCTCGGCTATTTGAAAGAGTTGCT
GCCGCGGCGTCCTGACCTAAAAATCATTATCACTTCCGCGACTATCGACCCGGAACGCTT
TTCGCGCCACTTTAATAATGCGCCGATTATTGAAGTCTCCGGTCGGACCTATCCGGTGGA
AGTGCGCTATCGCCCGATTGTTGAAGAAGCCGATGACACCGAGCGCGATCAGTTGCAGGC
GATTTTTGACGCCGTAGACGAACTGAGTCAGGAAAGCCATGGCGACATTCTGATCTTTAT
GAGCGGCGAGCGGGAAATCCGCGATACCGCCGATGCGCTGAACAAGCTGAACTTACGCCA
TACCGAAATCTTGCCGCTTTATGCGCGGCTTTCGAACAGCGAACAAAATAGGGTATTCCA
GTCGCACAGCGGACGGCGCATTGTGCTGGCGACCAACGTCGCGGAAACGTCGCTGACCGT
ACCGGGGATTAAATACGTTATCGACCCCGGTACAGCGCGTATCAGCCGCTACAGCTATCG
CACCAAAGTGCAGCGTTTGCCGATTGAGCCGATTTCCCAGGCGTCTGCCAATCAGCGTAA
AGGCCGCTGTGGTCGTGTGTCCGAAGGGATCTGTATTCGTCTCTATTCCGAAGACGATTT
CCTCTCGCGCCCGGAGTTTACCGATCCGGAGATTCTGCGTACCAACCTGGCCTCGGTTAT
TTTGCAGATGACCGCGCTGGGGCTGGGCGATATCGCTGCGTTCCCGTTTGTCGAAGCACC
GGATAAACGCAATATCCAGGATGGCGTGCGTCTGCTCGAAGAGCTGGGCGCGATCACCAC
TGATGAACAGGCCAGCGCCTATAAACTGACGCCGCTCGGTCGCCAGCTCTCGCAGTTGCC
TGTCGACCCACGTCTGGCGCGTATGGTGCTGGAAGCGCAAAAACATGGCTGCGTGCGTGA
GGCGATGATTATCACGTCCGCGCTCTCCATTCAGGATCCGCGCGAACGTCCGATGGACAA
ACAGCAGGCATCGGACGAAAAACATCGTCGCTTCCACGACAAAGAGTCTGACTTTCTCGC
GTTTGTGAATCTGTGGAATTATCTTGGCGAGCAGCAAAAGGCGCTTTCTTCCAACGCCTT
CCGTCGCCTGTGTCGTACCGATTATCTCAACTATCTGCGCGTGCGCGAATGGCAGGATAT
CTACACCCAGTTGCGTCAGGTGGTGAAAGAACTTGGCATTCCGGTTAACAGCGAACCGGC
GGAGTATCGCGAAATTCACATTGCGTTGCTGACCGGTTTACTTTCCCATATCGGCATGAA
AGATGCCGATAAACAAGAATATACCGGCGCACGTAACGCGCGTTTCTCCATCTTCCCCGG
TTCTGGTTTATTCAAAAAACCGCCTAAATGGGTAATGGTGGCGGAACTGGTAGAAACCAG
CCGCCTGTGGGGGCGCATTGCTGCGCGTATCGACCCGGAATGGGTGGAGCCAGTTGCTCA
GCATTTGATTAAACGCACCTACAGCGAACCGCACTGGGAACGGGCGCAGGGCGCGGTGAT
GGCAACGGAAAAAGTCACTGTTTATGGTTTGCCGATTGTTGCCGCGCGCAAGGTCAACTA
CAGCCAGATCGATCCGGCGTTATGTCGTGAACTCTTTATTCGCCACGCGCTGGTGGAAGG
TGACTGGCAGACGCGTCACGCATTCTTCCGTGAAAACCTGAAACTACGGGCGGAAGTAGA
AGAGCTGGAACACAAATCACGTCGCCGCGATATTCTGGTTGATGACGAAACGTTGTTTGA
GTTCTACGACCAGCGCATCAGCCACGATGTAATCTCCGCTCGCCACTTCGACAGCTGGTG
GAAAAAAGTCAGCCGCGAAACGCCTGATTTGCTCAACTTTGAAAAAAGCATGTTGATCAA
AGAGGGCGCAGAAAAAATCAGCAAGCTGGATTACCCGAACTTCTGGCATCAGGGCAATCT
CAAGCTGCGTTTGAGCTATCAGTTTGAGCCCGGCGCGGATGCTGACGGTGTGACCGTACA
TATTCCGCTGCCGTTACTTAACCAGGTTGAGGAAAGCGGGTTTGAATGGCAGATCCCCGG
TCTGCGCCGCGAACTGGTGATTGCTCTGATTAAATCGTTGCCGAAACCGGTACGCCGTAA
TTTTGTACCCGCGCCAAACTATGCCGAAGCGTTTTTAGGCCGCGTCAAACCGCTGGAGTT
ACCGTTGCTCGACAGCCTTGAGCGCGAGTTACGGCGGATGACCGGCGTTACCGTTGACCG
CGAAGACTGGCACTGGGATCAGGTGCCCGATCACCTGAAAATTACCTTCCGCGTGGTGGA
TGACAAAAACAAGAAGCTAAAAGAAGGGCGCTCGCTACAAGATCTGAAAGATGCGCTGAA
AGGCAAAGTGCAGGAAACGCTATCTGCGGTGGCGGATGACGGTATCGAGCAGAGCGGCTT
ACATATCTGGAGTTTTGGTCAGCTGCCGGAAAGCTACGAACAGAAGCGTGGCAACTACAA
AGTGAAGGCGTGGCCGGCGCTGGTGGATGAGCGCGACAGTGTGGCGATCAAACTGTTTGA
TAACCCGCTGGAGCAAAAGCAGGCAATGTGGAACGGTCTTCGCCGTCTACTGCTGCTGAA
TATTCCATCGCCAATCAAATATTTACATGAAAAGTTACCGAACAAAGCCAAGCTGGGACT
GTACTTTAACCCGTATGGCAAAGTGCTGGAGCTGATCGACGACTGTATCTCCTGCGGTGT
GGATAAATTGATCGACGCCAATGGTGGCCCGGTCTGGACGGAAGAAGGCTTTGCTGCGCT
GCATGAAAAAGTGCGTGCCGAACTGAACGACACGGTGGTGGATATTGCGAAGCAGGTCGA
GCAAATCCTTACGGCAGTGTTCAATATCAACAAACGTCTGAAAGGGCGGGTGGATATGAC
CATGGCGCTGGGGCTTTCTGACATTAAAGCGCAGATGGGCGGGTTGGTATATCGCGGTTT
TGTCACTGGTAACGGCTTCAAACGGCTGGGCGACACGCTGCGATATTTGCAGGCGATTGA
AAAACGGCTGGAAAAACTGGCGGTTGATCCACATCGCGACCGTGCGCAGATGCTGAAAGT
CGAAAACGTCCAGCAGGCGTGGCAGCAATGGATCAACAAACTGCCGCCCGCACGTCGTGA
GGATGAAGACGTGAAAGAGATCCGTTGGATGATAGAAGAGTTGCGCGTTAGTTACTTCGC
TCAACAACTTGGTACGCCTTATCCGATTTCAGATAAGCGTATTTTGCAGGCGATGGAGCA
GATTAGCGGTTAACCCTGCTATTTGCCTGATAAAGAAAAAACCCGGTAAGCATTTAGCGC
CGGGTTTTTTATTAATTCTAAAACGGTAAGGGTAAAAATTCAGGAATTCAGAAAAATACA
ATTCTCTGCTGCAAGATGAATAATGTTTATCTACAGCATTTCCTTAAAAGATATGTCAGG
CTTGCGGAGTGGCGGTTAAGGACATACGATTTCCTCCTTTCAGAGTGCTCCGCTTCTCAC
TATTATCTCACGCAGTATTCTTAAGGGAACGATAAGGAGGAACCATGAACATTACCCCGT
TTCCGACGCTTTCGCCGGCAACTATAGATGCCATAAATGTTATCGGACAGTGGCTGGCGC
AGGATGATTTCTCCGGTGAGGTGCCGTATCAGGCCGATTGCGTGATCCTTGCAGGCAATG
CGGTTATGCCGACTATCGATGCGGCATGTAAGATTGCCCGCGATCAGCAAATTCCTTTAC
TGATTAGTGGTGGTATCGGTCACTCGACAACTTTTTTGTATAGCGCCATCGCACAGCATC
CGCACTACAACACTATCCGCACCACTGGCAGAGCAGAAGCGACCATCCTGGCGGATATCG
CTCATCAGTTCTGGCACATTCCGCATGAAAAAATCTGGATTGAAGACCAGTCAACAAACT
GCGGTGAAAACGCACGCTTTAGCATCGCGCTATTGAATCAGGCCGTAGAACGAGTTCATA
CGGCTATCGTTGTTCAGGACCCCACCATGCAGCGGCGCACGATGGCGACGTTCCGCCGTA
TGACTGGGGACAATCCCGATGCACCACGCTGGTTAAGTTATCCCGGATTCGTTCCTCAGT
TAGGAAATAACGCAGACAGTGTAATCTTTATTAATCAGTTACAAGGATTATGGCCAGTTG
AGCGTTATCTCTCACTACTCACTGGCGAGCTGCCGCGTTTACGCGATGATAGCGATGGCT
ACGGTCCCCGCGGGCGAGATTTTATCGTTCACGTTGATTTTCCGGCAGAAGTCATCCATG
CATGGCAAACGCTGAAACATGATGCGGTGCTCATCGAGGCGATGGAAAGTCGCTCGTTAC
GTTAAAAATTGCCCGTTTGTGAACCACTTGTTTGCAAACGGGCATGACTCCTGACTTTTA
TTTCTGCCTTTTATTCCTTTTACACTTGTTTTTATGAAGCCCTTCACAGAATTGTCCTTT
CACGATTCCGTCTCTCTGATGATTGATGTTAATTAACAATGTATTCACCGAAAACAAACA
TATAAATCACAGGAGTCGCCCATGTCAGTACCCGTTCAACATCCTATGTATATCGATGGA
CAGTTTGTTACCTGGCGTGGAGACGCATGGATTGATGTGGTAAACCCTGCTACAGAGGCT
GTCATTTCCCGCATACCCGATGGTCAGGCCGAGGATGCCCGTAAGGCAATCGATGCAGCA
GAACGTGCACAACCAGAATGGGAAGCGTTGCCTGCTATTGAACGCGCCAGTTGGTTGCGC
AAAATCTCCGCCGGGATCCGCGAACGCGCCAGTGAAATCAGTGCGCTGATTGTTGAAGAA
GGGGGCAAGATCCAGCAGCTGGCTGAAGTCGAAGTGGCTTTTACTGCCGACTATATCGAT
TACATGGCGGAGTGGGCACGGCGTTACGAGGGCGAGATTATTCAAAGCGATCGTCCAGGA
GAAAATATTCTTTTGTTTAAACGTGCGCTTGGTGTGACTACCGGCATTCTGCCGTGGAAC
TTCCCGTTCTTCCTCATTGCCCGCAAAATGGCTCCCGCTCTTTTGACCGGTAATACCATC
GTCATTAAACCTAGTGAATTTACGCCAAACAATGCGATTGCATTCGCCAAAATCGTCGAT
GAAATAGGCCTTCCGCGCGGCGTGTTTAACCTTGTACTGGGGCGTGGTGAAACCGTTGGG
CAAGAACTGGCGGGTAACCCAAAGGTCGCAATGGTCAGTATGACAGGCAGCGTCTCTGCA
GGTGAGAAGATCATGGCGACTGCGGCGAAAAACATCACCAAAGTGTGTCTGGAATTGGGG
GGTAAAGCACCAGCTATCGTAATGGACGATGCCGATCTTGAACTGGCAGTCAAAGCCATC
GTTGATTCACGCGTCATTAATAGTGGGCAAGTGTGTAACTGTGCAGAACGTGTTTATGTA
CAGAAAGGCATTTATGATCAGTTCGTCAATCGGCTGGGTGAAGCGATGCAGGCGGTTCAA
TTTGGTAACCCCGCTGAACGCAACGACATTGCGATGGGGCCGTTGATTAACGCCGCGGCG
CTGGAAAGGGTCGAGCAAAAAGTGGCGCGCGCAGTAGAAGAAGGGGCGAGAGTGGCGTTC
GGTGGCAAAGCGGTAGAGGGGAAAGGATATTATTATCCGCCGACATTGCTGCTGGATGTT
CGCCAGGAAATGTCGATTATGCATGAGGAAACCTTTGGCCCGGTGCTGCCAGTTGTCGCA
TTTGACACGCTGGAAGATGCTATCTCAATGGCTAATGACAGTGATTACGGCCTGACCTCA
TCAATCTATACCCAAAATCTGAACGTCGCGATGAAAGCCATTAAAGGGCTGAAGTTTGGT
GAAACTTACATCAACCGTGAAAACTTCGAAGCTATGCAAGGCTTCCACGCCGGATGGCGT
AAATCCGGTATTGGCGGCGCAGATGGTAAACATGGCTTGCATGAATATCTGCAGACCCAG
GTGGTTTATTTACAGTCTTAATGAGTGAAAGAGGCGGAGGTTTTTTCCTCCGCCTGTGCG
CGTCAGAGTTTAGCGAATTTTTCGAGGGTGCGAATAAGCTGTGTGACGAAGCCATATTCG
TTATCGTACCAGGCGACCGTTTTCACCAGTTGTAAATCGCCCACGGCGGTAATTTCCGTT
TGCGTGGCATCAAACACCGAACCGAAATGGCTGCCAATGATATCGGAAGAGACTATTTCT
TCATCGGTATAACCAAATGACTCGTTATTGGTGGTTGCTTGTTTAAGTGCGTTATTCACC
TCTTCGGCAGTCACTTTTTTCCGAGAATCGATACCAGTTCAGTGACCGAACCTGTTTTCA
CCGGCACGCGTTGCGCATGACCTTTCAGTTTGCCGCTCAGTTCCGGGATCACCAGACCAA
TGGCTTTTGCCGCCCCCGTAGTGTGGGGAATGATATTTTCTGCCGCTGCGCGTGAAGCAC
GTAAATCTTTACCACGCGGGCCATCCACCAGTGACTGGGTGCCAGTATAGGCATGAATGG
TCGTCATCGTGCCGACTTCTATCCCGAAACTGTCATGCAAGGCTTTGGCCATCGGCGCAA
GACAGTTAGTGGTGCATGACGCCACGGAAACAATGGTGTCGTTGCCATCCAGAGTGTCGT
CATTGACGTTATAAACGATAGTTTTCATTTCACCGGCAGGGGCGGAAATCAACACCTTCT
TCGCACCAGCATCAAGATGCGCCTGCGATTTCTCGGCGGAGGTATAAAAGCCAGTACATT
CGACAATGATTTCTGCACCTTTCGCTTTCCACGGAATATTTTTAGCCTCTTTTTCGGCGT
AAACCGCGATACTTTTCCCATCAACGATAAGTGAATCTTCCGTAAAATCAACGCTCCAGG
GGAATGGTCCGTAGTTTGAATCATGTTTCAGCAGGTAGGCGAGAATTTATGGGGAAGTGA
GATCATTAATAGCGACAACGTCTATGTTGCTTTTGACTTCAAGTAATCGACCCAACACCA
GTCGACCGATACGACCAAAACCGTTAATACCAACTTTACTCATGGTTTTCTCCTGTCAGG
AACGTTCGGATGAAAATTGATCCTTTCCAAGCTTAGACCAGGATGGCGGGATGGGCAATC
TCCATTCTCACAGTGAAACGTAACGTACTGAAAACGGGTGAACAATATTTAATGAAATTT
TGAGAAAAGCCCGTTATGTTAACGGAAAATTATGTTAAAGCAGGAAATGTTATGGAAAAT
AAATATTCAAGGTTACAAATCAGCATTCACTGGCTGGTCTTTTTACTGGTTATCGCAGCG
TATTGCGCAATGGAGTTTCGTGGTTTCTTCCCACGTAGCGATCGGCCACTCATCAACATG
ATTCATGTTTCCTGTGGCATCTCAATTCTCGTGCTGATGGTCGTTCGTCTTTTGTTAAGG
CTGAAATACCCAACCCCGCCGATTATACCTAAGCCAAAACCGATGATGACGGGACTGGCG
CATTTGGGACATTTGGTGATTTATCTCCTGTTTATTGCGCTGCCAGTGATTGGTTTGGTG
ATGATGTATAACCGGGGCAACCCGTGGTTTGCGTTTGGTTTGACGATGCCTTACGCTTCA
GAGGCCAATTTCGAACGGGTAGATAGCTTAAAGTCGTGGCATGAAACGCTGGCGAATCTG
GGATATTTTGTCATCGGGTTGCACGCTGCGGCTGCACTGGCACACCACTATTTCTGGAAG
GACAACACACTTCTACGCATGATGCCGCGTAAACGTTCCTGAAGGATATTTAAAGAAAAC
GCCTGTACTAAAACCGACCCGTGGTACAGGCGAAGAATACGGGTCTACATCGGAAGCGCC
TATTATATTTATTTGTATGATAAATAAAACCATAATCCTTGCCCATACGTCCATCTGGCT
TATTTTTAATCAATTCACCCGATCTTTGATCTCATCAACGGTATCAAAATAAACCAGCGT
ATAACGTTCAAATCGAACATAAGATTCGATAAACCATGGAGGTTATATGAAAAAACTGGC
ACTTATTTTGTTTATGGGAACGCTTGTTTCCTTTTATGCCGATGCCGGGCGCAAACCCTG
TTCTGGTTCGAAAGGGGGGATCTCACACTGTACGGCAGGCGGCAAATTTGTCTGTAATGA
TGGTTCTATTAGTGCATCGAAAAAAACATGCACTAACTGAAGTGTAAAAGGGGTGCCATG
AGAAAATGAATCTGCTAGTCAAATGCGCGGGGAAAATCCCCGCGCTTGCCCTTACCTGGA
CGTGCAGGCCATGAGCGCAGCAACCTCCTTATCACCGTCCCGGAACCGCAGTTCGTAGAG
CGTTTGTCGGGTCAGGAGTGTGAATGTCAGAATCGTAATGCAGATAATGAGCAGACACAC
CACCAGAGGGTTGTGCTTCATAGCCTTTCTCCTTGCCGGATGGCGGGTAAGAGGCTAAGA
TCTGAATTGCTAGGTTCATTCGTTGGCCTCGGTTGATAGAAATATCGGTCGGGGCCTTCG
TCTTTCTGATTCCCGGTTAGCCTGAAAACAGAAAGTCTCAGGCACCCGCAGGCATCCTAT
GAGGTTTCCTTAGGGACGAAAATAATCACTTCACGAAATTGCGTGCTGTTTTCCAGAATT
TTTCGTCATTCGGGTTAGCCAGTTTAGCCATTCGTTACTCTCTTCATTCCAATAGCATTA
ATTTTCTATGCAATAATTGTTGTAAAAATGTGACGCAAAGAGGTTTTTGGTCATAAGTAA
TTACCGTCAAGTGCCGATGACTTTCTATCAGGAGTAAACCTGGACGAGAGACAACGGTAA
TGAATACAACTCCCTCACAGCGATTAGGTTTTTTGCATCACATCAGGTTGGTTCCGTTAT
TTGCCTGCATTCTAGGCGGTATCTTAGTTCTATTCGCATTAAGTTCAGCCCTGGCTGGCT
ATTTCCTCTGGCAGGCCGATCGCGATCAGCGTGATGTTACTGCGGAGATTGAGATTCGGA
CCGGGTTAGCGAACAGTTCAGATTTTTTGCGTTCAGCCCGGATCAATATGATTCAGGCCG
GGGCTGCGAGTCGTATTGCGGAAATGGAAGCAATGAAGCGAAATATTGCGCAAGCCGAAT
CGGAGATTAAACAGTCGCAGCAAGGTTATCGTGCTTATCAGAATCGACCGGTGAAAACAC
CTGCTGATGAAGCCCTCGACACTGAATTAAATCAACGCTTTCAGGCTTATATCACGGGTA
TGCAACCTATGTTGAAATATGCCAAAAATGGCATGTTTGAAGCGATTATCAATCATGAAA
GTGAGCAGATCCGACCGCTGGATAATGCTTATACCGATATTTTGAACAAAGCCGTTAAGA
TACGTAGCACCAGAGCCAACCAACTGGCGGAACTGGCCCATCAGCGCACCCGCCTGGGTG
GGATGTTCATGATTGGCGCGTTTGTGCTTGCCCTGGTCATGACGCTGATAACATTTATGG
TGCTACGTCGGATCGTCATTCGTCCACTGCAACATGCCGCACAACGGATTGAAAAAATCG
CCAGTGGCGATCTGACGATGAATGATGAACCGGCGGGTCGTAATGAAATCGGTCGCTTAA
GTCGTCATTTACAGCAAATGCAGCATTCACTGGGGATGACAGTAGGGACTGTTCGACAGG
GCGCGGAAGAGATTTATCGTGGCACCAGCGAAATTTCAGCTGGCAATGCGGACCTGTCAT
CTCGCACCGAAGAACAAGCGGCGGCTATCGAACAAACTGCCGCCAGCATGGAGCAACTCA
CTGCGACGGTGAAACAGAATGCGGATAACGCGCATCATGCCAGCAAACTGGCGCAAGAGG
CTTCTATTAAAGCCAGCGATGGCGGGCAGACGGTTTCCGGTGTAGTAAAAACGATGGGCG
CTATCTCCACGAGTTCGAAGAAAATTTCTGAGATCACCGCCGTCATCAACAGTATTGCTT
TCCAGACGAATATTCTGGCACTGAATGCTGCCGTTGAAGCCGCGCGAGCGGGTGAGCAAG
GGCGTGGATTTGCCGTTGTCGCCAGCGAAGTACGGACACTCGCAAGTCGCAGCGCTCAGG
CGGCGAAAGAGATTGAAGGCTTGATCAGTGAATCAGTCAGGTTAATTGACCTGGGGTCGG
ATGAGGTGGCAACGGCCGGGAAAACCATGAGCACTATTGTTGATGCCGTCGCGAGTGTCA
CACATATCATGCAGGAAATCGCCGCCGCCTCGGATGAACAAAGTAGAGGCATAACGCAGG
TTAGCCAGGCGATTTCTGAAATGGATAAGGTGACGCAACAGAATGCTTCTCTGGTAGAAG
AGGCCTCAGCGGCGGCGGTGTCCCTTGAAGAACAGGCGGCACGATTAACTGAGGCGGTGG
ATGTATTCCGTCTGCACAAACATTCTGTGTCGGCAGAACCTCGCGGAGCGGGTGAACCAG
TTAGTTTCGCTACGGTGTGAAAATGTTCAAGGAGGGATCGACAGATCCCTTCACCTTTCA
GAACGGCATTGATTTTCGAATAGCGTTAATCATCAACTGGCAACCAGAAGAGAACGTCGC
ATCTACGCGGGTCAGTATTCCAATCGGTTCGCCTGCACCATGTCCCGGAACAGGCAGGGC
CACCAGCGTGGCATGACGCAGGTCGTCTTTTACAGCGCCAGAAGGGACAAACCACACGTA
ATCGTATTCAACCGTAAGTTGACGAGATAGCGAAGCAGACAGCGTTTCGATACAACCCGA
AGGAATTTTACAGCCCTGGCTCTGCACTAATGCATCTGAATGCTGGCGTGGCGCAGTGCC
TTCTGGTGATACAACGACCGGCCATTCCAGCACCCGGCTTAGCGTTACGTTCTCCTGAAG
TAGCGGGTGATTAGGGCGGACAACCAGCTTCAACGATTCAAGAAACAGCAGTTCGTAATT
AAGCCCGGTCATCAGTTCAGGATCTGACATCCGACCAATGCCGATATCGATTTCCCCGGT
TTTTAAACCCGCCAGAATCATAGGGTTACTCATTGTCGCAACTTGCAAGGTCGTCTCTTT
TTGTTGCTGATGAAACTGACCTATAACCGAAGGTAATATCCCCAGTGCCGCAGTAGGTAG
TGCACCAACCCTGACGACATCATTATTAAGACCTTCTTTACGATGAAGCGACCGTCCGGC
AGTGTTGATGGCGTCAAGAACTCTGACTGCATGCGTTAAAAATTGTTCGCCGGGTAAGGT
AAGTTGCGCCCCCTGACGACCACGCTCAAACAAGCGAGCGCCAGTCAGCTGCTCCAGTTC
ATTCAATGTCTTAGAGAGCGCAGGTTGACTCAAATTAAGGGTTTCAGCCGCGCGCCCCAA
AGTTCCTTGTTGTGCGACAGCTACGAATGTATGAAGGTGGCGCAAACGGATGCGCTGACT
AAACAGACTATTTTTTTCCATAAGCGATGTTAAAAACGAAGCGGTGTCGCTGACAAGTGA
AGTTGTTTGATTATGATAACTTGATTGCAAAATATTATTAACAATTAAAGCAATTATGTT
ACAGCAAAATGGATAATATTGATGTTTTCGCGGCGAGATCACAGTTTGTAAATTCTTCCC
GCAAGAGTGAATGCGGTTACCTACACTCCAGATTACTGACCACTGGAGGCAGACACTATG
GCGAACAGCATCACGGCGGATGAGATTCGGGAACAGTTTTCGCAGGCAATGTCAGCCATG
TACCAGCAAGAAGTTCCGCAATATGGCACGCTGCTGGAACTGGTAGCTGATGTGAATCTG
GCTGTGCTGGAAAACAATCCTCAACTGCACGAAAAAATGGTAAATGCAGACGAGCTGGCG
CGACTGAATGTTGAACGTCATGGGGCGATTCGCGTTGGGACTGCACAAGAGCTTGCTACT
CTTCGGCGGATGTTTGCCATTATGGGGATGTACCCGGTGAGCTATTACGATCTCTCGCAG
GCAGGGGTGCCGGTACATTCGACAGCATTTCGGCCCATTGATGATGCTTCTCTGGCGCGT
AATCCCTTCCGCGTTTTTACCTCCTTACTCCGCCTTGAGCTTATCGAGAACGAAATTTTG
CGCCAGAAAGCGGCGGAGATTCTGCGTCAGCGCGATATCTTCACCCCACGTTGTCGACAA
CTGTTAGAGGAATATGAGCAGCAGGGCGGTTTTAACGAAACACAGGCACAGGAGTTTGTG
CAGGAAGCCCTGGAAACGTTTCGCTGGCACCAGTCAGCAACGGTAGATGAAGAAACCTAT
CGCGCATTGCACAACGAACATCGGTTGATTGCTGATGTGGTCTGTTTTCCTGGATGCCAT
ATCAACCACCTGACGCCACGTACGCTGGATATTGACCGGGTGCAGTCGATGATGCCTGAA
TGCGGAATTGAACCCAAAATTCTCATCGAGGGGCCGCCGCGCCGCGAGGTACCGATTTTA
CTACGCCAGACCAGCTTTAAAGCACTGGAAGAGACGGTGTTGTTTGCGGGGCAGAAACAG
GGCACGCATACCGCGCGCTTTGGTGAAATTGAGCAGCGTGGCGTGGCATTAACGCCGAAA
GGGCGACAACTGTATGATGATCTTCTGCGTAACGCTGGAACCGGGCAGGATAATCTCACT
CACCAAATGCATTTACAGGAAACCTTCCGCACTTTTCCTGACAGTGAGTTTTTAATGCGT
CAGCAAGGGTTGGCATGGTTCCGGTACCGTCTGACGCCTTCGGGTGAGGCGCATCGTCAG
GCGATTCATCCTGGAGACGATCCACAGCCCTTAATTGAACGTGGTTGGGTAGTGGCGCAA
CCCATCACCTATGAAGATTTCTTGCCCGTTAGCGCGGCGGGGATCTTCCAGTCAAATCTG
GGTAATGAAACGCAGACACGCAGTCACGGTAATGCCAGTCGCGAAGCATTTGAGCAGGCG
TTGGGTTGTCCGGTTTTGGATGAGTTCCAGCTTTACCAGGAAGCGGAAGAACGCAGTAAA
CGTCGCTGTGGTTTGCTTTAAAATCTGACCATCCGCCTTTGCAAAAATTTGCCTGATTTT
ACAAACGAATCAGGCTCATCCCATCGACATAAAAAAAATGCCGATTTATGCATATTCTCT
CAGTTCAACAATTGGATTATTAATAAATATTGTCTAGAGTGAGCGGTCATAAATAAGCAC
TTTCTTGCCGCTGAAAACGACCAGCGCGGGACCATTCACAACACCAGAAGGACTCACTTT
CAGGTATGGATCGTAGACGATTTATTAAAGGTTCAATGGCTATGGCCGCCGTGTGCGGTA
CCAGCGGCATTGCTTCTCTTTTTTCTCAGGCGGCATTCGCGGCAGATTCTGATATTGCCG
ACGGGCAAACCCAGCGTTTTGACTTCTCCATTCTACAGTCAATGGCGCACGACTTAGCGC
AAACAGCGTGGCGTGGTGCGCCTCGTCCGTTACCTGACACGCTGGCGACAATGACGCCGC
AGGCTTATAACAGTATTCAATACGACGCCGAAAAATCGCTCTGGCATAACGTTGAGAACC
GTCAACTGGACGCTCAGTTCTTCCATATGGGAATGGGATTCCGTCGCCGCGTTCGTATGT
TTTCTGTAGATCCAGCAACACATCTGGCGCGTGAAATTCACTTTCGCCCGGAGTTGTTCA
AATACAACGATGCAGGTGTTGATACAAAACAATTAGAAGGGCAAAGCGATCTCGGCTTTG
CCGGTTTTCGCGTGTTTAAAGCCCCCGAACTGGCGCGCCGTGATGTAGTATCATTTCTCG
GCGCGAGTTATTTCCGCGCCGTTGATGATACATATCAATACGGTTTGTCGGCCCGCGGCC
TGGCGATCGACACTTACACCGACAGTAAAGAAGAGTTCCCCGACTTTACCGCCTTCTGGT
TTGATACGGTAAAACCGGGGGCAACTACCTTTACCGTTTATGCGTTGCTCGATAGCGCCA
GCATTACTGGTGCCTATAAGTTCACTATCCATTGTGAGAAAAGTCAGGTGATTATGGATG
TGGAAAATCACCTGTATGCGCGCAAAGACATTAAACAGCTGGGCATTGCGCCGATGACCA
GTATGTTCAGCTGCGGTACTAATGAACGTCGGATGTGCGATACAATTCATCCGCAAATTC
ATGACTCTGATCGTCTGTCCATGTGGCGGGGCAACGGCGAGTGGATTTGCCGTCCGCTGA
ATAATCCGCAAAAATTGCAGTTCAATGCTTACACCGACAACAACCCGAAAGGGTTTGGTT
TATTGCAACTGGATCGTGACTTCTCCCATTATCAGGACATTATGGGCTGGTATAACAAAC
GCCCAAGTCTGTGGGTGGAACCGCGTAACAAGTGGGGTAAGGGCACCATCGGCCTGATGG
AAATCCCAACAACGGGCGAAACGCTGGATAACATTGTCTGCTTCTGGCAGCCAGAAAAAG
CTGTAAAAGCAGGTGATGAGTTTGCATTCCAGTATCGTCTGTACTGGAGTGCGCAACCGC
CTGTTCATTGCCCATTAGCGCGCGTTATGGCGACGCGTACCGGCATGGGCGGTTTCTCGG
AAGGTTGGGCGCCAGGTGAACACTATCCCGAAAAATGGGCGCGTCGTTTTGCCGTCGATT
TCGTTGGTGGTGATCTGAAAGCTGCCGCGCCAAAAGGCATTGAGCCGGTGATTACGCTTT
CCAGTGGGGAAGCGAAGCAAATCGAAATTCTCTATATTGAACCCATCGATGGTTATCGTA
TTCAGTTTGACTGGTATCCGACTTCGGACTCCACTGATCCGGTCGATATGCGGATGTATC
TACGTTGTCAGGGGGACGCTATCAGTGAAACATGGCTGTATCAGTATTTCCCGCCAGCGC
CGGATAAACGTCAGTATGTTGACGACCGCGTGATGAGTTAATCGTTTTTTCTTCGGCACC
TTCTTCGGGAGGTGCCGTCTGGTTAAACACGATCCCGCTCGCATTTTTCCCTAAGTTAAA
TGAGTAATCTGATGGTGTGTATTTCAGATACACCTTGTCAGCCACTAACAGGGAGTGCGT
ATGTTTCCAGAATACCGAGATTTAATATCCCGTCTGAAAAACGAAAATCCTCGCTTTATG
TCCTTGTTCGATAAACACAATAAACTTGATCATGAAATTGCCAGAAAGGAAGGTTCCGAC
GGTCGAGGGTACAATGCGGAAGTGGTCCGCATGAAAAAACAAAAGCTACAGTTAAAAGAT
GAGATGCTCAAAATCCTGCAGCAGGAGAGCGTCAAAGAGGTGTAAACTTTCCTAAGCCGC
CAGCCAGGCGGCTTTTTTAACAACTGCATGGATTGACTGGAGATAAGATGACTGAAACGA
TAAAAGTAAGCGAATCACTTGAATTACATGCTGTTGCAGAAAATCACGTCAAACCTCTTT
ATCAGTTAATCTGTAAAAATAAAACCTGGTTACAGCAGTCGCTAAACTGGCCGCAGTTTG
TTCAAAGTGAAGAGGACACGCGAAAAACGGTGCAGGGTAATGTGATGTTGCATCAACGCG
GCTATGCCAAAATGTTCATGATTTTCAAAGAAGATGAACTTATCGGCGTTATCTCGTTTA
ATCGTATTGAACCACTGAATAAAACCGCTGAAATAGGCTACTGGCTGGACGAATCTCATC
AGGGGCAGGGGATCATTTCTCAGGCGCTGCAGGCATTGATTCATCATTACGCCCAGTCTG
GTGAACTTAGACGCTTCGTGATCAAATGTCGGGTGGACAATCCGCAAAGCAACCAGGTCG
CTTTGCGCAATGGTTTTATCCTTGAAGGTTGCCTGAAACAGGCTGAGTTCCTGAATGATG
CCTATGATGATGTGAACTTATACGCGCGTATTATCGATTCACAATAACCCTGCCAGCGGC
GTTCGCGTAATGCGCTCCTCGCCGTTAATGACTTTTGGACCACGGACATGAACCGTGTCG
CCATCAAAGGCTTCAACGACGGCGTGGTCGGTTAACTCCACATGGTTTTCAATTATCACC
GCACCTGTAATACGGCTCTCACCTTGTATGACAACGTGCTCGTCGAGCAGAATCGGTCCG
CCACGTACCACGGCATTTCCGCCAACCAAGACATGATGTTTTAACACACAATTACCTTCC
ACAATGGCATATTCCGCCACCTGCGAACTGTAATGAATCGTCGGAATGGCATCTTCTTCT
ATGCCAGCTTTCACCTGCGCGTGACCGTAGACTTTAGCGCAATCGCATAGCCAGACATTG
TTCTCTTCATTACCTTCAATACTGGCAAAATCAAAAACTTCGGCGCGATGTTCAATAAAA
GCATACCGGACGACGGCATCGCCATAAATTTGTGCCTGGTGGACAATACGCGAGGCGCTA
ACCCTTGCGCGATCATAAATTTGGAGCAGGAGTTGATGGTCGGGCGTTAAGCCTTGTGCG
GCGACGATCATAGAATGTTGATCAATTAAGGCGTGACCAAATATTCTACATTGCCCGTAA
ACTAATGAGTCATGAATGGTGACGCTGTCACTTATATATGCACCCTGGCTGATTTCACTA
TTATCGATCCAGACGTTATCCGTTGCGTAAACCTCTCCCCACAGCACGCTGGTGCCGGTG
ATACGCGTATTACCGGAAATCACCGCTCCGCCGAACGCAATAGCATTCTGGTCGTAAATC
CAGCAATTTCCTTCTTGTGCTAACACCGTTTCGCGATCGATCCAGCCGCCAGCGGTTCCT
GCTATCACATCGTTAAAATCGCTAATGGCGATAATCTGCCGTAATAACACATTTTTTTTA
GTGCCATCTTCCTGATAACTAAAGGCTCGCTGTTCTTCACTTAGACGATATTTGCGCATA
GCGTTTTCCCACAGGTGACTTACTATAACCGTAGCAAATTCTGCGGCTCTGGCTATGCTC
GAGAAAATTCCATAAAATGCATTTCAAATATACTTTATAAATTAAACAAAATGAGTAAGA
AGATGCAGAGCGATAAAGTGCTCAATTTGCCGGCAGGCTACTTTGGTATTGTGTTGGGGA
CGATAGGGATGGGATTTGCCTGGCGCTATGCCAGCCAGGTTTGGCAGGTCAGCCACTGGT
TAGGGGATGGGCTGGTGATTCTGGCGATGATCATCTGGGGATTATTGACTAGCGCATTTA
TTGCCCGACTCATACGCTTTCCGCATAGCGTGCTGGCGGAAGTTCGCCATCCAGTGCTGA
GCAGTTTTGTGAGTTTGTTTCCGGCAACGACGATGCTGGTGGCGATTGGTTTTGTTCCGT
GGTTTCGCCCACTGGCGGTGTGCCTGTTCAGTTTTGGTGTCGTGGTTCAGTTGGCTTATG
CCGCCTGGCAAACTGCGGGATTATGGCGCGGATCTCACCCTGAAGAAGCTACCACGCCTG
GACTGTATCTGCCGACAGTTGCCAACAACTTTATCAGCGCAATGGCCTGTGGTGCGTTGG
GCTACACCGACGCCGGTCTGGTGTTTTTAGGCGCAGGCGTTTTCTCATGGCTAAGCCTTG
AACCGGTGATCTTGCAGCGTCTGCGCAGTTCGGGAGAATTACCCACGGCACTGCGGACAT
CACTCGGCATTCAGCTCGCTCCTGCGCTGGTGGCTTGTAGTGCCTGGCTGAGCGTCAACG
GCGGCGAGGGTGACACGCTGGCGAAAATGCTTTTCGGTTATGGACTGCTGCAACTGCTGT
TTATGCTACGTCTGATGCCATGGTATCTCTCCCAGCCATTTAATGCTTCATTCTGGAGTT
TCTCGTTCGGCGTATCTGCACTGGCAACCACCGGTTTGCATCTGGGGAGTGGCAGCGATA
ATGGATTTTTCCATACGCTGGCGGTGCCGCTGTTTATCTTTACCAATTTTATTATTGCAA
TACTGCTCATCCGTACTTTTGCGCTTCTGATGCAGGGAAAATTGTTAGTCAGAACCGAGC
GCGCCGTTTTAATGAAAGCAGAGGACAAAGAATGATCATTCGTGACGAAAACTATTTTAC
TGATAAATATGAATTAACCCGCACACACTCTGAAGTACTGGAAGCGGTGAAAGTGGTTAA
ACCGGGTAAAACGCTGGATCTGGGCTGTGGCAATGGTCGTAACAGTCTTTACCTGGCAGC
CAATGGTTATGATGTTGACGCATGGGATAAAAATGCCATGAGTATCGCCAACGTCGAGCG
CATTAAATCCATTGAAAATCTGGATAATTTACACACCCGAGTCGTTGATCTGAATAACCT
CACATTTGATAGACAGTACGATTTTATTCTTTCGACTGTGGTGCTGATGTTCCTTGAGGC
TAAAACCATCCCCGGGTTGATTGCCAATATGCAACGTTGCACTAAACCTGGTGGTTACAA
CCTGATTGTGGCGGCGATGGATACCGCTGATTATCCATGTACCGTCGGCTTCCCGTTTGC
CTTCAAAGAGGGAGAATTACGTCGATATTACGAAGGCTGGGAGAGGGTGAAATACAATGA
AGACGTCGGCGAGCTGCACCGCACCGACGCCAACGGTAATCGTATTAAACTGCGTTTCGC
CACGATGCTGGCACGTAAAAAATGACCCGGTAAGCACAAAACGCGTGAAAATTCCCCACG
CTGAGATGATTTACTGTTCTTCTTTTCGGTAAGCATATTTTTTATCGAAGGGATGTGAAA
TTAATCACAGTAGTCGAAGTTTTTAGCAGCTTAACTTACTGAAATTTAAGTACTGATGAT
TGACTTAGCCCCTTTTTCGGCATTGACTATGTCGTCTGAAAAGGGGCTGAAAAATTTATT
TTCACCAACACTTTTTTTGCCACAACACGAAGCGGCGCTTTTTGCTATAACTTAGAAAGT
AATATAATCATCTCAGGAAACTATTCATGCGTACCACATCATTTGCGAAAGTTGCAGCTT
TATGCGGCTTATTGGCTCTGTCTGGTTGTGCATCTAAAATCACCCAGCCAGATAAATATT
CTGGTTTTTTAAACAATTACTCTGATTTAAAAGAAACAACCTCGGCTACAGGTAAACCTG
TTTTACGTTGGGTAGACCCGAGTTTTGATCAAAGCAAATATGACAGCATCGTCTGGAACC
CAATCACTTATTATCCGGTACCGAAACCGTCGACCCAGGTAGGGCAGAAAGTTCTGGATA
AAATTTTGAACTATACCAACACCGAAATGAAAGAAGCGATAGCGCAGCGTAAACCACTGG
TTACCACCGCTGGGCCGCGTAGTCTGATTTTCCGTGGGGCCATTACCGGTGTAGATACCA
GCAAAGAAGGGCTGCAATTCTATGAAGTGGTTCCTGTTGCATTAGTGGTTGCGGGGACGC
AAATGGCTACAGGCCACCGTACCATGGATACTCGCCTCTATTTTGAAGGTGAGCTGATTG
ATGCAGCGACTAATAAACCGGTTATCAAAGTCGTTCGTCAGGGCGAAGGTAAAGACCTGA
ATAACGAAAGTACGCCAATGGCTTTCGAAAATATTAAACAAGTTATTGATGACATGGCGA
CCGATGCCACCATGTTTGACGTTAACAAAAAGTAGTTCCAGACGCGCCATCGTTAGATGG
CGCTTTTTATCCGGTGCGCCGTAAAACCCCATCCTTCAGGGCGGGGATATAAGGCGCGGT
TTTCCACCTGACCAGGTGTTTGCTGTTGTTCAATGTATTGGCGGATGACGGATATTGGCG
CACCTCCGCAGCTACTGGCAAAATAGCCAGGACTCCACAAAACGCCTTTGTAGTAATACC
TGAATGCAATATCTGGTCGATCTCGTCGCAGTCACCTACCCGATACGCCTTTGAGGCTGT
TTACCAGACTGGATATCGCCAGTTTGGGAGGATAGTTAATTAACAAATGGACGTGATCTG
GTTCGCCATCCATTTCAACCAGTTCAGCTTCAAAATCAGCACATACATTTGAAAAGTAAG
TGCGTAGTTTTTCTGTCGCGTCATGGTCAAAAATCTGGCGTCGGTATCTGGTGACAAAGA
GCAGGTGAACATGCATCAGGAAAACACAATGCCTTCCACGCCGGATATCGGTTTCTTTTT
TCACAGACCAAAGTATCATTTGACCTGTGAAACGATTACAGGCATTTAAATTCCAGTTAA
GACCCGGTGGTCAACAGGAGTGTGAAATGAGGCGCTTCGCAGGCGCATGTCGTTTCGTTT
TCAATCGTGCTCTGGCACGTCAGAATGAGAATCATGAGGCCGGTAATAAATACATCCCTT
ACGGGAAAATGGCTTCCTGGCTGGTTGAGTGGAAAAATGCCACTGAAACGCAATGGCTTA
AAGATTCTCCCTCACAGCCATTGCAACAGTCACTGAAAGACCTTGAGCGGGCTTACAAAA
ACTTCTTCCGGAAGCGGGCTGCTTTTCCCCGATTCAAAAAGCGGGGACAGAATGATGCAT
TCCGCTACCCGCAGGGCGTTAAGCTCGATCAGGAAAACAGCCGTATTTTTCTGCCGAAAC
TGGGCTGGATGCGCTACCGGAACAGCCGTCAGGTCACGGGTGTTGTGAAAAATGTCACTG
TCAGCCAGTCCTGCGGTAAGTGGTACATCAGTATTCAGACAGAAAGTGAAGTATCAACTC
CGGTTCACCCTTCAGCATCAATGGTCGGGCTGGATGCTGGCGTGGCTAAACTCGCCACGC
TGTCAGATGGCACAGTCTTTGAGCCTGTAAACAGTTTTCAGAAAAACCAGAAGAAGCTGG
CGAGACTTCAGCGACAGTTAAGCCGCAAGGTCAAATTCAGCAACAACTGGCAAAAGCAGA
AACGCAAAATACAGCGACTGCATTCCTGTATCGCAAATATCCGCAGGGACTACCTTCACA
AAGTCACAACGGCCGTCAGCAAAAACCACGCAATGATAGTCATTGAGGATTTGAAGGTCA
GCAACATGTCAAAGTCAGCAGCGGGTACGGTCAGCCAGCCGGGGCGCAATGTCCGGGCAA
AATCAGGTTTAAACCGTTCGATACTGGATCAGGGCTGGTATGAAATGCGCCGCCAGCTTG
CGTATAAGCAGCTCTGGCGTGGCGGTCAGGTGCTTGCTGTTCCGCCAGCGTATACAAGCC
AGCGTTGCGCGTACTGTGGTCATACAGCGAAAGAGAACCGCCTGTCACAAAGTAAATTCA
GATGCCAGGTATGTGGATATACAGCGAACGCCGATGTAAATGGCGCTCGCAACATTTTAG
CGGCGGGGCACGCCGTTCTTGCCTGTGGAGAGATGGTGCAGTCAGGCCGCCCGTTGAAGC
AGGAACCCACCGAAATGATTCAGGCGACAGCCTGAACGTAGCAGGGATCCACGTCCTTCA
GGGCGTGGAGGATGTCAATATCGGTTTCTGTCAGCGATTAAATTCAACACCACGTAACAA
ACGCCTCCGGCAATTAATCCCCAAAACGCAGAACCAATCCCGACCAGCGTCAATCCACTT
GCCGTTACCAGAAATGCCACCACCGCCGCGTCTCGCTCACGCTCATTATGCAGCGCCTGA
TACAAACTGCCGCCGATGGTACTTAACAGCGCCAGACCTGCCAGCATCTGGATCCAACTT
ACGGGCAGGGCAGCCATCATCCCGGTAATGGCACTACCAAACAGACCTGCGAGCAAATAG
AAAATGCCTGCAACGGCAGCGGCCAGCCAACGTTGATCTTTATCCGGATGCGCTTCCGGG
CTTTGGCAAATAGCCGCGGTGATTGCCGCAATACCGACGGAATAAACGCCGAAAGGGGAA
AAAACCAGTGCCAGCAATCCAGTAAATACAATTAATGGCGAAACAGGAGCCGAATATCCA
GCTGCTTTCATTGCTGCGATACCCGGTGCGTTTTGCGATGCCATCGTCACCAGAAAAAGG
GGGAGTGCAACGCTCAGGCTGTGAGCAAACGAAAAATCAGGGGTAATATAAGTGGGGAGA
ACGGGTTTAAAGACAACATCAGTTGTGACAACGTCACCTTGCGCGATGACGATCACGATC
CCAATAATCATCGCGGCAATTACCGCATAGCGCGGCGCAACGGCCTTGGTTGCCAGCCAT
ACCAGCAACATACTTCCACACAACGTAAATTGACCGTCCAGACTGGCAAACGCCTGTAAA
CCAAAGCGTAATAAAATCCCGGCAAGCATTGCCGCCGCAAGCGAGTGCGGAATAATGCGC
ATCAGACGAGCAAAGAGTCCCGTTATGCCGCAGAGGACTATTAGCGCGTTGGTGACAATA
AAAACGCCGATGGCTTCGTTAAGTGTTAGTCCCTGCAATCCGGTGACCAACAAAGCCGCG
CCAGGCGTTGACCATGCGGTGAGAACAGGTACGCGATACCATAATGTCAGAGTCAGCGTA
CTGACGCCCATTGCCAGCCCCAGCGCCGTCATCCAGCCAGAGATTTGTGCAGTGGTGGCT
CCGGCGACAATCGCTGCTTGCCAGATTATTGCCGCTGAACTGGCGTAGCCAATTAATACC
GCCAGAAACCCCGCCAGTAGCGTGGGTGGAGGAATAGAAAACAGACGCATAGTCACCTCG
TGCGTTATAGCGTACAGGCACCGTAGCATTTGTCCGTTATAACGCACAAGTGATAAACTT
CCGTTTTGCCGGAGGAGTCGCATGGAAAATCTCGCTCGCTTTTTATCCACCACACTTAAA
CAACTACGCCAGCAGCGCGGCTGGAGTCTTTCGCGACTGGCAGAAGCGACGGGCGTTTCT
AAAGCAATGTTAGGGCAGATTGAGCGTAATGAGTCCAGTCCGACGGTCGCGACATTATGG
AAAATTGCCACCGGGTTGAACGTACCATTTTCAACATTTATTTCTCCGCCGCAGTCCGCT
ACGCCTTCAGTTTATGATCCACAACAGCAGGCGATGGTGATCACTTCGCTGTTTCCTTAT
GATCCACAACTCTGCTTTGAACACTTCTCGATTCAGATGGCATCTGGTGCAATAAGCGAA
TCGACGCCCCATGAGAAGGGGGTAATCGAACATGTCGTCGTCATTGATGGACAACTTGAT
CTGTGCGTTGATGGGGAATGGCAGACCCTTAATTGTGGGGAAGGCGTTCGATTTGCTGCA
GACGTCACGCATATCTATCGTAATGGTGGGGAGCAAACCGTACATTTTCATTCCCTCATC
CATTACCCGCGCAGTTAAGCGGGAAAACTATTTCGCAACGTCGCGCTTGTGGCTAAAATA
GCCGCCATTTTTCAGCTACTGGATAAGAATGTGACCGTATCTTCTCATCGACTTGAACTG
TTAAGCCCGGCACGCGATGCCGCCATTGCCCGCGAAGCTATTTTGCACGGTGCCGATGCT
GTTTATATCGGCGGCCCTGGTTTTGGTGCCCGTCATAATGCCAGTAATAGCTTGAAAGAT
ATTGCCGAGCTGGTGCCGTTTGCCCATCGTTATGGTGCAAAAATTTTCGTCACGCTTAAC
ACCATTTTGCATGATGATGAGCTGGAACCCGCGCAACGGCTGATTACTGACCTCTACCAG
ACCGGTGTCGATGCGCTGATTGTTCAGGATATGGGGATTCTGGAACTTGATATTCCGCCG
ATTGAACTGCACGCCAGTACGCAGTGCGACATTCGTACAGTTGAAAAAGCGAAGTTCCTC
TCTGATGTTGGCTTCACGCAGATTGTGCTGGCGCGAGAGCTGAATCTTGATCAGATCCGC
GCGATTCACCAGGCTACGGACGCGACCATTGAATTCTTTATTCATGGGGCACTGTGCGTG
GCCTATTCGGGTCAGTGCTACATTTCTCATGCGCAAACAGGGCGTAGCGCCAACCGTGGC
GATTGCTCGCAGGCGTGCCGTTTGCCATACACATTGAAAGACGATCAGGGGCGGGTGGTT
TCCTATGAAAAACATCTGCTGTCGATGAAAGATAACGATCAGACTGCCAACCTCGGCGCG
CTGATTGATGCTGGTGTACGCTCCTTCAAGATTGAAGGGCGTTACAAAGATATGAGCTAC
GTGAAGAATATCACCGCCCATTATCGCCAGATGCTTGATGCCATTATTGAAGAACGTGGC
GATCTGGCGCGCGCTTCATCAGGTCGTACTGAACATTTCTTTGTTCCATCGACGGAAAAG
ACTTTCCACCGTGGTAGCACAGATTATTTTGTGAATGCCCGTAAAGGCGATATTGGCGCG
TTCGATTCGCCGAAATTTATCGGCCTGCCGGTAGGCGAAGTAGTGAAAGTGGCGAAAGAT
CATCTCGATGTTGCCGTTACCGAGCCACTGGCAAATGGCGATGGCCTGAACGTGTTGATT
AAACGTGAAGTCGTCGGTTTTCGTGCCAATACGGTCGAGAAAACCGGAGAAAATCAGTAC
CGCGTCTGGCCCAATGAAATGCCAGCAGATTTGCACAAAATTCGTCCACATCACCCACTA
AACCGTAATCTTGATCATAACTGGCAGCAGGCACTGACAAAAACCTCCAGCGAACGTCGG
GTGGCGGTAGACATTGAACTGGGCGGCTGGCAGGAACAACTGATTCTGACCCTCACCAGT
GAAGAGGGTGTCAGCATCACGCATACGCTGGACGGGCAGTTCGACGAAGCCAATAACGCC
GAAAAAGCAATGAACAATCTGAAGGATGGTCTGGCAAAACTGGGGCAAACCCTCTATTAC
GCCCGCGATGTGCAAATTAATTTGCCGGGGGCGCTGTTTGTACCAAACAGTCTGTTAAAC
CAGTTCCGCCGTGAAGCTGCTGACATGCTGGATGCTGCGCGTCTTGCCAGTTACCAGCGC
GGCAGCCGTAAACCGGTTGCTGATCCTGCGCCGGTTTATCCGCAAACGCATCTGAGTTTC
CTCGCGAACGTATACAACCAGAAAGCGCGTGAATTTTATCATCGCTATGGTGTGCAGCTG
ATTGACGCGGCGTATGAAGCACATGAAGAGAAGGGCGAAGTCCCGGTGATGATCACCAAG
CATTGTCTGCGCTTTGCCTTTAATCTGTGCCCGAAACAGGCGAAAGGCAATATCAAAAGC
TGGAAGGCGACGCCAATGCAACTGGTTAACGGCGATGAAGTATTAACGCTAAAGTTTGAT
TGCCGCCCATGCGAGATGCACGTCATTGGCAAAATCAAAAATCACATACTGAAAATGCCG
TTACCGGGAAGCGTAGTGGCATCCGTAAGTCCGGATGAGCTGCTGAAAACATTGCCGAAG
CGAAAAGGGTAAAACGCCAGTTTTCTGGTTACTCACAACTTATTGAATCTGCATGATATT
GCCTGCCGGGTAAGGCGTTACGCCGCATCCGGCATCAAATGACTCAACGTTGTCCCGCTT
CTGGTTTGCGCGATTTTTGCCAGTAAAAATGCTCGCGCAAACCTTCCGCCGACTCTTCCG
CCACAGCACGCAATTCATCGCTGTCCGCTTCATGACGCAGCTGATGATCCACATTCTTTA
CCCACACAAATTCATGTCCTTTGTGCCCTGCCATGAGTTGTCCTGAAAACAGAGCACACG
TTAATAAGACAACCGATAACGCCTTCGTAAACATCCTGCCACCTTTTTCTTACCTTTTGC
CGCTATGATGCCGATCGTTTCTTGAGGTTATTATTCAGTTTTGCAAATTAGCGCAAAGAA
ATTCTGGAATCTTCCTTCCTGATTTTGCATTGCATTCTGCCGTTGCGGCGATTTAGTGCT
ATTTTCGAGCAAATTACACACGGAGGTAAACACTAATGTTTACTTTGTTGATATACTCAG
CGGCAGGGAGGCGATGTGAAACAAAGCGAGTTCAGACGTTGGCTCGAATCTCAGGGCGTC
GATGTAGCGAATGGCAGCAACCATTTGAAACTCAGGTTTCATGGGAGGCGCAGTGTCATG
CCGCGTCACCCCTGCGATGAGATTAAAGAACCATTGCGTAAAGCAATCCTGAAACAACTC
GGTTTGAGTTAATCGCCAATTAAAAAGGTTAATGACATGCGAGAGACAGTCGAAATTATG
CGTTATCCCGTCACTCTTACACCCGCGCCGGAAGGCGGTTATATGGTTTCTTTTGTGGAT
ATCCCTGAAGCGTTGACCCAGGGCGAAACTGTCGCTGAAGCGATGGAAGCGGCAAAAGAT
GCTTTACTGACCGCATTTGATTTTTATTTTGAAGATAACGAGCTTATCCCTTTACCTTCG
CCATTAAATAGTCACGATCACTTTATTGAAGTACCTTTGAGCGTCGCCTCTAAGGTATTG
CTGTTAAATGCTTTTTTACAGTCAGAAATCACTCAGCAAGAGTTAGCCAGGCGAATTGGC
AAACCTAAACAGGAGATTACTCGCCTATTTAACTTGCATCATGCGACAAAAATCGACGCC
GTCCAGCTCGCGGCAAAGGCGCTTGGCAAAGAGTTATCGCTGGTGATGGTTTAATTACAG
TTAACGAAAAGTTGTCATTTTTAACAACTGATATAGACTGCCGAATCATCTGCACATAAT
TACGATTCGATAATGAAAAAATACCAGCAGCTTGCAGAACAATTACGCGAGCAGATTGCG
TCGGGTATCTGGCAACCCGGCGATCGTTTGCCTTCGTTGCGTGACCAGGTGGCGCTTTCA
GGCATGAGCTTTATGACTGTCAGCCATGCCTATCAGTTGCTCGAAAGTCAGGGATATATT
ATCGCACGACCGCAGTCGGGTTATTACGTTGCGCCACAGGCAATAAAAATGCCGAAAGCG
CCAGTCATTCCAGTCACTCGAGATGAAGCAGTCGATATCAACACTTATATTTTTGATATG
TTGCAGGCCAGTCGCGATCCGTCGGTCGTTCCGTTTGCCTCGGCCTTTCCCGACCCGCGA
CTTTTCCCCCTCCAACAACTAAACCGCTCGCTGGCGCAGGTAAGCAAAACCGCCACAGCG
ATGAGCGTGATTGAAAACTTACCGCCAGGAAACGCAGAACTGCGTCAGGCTATTGCTCGT
CGCTATGCCTTACAGGGCATCACCATTTCTCCTGATGAAATTGTCATTACTGCCGGGGCG
TTAGAGGCATTAAACCTCAGTTTGCAAGCGGTAACTGAACCGGGCGATTGGGTGATAGTA
GAGAATCCTTGTTTCTACGGTGCGTTGCAGGCGCTGGAGCGGCTACGGCTGAAGGCGTTA
TCGGTGGCGACGGATGTTAAAGAAGGGATAGATCTTCAGGCGCTGGAACTGGCGTTGCAG
GAGTATCCGGTGAAAGCGTGCTGGCTGATGACTAATAGCCAGAATCCACTCGGATTTACC
TTAACGCCGCAAAAAAAAGCACAACTGGTGGCGTTGCTCAATCAGTACAACGTAACGCTG
ATTGAAGATGACGTTTACAGCGAACTTTATTTTGGACGGGAAAAACCGCTGCCTGCGAAA
GCGTGGGATCGCCACGATGGCGTTTTGCATTGCTCTTCGTTTTCGAAATGTCTGGTGCCT
GGTTTTCGTATTGGTTGGGTCGCCGCCGGAAAACATGCACGTAAAATTCAACGCTTGCAG
TTGATGAGTACGCTTTCCACCAGCTCACCGATGCAACTTGCGCTGGTGGATTACCTTTCC
ACGCGCCGATACGACGCCCATCTTCGTCGCCTGCGTCGCCAGCTTGCGGAACGTAAACAA
CGTGCCTGGCAGGCACTGCTGCGTTATCTGCCTGCGGAAGTGAAAATTCATCATAATGAC
AGTGGTTACTTTCTCTGGTTGGAGCTCCCCGAGCCGTTAGATGCCGGCGAATTAAGCCTG
GCGGCACTGACGCATCATATCAGTATTGCGCCGGGTAAAATGTTTTCTACCGGTGAAAAC
TGGTCACGTTTTTTCCGTTTTAATACCGCGTGGCAGTGGGGAGAGCGTGAAGAACAGGCG
GTAAAACAATTAGGCAAACTTATTCAAGAACGGCTGTAATAGCGTTTAATTTAATTCCTC
TTAGATTGGGTAATATGAATTTCGAATAGCAGTCATATTTCCTAACTCCTTGACTATACT
CCAGAAGATAACCTTACAGACGGCATAATGCGCGGTAGCTCACAACCTGAATAAATTTTC
TCAGGGGCGAAGGTGTGCCTGCAAGCCGCCGTCTATGGTTAAACAAGGAGATATTTTTAC
GGCACGGCGGCTGAACAATTAATTACGACAGGAGTAAGACCTTATGAGCAAGACATTTGC
CCGCAGCAGCCTGTGTGCGCTCAGCATGACAATAATGACCGCTCACGCCGCCGAACCGCC
TACCAATTTAGATAAACCGGAAGGGCGACTGGATATTATCGCCTGGCCGGGATACATCGA
ACGCGGACAAACTGATAAACAATACGACTGGGTAACGCAGTTCGAAAAAGAGACAGGCTG
CGCGGTGAATGTGAAAACCGCCGCGACTTCCGATGAAATGGTCAGTCTGATGACCAAAGG
GGGTTACGATCTGGTTACGGCATCCGGCGATGCCTCGCTGCGTTTGATTATGGGTAAACG
CGTGCAGCCGATTAATACCGCATTGATTCCCAACTGGAAAACGCTCGATCCGCGCGTGGT
TAAAGGCGACTGGTTTAATGTTGGCGGCAAAGTTTACGGCACACCTTACCAATGGGGGCC
GAACCTGCTGATGTACAACACTAAAACCTTCCCGACGCCGCCGGATAGCTGGCAAGTGGT
TTTTGTTGAGCAAAATCTGCCGGACGGCAAGAGCAATAAAGGCCGCGTTCAGGCTTATGA
TGGCCCTATCTATATTGCGGACGCTGCGTTGTTCGTTAAAGCCACTCAGCCGCAGTTGGG
CATCAGCGATCCGTATCAACTCACCGAAGAACAGTACCAGGCGGTGCTGAAAGTGCTGCG
CGCTCAACACAGTTTGATCCATCGCTACTGGCATGACACTACCGTGCAAATGAGCGATTT
CAAAAACGAGGGTGTGGTTGCTTCCAGTGCCTGGCCCTATCAGGCCAACGCCCTGAAAGC
CGAAGGCCAGCCTGTTGCTACCGTTTTCCCGAAGGAGGGTGTTACCGGTTGGGCTGATAC
CACCATGCTGCATAGCGAAGCGAAACATCCGGTTTGCGCCTACAAATGGATGAACTGGTC
ATTAACGCCAAAAGTGCAGGGCGATGTGGCGGCCTGGTTTGGCTCGTTACCGGTAGTGCC
GGAAGGGTGTAAAGCCAGTCCGTTATTAGGCGAAAAAGGTTGTGAAACCAACGGTTTTAA
CTATTTCGACAAAATCGCCTTCTGGAAAACGCCTATAGCAGAAGGGGGCAAGTTTGTTCC
CTACAGTCGCTGGACGCAGGATTACATTGCCATTATGGGCGGTCGCTAACTTCGCTGGGG
TGCTTTATGACGTACGCAGTGGAGTTTGACAACGTCTCGCGGTTGTACGGTGACGTGCGC
GCAGTAGATGGCGTCAGTATTGCGATAAAAGATGGTGAGTTCTTCTCTATGCTGGGGCCG
TCCGGCTCCGGCAAAACCACCTGCCTGCGCCTGATTGCTGGCTTCGAACAGCTTTCCGGC
GGGGCTATCTCTATCTTTGGTAAACCCGCCAGCAATCTGCCACCGTGGGAGCGGGACGTG
AATACTGTCTTTCAGGACTACGCGCTATTTCCGCATATGTCGATTCTTGACAATGTCGCC
TATGGGCTGATGGTCAAAGGCGTGAATAAAAAGCAGCGGCACGCAATGGCGCAAGAGGCG
CTGGAGAAAGTGGCGTTGGGGTTTGTACATCAACGTAAACCGTCACAACTTTCTGGTGGT
CAGCGCCAGCGGGTTGCTATCGCCAGAGCATTGGTGAATGAACCGCGCGTATTGCTGTTG
GATGAACCGCTCGGCGCACTGGATCTCAAATTGCGTGAGCAGATGCAGCTGGAACTGAAA
AAACTGCAACAGTCTCTCGGTATCACTTTTATCTTCGTTACCCACGATCAGGGCGAAGCG
TTATCGATGTCCGATCGTGTGGCGGTTTTCAATAATGGACGCATTGAGCAGGTCGATTCC
CCGCGCGATCTCTATATGCGCCCGCGCACGCCGTTTGTTGCCGGGTTCGTTGGTACATCG
AATGTTTTTGATGGACTGATGGCAGAGAAACTTTGTGGCATGACGGGAAGCTTCGCCCTG
CGACCGGAACATATCCGCCTCAACACCCCTGGTGAACTGCAGGCCAATGGCACGATCCAG
GCGGTGCAATATCAGGGCGCGGCAACTCGTTTTGAACTGAAATTGAACGGCGGTGAAAAA
CTGCTTGTGAGTCAGGCCAATATGACAGGCGAAGAACTGCCTGCCACGCTCACGCCCGGA
CAACAGGTGATGGTTTCCTGGTCGCGTGATGTGATGGTGCCGCTGGTTGAGGAGAGGTGA
ATGGCGATGAATGTATTGCAATCACCTTCACGTCCAGGTCTGGGTAAGGTGTCCGGTTTC
TTCTGGCATAATCCGGGGCTGGGGCTGTTTTTACTGCTGCTTGGCCCGCTAATGTGGTTT
GGCATTGTCTATTTCGGCTCGCTGCTGACACTGTTATGGCAGGGATTTTATACTTTTGAC
GATTTCACCATGTCGGTAACGCCGGAACTGACGCTGGCGAATATCCGTGCGCTGTTTAAT
CCGGCGAATTACGACATCATTCTCCGCACGCTGACTATGGCTGTGGCAGTCACTATCGCC
AGCGCCATTCTGGCTTTTCCAATGGCGTGGTATATGGCGCGCTATACCAGCGGGAAAATG
AAAGCGTTTTTTTATATTGCGGTAATGTTGCCGATGTGGGCGAGCTACATTGTTAAAGCC
TATGCCTGGACGTTATTGCTGGCAAAAGATGGCGTGGCTCAGTGGTTTTTACAACATCTT
GGGCTGGAACCACTGCTGACTGCGTTCCTTACATTACCTGCGGTGGGCGGAAATACGCTG
TCAACTTCCGGGCTGGGGCGCTTTCTGGTGTTTCTCTATATCTGGTTGCCGTTCATGATC
CTGCCCGTTCAGGCGGCGCTTGAGCGTTTGCCGCCGTCATTGTTGCAGGCGTCGGCTGAT
CTCGGCGCACGTCCACGACAAACCTTTCGCTATGTGGTGCTGCCGCTGGCAATCCCGGGT
ATTGCCGCTGGCTCTATCTTTACCTTCTCACTCACACTGGGCGATTTTATCGTCCCGCAG
CTGGTTGGTCCTCCAGGATATTTTATCGGCAATATGGTTTATTCCCAGCAGGGGGCGATT
GGCAATATGCCGATGGCGGCGGCATTCACCCTGGTGCCGATTATTCTCATCGCACTGTAC
CTGGCGTTCGTGAAACGTCTGGGAGCGTTCGATGCACTCTGAACGCGCACCGTTTTTCCT
CAAACTGGCGGCCTGGGGCGGCGTTGTTTTCCTACATTTTCCCATCCTGATAATCGCCGC
CTATGCGTTTAACACTGAAGATGCGGCGTTTAGTTTTCCACCGCAGGGCCTGACGCTGCG
CTGGTTTAGCGTGGCAGCACAGCGTAGTGATATTCTTGATGCCGTGACACTGTCACTTAA
AGTGGCGGCGCTGGCGACATTAATTGCGCTGGTGTTAGGGACGCTGGCAGCTGCCGCGCT
GTGGCGACGAGACTTTTTCGGCAAAAACGCCATTTCGCTGTTACTGCTGCTGCCCATTGC
GCTGCCGGGCATTGTCACTGGTCTGGCGTTATTAACCGCCTTTAAAACCATCAATCTGGA
GCCGGGATTTTTCACCATCGTGGTCGGTCATGCGACTTTTTGTGTAGTTGTGGTGTTTAA
CAATGTCATCGCCCGTTTTCGCCGCACCTCCTGGAGTCTGGTTGAGGCGTCAATGGATCT
TGGGGCCAATGGCTGGCAAACCTTCCGCTACGTAGTGTTGCCGAATCTCAGTTCGGCGTT
ACTGGCAGGAGGAATGCTGGCGTTTGCCTTGTCGTTCGATGAAATCATCGTTACGACCTT
TACGGCAGGTCATGAACGAACGTTACCGTTGTGGTTGCTCAATCAGCTTGGGCGACCGCG
TGATGTACCGGTAACTAACGTGGTGGCACTGCTGGTTATGTTGGTAACAACCTTGCCGAT
CCTGGGGGCCTGGTGGCTAACCCGCGAAGGCGACAATGGTCAATAACCACTGATACAGGA
ATATGCTATGCAACATAAGTTACTGATTAACGGAGAACTGGTTAGCGGCGAAGGGGAAAA
ACAGCCTGTCTATAATCCGGCAACGGGGGACGTTTTACTGGAAATTGCCGAGGCATCCGC
AGAGCAGGTCGATGCTGCTGTGCGCGCGGCAGATGCAGCATTTGCCGAATGGGGGCAAAC
CACGCCGAAAGTGCGTGCGGAATGTCTGCTGAAACTGGCTGATGTTATCGAAGAAAATGG
TCAGGTTTTTGCCGAACTGGAGTCCCGTAATTGTGGCAAACCGCTGCATAGTGCGTTCAA
TGATGAAATCCCGGCGATTGTCGATGTTTTTCGCTTTTTCGCGGGTGCGGCGCGCTGTCT
GAATGGTCTGGCGGCAGGTGAATATCTTGAAGGTCATACTTCGATGATCCGTCGCGATCC
GTTGGGGGTCGTGGCTTCTATCGCACCGTGGAATTATCCGCTGATGATGGCCGCGTGGAA
ACTTGCTCCGGCGCTGGCGGCAGGGAACTGCGTAGTGCTTAAACCATCAGAAATTACCCC
GCTGACCGCGTTGAAGTTGGCAGAGCTGGCGAAAGATATCTTCCCGGCAGGCGTGATTAA
CATACTGTTTGGCAGAGGCAAAACGGTGGGTGATCCGCTGACCGGTCATCCCAAAGTGCG
GATGGTGTCGCTGACGGGCTCTATCGCCACCGGCGAGCACATCATCAGCCATACCGCGTC
GTCCATTAAGCGTACTCATATGGAACTTGGTGGCAAAGCGCCAGTGATTGTTTTTGATGA
TGCGGATATTGAAGCAGTGGTCGAAGGTGTACGTACATTTGGCTATTACAATGCTGGACA
GGATTGTACTGCGGCTTGTCGGATCTACGCGCAAAAAGGCATTTACGATACGCTGGTGGA
AAAACTGGGTGCTGCGGTGGCAACGTTAAAATCTGGTGCGCCAGATGACGAGTCTACGGA
GCTTGGACCTTTAAGCTCGCTGGCGCATCTCGAACGCGTCGGCAAGGCAGTAGAAGAGGC
GAAAGCGACAGGGCACATCAAAGTGATCACTGGCGGTGAAAAGCGCAAGGGTAATGGCTA
TTACTATGCGCCGACGCTGCTGGCTGGCGCATTACAGGACGATGCCATCGTGCAAAAAGA
GGTATTTGGTCCAGTAGTGAGTGTTACGCCCTTCGACAACGAAGAACAGGTGGTGAACTG
GGCGAATGACAGCCAGTACGGACTTGCATCTTCGGTATGGACGAAAGATGTGGGCAGGGC
GCATCGCGTCAGCGCACGGCTGCAATATGGTTGTACCTGGGTCAATACCCATTTCATGCT
GGTAAGTGAAATGCCGCACGGTGGGCAGAAACTTTCTGGTTACGGCAAGGATATGTCACT
TTATGGGCTGGAGGATTACACCGTCGTCCGCCACGTCATGGTTAAACATTAAGGATAATA
TTGCAGATCGTAAGAGTATGAGATGATCTTGCGTACTGTCAGAGCACTGATTTCTCTGAC
AGTACGTGCTGCGTGCAAAATCACTACATCAAATAAACCAGCCAAATCTCATAGAGATAA
GAGTAAACAAACCAACAGCAGCAAAGAAATTTATCAGTACTACAGTTCTACTGGAAACAT
TCATTTTTGCCACCTTTTATCATTGCCCCTATGTGTATAGTACGGGTTAAGAAAATCCGC
AATAATACTCATTCTGAAGATGGATAAGGGCAAGTTGCTGTTTGATGATTTTTTCTCAAA
CTGGTGAAAAAACTTGATGCACGTCAAAAAATGACGCATATTTGCGCGCGTTTTATTCAT
CTGGCTGGACGCCCGTACATGTCTCTCTATCAACACATGCTTGTTTTTTATGCGGTTATG
GCAGCAATCGCATTTCTTATCACCTGGTTTCTTTCTCACGATAAGAAACGCATCCGTTTC
TTAAGCGCCTTTCTGGTGGGGGCAACATGGCCGATGAGTTTCCCGGTGGCGCTGTTGTTT
TCACTGTTTTAAATCTTACTCACTGGCTTGACGGCACCACGCAGACTTATATCATTTGGA
TGAATCGATAAATTTCACAAGTGGCTAAGGAGAAAGTATGTCGCATCTGGATGAAGTCAT
CGCGCGCGTGGATGCCGCGATTGAAGAGAGCGTCATTGCCCATATGAACGAATTATTAAT
CGCCCTGAGCGATGACGCGGAGTTAAGTCGGGAAGATCGCTACACCCAGCAGCAACGTCT
GCGCACAGCGATCGCCCATCACGGTCGCAAGCATAAAGAAGATATGGAAGCGCGCCACGA
ACAGTTAACCAAAGGCGGCACCATCCTCTGATTAAAATGAGCGTCTGGCTACCAACCAGG
CGCCAACCACAAGTAAAATTGCGCCACAAATTGGGCCGAACAACGCCCGTAGTGGTACGC
CATGACTGCGGAAGATATCCAGCATCAGACCGCCAATCAGCTGACTGGCGACCAGTACAG
CAATAGTTGTCGCCGCTCCCACATTCTGATATCCGCTGATACTGGCGAAGACAAAAAACG
ATCCCAGCAAGCCAGGTATAAGTGTCCACCAGCGCACGCTGGACACCAGTTCGCCAAACC
CCGCCATGCCTTGTTTAAACCATAAAATAGAAACAAAGAGCACAATCCCCACCAGTGAGT
TCAGCAACATGGCGATGAGAATGGTAGAGGAGGTCTGGGTGATGCGCACCATCAGCGTGT
TCTGGACAACCAGACCAATTCCGGCGGCAATCAAAAAAGCAAGGGTGAGCGACTGATTCA
TCCAATCGCGTCCGGTTCAGTGCGCTCGTCGAGTTGCAACTGCATAAATGTCAGATCCAG
CCAACGACCAAATTTAGTGCCTACCTGCGGCATTTGCGCGGTGACGACAAATCCCAGCGA
CTGGTGGAGATGCAGCGAGGCCTGATTTTGCGATTCGATCCCGGCGACCATGACATGCTT
CCCGCAATCCCGCGCTTCATCAATCAATCGGCTTAACAATTTACGCCCCAGACCTTTGCC
CTGATGATCGGGATGGACATAAACCGAATGTTCCACGGTATGGCGAAAACCATCGAAACT
ACGCCAGTCGCCAAACGAGGCATATCCCGTCACTACGCCGTTTTCCTCGCTCACCAGCAC
TGGATAACCTGCTAAAGTCCGCGCTTCAAACCAGGCAATGCGGTTATCAGCATCCACCGT
TTGGTCATTCCAGATAGCCGCCGTATACAACACGGCGTGGTTATAAATTTCCGCAATGGC
AGCACAGTCGGCTTTGCGGGCAAAACGGATGGACATGTCTGGCCTCAATAAAATAATGAT
GATGATGTTATCAATACTATCGAAAACAGCCCGAAGCAACGGATTCCTCGATGAAATTAT
TGCGTGTTGCAGAGGGGATGTGACGGCTGCAAACAAAACCAATCCCGTGAGCCTGCTACT
ATTGATGGATTCATGCCAAAAGCACAGGAGAGCATTATGGGGCAACAAAAGCAGCGTAAT
CGACGTTGGGTTCTGGCCTCGCGTCCACATGGCGCACCTGTTCCGGAGAATTTCCGTCTT
GAAGAAGATGATGTCGCCACACCGGGTGAAGGACAGGTGTTACTGCGCACAGTTTATTTG
TCCCTGGACCCGTATATGCGTGGACGTATGAGCGATGAGCCATCTTATTCACCGCCTGTT
GATATTGGCGGCGTGATGGTCGGCGGTACGGTGAGCCGTGTCGTGGAGTCGAATCATCCT
GATTATCAGTCTGGCGACTGGGTGCTGGGCTACAGTGGATGGCAAGACTATGACATATCC
AGTGGTGATGATCTGGTGAAACTTGGCGATCATCCGCAAAATCCATCGTGGTCGCTGGGT
GTGCTAGGGATGCCAGGCTTTACCGCTTATATGGGCCTACTGGATATCGGTCAGCCTAAA
GAGGGCGAAACGTTGGTGGTAGCTGCGGCGACAGGACCAGTGGGGGCGACGGTGGGGCAA
ATCGGCAAACTTAAAGGTTGCAGAGTGGTGGGGGTAGCCGGTGGCGCGGAAAAATGCCGC
CATGCTACCGAGGTGTTAGGCTTCGATGTTTGTCTTGATCACCACGCGGATGATTTTGCC
GAACAACTGGCGAAAGCGTGCCCAAAAGGTATTGATATCTATTATGAAAACGTGGGCGGT
AAGGTATTCGATGCGGTGCTACCGTTACTTAATACATCTGCGCGCATTCCCGTCTGCGGA
TTAGTGAGCAGCTATAACGCTACAGAGCTACCACCCGGTCCGGATCGTTTACCTCTGTTG
ATGGCTACAGTGCTGAAAAAACGTATTCGCTTGCAAGGTTTTATTATCGCTCAGGATTAT
GGTCACCGCATCCATGAGTTTCAGAGGGAGATGGGGCAATGGGTGAAAGAGGATAAAATC
CACTACCGCGAAGAAATTACTGACGGTTTAGAGAATGCGCCACAGACGTTTATCGGCCTG
CTGAAGGGTAAAAACTTCGGCAAAGTGGTGATCCGCGTGGCGGGTGATGATTAAAGTTTC
AACGGCGGCGTAAGCCGCCATAAAAATCCAGGCAAAAAGCTTATTTTCAGCTTTAATTAA
CTAACCACATCATTGTTCTGCTGCTAATAACAACAAAGGTGAGTGGTTTATGATTATTCA
CTTTAATACACCAGGTGAATTCCTTCTGCCATGCAGGCAGGGTTGGACAGAAAACACGCG
AAGGAATTAAAATGCCTGGAACGGGAAAAATGAAACATGTCAGTTTGACTCTGCAGGTTG
AGAACGACCTGAAACATCAGCTTAGTATTGGCGCATTAAAACCTGGCGCACGCCTGATTA
CTAAAAATCTGGCGGAGCAATTAGGTATGAGTATTACACCTGTGCGTGAAGCATTATTAC
GTCTGGTTTCGGTGAATGCGCTTTCTGTCGCACCTGCACAAGCATTTACAGTTCCGGAAG
TGGGGAAACGTCAATTAGACGAAATCAATCGGATCCGCTACGAACTGGAATTAATGGCAG
TTGCTCTGGCTGTTGAAAACCTCACCCCGCAAGACCTTGCGGAACTCCAGGAATTGCTCG
AGAAATTACAGCAGGCGCAAGAAAAGGGCGACATGGAACAAATCATTAATGTAAACAGGC
TATTTCGCTTAGCGATTTATCATCGCTCAAATATGCCCATCCTGTGTGAGATGATTGAGC
AACTGTGGGTCAGGATGGGGCCTGGTTTACATTATCTCTATGAAGCGATTAATCCAGCGG
AATTACGGGAGCATATAGAAAACTATCATCTGTTACTCGCTGCGTTAAAAGCAAAAGACA
AAGAGGGATGCAGACATTGTCTTGCTGAAATTATGCAACAAAATATTGCTATTTTATACC
AGCAATACAATCGTTAAAGTAAATGCCCGGCAAATACCGGGCATCAAGGTAATTACTCAA
ATCTCCACGCAATATTCATGCCGACACCATAATTTCGTCCGGGCGAAGGTTCGTAATATC
GCCCGTTTGACTCATTGACAATGACAGAACCAACGTATTCTTTATCGAATAAATTATCGA
CACGACCAAATAAATCCACAGTTAAATTGTGGTAATTGTATTTATACCCGGTGAATAAGC
CGACGAGAGTATAAGACGGCGCTTTTGCCGTATTTTCATCATCTGCCATAATATCGCCCA
TATAACGCGCTTCCGTGCCTGCATACCAACCATCTTCCGGTACATAACCTATCGACGCAA
AGCCCATATTACGGGCGATCCCTGGCATCCGATTACCGTTACAATCCTGTTCATTGCAAA
CATTGCTGCGATAGGTCGCATCAAGCCAGGTCCAGGACGCGTTTACGCGAAAATCTCCTG
CGAAACGTTGATCCCATGCCAGTTCAGCGCCTTGACGACGGGTCTTTCCGGCATTTTTGT
AAGTCGTACGCCCACCGCTACTGCTATCGACAACAATTTCATCATCAGTGTCGGTCTGAA
ACAATGCGAGACTAAGCAGCCCATCACCAATACGCGTTTTACTGCCGATCTCAATTGTAT
CGTTGGTGGATGGTTTTAAACCTAAGTTCATACCGCTTTGCCCATCAGCACGATAAGACA
GCTCATTAATCGTCGGCGTTTCAAAACCTCGCCCGGCTGCCAGATAGATATTCCAGGCAT
CGGTCATTGCATATTTTAACGAACCGGCAGGTAGCCATTTATGATAACTGGCATCACCGC
TGTCATCGCCGTTACCCGGAGTAACGTAATGGTCGTTGGAATCAAACCACACGGAGCTGT
AGCGCACGCCAGCATCCAGCGACAGTTTTTCGCTCAGCTGCCACTGCGTCTGTAAATAGG
GATCGATGTTCCACATCAGATTGCGTTCGTCGCGACGCAACTCACCTTTTTGCCCGTACT
CCGGCATGCCGCTATTCAGGCGGAAGTTATTGTAGCCCTTGCGGTTTTCACTCATGTTTT
CGTAGTTCAGGCCGGTAGTGAACGTGACCGGAACGCCCAGTTCACCACGGTGTGTCCAGC
GGCTGTCTATTCCCTGGTAATGGCGTTGCAGGGTAATCACGCCGCCCGCATGTGACGGGT
TAAGTTGTGGTGCCATGGGTATTGACTGGTACTGGGTCGTTTCTCGCTCTCCGGCATACA
TCATCACACTCATATCATCCCGCGAACTCAGGCTACGCTCATAGCGCAACCCAGCCTGAG
TTTGCTTGATGGTTTTTCGCGTGTCGTACTGTTCTGCACGAGGCGCTTGTTGTGGATTAG
CCTTCCATTCTGCTTTGGTTAGCCCACCTGGGTCATCTGCTTTGATATCCACACTATTGA
AAATCAGACTTAATTTGCTGGCTTCATCAATGCGTACGCCCAGTTTGGCATTGGCTAAAT
TTTTCTGTGCGCCACTATGGTCACGATAGCCGTGGGTCGTAAAACGCGTGGTTGAGACGG
TGTAATCGACATCGCCAGGCTGTGTGCCGTCTCCCGTTGCGCCCGTTGCTTTCAGCCCAT
AGCGCCAGCTGCCAAAACTGCCGTAGTAACTACTGGCTTCAATGGTTGGTGGCTGTTGTC
CGGTCTGGGTGGTGACATTCATTACCCCACCAGACGCGTTGCCATACAGGGCAGAGAAGG
GGCCACGCAGCACTTCCACATTTTGCACACTGCTTAAATCGATGTTGGATGTTTGCCCTT
GCCCGTCGGGCATGGTGGCGGGAATACCGTCCACATACAGGCGAATACCGCGAATACCGT
AAGTGGAGCGGGAGCCAAATCCGCGAATCGACAGCTGTAAATCTTGCGCATAGTTCTGCC
GGTTTTGTACCTGCAAACCAGGCACGCCGGTCAGTGATTCGGACAAGTTAATGCGCGGTG
TTGCCAGGCGCATCTCCTCGCCATCCACCACGCTTACTGCTGCTGGGGTATCCAGTTCTG
AAACCACCTGCGGTGCGGCACTGACAATCATAGTCTGTTCATCAGCGGCAAAAACAACGG
GGGAAAGGACAAGCAGTGCGGGCAAAACGGTCTGTCGGACGGAAAAAATCTTCATGAAAA
AAGCCAGGTTAAGAATGGGAAAACGCCGTCATGGTAATGAAATTGTAAATTTATGGAAAA
TGAAACGGCACAATACGTTAAGTAATTGAGAAAATTGTAGTCGTAACGGCAAGAAATGCT
CCACATTTGAGAAAATAATGATTACCATTCCCATTTATAACAAGAGCGTAACGATGATTA
CGCTTAGCGAAGCATTGTGAAGCAGCAAAAATATCGGTTCATCAAAGGGAGTCGTCATGC
ATTTACGTCATCTGTTTTCATCGCGCCTGCGTGGTTCATTACTGTTAGGTTCATTGCTTG
TTGTTTCATCATTCAGTACGCAGGCCGCAGAAGAAATGCTGCGTAAAGCGGTAGGTAAAG
GTGCCTACGAAATGGCTTATAGCCAGCAAGAAAACGCGCTGTGGCTCGCCACTTCGCAAA
GCCGCAAACTGGATAAAGGTGGCGTGGTTTATCGTCTTGATCCGGTCACTCTGGAAGTGA
CGCAGGCGATCCATAACGATCTCAAGCCGTTTGGTGCCACCATCAATAACACGACTCAGA
CGTTGTGGTTTGGTAACACCGTAAACAGCGCGGTCACGGCGATAGATGCCAAAACGGGCG
AAGTGAAAGGCCGTCTGGTGCTGGATGATCGTAAGCGCACGGAAGAGGTGCGCCCGCTGC
AACCGCGTGAGCTGGTAGCTGACGATGCCACGAACACCGTTTACATCAGTGGTATTGGTA
AAGAGAGCGTGATTTGGGTCGTTGATGGCGGGAATATCAAACTGAAAACCGCCATCCAGA
ACACCGGTAAAATGAGTACCGGTCTGGCGCTGGATAGCGAAGGCAAACGTCTTTACACCA
CTAACGCTGACGGCGAATTGATTACCATCGACACCGCCGACAATAAAATCCTCAGCCGTA
AAAAGCTGCTGGATGACGGCAAAGAGCACTTCTTTATCAACATTAGCCTTGATACCGCCA
GGCAGCGTGCATTTATCACCGATTCTAAAGCCGCAGAAGTGTTAGTGGTCGATACCCGTA
ATGGCAATATTCTGGCGAAGGTTGCGGCACCGGAATCACTGGCTGTGCTGTTTAACCCCG
CGCGTAATGAAGCCTACGTAACGCATCGTCAGGCAGGTAAAGTCAGTGTGATTGACGCGA
AAAGCTATAAAGTGGTGAAAACGTTCGATACGCCGACTCATCCAAACAGCCTGGCGCTGT
CTGCCGATGGCAAAACGCTGTATGTCAGTGTGAAACAAAAATCCACTAAACAGCAGGAAG
CTACCCAGCCAGACGATGTGATTCGTATTGCGCTGTAATAGATATGGCGAGGGTGAAAAC
GGTGAGACTTGCCTGCCTTTTATCACGGCGTATCCGGCACTTTCGTCAGTAATCTGAATT
TGCCCGGCACGTAGCCGGGCAATTTTGCAATTAACTCGCCGTTTCAGGCTTAAACACAAT
TTCCTGTTTTTCTTCATCTTCCTCGACGACTGGCGCAGTGCTGTGAATTTCAGCAACGCG
TTTGCGCACACCAAACCAGCCTATAACCAGCAAAATACCGATAATCGGCAGCGCCGCGAT
AGTATAAGTCCCGTTCGGGTAATCGAACGCCATCAGCACAAGGACACTCAGTAAAAACAG
TAATGTCAGCCAGGAAGTGAAGGGCGCGCCAGGCAGTTTAAAACTGACATCCGCTGCTTT
GCCTTCTTTAATCGCTTTACGCAGGCGCATCTGGCACACGATGATAAACGCCCATGAAGC
GATGATTCCCAGCGACGCGAAGTTCAACACAATCTCAAATACGCGCGACGGCACCAGATA
GTTGAGGAATACGCCGACGACATACACAACTAGTGTCGCCAGAATCCCGGCATACGGCAC
ATGCTGACGACTCATTTTCGCCATAAAACTCGGTGCGGAACCGCCCATCGCCATTGAGCG
CAGAATACGTCCGGTGCAGTACAGACCTGAATTCAGGCTGGAGAGGGCAGCGGTCAGCAC
CACAATGTTCATAATGCTGCCGATATATGGCACACCCAGTTTAGAGAAAAACGTCACGAA
CGGACTTTGCCCCGCCTGATACGCGCTCCACGGCAATAACATAACCAGCAACACCACGGA
GCCGACGTAAAACAGGCCAATACGCCAAATCACACTGTTAATGGCTTTAGGCACCATGGT
CTGCGGATCTTTACATTCTCCGGCAGCTGTACCCACCATTTCAATGGAGGCAAAAGCAAA
CACTACGCCCTGAATCAACACCAGCGCAGGCAGCAAACCGTGGGGGAAGAAGCCGCCATT
ATCGGTGATTAAATGAAAGCCAGTGGTGTTGCCATCCAGCGGCTGACCACTACCGAGGAA
CACTGTACCCACGACCAAAAAGGTCACAATGGCGAGCACTTTAATAAGCGCAAACCAGAA
CTCCATCTCCGCAAACCATTTCACACCGATCATATTCATGGTGCCAACGATGGTAAGTGC
AGCGAGCGCAAAGACCCACTGCGGCACGCCGCCAAACGCACCCCAGTAATGCATATACAG
AGCGACGGCGGTAATATCAACAATCCCCGTCATCGCCCAGTTGATGAAGTACATCCAGCC
AGCAACATAAGCGGCTTTCTCACCCAAAAACTCACGGGCATAAGAAACAAAACTGCCACT
GGAAGGGCGGTGTAGCACCAGCTCACCCAATGCACGCAGAATAAAAAACGAAAACAAGCC
ACAAATTAAATAAACCAGTGCCAGTGCGGGCCCCGCCATTTGCAGTCGGGCTCCTGCACC
TAAAAACAAGCCGGTGCCAATCGCGCCGCCAATGGCGATCATCTGCACCTGGCGATTGCC
CATCGCTTTGTGATACCCCTCTTCGTGGGCATTAAGCCAGCGGCGTTTCGCGGCGTGTTG
ATCTGAAGTGTCGGTGTCGTGTTTACTCATTGCTCTCCCTGATTGCTTTAATGAAAAAGT
CATATAAGTTGCCATGAACAATGTTTATTCATCCTGGCGATGATAGTTATCACCATTATT
CTTTATGGGTATAAAACTATCGGCGCAGCATCCTACCCGTTATCGATAAACGATGCAAAA
CATCCCCTTACAATCCTGAAGGGGATTAATACAACTGACGAAAAAATGACAAATCCTTTT
GCTGGTTAACCTGTGTACTGTCCTACACTTAATCTTTAAAAGATTGTGAGGGGCATATGA
TTAAGGTGTATGGCGTACCCGGATGGGGCTCTACAATCAGTGAGCTGATGCTAACACTGG
CTGATATTCCTTATCAGTTCGTTGATGTCAGTGGTTTTGACCACGAGGGAGCTTCACGCG
AGTTATTGAAAACCCTGAACCCGTTGTGTCAGGTTCCGACACTGGCATTGGAAAATGACG
AGATTATGACGGAGACAGCGGCGATTGCATTGATGGTTCTCGATCGTCGCCCGGACCTTG
CGCCACCGGTTGGGCGCGCCGAACGTCAGCTGTTTCAACGGCTATTGGTCTGGCTGGTTG
CTAATGTCTATCCAACATTCACTTTCGCCGATTACCCTGAGCGTTGGGCTCCTGACGCAC
CTGAACAGTTAAAGAAGAATGTTATTGAATATCGAAAATCGCTTTATATCTGGTTGAATT
CGCAGCTCACTGCTGAACCTTATGCGTTTGGTGAGCAACTAACGCTGGTGGACTGTTATC
TTTGCACTATGCGCACATGGGGGCCTGGGCATGAATGGTTTCAGGATAATGCCACGAATA
TCAGTGCGATTGCTGATGCTGTATGTCAGTTACCGAAATTACAAGAAGTATTAAAAAGGA
ATGAAATTATTTGAGTGGGATACCAGAAGATTATGTTATTTATTATTCAGTAACTTTATC
CACAATGATGGGCGTAATTAATTAAATTCATGGTATGTTTTTTAATTTATATCACTCTCC
TTTTCATTCAGCGTGTCTATTTCATTTCCTCTGAAAAGAAACTAACTATTCACATCGTGC
AGATGTTTCAGTTGTTATCACAGGCATTCTATAATCTCAAAATGTTTTTAATGATGGATA
TGCTCGGAGTTGGAGATGCAATTAATATTAATACAAATAAAAATATCCGGCAGGTATGCT
AAAAGGATAAATGGCGTTCTCTGTATTTATTCGCAATTATCTGTAGGACAAATATGGAGA
GCTTGATGAGTCAGAGCTAAAACAGCAATTGATTAATAAACATGTTGATTTATTCAAGAA
AATGGATGTATTTTAAATGTTGATTCTTAATATAACCTAATCAATAGATTATCAAGTGAG
AGCTACACATTATTGGAGGGGCAGGGGAAAACACCATTTTGGGAACAATGCATCAGGTAC
TCTTACCACTGAAGCAAGATCATCCGGCACCAGGTGGTGGTGCAGTGCTTTGGAAATGGT
CCCCTCGGGGGAGTTGTCATTATTTTCTATGCTATTTGCTTATTATATTCATCAGGTGAA
TTTAATAAATTCCTAATTTGAAATATCCACTATTAAGCTAGTGTTTAACGACGTTAAGAT
GGCAATGTGCAGATCATGTTATCAGGGTGGGGCGGTAGCGTATATTCCTTATACAAACCA
TCATTCATTTCAATGATTGTTATTGAATTATTTATTGTTGTGAATAAAAAGACATTATGA
ATATTGGTTTGACTTTGCATATCAGGTTTTTTATTACTCGCTGTAATGTACGAGCCTGTC
GTGAATAACGTCGAGAACCCATCCGTTGCGTTTGTGATTATTTTGTTGACTAAACAGACA
CCCGTTTCTCTGAAGTAAAATCCCAGACTAAATCATCACATAACCATGACATTTTTCTGA
TATTCCCCGGTAACGCCAGATGTCGACTCGCTTAACCACCCTCAGCCATACCAGTGAAGG
CCACCGCGTGTCGGTCCACTACGGCTATGACGATAAAGGCCGCCTGACCGGCGAACGCCA
GACGGTGGAGAACCCGGAGACGGGGGAACTGCTGTGGCACCATGAGACCGGACATGCGTA
CAACGAACAGGGGCTGGCAAACCGCGTCACGCCGGACAGTCTGCCGCCGGTGGAGTGGCT
GACCTACGGCAGCGGCTATCTTGCGGGCATGAAGCTGGGCGGGACGCCGCTGCTGGAGTT
CACGCGCGACCGCCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAA
TGCCGCATATAAACTGACCAGCACATACACCCCCGCAGGCCAGTTACAGAGCCAGCACCT
GAACAGCCTGGTGTATGACCGTGACTACGGGTGGAATGACAACGGCGACCTGGTGCGCAT
CAGCGGCCCGCGACAGACGCGGGAATACGGCTACAGCGCCACGGGCAGGCTGGAGAGTGT
GCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCACGGACCCGGCGGGCAA
CCGGCTGCCGGACCCGGAGCTGCACCCGGACAGTACACTCACAGTGTGGCCGGATAACCG
CATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAGAA
GACGGACCGCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCA
CTACGACAGCCAGCACCGCCTGGTGTTCTACACGCGGATACAGCATGGCGAGCCACTGGT
CGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACGGGTCTGGCGGCG
GGAGCGTGACCTGACGGGGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGG
CTGGGACGGAGACAGGCTGACGACGGTGCAGACTGACACCACACGTATCCAGACGGTATA
CGAGCCGGGAAGCTTCACGCCGCTCATCCGGGTCGAGACAGAGAACGGCGAGCGGGAAAA
AGCGCAGCGGCGCAGCCTGGCAGAGACGCTCCAGCAGGAAGGGAGTGAGAACGGCCACGG
CGTGGTGTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAAGAAATCCGGGC
AGACCGCGTGAGCAGTGAAAGCCGGGCGTGGCTTGCGCAGTGCGGGCTGACGGTGGAGCA
ACTGGCCAGACAGGTGGAGCCGGAATACACACCGGCGCGAAAAGTTCATTTTTACCACTG
CGACCACCGGGGCCTGCCGCTGGCGCTCATCAGCGAAGACGGCAATACGGCGTGGCGCGG
GGAGTATGATGAATGGGGCAACCAGCTTAATGAGGAGAACCCGCATCACCTGCACCAGCC
GTACCGTCTGCCAGGGCAGCAGCATGATGAGGAGTCGGGGCTGTACTATAACCGTCACCG
GCACTACGATCCGTTGCAGGGGCGGTATATCACCCCGGACCCGATTGGGTTGAGAGGTGG
ATGGAATATGTATCAGTATCCGTTGAATCCCATACAAGTGATAGACCCAATGGGGTTAGA
TGCGATTGAGAATATGACATCAGGTGGACTAATTTATGCCGTATCTGGTGTACCTGGATT
GATTGCTGCAAACAGCATTACTAACAGTGCTTACCAGTTCGGTTATGATATGGATGCTAT
TGTTGGCGGAGCTCATAATGGGGCCGCCGATGCAATGAGACATTGTTACTTGATGTGTCG
AATGACTAAGACATTTGGATCAACAATAGCTGACGTGATAGGTAAAAATCATGAGGCGGC
AGGGGATAGACAAGGTCAGCCAGCTAAAGAAAGAATCATGGATCTTAAAAATAACACTGT
CGGTATTGCTTGTGGCGATTTTTCTGCCAAATGTAGCGATGCATGTATTGAAAAATATAA
CACTGGGCAACTCTTCGGGTTAGATGGTATAAAAGCAGATAATCCAATAAAAGCAAAGCA
AGGGAGTTCAGATGCTTCAAATTATTAGAGGCAAACTTGTCATTTTTTTAATTACCCTTT
GTTTATTTGTTGTTTACCTTGGGTTTGATAACAATTCAAATTCTGACATCGTATTTTATG
GACATAAAACACCAAAGAGCGTTGAGATATATCTTTCTGAAAAAAATATTATTTATAAAA
TAATTAATGACCAAAAAATTAGTAGAGGGAATGGTCATTTTATAAGTATAATGGTTAATA
ATTACAGGACGCACTGTGGAGTGGTTGATATAAATCTTAATTTTTTCAATGATATTCTTT
ATAGCGTGCGATTAAAAAACATTAGTAAACTGGAGAATATGGAGTTCTGCGCTACAAAAC
AACGGGTGTATTTTAGTGATAAAAACAAGAAGGCTAGTTATAAAATAATTAATTATGGAG
ACTATTATGATGTTGATTATTATGATAACAATTTGAAAAATGAAGTTTTTGACTGGATTG
GTAAATGGTCATAATGAACAACACCAGAAAGAGAAAAATATAAAATACATACAGAAAGAC
ATGAGAGCAAGGGACGGGGCAGGGCAAGATCATGAAAATTGTGATGTAAATCACGATTTT
CATCTTTGCTTTAACGCCTACAGGTGATCAAAATTTAACCTTTGGAATAACTAAAAAGAT
AAAAAAGGACGCCAGGTGAGTATTCAAAGTTTGCTTGATTATATTTCAGTGACCCCTGAT
ATACGACAACAAGGAAAGGTTAAACATAAATTATCTGCTATTTTGTTTCTCACCGTATGT
GCAGTAATTGCAGGTGCCGATGAGTGGCAGGAAATTGAAGATTTTGGACATGAAAGACTT
GAATGGCTAAAGAAATATGGTGATTTTGATAATGGCATTCCGGTCGATGACACCATTGCA
CGCGTTGTGAGTAACATTGACAGTTTGGCCTTTGAAAAGATGTTTATTGAATGGATGCAG
GAGTGCCATGAAATCACTGATGGTGAAATTATAGCAATAGATGGAAAGACCATAAGAGGC
TCCTTTGATAAGGGAAAAAGAAAAGGAGCAATCCATATGGTGAGTGCATTCTCGAACGAA
AATGGTGTTGTACTGGGGCAGGTGAAAACGGAAGCCAAAAGTAATGAGATTACAGCCATT
CCAGAGTTGCTTAACCTACTGTATTTAAAGAAAAATTTGATAACCATTGATGCTATGGGC
TGTCAGAAAGATATCGCTTCGAAGATCAAAGATAAAAAAGCAGATTATCTTCTGGCAGTA
AAAGGCAATCAGGGGAAATTACATCATGCATTCGAGGAAAAATTTCCTGTAAATGTGTTT
TCTAATTATAAAGGCGATTCGTTTAGTACGCAGGAGATAAGTCATGGAAGAAAAGAAACA
CGTTTGCATATTGTCAGTAACGTAACGCCTGAACTTTTGTGATTTTGAATTCGAATGGAA
GGGATTAAAAAAGCTTTGTGTAGCATTGTCATTCAGGCAGAAGAAAGAAGATAAATCAGC
AGAAGGTGTAAGCATCCGATATTATATTTCATCAAAGGATATGGATGCTAAAGAATTTGC
ACATGCTATCAGAGCGCACTGGCTGATCGAGCACAGTCTTCATTGGGTGTTAGATGTAAA
AATGAATGAAGATGCCAGCCGGATAAGAAGAGGAAACGCAGCCTAAATAATATCTGGAAT
AAAGAAGATGGCACTGAATTTATTAAGAGATTGCAAAGACATTAAGGGTGAAGAGGAAAA
GAAAGAAGGCTGCGTTAAACACAGGGAAAGATCATCAGAAGTTCACTTTTTGTACTAAAC
AATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTTATT
GCTTACACATGATCAAATACTCCTTACATAATTAAGGAGAACAAAATGGAACTTAAAAAA
TTGATGGGACATATTTCTATTATCCCCGATTACAGACAAGCCTGGAAAATGGAACATAAG
TTATCGGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGCTGGGAA
GATATAGAGGATTTTGGGGAAACACATCCCGATTTTTTGAAGCAATATGGTGATTTTGAA
AATGGTATTCCTGTTCACGACACCATTGCCAGAGTTGTATCCTGTATCAGTCCTGCAAAA
TTTCACGAGTGCTTTATTAACTGGATGCGTGACTGCCATTCTTCAGATGATAAAGACGTC
ATTGCAATTGATGGAAAAACGCTCCGGCATTCTTATGATAAGAGTCGCCGCAGGGGAGCG
ATTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGACAGATCAAGACG
GATGAGAAATCTAATGAGATTACAGCTATCCCAGAACTTCTTAACATGCTGGATATTAAA
GGAAAAATCATCACAACTGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATACAA
AAACAGGGAGGTGATTATTTATTCGCGGTAAAAGGAAACCAGGGGCGGCTAAATAAAGCC
TTTGAGGAAAAATTTCCGCTGAAAGAATTAAATAATCCAGCGCATGACAGTTACGCAATG
AGTGAAAAGAGTCACGGCAGAGAAGAAATCCGTCTTCATATTGTTTGCGATGTCCCTGAT
GAACTTATTGATTTCACGTTTGAATGGAAAGGGCTGAAGAAATTATGCGTGGCAGTCTCC
TTTCGGTCCATAATAGCAGAACAAAAGAAAGAGCTCGAAATGACGGTCAGATATTATATC
AGTTCTGCTGATTTAACCGCAGAGAAGTTCGCCACAGCAATCCGAAACCACTGGCATGTG
GAGAATAAGCTGCACTGGCGTCTGGACGTGGTAATGAATGAAGACGACTGCAAAATAAGA
AGAGGAAATGCAGCAGAATTATTTTCAGGGATACGGCACATTGCTATTAATATTTTGACG
AATGATAAGGTATTCAAGGCAGGGTTAAGACGTAAGATGCGAAAAGCAGCCATGGACAGA
AACTACCTGGCGTCAGTCCTTACGGGGAGCGGGCTTTCGTAATCTTGCCCTGGGCATTAT
TGTCGTATAAACGCTTTACCGGACACATGACATTCACAATGTGTGTTAATTTTACTGACA
TCTTTCAAAAGGAGCGTAATCATGCCGCACATCGACATTAAATGTTTTCCGCGTGAACTG
GACGAACAACAAAAAGCAGCACTTGCTGCAGATATTACCGACGTTATTATTCGTCATCTG
AACAGTAAAGACAGTTCGATAAGCATTGCTCTACAGCAGATTCAACCAGAATCTTGGCAA
GCTATCTGGGATGCCGAAATCGCGCCCCAAATGGAGGCTTTGATAAAGAAACCTGGTTAT
AGCATGAATGCTTAACCCGCCGTAACACGCTTGCCGCTGGTAACAAACGTCCCAGCACCT
AAATGATGCAACGTATTGAGCTTATCATCATCAAACTGCCAGCGGCCTTCGACAAATACC
CGTGCGTCTGCCGCTGCTGATACTACTTCGCCAAACAGCGTGTCGTATTCTTCTTGCGCA
GAAGTCGCAGGTAGCAATCGACACTCCATCCACGCCAGACATTTTTCCTCGACCAGAGGC
AAACCAAATACCGGGCCTCTCACAACCGGAATGCCATAGCAATTAAATTTATCTTCATCA
CGCCCCGACACACTTCCCACCGCCCACGTCCAGTTAGTTGCTGCAACGCCCGGGATAACG
ATGCCAAATTTACCGTTATGTTCAATCAACTCCCTGGTCCATGTCGATTTATCTACCACA
ATCGCCACGCGTGGAGGTTCAAACTCCACCGGCATTGACCAGGCTGCAGCCATAATGTTA
CGCCGCTGGGATTGCTCATCGAAACTGGTGATCAAGACCGTTGGGCCATGATTTAACAGA
CGGCTGGCATGGTGTAATTCTATGGGGATGAATCGGCTCATGGTATCGCCTCGCGAAGAA
GGTTTTTTTAAGCGTAGTCCGTAACGCAATAAGTAACGAAATTAACGGGATTGGCGATTT
GCGAACGTGATGCATGTCCGCGATCGCACAAAATAGCCGGTGCGGCGTCTATTCCAGGTT
ATAAGTTGAGAAAACCACTAAGGGAAACGCCTGATGACGCCCATTCTGAATCACTATTTT
GCCCGTATTAACTGGTCGGGAGCTGCTGCGGTCAATATTGATACGCTTCGTGCATTGCAC
CTGAAACACAATTGCACCATTCCGTTTGAAAACCTCGACGTTTTGCTGCCGAGGGAAATA
CAGCTTGATAATCAATCGCCGGAAGAGAAACTGGTGATAGCCCGTCGTGGCGGTTACTGT
TTTGAGCAGAATGGCGTGTTTGAGCGGGTGTTACGCGAGCTGGGGTTTAACGTTCGCAGC
TTGTTAGGGCGCGTAGTGTTATCAAATCCGCCAGCATTACCGCCGCGCACCCATCGTTTG
CTGTTGGTGGAACTGGAAGAGGAAAAATGGATTGCTGATGTCGGTTTCGGTGGGCAGACG
CTAACCGCGCCGATTCGTTTAGTTTCCGATCTCGTGCAGACCACGCCACACGGAGAGTAT
CGGTTGTTGCAGGAGGGTGATGATTGGGTGTTGCAGTTTAATCATCATCAGCATTGGCAG
TCGATGTACCGTTTTGATCTCTGCGAGCAGCAACAAAGCGATTATGTGATGGGCAATTTC
TGGTCGGCGCACTGGCCGCAGTCGCATTTTCGCCATCATTTGCTGATGTGCCGCCATTTG
CCGGACGGCGGCAAGCTGACACTGACCAATTTTCATTTTACCCATTATGAAAATGGGCAC
GCGGTGGAGCAGCGAAATCTACCGGATGTGGCGTCATTATATGCTGTGATGCAAGAACAG
TTTGGTCTGGGCGTGGATGATGCGAAACATGGCTTTACCGTGGATGAGTTAGCGCTGGTG
ATGGCGGCGTTTGATACGCACCCGGAGGCGGGAAAATAATTTATGTCAGGTTGCCGGATG
CGGCGTAAACGCCTTATCCGGCATACATTAGCCCGGTTGTAGACCTGACAGGCGAAGCGC
ATCAGACAACGGTTTCAGAGTTCAATTGCCCATTCGGCATGAAACAAAATCACCGCTGTG
CCTGAAATGGTGACTTTTTCCGGTTGGTTATCACGAATTGTCACCGTCACTTCAATCATA
CCGTCACGCCCCAATGCGCGCCCCTGATGGCCTTTAACACGCAACACGTTGCCATCGTGG
GGCAATACGTTGTGATGTACCAACCATGCACCCATCGGGCCATTGGCATTGCCAGTCACC
GGATCTTCCACAATACCAATCGCAGGCGAGAACATGCGACCATCGGTTTCGTTTTTGCCT
GGGCGGATCTGGAACGGGAAGAAACCATTGCAGCCAATCTTTTTGCTGATAGCGGTCAGC
GCATTAAGGTCAGGCGAAAGGGCGTCGATATCCACTTCCGGTTTCAGTGGGATCATCACT
TTTGAGTGTCCTGTTGTTGCCACCTGAATTGGCAAGCCTGGCAGAATATCGTCCTCAGTG
AGATGAAGCGCGTTGATAATCGCCGCACGTGTTTCACCTTCCAGCGGTGGCTCAAAGCCC
GGCGTACCTTGTTCCAGCGAAATACGATAATCATCGTTGTGCTTTTCGATAGTCACGCGA
TGTTTTCCTGCCAGCGATGTTTGCCAGATCGTGCAATTTCCTAAACCTAACACCTTCGCA
CGTACATAGTGCGCAGCTACTGTCGCGTGACCGCAAATCGGCACTTCAACCGTTGGCGTA
AAGTAGCGGATGCGCACATCGCTGTCGTCGCTGTGCAGCAGAAAAGCAGTTTCCGAATGG
CCTAACTCGCGGGCGATAAGCTGCATTTGCGCTTCGCTAAGATTATCGGCGGGGAAAACA
ACACCGGCAGAATTGCCGCGAAACGGTTGTGAGGTAAAAGCATCGACGTGGTACACCTGC
GGTTTCATTAACGTTCTCCTGTGACTGGAGAACTATCATAGCCTGCAAGTGGCCGGAGAG
CGAAGGGCTATCCGGCCAGGGTGAAATTATCGCCGCGAACGCACAATTTGATATCGACGA
GTAAAGTACTCAAACGGCGCGCTCCACACATGCACCAGTCGGGTGAACGGGAAGAGCAGG
AAGATGGTCATTCCCAACACCAGATGCAGGCGGAAGACGAACGCTACGCCGTTGAGCATC
TCTGACGATCCACCACGGAAAGTGACAATGCTTTGCGCCCAACCCACCAGCTTCATCATT
TCGCTACCATCAGGATACTGTGCTGAAAACGGTATGGTACTTAGCCCCAACAGACACTGG
ATCAGCAAAATGCTCATGATGATGATATCCGGCGTAGTGGAAGTGGCACGCACGCGCTGA
TTTGTCAGCCTGCGCCACAGCAGTCCTGCGCCGCCAATCAACGTCAACACACCGCAAATA
CCGCCGAGCACCATCGCCATGAGTTGTTTCGCTGCCACTGGCAAAAACCACGCGTACATC
CAGTGCGGCGTTAACATGCCGAACAAGTGCCCGAAGAAAATCCCCAAAATGCCGATATGG
AACAGATTCGACCATATCACCATCCCGCGTTTATCGAGCATTTGACTTGAGGAGGCGCGC
CAGGTGTACTGCCCGTAGTCGTAGCGCAGCCAGCTGCCGAGGAAAAACACCGTCGCACAA
ATGTACGGGTAGATATCGTAAAAAAAGACGTTCAGATACTGAATCATTTCCCACCTCCCG
CACTGATGTCGACATATTGCGGCGCGACATCCTGGCTAAAGCGTCGCTGATATTGATTAA
GCGGCGAGCTGTCACACGCCGTGGCGTTATCTTCAATAAACTTCACCTGTTCCTCTTCCC
ACACTGCATCAAGCGCCTGGCGGGTGTCATCGCGCTCTTCGCTGTTTACTTGTTTTGTGA
CACTGTCACTTGAAAGGGAGCTTCCCGCCAGTTGCAGCAGAGCATCAAACAACGCGTACC
ACGGTGCCTCGCGTTGTTTTAAGCGACCGCCAAGCAGGGCGAGGATCGGCGCAACATTGA
GCAATCCTTCTTTCGCCTGATCGTCAGGCAGTACGCTTAAATACTCCAGATACAGCGGTA
GATAATCGGGCAGTTCCCGACAATCCAGCTGCAGGCCGACCTTTTCATACTCCGCCAGCA
GGTCCACCATTGCCTGGCCGCGATCGCGGGACTCGGCATGAACATGTTCGAACAGCAGCA
GCGACGTGGTGCGCCCGCGGTCAAACACTTCGCACCATTCGGCCTGTTTATCCAGCAGCG
GCGCGTTAAGCAGGTTGTGGGTGAAATCCGTAAGCATCGGCGCGTCGCGGCGGATCAACG
CCAGCGCGTCCTCCTTGCATTCCCACAACAGCTCGTCCGGATACTCCATCAACAGGCCGA
TCACTTTGAGGATCTGCATTATTCGCCCTCCGCTTTGTCGCGCACTTCGGTGATGTTGAT
GGCATCGATACGGCTACTGTTGAACAGGTTGAATTTACTGTCCGAACCGTGGCAACCGTC
GCCAAAGGTAAAACCGCAGCCGTTGCGTTCTGCGAAGGCATCGCCCGCCATTTCCCGATG
GCTGGTCGGGATAACAAAACGATCTTCATAGTTGGCAATGGCGAGATAGCGATACATCTC
TTCGACCTGGGCGACGCTCAGGCCTACTTCGTCGATGGCACGAGTATCAGTAACGCCTTC
CACGGTTTGTGAACGCATATAGTGGCGCATCGCCATCATCCGTTTCAGCGCCCGCAGTAC
CGGACCGGTATCGCCGGCACTCAACATATTGGCGAGATATTGCACCGGAATACGCAGGCT
TTCGATGGCGGGCAGCACGCCTTCGCTTTTCGGCAAACCGCCCGCATCTGCGTAGGACTG
AATCGGTGACAGCGGAGGAACGTACCAGACCATCGGCAGGGTGCGGTATTCAGGGTGCAA
CGGTAGTGCCAGTTTCCAGTCCATCGCCATTTTGTAGACTGGCGAACGCTGGGCAGCGTC
AATCACATTTTGTGGAATACCTTGTTTCAGGGCTTCCTCGATCACTGAGGGATCGTGTGG
ATCGAGGAACACTTCGCACTGGCGTTCATAGAGGTCAACTTCGCGCTCGGTGCTCGCCGC
TTCCTCGATGCGGTCGGCGTCGTAAAGCAGCACGCCCAGATACCGGATGCGACCCACGCA
GGTTTCTGAGCACACGGTCGGTTGACCGGACTCAATTCGTGGGTAACAGAAGATGCATTT
TTCTGACTTGCCGCTTTTCCAGTTGAAGTAGATTTTTTTGTACGGACAACCGCTTATGCA
CAAACGCCAGCCACGGCATTTATCCTGATCAATCAGCACAATGCCGTCTTCTTCGCGTTT
GTAGATAGCGCCGCTTGGGCAGGTCGCCACGCAGCTGGGATTGAGGCAGTGTTCGCACAG
GCGCGGCAGGTACATCATGAAGGTGTTTTCAAACTGCCCGTACATCTCCTTTTGCATGGC
CTCGAAGTTGCGGTCGCGGGCACGTTTTTCGAACTCACCGCCCAGCAGTTCTTCCCAGTT
TGGCCCCCAGATCACTTTGTCCATCCGTTTGCCGTCAATCAGTGAACGCGGGCGAGCAGT
AGGAATATGTTTGCCTTCCGGTGCGCTATGCAAATGTTCGTAGTCGAAGGTGAAAGGTTC
GTAGTAATCATCAATCTGCGGCACCACCGGGTTGGCGAAGATTTTGGTTATTACGCCCAT
CTTGTTGCCCAGACGCGGGCGTATCTTGCCATTCACATCACGCACCCAGCCGCCTTGCCA
CTCTTCCTGATCTTCCCAGTTTTTCGGATAACCAATGCCCGGTTTGGTTTCGACGTTGTT
AAACCATGCGTACTCCATGCCTTCGCGCCCGGTCCAGACGTTTTTACAGGTCACCGAACA
GGTATGGCAGCCGATACATTTGTCGAGGTTAAGCACCATGCCGACTTGTGAACGGATTTT
CATTTTTTCGCCTCCTGTACCTGATCGCGACCTTCATCATCCAGCCAGTTAACGTTCTTC
ATCTTGCGGATCATGATGAACTCATCGCGGTTCGATCCGACGGTGCCGTAGTAGTTAAAG
CCCCAGGCCAGCTGCGCGTAACCGCCAATCATATGCGTTGGTTTCGGGCAAACGCGGGTA
ACCGAGTTATGAATGCCGCCGCGCATGCCAGTTACTTCCGAACCAGGAATATTCATAATG
CGTTCCTGGGCGTGATACATCATGGTCATGCCCGGCGGTACACGTTGGCTGACCACCGCG
CGGGCAGTCAGCGCGCCGTTGGCGTTGAATACTTCCACCCAGTCGTTATCGACAATGGTC
AGTTCTCGGGCATCTGTTTCGCTGATCCAGACAATCGGTCCACCGCGAGAGAGCGTCAGC
ATTAGCAGGTTTTCACTGTAGGTTGAGTGAATGCCCCATTTCTGGTGCGGCGTCAGGAAG
TTAAGTGCTTTTTCCGGGAAGCCGTTTGGCGGTATCTGGCGCATCTCACTGACGCTACGG
GTGTCGATAGGCGGGCGATAAGCCACCAGGCTTTCACCAAAAGCACGCATCCACGGATGA
TCCTGATAGAGCTGCTGGCGTCCCGACAGCGTGCGCCACGGAATTAACTCATGAACGTTG
GTGTATCCCGCGTTATAGGAGACGTGATCGCTTTCCAGACCGGACCAGGTGGGGCTGGAG
ATAATTTTACGCGGCTGCGCCTGAATATCGCGAAAGCGAATCTTCTCGTCCTCTTTGTGC
AGCGCCAGATGGGTATGTTCGCGCCCGGTGATCTCGCCCAGCGCCTGCCACGCTTTGACT
GCAACATGACCGTTGGTTTCCGGTGCCAGTGCCAGAATCACTTCTGAAGCGTCAATGGCG
GTGTCAATCAGCGGACGCCCCTGTGCCGGGCCATCACGCTTGGTGTAATTGAGTTTGCCG
AGGAAATCGATTTCATCCTGGGTATTCCACGAAATCCCTTTACCGCCATTGCCAAGTTTG
TCCATCAATGGCCCGAGCGAGGTAAAGCGTTCATACGTAGCAGGGTAGTCGCGCTCCACC
GCCACAATATTCGGCGCGGTTTTGCCTGGAATCAGATCGCATTCGCCTTTGCGCCAGTCG
AGCACTTCACACGGCTGTGAGAGCTCTGCCGGAGAGTCATGCAGTAGGGGTTGTAATACC
ACGTCGGTTTCTTTGCCAAGATGACCCACGCACACTTGCGAAAATGCTTTGGCGATACCT
TTGTAGATTTCCCAGTCGCTGCGTGATTCCCACGCCGGATCGACCGCCGCAGAAAGCGGA
TGAATAAACGGATGCATATCCGAGGTGTTCATATCGTCTTTTTCGTACCAGGTGGCGGTG
GGCAGAACGATATCGGAGAACAGGCAGGTACTGGACATGCGGAAGTCGAGCGTCACCAGC
AGGTCGAGCTTGCCTTCAATCGCTGCAGTTTGCCACTCGACTTCTTCCGGTTTGATCCCG
TCGCTGGCACCGAGTTCCTCGCCCTGAATCCCGCTTTCGGTCCCCAGCAGATACTTCTGC
ATATACTCGTGGCCTTTGCCGGAGGAGCCAAGCAGGTTAGAGCGCCAGACAAACAAATTA
CGCGGATGATTGCTGCTGCTATCTGGTTGTTCGCAGGCCATACGTAAATCGCCCGATTTC
AGCGCCTGGGCGGTAAATTCTGTGGGGGATAATCCGGCCTTGTCGGCTTCAGCTTTAATC
CCGAGCGGGTTACGCCCCAGCTGCGGCGCAGAAGGTAGCCAGCCCATACGTTCGGCGCGA
ACGTTGAAATCAATCAGATGACCGCTGTACTTACTGGCATCGGCGAGCGGTGAAAGTAAC
TCCTGAGCAGAGACTTTTTCATAGCGCCATTGGCTGGAATGATTGTAGAAAAACGAGGTG
CTGTTCATTTGGCGCGGTGGTCGGTTCCAGTCGAGCGCAAAGGCCAGTGGCAACCAGCCG
GTTTGTGGGCGCAGTTTTTCCTGGCCGACATAGTGTGCCCAGCCGCCACCGCTTTGCCCG
ACACAACCGCAGAAGATCAGCATATTGATCATCCCGCGGTAGTTCATGTCCATGTGATAC
CAGTGGTTAACACCTGCGCCGAGGATAATCATCGAGCGCCCATGCGTTTTATGGGCGGTA
TCGGCAAATTCACGGGCGATGGTTTCAATATACTGGCGCGGCACGCCGGTAATTTGCTCA
CCCCAGGCTGGGGTGTACGGTTTGATTTCAGCGTAATCTTTCGCACTGTTTTCATCTTCC
AGCCCGCGATCGAGGCCGTAATTCGCCAGTACCAAATCATAAACGCTGACCACCGGACAG
GTGTTGCCATCGACTAACGTCAGGTTTTTAACGGGCAATTGGCGCACCAGCACCGGATTG
TGTTTTACGCTGCGAAAATGCGGATTTTCAATGCCGCCAAAGTAGGGGAAGGCCACGCCT
GCAACAGCGTCATGTTGACCGAGCAGGGTTAACGACAATTCGGTTTCCGTACCGGCGGCA
ATGGATTCCAGATTCCATTTGCCTTTTTCTCCCCAGCGGAAACCAATCGAACCGTTCGGC
ACTACCAATTCACCTGCGGTATTAACTGCTACGGTTTTCCACTGCGGATTGTTGCTTTCG
CCCAGTCCATCCACCAGGTCAGATGCGCGGATCATGCGCCCGGGAACGTAGCTACCATCG
TCGCGAGGCTCCAGCATTACCAGCATCGGCATGTCGCTGTAGCGGCGGCAGTAGTTGATA
AAGTAGTCGCTGGGATTATCGAGATGAAACTCTTTTAAAATCACATGGCCCATTGCCATC
GCCAGGGCGCTATCAGTGCCTTGTTTCGGTGCCAGCCACTGGTCGCACAATTTGGCCACT
TCAGAGTAGTCAGGGGTAATGGCGATGGTTTTAGTGCCTTTGTAGCGTACTTCGGTAAAG
AAGTGGGCGTCCGGCGTACGTGTCTGCGGTACGTTAGACCCCCAGGCGATGATGTAGCTG
GAGTTATACCAGTCGGCAGATTCCGGTACGTCGGTTTGCTCGCCCCAGGTCATCGGCGAG
GCGGGCGGCAGGTCGCAATACCAGTCGTAGAAACTTAAACAGGTGCCGCCAAGCAGCGAC
AGATAACGCGTTCCGGCGGCGTAAGAAACCATCGACATCGCCGGGATCGGCGAGAAACCG
GCAACGCGATCCGGGCCGTAGGTTTTGATGGTCCAGACGTTAGCGGCGGCAATCAGCTGG
TTTAGTTCCTGCCAGTTGGAGCGGATAAACCCGCCGCGCCCACGCACTTGTTTGTAGCTC
AGGCACTTTTGCGGATCGTTCATAATCGATGCCCACGCCAGTACCGGATCGCTGTGTTGC
TTGAGGGCTTCGCGCCACAGTTCAATCAGTCGTTTACGAATGAGCGGGTATTTCAGGCGG
TTAGCGCTGTAAAGATACCAGGAGTAACTTGCGCCACGCGGGCAGCCGCGAGGTTCATGA
TTGGGCAGGTCAGGGCGAGTGCGCGGGTAGTCGGTCTGTTGGATTTCCCAGGTCACCAGA
CCATTTTTAACGTAGATTTTCCAGCTACAGGAGCCTGTACAGTTAACACCGTGGGTGGAA
CGCACGATTTTGTCGAACTGCCAACGCTGGCGATAGCTGTCCTCCCAGTCGCGGTTGCTA
TGCATCACCTGTCCGTGACCATCGGCAAAGGTTTCGCCCTTTTGTTTGAAGTAGCGAAAG
CGATCCAAAAGTTTACTCATGACATGACTCCTGCTCCAGGAATGAATTGGGATCTGATGC
CTTGTCGGATGCGACACGGTTGTACATCAGGCATCGATCTCTTATTTTTGGCTGAACTTC
CGCCGACCATAAACCAGCCAGGTCAGCAGCACACAAACGATGTAGAAGATTAAAAACACT
TTCATCGCGCCGACCGGAGAGCCGGTCATATTGAGCGACATGCCAAACGCCTGCGGAATA
AAAAAGCCGCCCACTGCGCCAATGGCTGAGATAAAGCCCAGAGCCGCCGCCGTTTCGGTG
ACGGCTTCTTTATGAGCTTGCTCATCACTACCGCCTTTCATCTTTACCCGATAAATGGTT
ATCTGGCGAAAGATGACGGCGATCATCTGGAAAGTAGAACCACTTCCCAGACCCGCAGTC
AGAAACAGCCCCATAAATACGGCGTAAAAGGCGATGAAATTACCGGAGCCTGTGCCCGGT
AAGGTAAGGAACAGCAGGGCACTGAAAATCGCCATAAAAATAAAGTTGATCAACGTCACC
CGCACGCCGCCGAACTTATCGGAAATAGCACCACCAACCGACCGCGCGATGGCACCGATA
AATGGGCCAAAGAACGCCAGGCGCAGAATATTCACATCCGGGAACTGGGTTTTTGCCAGC
ATGGCAAAACCCGCAGAAAAACCGATAAACGAACCGAAGGTGGCAAGGTAAAGCAGGCTC
AGCAGCCAGAGATGCAGGCGTTGTAAGACAGGGAGCTGGTCGGCAATTGAGGCGCGTGAA
CTGGCGATATCATTCATCCCTGACCATGCGGCGATCGTGGCAATCGCCAGTAGCGGTACC
CAAATCCATGCGGCATTCGCCAGCGACATCACCGAACCGTCGGCCTGCGGTACGCCATTG
ACGCCGAGAAAGGCAAATACAGGTACAAAAATGACCAGCGGTGCAACCAGCTGCATTACA
CTTACACCTAAGTTTCCTAATCCGCCATTAATCCCAAGAGCGCTCCCTTGTTTGGCTTTT
GGAAAGAAGAAACTGATATTGCCCATGCTCGAAGCAAAGTTTGCACCTGCAAAACCGCAT
AGCAAAGCGATAACGATAAATATCCCAAAAGGAGTATTCGGATTTTGCACGGCAATTCCG
AGCCAGACGCAAGGAATAATCAGGATTGCAGTACTAAAAACCGTCCATCGGCGTCCACCG
AATATAGGCACCATAAAGGAGTAGGGAACACGCAATAATGCGCCAGAAACGGAGGGTAAT
GCGGTTAATAAAAAGAGTTGATCGGTAGTAAAATTAAAACCGATTTTATTGAGATTAACG
GTAACTGCGCTAAATAGCATCCAGACACAGAAGGCAAGAAGTAGACAACTGACTGATATC
CAGAGATTTCTTCGAGCAATATGTTTTCCTTTATTTTCCCAGAAGGCCGGATTTTCTGGT
TTCCAGTCGCGCAAAAGATAACGACTATTTTTCTCATTTTGCAGTGCCATATTGTTCCTC
ACATGCACACATTGGTAATGAAAAAAAGACAAAACACGAGGTAAGGCGCAATAGCCAGTT
ATTAGAATTAAGGATGAATTGGGTGAAGTGCTGATTGAAAGAATAGATAAGAAAGCGTAA
CCGCGGGGGCAGAATGGGGATTAAGTAGCCAGATATGTGTTACTAAATGTAACTAACAAG
CTAACCTTCAAACGGGGTTAATCTTTGAACGTATGTCATGTTTCAACCCTTCAGATCGTG
AATCTAAAGGGTTACATATTAACTATATTATCAACAAGACCAGACACTTATAGAATTAGT
GATGATTTATTCACTAAAAAGGCCATGAACTGGAGGAAAACGATCTGTCCAGAAGGTCTA
TCGGTTCCTCTCTTATTGCCTGATTGTAATAATCGTTATTACAGTAAGTATTGTTTATTT
CATCTAAGGTCATGTTTTTAACTTTTATATTCATCTGGTTTACAACTTCCTCTGTCTTGT
AAGTGTGTATATTATATGGGGTATATGCTTTTTTAATAGGATAGTGAAACAATTCGTTAT
CCACATCTATTCCGTCAGAGTGAACTTCAAATGCACCAGGCGAAAGAATTGCCAGGCCAG
TATTAAGCTTAAGTGCTGGGGAAAACAAATTAAATAACATGAGCTGCATAGTAGGGCAAT
TGTTCTTCCCAGAAACATTTAAAAAATTTAAGTTTTGCTCTGTTTTATTATGGGGAATAA
AGTTCCAATATCGGATGTATTATTAGTATCAATGTGGGTTATTTTATTATTGTCCAGTCT
TAAACTTTTGATAGATGGAAGATAAGTCAGGAAATCAAGATTTATATATTTCAACTGGTT
GTTAGCAGCGTTTAATGTCTGAACATTGCAGAAGTTGCTATAGAATATTTTAATTTCAGA
AAGCAAATTGTTGTTAATAAGTAACGTATTCAAGTTGGGAAATAAGTCATTGTGTAAACT
TGTTAGTTTATTATGGGATAGATCCAGCAGTAAGAGTTCATTTTTATTACCTGCAACAAT
ATCAGTTAATTGATTATGGCTGAGATTCAGGTATTGCAGCCATTCGCAAGATTCTAATTG
CACAAACTCTAGTTGATTATGTGCCGCACTAAAATAAGTAACTGATGAAAGCCTATCTAT
ATCAATATTTCTGAGAGCATTATTATTCATAGATATATGTGTAATACTTACATTTCTGCC
TTGAGGAAAATTTATTGACTCAAGAGCATTACTATTCAGACTTAGCTTTACGAGTCTATC
GTAGTTGGTTGCATCAAAATGTGTGAATTGGTTATTATCAAGATTGATAGATGTGAAGTT
TTGCAGCCCTGGTGGTTGAGTGGTTAAATTAAGTCCTGATAAATCAATGGTCACTTCATT
AGTGTCATCAATTATATTTCTTACTGCAGTCCAGTACTGCATTTGTGCAAGTGGATCATT
GTTGATGCCGTTAACTAATACATGCCAAAGATGTTTTGATGATATTAGTTGATCAATGTC
ATTGGTTGGCAGTAAATTGTTATTGCTTAAGTTTAAATATTCCAGTTTTGTAGTGTTTTT
GGCGTTTAAATGTGCAATATGGTTGTCGTTTAAAGTGATTGTTTTCATCCTGGGATGATT
GTGTAATATAAGGTCAGTGATCATATTGTGATGGGCACTTAACTCAATCAGAGATTCTTG
CCGCGCGAGCCGTTGGCTTCATCGTTATAGCCTTTAAAATCATATTCCCAGTGACCAAAA
CCAATCATTTGATCATTGATTTGCGTTTCTCCTTTAAAGCCGAGACGGGCATAAGTTTTA
TCACCATCGTCACGCTTATCATCAGTAAAATAACGTAGAGCGGTAACCTTGCCATAAAGG
TCGAGTTTATTACCATCCTTGTTATAGACTTCGGCAGCGTGTGCTACGTTCGCAGCTAAC
AAACCAGTTACAACCACCGCAACTATTTTTAATTTCATTTAACAGAATCCTTTTAATTAT
CGTTAAACGTATTTTCTAAACGAATTTTAAACGGCGTCATTTATAAATGACATACTGTTT
TTAAAATAGAATGGTGATTAAAAACAATGAGAAAAATAGATGAAATAATATTATTTATCG
ATATGTGATCGAAGTCGAAATGAGATATAAGGTGAATTACTGGTATTTGAAATTTATTTT
TTTAATATTGTCGGAATTTATCTGATTAACTACCGGGCCGTAGACCCGGCAGTTATTTTA
ACCACGACGTGTCGCCAGCCAGCAGAGCAGGGAACCGCCGCAGACCATCAGCGCGCCTTG
CCAGAACGAGAACGACAGCGGGGCGCTGAGCAGCACGGCTGCAAGCGCTGAGGAAAGTAC
AGGCGTAAAATACGAACCTACCGCCATAATGGTGACATTGCCATGCAATATACCGACATT
CCATGCAGCATAAGCAAATCCTAAGGTAAATGCCGCAGAGATGAGTTTAATCATGACGGG
CGTGCTAAATATCATTTCTGGTTGTGGCGTAAGAAAATAGTAAACCCACAGACTTGCTCC
CGTTAGCAGGACAAAAACGGTAATTCCATTAAATCCGCGTGCGTATTTATTCGTTACTGT
GCAATAGGCTGCCCAGATAAACGCACCAATGAACGCCAGGAAATAACTCAATGGGCTGGT
GGTGATATTATTGATGATTTCATCATAATGTAACCCATTGTCACCGCCTAACACCCAACA
GACGCCGACGAGGGCTAATAATAATCCAGGTACAATCAACCAGTTGGTTTTCTGACCATT
AAACAGAATGGCAAAGAGAATTGTCAGGCTGGGCCACAGATAGTTCACCATACCCACTTC
AATCGCCTGATGATGGGTCGCCGCATACCCTAAGGAAAGCGCCAGACAGATTTCATAGCT
GACGAATAACAGACTCCCGGCGAGTAAATAGCCTTTCGGGATTTGCCGAATACGCGGAAA
TCCAACCGTGAAGATTAACAGCAGCCCGCTTAATGAATAGATAGCAGCTGCGCCGCCGAC
CGGGCCGAGCCCCTCACTGACACCGCGAATCAATCCTACCATCGTGCTCCACAGGACGAT
CGCTATCAGCCCTATGAGCGTTGCTTTTTGTCGTGTCATGCTCGCTGTTTTGTCTCTCTT
GCCGTTAAAAATTAAGCTGAATTTTATAGCATTTTTTTAACTGGCCTGTCAGGCAGTGGT
GCGTTTTTCTACCGCTATTGAGGTAGGTCAATTTGCGAAGGCGGATTATTTTGTGGCAAA
CAGATGTTCTTTTTGATTTCGCGCAAAAAGATTCAGAATTTTACTGTTAGTTTCCTCGCG
CAGTAATACCCCTGAAAAAAGAGGAAAGCAATGGACGTCAGTCGCAGACAATTTTTTAAA
ATCTGCGCGGGCGGTATGGCTGGAACAACAGTAGCGGCATTGGGCTTTGCCCCGAAGCAA
GCACTGGCTCAGGCGCGAAACTACAAATTATTACGCGCTAAAGAGATCCGTAACACCTGC
ACATACTGTTCCGTAGGTTGCGGGCTATTGATGTATAGCCTGGGTGATGGCGCAAAAAAC
GCCAGAGAAGCGATTTATCACATTGAAGGTGACCCGGATCATCCGGTAAGCCGTGGTGCG
CTGTGCCCGAAAGGGGCCGGTTTGCTGGATTACGTCAACAGTGAAAACCGTCTGCGCTAC
CCGGAATATCGTGCGCCAGGTTCTGACAAATGGCAGCGCATTAGCTGGGAAGAAGCATTC
TCCCGTATTGCGAAGCTGATGAAAGCTGACCGTGACGCTAACTTTATTGAAAAGAACGAG
CAGGGCGTAACGGTAAACCGTTGGCTTTCTACCGGTATGCTGTGTGCCTCCGGTGCCAGC
AACGAAACCGGGATGCTGACCCAGAAATTTGCCCGCTCCCTCGGGATGCTGGCGGTAGAC
AACCAGGCGCGCGTCTGACACGGACCAACGGTAGCAAGTCTTGCTCCAACATTTGGTCGC
GGTGCGATGACCAACCACTGGGTGGATATCAAAAACGCTAACGTCGTGATGGTGATGGGC
GGTAACGCTGCTGAAGCGCATCCCGTCGGTTTCCGCTGGGCGATGGAAGCGAAAAACAAC
AACGACGCAACCTTGATCGTTGTCGATCCCCGTTTTACGCGTACCGCTTCTGTGGCGGAT
ATTTACGCGCCTATTCGTTCCGGTACGGACATTACGTTCCTGTCTGGCGTTTTGCGCTAC
CTGATCGAAAACAACAAAATCAACGCCGAATACGTTAAGCATTACACCAACGCCAGCCTG
CTGGTGCGTGATGATTTTGCTTTCGAAGACGGTCTGTTCAGCGGCTACGACGCTGAAAAA
CGTCAATACGATAAATCGTCCTGGAACTATCAGCTCGATGAAAACGGCTATGCGAAACGC
GATGAAACACTGACTCATCCGCGCTGTGTGTGGAACCTGCTGAAAGAGCACGTTTCCCGC
TACACGCCGGACGTCGTTGAAAACATCTGCGGTACGCCAAAAGCCGACTTCCTGAAAGTG
TGTGAAGTGCTGGCCTCCACCAGCGCACCGGATCGCACAACCACCTTCCTGTACGCGCTG
GGCTGGACGCAGCACACTGTGGGTGCGCAGAACATCCGTACTATGGCGATGATCCAGTTG
CTGCTCGGTAACATGGGTATGGCCGGTGGCGGCGTGAACGCATTGCGTGGTCACTCCAAC
ATTCAGGGCTTGACTGACTTAGGCCTGCTCTCTACCAGCCTGCCAGGTTATCTGACGCTG
CCGTCAGAAAAACAGGTTGATTTGCAGTCGTATCTGGAAGCGAACACGCCGAAAGCGACG
CTGGCTGATCAGGTGAACTACTGGAGCAACTATCCGAAGTTCTTCGTTAGCCTGATGAAA
TCTTTCTATGGCGATGCCGCGCAGAAAGAGAACAACTGGGGCTATGACTGGCTGCCGAAG
TGGGACCAGACCTACGACGTCATCAAGTATTTCAACATGATGGATGAAGGCAAAGTCACC
GGTTATTTCTGCCAGGGCTTTAACCCGGTTGCGTCCTTCCCGGACAAAAACAAAGTGGTG
AGCTGCCTGAGCAAGCTGAAGTACATGGTGGTTATCGATCCGCTGGTGACTGAAACCTCT
ACCTTCTGGCAGAACCACGGTGAGTCGAACGATGTCGATCCGGCGTCTATTCAGACTGAA
GTATTCCGTCTGCCTTCGACCTGCTTTGCTGAAGAAGATGGTTCTATCGCTAACTCCGGT
CGCTGGTTGCAGTGGCACTGGAAAGGTCAGGACGCGCCGGGCGAAGCGCGTAACGACGGT
GAAATTCTGGCGGGTATCTACCATCATCTGCGCGAGCTGTACCAGTCCGAAGGTGGTAAA
GGCGTAGAACCGCTGATGAAGATGAGCTGGAACTACAAGCAGCCGCACGAACCGCAATCT
GACGAAGTGGCTAAAGAGAACAACGGCTACGCGCTGGAAGATCTCTATGACGCTAATGGC
GTGCTTATTGCGAAGAAAGGTCAGTTGCTGAGTAGCTTTGCGCATCTGCGTGATGACGGT
ACAACCGCATCTTCTTGCTGGATCTACACCGGTAGCTGGACAGAGCAGGGCAACCAGATG
GCTAACCGCGATAACTCCGACCCGTCCGGTCTGGGGAATACGCTGGGATGGGCCTGGGCG
TGGCCGCTCAACCGTCGCGTGCTGTACAACCGTGCTTCGGCGGATATCAACGGTAAACCG
TGGGATCCGAAACGGATGCTGATCCAGTGGAACGGCAGCAAGTGGACGGGTAACGATATT
CCTGACTTCGGCAATGCCGCACCGGGTACGCCAACCGGGCCGTTTATCATGCAGCCGGAA
GGGATGGGACGCCTGTTTGCCATCAACAAAATGGCGGAAGGTCCGTTCCCGGAACACTAC
GAGCCGATTGAAACGCCGCTGGGCACTAACCCGCTGCATCCGAACGTGGTGTCTAACCCG
GTTGTTCGTCTGTATGAACAAGACGCGCTGCGGATGGGTAAAAAAGAGCAGTTCCCGTAT
GTGGGTACGACCTATCGTCTGACCGAGCACTTCCACACCTGGACCAAGCACGCATTGCTC
AACGCAATTGCTCAGCCGGAACAGTTTGTGGAAATCAGCGAAACGCTGGCGGCGGCGAAA
GGCATTAATAATGGCGATCGTGTCACTGTCTCCAGCAAGCGTGGCTTTATCCGCGCGGTG
GCTGTGGTAACGCGTCGTCTGAAACCGCTGAATGTAAATGGTCAGCAGGTTGAAACGGTG
GGTATTCCAATCCACTGGGGCTTTGAGGGTGTCGCGCGTAAAGGTTATATCGCTAACACT
CTGACGCCGAATGTCGGTGATGCAAACTCGCAAACGCCGGAATATAAAGCGTTCTTAGTC
AACATCGAGAAGGCGTAAGGGGGCGAACAGATGGCTATGGAAACGCAGGACATTATCAAA
AGGTCCGCAACTAACTCCATCACGCCGCCTTCTCAGGTGCGTGATTACAAAGCAGAAGTC
GCAAAACTTATCGACGTTTCCACCTGTATCGGCTGTAAAGCCTGTCAGGTGGCGTGTTCG
GAGTGGAACGACATCCGTGATGAAGTGGGGCACTGCGTCGGGGTTTACGATAACCCCGCC
GATCTGAGCGCCAAGTCCTGGACGGTGATGCGCTTTAGCGAAACCGAACAGAACGGCAAG
CTGGAGTGGCTGATCCGTAAAGACGGCTGTATGCACTGTGAAGATCCCGGCTGCCTGAAG
GCGTGCCCGTCTGCTGGTGCAATCATTCAGTACGCTAACGGGATTGTCGATTTCCAGTCG
GAAAACTGCATCGGCTGTGGTTACTGCATTGCCGGGTGTCCGTTTAATATTCCGCGCCTC
AACAAAGAGGATAACCGGGTATATAAATGCACGCTCTGCGTCGATCGCGTCAGCGTCGGC
CAGGAACCGGCTTGTGTGAAAACCTGTCCGACCGGGGCTATCCACTTCGGCACCAAGAAG
GAGATGCTGGAGCTGGCGGAACAGCGCGTGGCGAAACTGAAAGCGCGTGGTTACGAACAT
GCTGGCGTCTACAACCCGGAAGGGGTCGGTGGTACGCACGTTATGTACGTGCTGCATCAC
GCCGATCAGCCGGAGCTGTATCACGGTCTGCCGAAAGATCCGAAGATCGACACCTCGGTA
AGCCTGTGGAAAGGCGCGTTGAAACCGCTGGCAGCGGCTGGCTTTATTGCCACTTTTGCC
GGGTTGATTTTCCACTACATCGGTATTGGCCCGAATAAGGAAGTGGACGATGACGAGGAG
GATCATCATGAGTAAGTCGAAAATGATTGTGCGCACCAAATTTATTGATCGCGCCTGTCA
CTGGACCGTGGTGATTTGCTTCTTCCTGGTGGCGCTGTCCGGGATTTCGTTCTTCTTCCC
GACGCTGCAATGGCTGACGCAAACCTTCGGTACGCCGCAGATGGGACGCATTTTGCACCC
GTTCTTCGGCATTGCGATTTTCGTCGCACTGATGTTTATGTTTGTGCGTTTTGTGCATCA
CAACATCCCGGATAAGAAAGATATTCCGTGGCTGTTGAACATTGTCGAAGTATTGAAAGG
CAATGAGCATAAAGTGGCGGATGTCGGTAAGTACAACGCCGGGCAAAAGATGATGTTCTG
GTCGATCATGAGCATGATTTTCGTGCTGCTGGTGACCGGGGTGATTATCTGGCGTCCGTA
CTTTGCGCAGTACTTCCCGATGCAGGTTGTTCGCTACAGCCTGCTGATCCACGCGGCTGC
GGGTATCATCCTGATCCACGCCATCCTGATCCATATGTATATGGCATTTTGGGTGAAAGG
ATCGATTAAAGGGATGATCGAAGGGAAGGTAAGTCGTCGCTGGGCGAAGAAACACCATCC
GCGCTGGTATCGTGAAATCGAGAAGGCAGAAGCGAAAAAAGAGAGTGAAGAAGGGATATA
ATCTCTTTTGAACTTTAAGCTGAAAATGGCGCTGTAAAAGGCGCCATTTTCATATTGTAG
ACAACGTAGGCTTTGTTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCATGAAAACCC
TTCAAATCCAATAGATTGCAGTGAACGTGTAGGCCTGATAAGCGTAGCGCATCAGGCAAT
GTTGCGTTTGTCATCAGTTTCAAATGGCGCTGTAAAAGGCGTCATTTTCATATTGTAGAC
AACGTAGGCTTTGTTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCATGAAAACCCTT
CAAATCCAATAGATTGCAGTGAACGTGTAGGCCTGATAAGCGTAGCGCATCAGGCAATGT
TGCGTTTGTCATCAGTTCTAAATGGCGCTTTATAAAGTGCCATTTTTTTATTGCGTAACC
AGACGGCGTAATCGCGACACATCCACTGTTTTTTCTGCCTCTGCCAGACTCCAGGCGTTT
TGCAGATTCAGCCACATTTGCGGCGAACTGCCGATCACCACGGAAAGTTTAATCGCCATT
TCTGGCGTCAAAGCTGCTTTTCCTGTCAGCAATCGGCTTGCCGTTGAGGGAGCAATTTCC
ATTGCTCTGGCAAACTCGCGCAGGCTGACATTAAGTTCGTCCAGTGATTCCTGAATAATG
TCCCCCGGGCGGGGATGATTGGCCATTTTCATTAGTGTCTTTACTCTCAGTAGCGTTCCT
TCACTGGGAACACTATCATTATTGTTCCTTCCTACGCAACAATAATCCATTTAGCCATTT
CATGTTGGAGAGTGTGCGATGCTGCGACCCGAACATGGCAGTCGCAGCAAAGGCCTCTTA
GTGACGGAAATCAATCACCATGCGGCCACGGATTTTGCCTTCTTCCATCTCAGTAAAGAT
GGTGTTGATGTCCGCTAACGGACGCAGGGCGACTTTCGGCACCACTTTACCTTCGGCGGC
AAACTGGAAGGCTTCAGTTAAATCCTGGCGCGTGCCGACCAGCGAACCGACCACTTCAAT
ACCATCCAGCACAAGACGTGGGATATCCAGGCTCATAGACTCCGGCGGTAGACCGACAGC
CACAACACGACCGCCTGCACGGACAGCATCAACTGCCGAGTTAAACGCAGCTTTAGCTAC
CGCTGTTACCACCGCAGCGTGAGCGCCACCAGTTTTCTCCTGCACAATTTTGGCGGCGTC
TTCGGTGTGTGAGTTAATCGCTAAATCTGCGCCCATTTCGGTTGCCAGTTTTAACTGCTC
ATCATTGACATCAATGGCGATCACTTTGGCGTTAAAGACATTCTTCGCGTATTGCAGGGC
GAGGTTACCCAGACCGCCAAGACCGTAGATAGCAATCCACTGCCCTGGACGAATTTTTGA
CAGCTTAACGGCTTTGTAGGTGGTGACTCCCGCACAGGTAATGCTGCTGGCCGCCGCCGA
GTCCAGACCATCTGGCACTTTTACCGCGTAATCGGCGACCACGATGCACTCTTCCGCCAT
CCCGCCATCAACGCTGTATCCGGCATTTTTAACTGAACGGCAGAGCGTTTCGTTACCACT
GTTACAGTATTCGCAATGACCGCATCCTTCGTAGAACCACGCCACGCTGGCACGATCGCC
TGGTTTTAATGAGGTGACACCTGGACCCACTTCTGCCACCACACCGATGCCTTCATGGCC
CAGAATTACGCCGGTTTTGTCACCAAAATCGCCATTCTTAACATGAAGATCGGTATGACA
TACACCACAACACTCCATTTTCAGCAGGGCTTCGCCATGTTTCAGTGAGCGCAGTGTTTT
ATACGTAACGTCAACATGATGATCCTTCGTAACAACTGCAGCCTTCATAGTTCCTCCTTT
TCGGATGATGTTCTGCATAGCAGGTGAGGCAAATGAGATTTATTCGCCACTACCCAGTAT
GGATGAGATCTGAAAAAGGGAGAGGGAAATAGCCCGGTAGCCTTCACTACCGGGCGCAGG
CTTAGATGGAGGTACGGCGGTAGTCGCGGTATTCGGCTTGCCAGAAATTATCGTCAATGG
CCTGTTGCAGGGCTTCGGCAGAGGTTTTCACCGCCACGCCTTGCTGCTGCGCCATTTTGC
CAACCGCAAACGCAATTGCGCGGGAGACTTTCTGAATATCTTTCAGTTCCGGCAGTACCA
TACCTTCGCCGTTCAGCACCAATGGTGAATACTGCGCCAGCGTTTCACTTGCCGACATCA
GCATCTCATCGGTGATACGTGACGCGCCGGAAGCAATAACACCCAGGCCGATGCCCGGGA
AAATAAAGGCGTTGTTACACTGGGCGATAGGGTAGATTTTATCTTTCCATACCACTGGAT
TAAACGGGCTGCCCGTGGCGACCAGCGCGTTACCTTCGGTCCAGGCGATAATGTCCTGCG
GTGTGGCTTCCACGCGTGACGTCGGGTTAGACAGCGGCATCACGATCGGACGCGGACAGT
GTTTATGCATCTCACGGATGATCTCTTCCGTAAACAGCCCGGTCTGTCCTGAGACGCCAA
TCAGAATATCTGGTTTTACATTGCGCACCACATCCAGCAGTGACAGCACATCGCTGTCGG
TATCCCAGTCACTGAGGTTTTCGCGCTTCTGCACCAGTTTGGTCTGGAAAGGCAGCAGGT
TCGGCATCTTGTCAGTCAGCAAGCCAAAGCGATCGACCATAAAGACTTTCTGCCGCGCCG
CTTCCTCGCTTAATCCTTCGCGCTGGGTCTGGGAGATGATCATTTCGGCAATGCCGCATC
CCGCTGAACCTGCGCCAAGGAAGACGATTTTTTTCTCGCTTAACTGACCACCTGCCGCGC
GGCTTGCTGCGATCAGTGTGCCGACTGTTACCGCCGCAGTGCCCTGAATGTCATCGTTAA
AAGAACAAATTTCATTGCGATAGCGGTTAAGTAACGGCATCGCATTTTTTTGAGCAAAGT
CTTCAAACTGCAACAGCACGTCTGGCCAGCGTTGTTTCACAGCCTGGATAAATTCATCAA
CGAATTCATAGTATTCGTCGTCAGTGATACGCGGATTACGCCAGCCCATATACAGCGGAT
CGTTAAGCAGCTGTTGGTTGTTCGTTCCGACATCCAGCACCACCGGAAGGGTATACGCCG
GGCTGATGCCGCCACAGGCGGTATAGAGCGACAGTTTACCGATCGGAATGCCCATCCCGC
CGATGCCCTGGTCACCAAGCCCCAGAATGCGTTCACCGTCAGTCACCACAATCACTTTAA
TATTATGGTTCGGCACGTTTTGCAGAATATCGTCCATATTGTGCCGGTTCTGGTAAGAGA
TAAACACGCCGCGTGAACGGCGGTAGATCTCAGAAAAACGCTCACAGGCTGCGCCGACGG
TTGGGGTATAAATAACAGGCATCATCTCATCAAGATGATTGTTTACCAGACGGTAGAAGA
GGGTTTCGTTAGTGTCCTGGATGTTACGCAGGTAGATGTGTTTGTCGATTTCGGTTTTGA
ATCCCTGATACTGGATCCATGCTCGTTCCGCTTGTTCTTCGATGGTTTCGACCACTTCCG
GCAGTAACCCCAGCAGGTTGAAGTTACGGCGTTCTTCCATGCTGAAGGCACTGCCTTTAT
TCAACAACGGAAATTCCAGCAGTACAGGGCCAGCGTAAGGGATATAAAGCGAACGCTGTT
TTTTTGTTTTTGGTTCCATGTCACTCACTCTTTTTTGAATATCCATCCCTGGGGGGCTTT
TATCGTCTTTGCTTTACCGCCAGGGCGTCGGCCTCAAGTATAAAGCAGATAAAAACAAAA
ACACCATTGCGCAGGCAATGGTGTTTAATCGTCATTGAGGACTGATGGTTATGAATTACT
TTTCAGCGGGGCGTTTTCTGCCGGTTGGGTTATTTACTACGCTGGATTTGTCACCTTCGG
TAACTATTTTGCGCTGGTTAGAAATTTTATGGTCCAGTCCAAGAATATGACGTGCCTGAC
GGTTCGATTTCATTTTAACTCCTCAATCCTGTAGCTAGTTTTAAGGACAACATCGCCGTA
GCGAAGAAACACGTGCTAAACCCCTAAATTAGGTTGCCGATCAAGCATAGCACCTTAAAG
CGTAGGGTGCTGGCCACTGACCACATAATTGATCGTTTGCTGGTAGATATCACTGAGGAT
GTCGTTATCAGAAGCTTCAACCCATTTGGTCAGCTCCATGAGAATGTCATCTTCAGTGAC
AACACCATGCTGTGCCCGAAGGCCTTGCTCAATGGCATTAACCAGAGCGGGTTCTGCTGT
TGAATTTTCTGCCTGATAATAAGTAAACATAGTGATTCTCCGTGTCTGTGTATTTATGGT
GTCTGCTACGGATCGCAGATTTATAAAGCACATTCAGCATGGCAAATATTTGCCGCTTCG
TTGTTAAGATTAGTCCTGGTTGATGATTTTTATATTTTAACACCATGATATTCATAGGGA
TTGTGATTGGTATGATCCGATTAATATTGATACAATATCTTTTGGGTTATATATTCCCGG
TAATCTATTGTGGGAATTTAATTTAAGTGCAGAAGTAATATTTTCGCCGGATTTTATTCG
GAATATCCTGCTTATCCTCGTGCTGTTTCTCACGTAGTCTATAATTTCCTTTTTAAGCCC
ACAGGAGAGCAACAATGACAATCCATAAGAAAGGTCAGGCACACTGGGAAGGCGATATCA
AACGCGGGAAGGGAACAGTATCCACCGAGAGTGGCGTGCTGAACCAACAGCCGTATGGAT
TTAACACGCGTTTTGAAGGCGAAAAAGGAACCAACCCTGAAGAACTGATTGGCGCAGCGC
ATGCCGCATGTTTCTCAATGGCGCTTTCATTAATGCTGGGGGAAGCGGGATTCACGCCAA
CATCGATTGATACCACCGCCGATGTGTCGCTGGATAAAGTGGATGCCGGTTTTGCGATTA
CGAAAATCGCACTGAAGAGTGAAGTTGCGGTGCCGGGTATTGATGCCTCTACCTTTGACG
GCATAATCCAGAAAGCAAAAGCAGGATGCCCGGTCTCTCAGGTACTGAAAGCGGAAATTA
CGCTGGATTACCAGTTGAAATCGTAAAGCATTGCCGGATGACGCGTCAGGCGCGTGAATG
CCTGATGCGTTGTTAGCATCTCTACAGCGCCCGCCAGCACCGGAGCTCACGTCCGTCCTC
CCTTATTGCTAATGATTGCCGGACTTCACATCCGTGGGTTGCCAGCGGGCAACGTTCGTA
GAAAAAACAGCCTTGCGGCAACGTGCGGTTTCCCGGCAGATCCGTTTTACGTAATGCCCA
TTCTTCCTCCAGCGGTTTATCAATGGCGGGGAGGGAATCCAGCAATAATCGGGTGTATGG
ATGTGCAGGTGCCGTCAGCACCTGCTGCGCGTCGCCCAGTTCTACAATCTGCCCGAGATA
CATCACCGCCACCCGATCGCTCATATGACGTATCACCGAGACATTGTGTGAAATCAGCAC
ATAGGTCAGCCCGTGATTTTCCTGTAGCGTTACCAGTAAATTGAGGATCTGCGCCTGAAC
GGAGATATCCAGCGCAGAGGTTGGCTCATCAAGCACAATCACGTCAGGCTGCGAAGAGAG
TGCTCTGGCAATGGCGATACGTTGCCGCTGCCCGCCGGAGAACGCATGAGGCAGGCGGTC
GAGATACTCCGGACGAATACCCACCTGCACAGCCAACTCCTCTGCCAACGCTCGCCGCTG
TTGTTCACTACTACGCTTAGCTATCCAGAGCGGTTCTGTGATGATGCGCCACACCGGTAA
GCGCGGATTAAGCGAAGAGAGCGGGTCCTGAAACACCATCTGCATAATGCGTTGTGAGCC
AGAACGGATGTACTGCCCGTGGCTCGGTTGCAGCATACCCATTAAAAGCTGTGCGAGGGT
GCTTTTGCCGCAGCCTGACTCGCCGACGATCCCTAAGGTTTCACCACGGCGGATCTGTAA
ATCAATACCATTAATGGCATGAACATGTTCCGTAGTTTTACCAAGCCAGTTTTTACGGGC
CGGGAAATTGATATGGACGTCGCGTAACGTTAATAACGTGTCAGACACTTATAACCTCCT
GCTGCGGATACCAACAGGCACAGCGCTGGTTGTTGTCACCACACGCTGTCAGCGCCGGGA
CGTTTTCACACTGTGCACCTGCCGCATAGCAACGATCGCGAAAAGCGCAGCCGTCAGGCA
AATGGGTGAGGTTTGGTACCGTCCCTGGAATGGCGGGTAATAGCTGGCGTGGTACTCCAT
GTTCTGGTGCGCATTGCAGCAAACCAATGGTATACGGATGCCGGGGATGATGGATAACGT
CTGCCGTCACGCCGCTTTCAATTACGCTTCCGGCATACATCACGTAAACGCTATCGCACA
GTTGCGACACCACGGCCATATCATGGCTGATGAACAGAACCGCAGTTCCACTGGCGCGGG
CTTTATGTTTAAGCAAACGCAGTACCTGCAACTGCACCGTGACGTCCAGCGCCGTAGTCG
GTTCGTCGGCAATAATCAATTGCGGCTCGCAGGAGAATGCCAGCGCAATCATTACCCGCT
GGCGCATACCACCTGAAAGCTCAAACGGATAGCGCGACATAACTTCCACGGCATCCGGGA
TTTGCATCTCTTCCAGCAGGTCAATCGCTTTAGCTCTGGCTTCCCGACGACTTATTGGTT
GATGATGGCGGATCACGTCCATCATCTGAAGACCTATTCGACGTGTCGGATTGAGGGCGG
TCATCGGTTCCTGAAAGATCATCGCCACTCGTGCGCCGCGCCACTGACGAAGCTGTTTTT
CCCGCGCGTTAAGAACATCTTCTCCCAGCAGGGAAATCTGCCCCCGATGTACGCAATAAC
TGCCCGTCGGTAGCAGACGCATAATCAGCATTGCGGTGACTGATTTACCTGAGCCGGATT
CTCCCACCAGACCGACAATTTCACCGCGGTTAATCTGCAAGGACACATTGTTGAGCGCGT
GAACATCACCGTTAAAACCGGGGAAACTCAAATGCAGTTGTTGAATGTCCAGAACGGGTT
GGGTCATGACTGCTTTCCTCCTGCTTTCGGGTCAAGCAGATCGCGAATACCATCACCAAA
GAGATTAAACCCGACGGCGGTAAGCAAAATCGCTGCCCCCGGAAATGCGCAATACCACCA
CTGATCGAGTACATAGTTGCGACCATTTGCTACCATCGCGCCCCATTCAGCACTCGGTTG
TTGAGCACCCAGGCCAATAAATCCCAACGTGGCGGCCATTAAAATCGCGCTACCGATATC
CAGCGATGCCTGCACGATCAGCGGCGGTAGGGAGTTACGTAAAATATGCCAGTTGATCAG
ATGCCAACGAGACGCGCCAAAGGTTTTCGCCGCCTGAACATAGGTATACTGGCGTACAAC
TAATGCTTGCCCCCGCGCCAGGCGCACATAAAAGGGAATTCGCACAATAGCAATAGCCAG
CATGGCGTTAAACAAACTCGGCCCGAGAGCGGCAGCCAGTGCCATTGTCAGTACCAACGA
AGGAATCGACAGCATAATGTCCATGATGCGCATGATGATGGCGTCTGCGCGTCCACCAAG
CACACCGGATAGACATCCGAGTAGCGAACCAATCATACCCGCAATGGCAACCACGACTAA
TCCGGCGAGAATTGATTGCTGACTGCCGACCAGTACGCGGCTAAACAGATCGCGTCCCAC
TTCATCGGTGCCAAACCAGTGCGCCGCAGAAGGCGGCAAAAGGCGGGCGGTTAAATCAAT
GGCGTTGGGATCATGCGTCGCCAGCCACGGTGAAAAAATCATCATCAATAGCATTAATAC
AATGATGACTGCGCTGGTCACGGTGAGCGGACTGCCTTTCAGCATCCATACCAGTTTTGC
ACCGTTAAATCGCGTTTGTTTTTGTGGGCGTACGGCGGACGTTTCCTCGCTTAGCATCAT
TCACCACCTCCACGTCCGATACGCGGATCAATCCACAAATAGAGCAAATCCACCACCAGG
TTGACCAGCACATAAGCAAATGAAACCACGACGGCAAAGCCCATCACTGCCGGGAAGTCG
AGCGCCTGTATTGATGTTACTACCCATGCACCCATTCCGGGCCAGGCAAAAACGGTTTCG
GTGAGCACTGCGCCATACAACAAATCGCCCAGCGCCAAACCCAATACGGTAATCGATGGG
ATCAACGCATTGGGTAGCGCATAACATAAAACGATATACCAGCCGGGCAAGCCGCTGGCC
CGGGCGGTACGAATGTAGTCTTCACTCAATTGTTCCAGCATCGCTGAGCGGATCTGGCGA
GCGACAATTCCCAGGTGAACGAACGCCAGCGTTAATGCCGGTAAGATGAGATGTTGCAAC
GCATTGAAGAAGACTTCACCGTTGCCTTCAAGCAGCGCATCGAGCAGATAAAAGCCGGTA
ACGTGCGTTGGTGGATCCAGCCAGTCATCAAGCCTTCCGCCGCCGGGAAGAATTTGCAGA
TGACCATAAAACAGCACAATGACGCCCAGCCCAAGCCAGAACGCAGGTGTGGAGATTCCG
GTAATGGCCATTATTCGCACCAGATGATCCAGCCAGCGATTTCGCCAGACTGCAGAGAGT
ATGCCCAGCGGGATGCCAATCAGGAGTGCCAGCAGCAGGGCACCAAAAGCCAGCTCCAGC
GTCGCCGGGAAAAATATACGCAACTCTTCCAGCACCGGACGCCCGGTACGAATGGATGTT
CCCAGGTCACCATGAAACAGGTCGCTGACGTAGCGGTAAAACTGTACATACAGTGGCTGG
TCCAGTCCCAGTTGCTGGCGAATATTTTCCACGATAGCATCGCTGGCGCGGTCACCCGCC
AGTAACCGCGCCGGATCACCAGGGATCAGATGCGAGATAATAAACGTAATCACGCAGACG
CCCGCCACCACGAGCACCAGCCCCCAGCAGCGTTGGCGTAAAATACTCCAGAAGGTCACG
TTATTTACTCATGGTATTGATATTGAAGACCTGTTCCAGCATGGGATTGAACACAAAGCC
TTTCACCTCTTTGTTCATCGCCAGTTGGTAGTTTTTCTGGAACAGGTACACATAAGCAGC
GTCATCAATGACGATTTTCTGTGCCTGCTGGTAGTCCCGGGTACGCTGCGTCTGGTCGGT
GGTCGCAAGCGCATTGCGCAGTAACTTATCGACCTCACTGTTTTCATAGAACGAGCGGTT
ACCCGGCAGACCTTTTTTGTCTGACTCAAACCAGTAATTCATAAACATATACGGGTCGGC
AAAATCCGGACTCCAGTTGCCAATCGCAATGTCGTAATCACCTTTACCCACTCTGTCGCG
CATGGTGGCGTTCGCCAGCTTTTCCAGCTTCACAATGATGCCCAGCTTGTTGAGACTGGA
TTGTGTCGCCAGAGCAATAGGCTCCCAGTTCGGATCGTTATCGGAGTAGAGAAACGTCAG
GCTGGTGGGTTTGCTCGTCACTTTATCCCATTCGGCTTTGGCTTTCGTTTCGTCATGGTT
GTATTGCATTGCCGTCGCATCGTAGCCCCACATGCCTTCCGGAATCGGGCCGCGCATCTG
TTTTCCGTTACCACTCAGAATGCCGTTAACCATGCCCTGATAATCGGTAGACCAGGAAAT
GGCCCGACGCAGATCCGCCTGATTAAGAGGCGCTTTGCTGTTATTCAGATACAGATAGGT
AACGCGCAGTGACGGATACTCTGCCACATTGACTTTATTTTCCTGCTTCAGGGCGTTGAG
TTGATCCACCGGCAGCGCATCGGCAATGTCAATGTCGCCACGGGAGAGCTGCAGGCGACG
GGAGGCACTTTCACCAATAATTTTTACCGATACCCGTTTGAAGTTCGGTTTATTGCCTGG
GTAATGCGGATTTGGCACCAGAACTAATTGCTGACCTTTTTGCCAGCTTTTCAGCATAAA
TGGTCCGGAACCGGCGGTATTTTGCGCGAGGAAGCCGCGAGCATCATCCGCTGCATGTTC
CTTTAAGACCGCCGGATTGATAATGGATGCACCGTCATTCGCCAGCGTGTAGAGGAACGG
TGCGAATGGTTGGCTAAGGGTAAACTTCACCGTATGTTCGTCGGGAGCATCAATCTTTAA
ATCTTTGGGAAATGCTTCTGCTGGCCCCTGGCCGATTTTTAGTAGCCGCTCAAAAGAAAG
TTTTACTGCTTCGGCAGTGACAGGTGTGCCATCGGCAAATTTAGCATTATCTTTCAGGGT
GAACGTCCACTCTTTTTGATCGTCAGACGCTTTCCAGCTACTTGCCAGATCGCCTTCAAC
GTCGGTTGAGCCTTTATCACCGTCCGTTTTGTACTGAACCAGCCGCTGATAAGACGGGTA
GGTCACTGTCCAGTCGTTATTATCTATTGTTACCGCCGGGTCGAGGGTTTGTGGATCGGC
GGCCTTACCAATCACCAGCATATCTTTTGGTACGGCGGCGTGCGCAACCGGGAAATTTGT
GGCAAGGACGAGCGCGAGCAATGTGGGACGAAACGATATCGATCTCTTCATGACAGTTTC
CTGATTAACTGACGTGCTGTGTGCCAGGGGATATAAAACAAGAGAATTGATCAGCGAGCA
GAGGGTAACTCGCTGCCTGGGGTAATTCGAAGTGCCACCATTCGCTGGAGATACCGACAA
AACCGCCACCAGTCATTATCGCATTCAGCAACAGCCGATTGCGCTGAGCGGCGGGCGGGA
CGGAAGGGTGATAGGCATGGGAGCGCTCGTGCATTTCATCGAACCCTGCGCCCATATCGA
GGATGTTCCCGTGCTCATCACGAAGCGTCAGGTCGATCGCCGTGCCACGGCTGTGATTAG
AACCGACCGTCACATCAACAACATATTGCGGGTCTGGGCAGGCTTGCCACAACATCGCCT
GTGCTTGTTGTGGGCGATACGCATCGTAAATCACCAGTTGTAACCCTGACAGCTGGGCGA
TGCTGATACTTTTCGCCAGCGCGGTAATCGCATCCTTGTGTAACAGACAACGCGCTTGCT
GATAAATAGCTTTACCTGTGATGTTATCAGCGCAGGCGTATTTCAATTCGATCTCCAGAT
CAGGGAAGATTACGGCTAAATCAACCAGTTCGGTGGTATCCGACATAAACGGTTCCTGTA
TAAGACAAAAATTGCTGCGCTTTCCGCTTATGCAGATCTCATGCCATGCCGGGATAAGCG
CCAGAATGCTGGCTTAAAGTTATATTTTTTAACTTTTGATCAACATTTGTGCAGCGTAGT
GCAGTTTTGGTGCAAGAGGGGAAGTTAAGGAAGGAATCTCCCGGAATCGTAGCTGAAATC
ACAGTATTTAAGTGACAGTGTCACGTTAAATGAAAACCCGCGAGTGCGGGCGAGAGGAAT
TTGTCAGATTTTCAGCGGTAACACGCTGCTCATCCAGCCTGGAATTTCTTCGGCGGGTAG
GGGGCGGGAAAAGAAATATCCCTGAATAACGCGACAGTGGATCTTGCGTAGCATCTCAAA
TTGCTCTTTGGTTTCGACGCCTTCCGCCACGACGGTTAAATTGAGGCTTTGCCCAATGCT
GGTAATGGCTTCAAGTAAGGCAAGGATGCGTTTTTCGGTCAGACAACGATCGACAAAACT
TTTGTCAATTTTGATTTCCGTTACCGGAAGACTGACTAAGCGGGATAATCCGGAAAAGCC
CGTACCAAAATCATCTACCGATAAGCCCACGCCCATATCACGCAGGATCTGAATGCGCTT
AAAGATTTCGGTATCGTGTTCCATCATCATGCTTTCCGTGATTTCTACCGTCAGCTGGTG
GCCGTCAATACCCCAGGCGTGCATTGCATCAGACACCTGATTAGGCAGTTGATTACTGCG
AAAGTGCAGCGCCGACAAGTTCACGGATAACGCCGGGATATGAATATTCTGGCTACGCCA
TTCTGCTAACTGACGGCAAGCTTCCGCGATGACCCAGCGCCCAATATTTTCGATTTCACC
AATCTCTTCTGCGAGAGGAATAAACCGTGAAGGGGGCACATGACCATGCAGGGGATCGTG
CCAGCGAGCAAGGGCTTCGATGCCGTACAGTTCACCCGTTTCTGCGAAGATTTGCGGCTG
GTAAACCAGTTTCAGTTGGTTATTGCTAATCGCTTCTTTCAGCGCTGCGCCTAAAACCAA
ACGCTCTTTTACCATTTCGTTCATCGCCGGGCTGAAGAACTGCCAGCCGTTACCGCCATT
CTTGCGAATATAATCCATTGCATTGTGAGCAGTGGAGAGCAAGTAATCGCGGTTTTTACC
CAGGTCGTAGCTGATGCCAATACTCAAGGTAAGCGGGAAGGGTTTATCGTCAATCATTAT
CGGCTTGCTGACCACATTCCGTAGCTCATCGGCGATTTGGGTAATGTTACTGACGTCGTT
TTCGAGGCTCACGAGGACAAACTGCGTACCTTCGATACGACAGAGATACTGATCCGGTTT
GAGTTTTTCACGAAAGCGATTGACCACTTCCAGCAATGCCTGATCGGCCCACGCATAGCC
AAGGCTATCAATCACATCCTGAATATGGTCAACACCGATGAGATACACCACGGGAGAGAC
GGCTTTGTCGACCAGGTCATCGAGGTAATTGTGCAGGTTATTGCGATTTGGCAGACCGGT
CATCGGATCAAATTGGATGAGTTGTTCAATATGCTGACGGCTTTTTTCCTGTTCCAGCGC
CAGCGCGGCCATATGCTGGCTGATATCTGCCACGCGTTCGATAAAGGCGCTGGTTTCTGC
TCCTGACGAGGTTTTAATTTGCAGGATCCCCGCAGGCGCGCCATCACGCTGACGAATGGT
CGCTGACCAGCTTTGCGCATTTTGAATTTCTGCACCGTGGGAAGATGACGCCCAGTGTAT
CGGCATCCCGTTGCGCAGTGCGAACAGCGAAACATGCGATTCGTTGAGTACAGATTCGAT
GTTACGACAAATGATTTCCCCCATTTCATGAAATGGCGGGCTGCTGCACATGGCGGCGAG
AATATTGCCTTCAAGCTGGCGAATCTGCCGTTCTTCGGTGATATCCGAGAAAGTCATTAC
CAGGTTCTGCAGATGCGCGAGCACGTCATAAACCGGGCTGATAGAGGCTTTAATCCAGAT
TTTTTCACCGGTGCGCGTCAACAGCAGAAATTCGTCCTGATCGCGGGCGGTTTTCCATAG
CAACTGTTGTAAACGAATGCGGTTATCGGCAGGGAATTCAGGAATGTTCAGGAGTGTATC
GGGCTGCATACCGCTGGCTTCGCTAATGCAGTAACCAAACATTTCGGTAAATGCGCGATT
GCACTGCACAATATGGCGTTCCGGATCGAGGACAATCACCGGTCGGTCGAGATGGTCAAC
GGCAATAATCAATTGTCGGGTCTGTTCTTTTTGCGCCATTTCTACGCTGGCATCCCGTAC
CAGCGCCAGGTAATAAACTTTCCCCTCGGCGCTCACTTTCGATAGCGCAAAACGGGTCCA
GATTTTACTGCCGTCTTTTTTCTCCAGCTGCAGCTCCCGACTCATCCCCTCAACACGCGC
TTTACCGCCTTCACGGTTGTGACGAATGTATTCAGGATGCGCAGGACGCAAATCCCGCGG
AATCAGCATATCAATGTTATTGCCAATGACTTCTTCACGTTTGTATCCCCAGAGCTTCTC
TGCGGCGGGGTTGAAAAACATCACTTCATCATTTTCGTTAATTAACACCGCACCCATCAT
ATTTTGCTCAAGGGCGGGGAAAAAAATGCCATCGGCGGCATTATCCGCATCGGTTAGCTT
CATGATTACCTCTGCATCCTGGCGCATCTAAAGACTGGCTTTCCAGAGTTCAACACGGTT
TCTACCTCGTCTTTTGGCGATATACAGAGCTTCATCGGCTATTTGAATGAGGCGCTCATA
GTCAGGATGACCATTAAACATGGCGGCACCGATGGAAAGTGAGAGGGCAATATCTTCGCC
GTTTGCGGCTTTCAGTTTGGTTTTCTCCACCCGACTGCGAATACGTTCTGCGGTACGTAA
CGTTTCGTTTTCAGAAGCTTCAGTCAAAACAATGATAAATTCATCGCCCCCGTAGCGGAA
AACATAATCACTACTGCGGACGTTGTCATAAAAGGCCTGAGAGACTTTACGCAGAATTTC
ATCACCAGTGTTATGGCCCCACGTATCGTTGATCTCTTTGAATTTATCAACGTCAATAAT
CAGCACTGACAGCGGTGTACCGGTCCGGTTGGCATGGGCAATTTCGCGTTTGAAGATAGT
CGGTAGGAAACGGCGGTTAAGTAATTTCGTCAGTACATCCATACCGACTTCGTGGCGCGA
TACTTCTTCAAACAATTCACGCAGCAAGGTAATAATTTGCGATACGGTATTTCTTATCTG
TAATAAAAATTTCACCCGCAGACTTCTGTTATTCAAATTTCTGGTGTTACGCATGGTTTG
ATTGAAAATACCGTCGAAATCCTGAATCAGACGGGAGATATGGCCTACTTCGGCAATACC
ACTAAAATAATGTCGACCTTTATGGTTAAACCACAGGCCAAAATCAGCCTGGCTTAAAGG
CAAACTACTGCCTAAATCAGAATCCAGCAGGATTTTATAGATAATATCTATTTCCCATGA
AAGTATTGAGGCTATTTGCCGTTCTTTTTCTTCTTCGGCGTTTTCCAGTAACGAGAAGAT
ACGATAGTTTTCATCTTCCTTTGAGGCACTACTGTCACTAAAGGTAAACGCGCGAGTCAT
CACTTCCATCGCGATATCAATACTGTTAATCGAGAAATGGTAGACCTGAAGTTTTTCTGC
GGCGGAATAATCCGAAGAGAAGATCACCGGATAGAGGATTTTTTTCAGCACCCGAAACCC
CATCTCGACAATTTCTACCGGAATTCCTATGCGGGCATGCACTTCCGCGACGGTATGCTG
GATTTGTATTAGCCTTTCGACATCGTCAACCTGGGCAGAAAGCACGTTAATAATCCAGCG
TTCCATCGCACTCTTCAACTGCCGCTCAACTTGTTCATTACTCAAGAATTCTTCGGCATG
CGGGTCGATGCGGACAATTCGATAAAACTCGATACTCAGATAATGAGCATGCGCAACGGC
AATTTCCGCGGCTTTAGCACGAATGGGCGGATCTGCCTGTTCGACAAGTCCGGTCCACTC
ATCTTTCATTCTTTTAAAATACATCTCCATAATTCACACCCTTATAAGGCTGGGAAATCA
GACGGAATCAAAATGAAACGCAACGTGCGAGATCGACTAACTGCACCATATTCTCCTGAA
ATATGAAGATATACTGAAAAGAAATAAGCGATTTAGGACAGTTTCAATCTACGCTACTGT
TCTTCAGAAGAGTATAGCCCATCGTAATTATTTTTCGGTGACAGCGAATATCGTATGGTT
TTTCATATTCATACATTTTTATTAGGGATTTATGGCTGTTTAACTAAGTGTGGTTAATTT
GACTTAAGTAAGCATGATTATTAGTGGGATAGTTTAAGAGGGTAACAAGCCGGTGGGTAA
AGCACCGGCTTGTTACAAAGTAAGAATGGGAGTTTAACTGCCCCAGCGACTTTGCAGATA
GCTGACCGCTTGTTGAGTCTGCGGTTTATTCAGATAGTCCTCACGGAACAAGATGGTGCC
GCTAATTTCGGGCACAGCATCGTTAAGATCGAGCTGCTTTTTCAGTTCCGGTACGCCGCC
GTTAATCATCCAGTCTGGCTCTATCTTTGAAGGTTCACCCACTTTATAGAAGGCGATACC
GATATACAGGCGGGTCCTGGTCGGTTTAACGACATCCGCCCACCATTTTGCCAACACGTC
ATAACGCGCGGCACTCCGTGAGAACGGCCAGTAAATTTGGGGAGCAATGTAATCCAGCAA
TCCTTGTTCCACCCATCGACGGGTGTCAGCGTAGGATTCGTCATAGGCTGCCGCGCCTCG
GGTATCGGAACCGAGCGGATCGTGTGATCGGTTACGCCACACGCCTGCCGGGCTAACACC
AAATTCGACTCCCGGCTTAATGCTTTTAATGGTGTGCGATACCTTTGCAATTAACTGCTG
AGTATTGTTGCGCCGCCAGTCTGCTTTTGACGCAAATGCGCCTCCGTATTTACGGTACGT
TTCGTTATCATTTAGCCGTGAACCCGGTGACTCCGTATAGAAATAGTCGTCAAACTGCAC
GCCATCTACGGGATAGCGGGAAACCACTTCTGCGACTATTGATGTGATCCAGTCCTGAAC
CTCAGGGATGCCCGGGTCGAGGACAAAGCGATCGCCAGACGTTCTGATCCAGTCGCGGTG
TTGCACATAGACGCTCGCCGGTTGTTGAGACAGAGTGCTATTCAGTTCCCTGATAGTACC
GGGCTTCGTATTAACCGATACGCGATAGGGGTTAAACCAGGCGTGTACTTTCATCCCACG
CTTGTGGGCTTCGTCGAGCATAAATTGCAGCGGATCGTAACCCGGATTTTCACCAATCTT
ACCGGTCATAAGATCGGACCACGGCAAAATTTTCGATGGCCACAGGGCGGTACCGTCCGG
CTTGACCTGGAAAAAGACCGTGTTTATGCCGAGACGTTGCAGATGATCCAGTTTGTCGAT
CATCGCCTGTTGTTGTACACGGGCCCGGCTGGTGGGGTTACTAATGTTAACCGAGGAAAC
CGGTGGCCAGTCGAGCCGAGAAACCGTGGCCAGCCAGATGCCACGCATCGGTTGTGACGA
TTGTTGCGTCGTGGCTGGTGGCTTTGAACCTGCTGGTGGTGTCACCATGGACTCTGGAGG
CGTGCTTTTACAACTACACAGTAAAAGTGCCAGTGCAACTAGTATCGCTGGTCTTCTAAT
CGTTAATTTCTTGTTTCGGGAGCAGATATCCATATGTGCTGGTTTCCGGTAAACAGATGT
GCGCTCATTCTCGTACTTATCCCCGTTAAGTCAATACGACAGCAAGCACGAAAAAGGGAG
CGATGAATTATCGCTCCCTTGTCTTATAACCATTCAGACATGGTTAGTGTTTCTTGTCAT
TCATCACAATATAGTGTGGTGAACGTGCACGCGGGTGCAGGAAGAAGTGACCTTTTGGTG
CGTTCTGACTGTTGATTGGCTCCAGAGTGACGCCGGTATTTGCTTTGCCTTTACGATCAT
GAACAGCATAGAGAATAAAGGGCAGGGCAAGTACCACCAGGAAACTAACAACCAGTAATT
CAACATACATATCGGTAGAATCACCCTGGATGTTATCCGGCGGCAGGAAGGAAACAATAA
ACGCCATAATTGAAGTCAGCAGACCGACAATTGCCACGACCAGTTTCACCCCTTTACCAC
CAGGGATATTAAATGTGCGTTTTAAGTCAGGATGTTTAAGAACCAACACAATGTAGCCAA
TAAACAGCATGAAATAAGCACACAGATAAATCACCACCGTCAGCGCCAGTGCGATCAGGA
AGGACATGTTGTTACCGCCACCGGTATTGGTGAGGATGATCAACGCGATAGACGTAATCA
CCAGCTGCGAAATGACCAGCGTTACCGGTACGCCATTTTTGTTCATTTTAGCGAATGCCG
CTGGCAGCAGGTTTTTCTGCGCTGTTACATACATCCCGCGAGAAGGACCAACAATCCAGG
AGGCGATTTCCGCCAGAACACCCAGCAACAGCAGTGCGGAGATCACGCGAACCGTCCACT
CAATTTCTGGTGCCACATGGGACATCAGAACGGTAAAGGTTTGCATTACCCCTGCGGAGA
GGTTGATTTCATTACCCGGAATGACCATCGCAATAGACAAACCACCAACAGAGCTTAAGC
AGATTGCCGCCACCATCAGCAGTAACATAGCCAACGGATAGTCGCGCCCTGGGTTGCTCA
TTTCATTGACGTGGGTTGCGGATGCTTCTACGCCCATATAACTCAAAATGAAGGCAACAA
ATACTACCAGGGTGCCCACTTTAGAGAAGTCAGGGAAGAAGGTCTTCGAATCCATTTCGA
TAGCAACGGGGGCACCGGAGTGCAGATAAATAGCCGCTAATGCGATCAAAATAAATGCAG
GTAACAGGATACCGGCGAAGAAGCCAACTTTAGCAATTCGCGCCGTGTATTTCGTGCCAC
CAAACTGCGTTAATGCCAGCGCCCAAAGAATGATGAGTGCTGCAATAGTTTTGGTAATGG
GGTCTTCATTCAGCGCTGGCCATTTCAGGATGTAGGAGAGTGCCCCTAACACGAAATAGA
GCATCGGAATAAAACCAATGGCGATTTGCAGATAGCCAAATGAGATCGCTGCAAATCCCC
ATCTCGGCCCCAGAGTATTTGATACCCAGGCGAAGACACCACCTTCTTCCCAGCCGTCGA
CGGTGGCCATTTCCGCAGCACAAAGTCCCACGGGAATAAACCATAAAATCCCGCCTAATA
GCAGGAAGAAGACTAATGAAAAGCCCGATGTTGCGAAGGTAGGGTATTCATAAACAGCCA
TTACCATCGATGCCGTTATGGCAAAGAATCCAAGTAATGTGAGCTGCTTAGCTTTACCTG
TCTGTACTGATGTAGCCATATTATCCCCCTAAAACGGTATTCCTGTCGGAACCGCACCTG
TTTTGTTCTGAAGCGTATTCAGAACAATATTTTCCGTTGCTAATGCCAGTGAACAGACTT
TGGAAATTGTCCCGAAACGGGTTCGTTTCGGGACACCGTTACCGTTAAACGTTATCAGGT
ATGTTTAAAGCTGTTCTGTTGGGCAATACCCTGCAGTTTCGGGTGATCGCTGAGATATTT
CAGGGAGGCTTTGTAGTCTTCCAGCAACAGTTCAGCAAAGTCCATTTCGAAGCCGCGACG
ACACATAATGCGCATCACCACGATGTCGGTGGCTTCACCGCCGAGAGTGAAGGCCGGAAC
CTGCCAGCCGCGCAGACGCAGACGTTCAGAGAGGTCATACAGGGTGTATCCCGGATCTTC
ACCATCTTTCAGTTTGAAGCAAACCGCCGGGATGCCTTCGTCCGGGCGACCCGTACAGAT
GAACTCATACGGCCCCAGTTTGGCGATTTCATCCGCCAGATAAGCGGCAACCTGGTAAGA
GGCGTTCTGTACTTTGGTATAGCCTTCACGACCGAGGCGCAGGAATTCATAGTACTGTGC
AATTACCTGACCCGCCGGGCGGGAGAAGTTGATGGCAAAAGTACCAATTTGACCACCCAG
GTAGTCAACGTTGAACACCAGTTCCTGCGGCAGCGCTTCTTCGTCACGCCAGATAACCCA
GCCGCAGCCCAGCGGAGCCAGACCGAATTTATGGCCTGAAGCACTGATCGATTTCACACG
CGGCAGGCGGAAGTCCCAGACGATATCCGGGGCGACGAACGGTGCCAGGAAGCCACCGCT
GGCAGCGTCGATGTGCATGTCGATGTCGATACCGGTATCGGCCTGGAATTTATCCAGCGC
ATCGTGCAGCGGTTGTGGGAACTCATAGTTACCAGTGTAGGTCACGCCGAAAGTCGGCAC
CACGCCGATGGTGTTTTCGTCACAGGCTTCAATCATGCGTTTCGGGTCCATAAACAACTG
ACCGGGGCGCATAGGGATCTCACGCAGCTCCACATCCCAGTAGCGGGCGAATTTATGCCA
GCAGATTTGTACCGGACCGCACACCAGGTTTGGTTTATCCGTTGGTTTGCCTGCAGCTTC
CATACGCTTGCGCCAACGCCATTTCATCGCCATCCCGCCGAGCATACAGGCCTCGGAAGA
ACCAATGGTGTTGGTGCCAACGGCCTGACCATTTTTCGGCGCAGGCGCATGCCACAGATC
GGCAACCATATTTACGCAACGCAGGTCGATGGCTGCGGATTGCGGATATTCTTCTTTGTC
GATCCAGTTTTTGTTAATGGATAAATCCATCAATTTGTGGACATTTTCGTCGTCCCAGGT
CTGGCAGAAAGTGGCCAGGTTCTGACGAGCGTTGCCATCAAGATATAATTCGTCATTGAT
AATCTGGAATGCGACATCGTCGCGCATTTCGTGCAGCGGAAAACGTTTTGATTCTGCGAT
AGTGGAAATAGACTTCGCACCAAAACGTGAATCGAGTAGTTCCGACCTTAAATCCGTTAC
TTGCTTCTTATCCATTTTAAACTCCTTAAAATGATTGGATCGCATTAAAAAAGTAGGATT
TATCGATAAAGTAAGCAAGTGCAAAGGACTCGTGTTTAAATAACAAAATCCTAATGTTAT
TTATCGTGAGATATTACGCGAATAATATTTTTTCATTGAAAAACAATACAATATGAAATT
CTTGGGTGGTGGTAAGGTGTTTTATGCTGTTATTTTTATGCGCATTCTGTGTCTCCTGAA
TTATCACGTAAAAATCAGACCTTAAAATATCACTATTAGTACTTGATTATTATTTTGAAC
GCATTTATAAAATTATTACATAAAAATAGCGAATATTGCTAAAATCCCCGCCAACGATGT
GTTGACGGGGCTGTTATTATTTTGGCAATAATACTCCGGTATAAGTATTTACCGGATGAG
AAAGATATTGTTTAACGGCAGTGTTAACATTCTCTACCGTCATTTGTTTCAACAATTGCT
CCTGCTCAGTCCATGCTGCAGGATCGTCATATTGAATAAGACTATTTACAATAGTGTTCG
CTAATTGTTGAACGCTACGCTGTTGGATATCGAGGCTGCGCTGAACGTTTTGCTGGTATT
CATTCAGTTCTTGCTCACTGATCCCTTTAGCCAGACGCTTAACCATCACTTCATTCGCTA
ACGTTAACAGTTCATCATGTCGTTCTGGTTGACAAGTAAAAGCCAGCAAATGACTGATAT
CTTTGGCCTGAGGATCAACCGAGAGGCGAGAAGAAACGCTGTATGCTCCAGATGCCTGTT
CACGAATATTAACACGTAGATCTTTTGCCAGTGCGACGTTAAAAGCATCGAGCGCCATAC
GCGTCGGCAGATTAACAGGTGTCCGGGAATCATAACGCTTCCACTGTGAAACCTGTGCCA
CAGGTTCATTTTGTTCTTTTACAGTAACCGATGCGTTGTCCGTCGCGCGAGTTAATGGTT
TACCTGCGGCTAATGGCGAATCAGAGTGTTTGATTGATCCTAAGTAACGCGTAATTAACG
CCACGAGTTTGTCTTCTGCGACATTACCGACAATGACAAACGTGATATCCGCTGGAGATG
AAAACAATTGGCGATCGGCAGCCAGCGCATCTGCGGCAGTAAACTGTGCAATCTGATTTT
CTTGCAGTAATTTCGTGCGGTCATCAGCATAGCGCGTCTCATACATCTGCTGGGCGAATT
TCTCCGCTGGACGCTGGTCGAGCGTTTTCAACGCCTGAATTTGAGCATTTTGTAGCGATG
CCCAAATATTATCGTTAATCGTGCTGTGGGTGATTCGCTGGTTAATCAACTGAAAACCAG
GTTCAGGGTTATTAGTCCGCGCGCTAACGGAGAGCAACGTATTCATGCCACTGACTTTAC
TGCTCATGGTTACCGAATTTTCCGCACTCCAGCGTTTCAGGCTGGAAGAGGAGAGTTCGC
CAACGCCGCTTCCGCTAACTGCTTTATTTGCCAGCGCGATAAGTGATTTTTGCTGCGCAG
GGAAACTTAAATCGCCTTTATTCGATACGGCAATAATTTGTAGCTTTTGCTCTTCACCCG
CGGATTTTGCCAGAATAACCCTGGCACCATTGGAAAGTGTTAATGATGTCAGATTCTCCG
CCAGCGTTTCTTTGCTGCTAATTTCCGCCTGTGGGTCTGCGTCTACTGTTAACGATAAAT
TTCTGCCTGGGAAGACGTAAGCCGCCAGCTTTTTGTTGGCGTACTCCTTTTCCAGCGCCA
GGATAGCCGCAGGAGACAATGCTTTTTTGGCGGCAACCTCATTGTTTACCATTTGCTCCC
AAAATGCGTCCTGGTTCTTTCTTAACTGCTGCCATTTTTCCGCCAGACTTTGCACGGTAA
TTTGCTGCCACAGACGTTTCGAAAGTTGATATGTCTCTTCCGGCGACAAGAACGGCGTAT
TATTTAATGAGCTGGATGCCAGGCGACTGGTCAGCATACGTAAATCACGTTCAGCTTGCT
GATCAACCGCATTTTTCAGCCAGGTGAGGCGGGTAGATTTGACATCATCGAGTTCTTCAG
CAGAAAAACCATGCTGATCAATGGTTGCCAACTCTGCCATTAATGCATTCGCAGCATCCT
GCATATTATCGTCTCGTGCATTTACACGGAAAAACAGCGACTGATAATCGGGTGCAATTT
TAACGCTGCGCGCAGTGCCGCCAGAAATAGTCTTCAACTCGCCCGACTGTATGCGTTCCT
GCAGACGTTGATTGAACAGCTGAACTAACATGCTCCATTCAGCTTGTTCGATAAAGCTTT
GCTCATCGTTCACTTGTACCATTGGCAGGCGATAATAGAGTGCGATGCCGTTCACCCGGT
TTTCTTTATCATTAATGATATTAAAGCGCAGGTGGTTTTCGGCTTTTGTCGGCCAGACGC
GATTTTCAGCTGCTTTGTTAGCCGGAAGCTTACTTAAATTATCCTTTATCAGCGCCAGCG
CTTCTTTACTGTCGATATCGCCGACCACGATAAAGGTCATATTATTTGGTTGATACCAGC
GTTGATAAAATTGGCGCAATTGTGCCGGTGTGACCGTGGCGACAGTATCCATCAGGCCGA
TAGGTTCACGGTCTAAATTACGGGTATTTGCCAGCAGGAAAGGGCGGCGCGCCTGAGAGG
TGCGCCATTTCGCATCCTGATGGGCACGCCATTCCTCAGTAATTACGCCACGTTCAGCGT
CTACTTCGAGTTTTTCAAAGGTTGCGGCATTACTCCATTCACTGAAGATTGCCATCACTT
GTTGCAGATTTTGTTTCTGCGTAGTCGGCAAACTCACCTGATACACCGTTTCGTCATAGC
TGGTATAGGCATTAACATCGCGACCAAAACGCAGGCCCATTGACTCAAATGTTTCGATGA
CTTTATTACCCGGCCATGTTTTTGTGCCGTTAAACATCATATGTTCTACAAAATGAGCCA
CGCCGAGCTCATTGTCTTCTTCCTGCAATGAACCGGTATGAATTTGCAGCCATAAATTTA
CCTGATCCTTTGGATGAGCATGCGGATAAATCATATATCGCAAGCCATTGTCCAGTTGCC
CGGTAATTAACTTTTCATCCTGCGGTAAGGCGGCGGCAATCAGCCGCCCGGGGAGCAACA
GAGTTGCCACTAACGTCAGTAAGAAACAGAGGTTTCTCATAATTATCTCCATGCGAAAAC
CGGGCGAATTTACCCGGTTAAGTAAAATCCGAACTATTAAAATTTCATGCTGACATCAAG
CCAGAAAGTACGGCCACTGGCGTAGGTCGCCACACCGGTGTTCGTTGTATCAACAGCGGT
TTTGCTATCCAGTACATTGAGAATATCGGCACTGATCGTCAGGTTTTGTTGTTGCAGAAA
TTGTGGCGTCCAGGACAAGCGGGTGTCCCAGGTCAGGCTGCTATCCAGTTTTTCGTCAAC
ATACTGCTTGTAATCTGAATATTCGCTGATGTATTGCGCATTTGTCTTACCAAGGATAAT
GCGAGCTTTACGCGCTTCTTGCCAGGCCAGCGTATTCGCCCACACTAACCCGCTCGGTTG
ATGCGTGAAATCCATGTTTAAGGAGATCTTTAATGGGTTATTAAAATCTGCCACTGGAAC
GCTATCGTAAGAGACCAGATTACCGTTATAAACCACCTGGTTATCACCGGTATTGCTCTC
CTCATAACCATTGTTTAACGACAAGTTGCCCTTGCTCTTGATATAGCTAAAGACAATTTG
TGGGTTAATATCTACCTGGCGGATATGCAGGGGTTCGGCCAGTTCAAAACTGAGGCTGAA
CGAATGCGTTTTGGTTTTGCCATCGTTGTTATATTCAGTAATGGTGGTTTTAGTCGCGCT
GTCGGTACGACTGCTTTTGCTGATTTGATCATGCGCTTCACGGTAAACATAGTTTGCACG
CGCAATAACGTTCTTACCGATTTTCTGCTGCAATCCCATTGCCAGTTCATCGTTATAAGG
CGTTTTCAAATCCTGATAACGCGTCAGAGTTTTATTACCTGATACCGATTCCGTCCAGCT
ATTGCGGATATCACGTAATCCCATATCAAGAATATTCCCGCCATAGTAACGGTTATAACC
TGCTGTAATCATTGAGGTTTGATTAGCAAAAATATCCCATTCCGTCATAAAGCGCGGGGA
GATATTGTGGTTTGACAGATAGTTGTCATAGTCATACCGCACGCCGGGCATTAATGACAC
ATTACGCCAGCTAATGCGATCCGCCATATACAGCGTGTAGTTGTCAATTCCCAGGCGGCC
TTTACCTTTATGGTAAATGGTATGGTTAGTTTTCTTTCCGGCAGCATTAATCACATAGGA
TTCAGACTGGTTATGGCGTTCAGTCCACGCATCGGAATAGATGTATTCCGCGCCGAAGTA
GGGTTGATGCGAAACATTACCCACGGCGAATTTTTGCCAGTCCAGGCGTGTTTTGAAGGT
GTAATTATCTACAGCCTGGGAAATGTGTCCTAATCCGCCACGGGTGCAACGCCCTGTAAT
ATCACCATATGTACATGAAAGTTCGGTGTACCAGATGTCATGATCGTGACGGGTATAATC
ACTAATATGATCCCAACCAACGGTGGTACGCAGTTTGGCCCATGCGAGCTGCGTATCCAT
ATCCCATGCCAGACCATAGGATTTATTACCCATTTCGCGATCAGACTGCGGGAAGGTGCT
GGTATTATAATCACGGCTGGAGCCGGTATATTTTAAGGTTAAATCGTGGGTAAAGCGGTC
GCTGGCAAACCAGGTAAATTTGCTTAATGCAGTATCGATAACGTTTTTATACTGTGCCCG
ACCGGCGACAATGCCGTCATTCGAAACATAATCCGCGCGGGTGATATCAGACTGGCGGCG
CGATAAACCGGCGGTAACGCCGAAGTTATCAGCGAGTTCCTGATTAAACGACAAGGTATA
AAAGTTCTTTTTAAAATCTGGGGAGTAATAAGTACTTCCTGAAGAGCCTTGATTAAATGC
GCTCTTGTTATTCTCATCGATATGCGATGTTAACCAGTCCGAACGCGTAGTGCGATAACC
CAATTTCACCTTGCTATCATCAGCGTTGAAGCGTTTGATCTTTGCATCAATTACCCCGCC
ATTGAAGCGACCAAATTCAACCGGCACAAAACTGTCATAAAGCGTCACATTGTCCAGTAA
GCTGACATCAAGATAATACCCCTGTGACATCCCGCTAATATTGGTTGCACTACTGGCATC
GGACTCATTCGCTGGGTTCAGGTTATTAGTTGCACTAATACCGTCAATCAAATAGGCATT
CTGGTAGGGCGACGCACCGTGAATAGAGATTTTCTCAGGGCGAATATCTCCCTGGTTCAA
CGAGGTACTTTGCGTTGAATCCATGCGTACCGCAGGGTTGGTTCTCAGCAGATCGCTGAT
ATTGCCATTCCCGGTCGGTAAACGCTCGATGCTTTCACTGGTGTAATGCGTGTTGCCGTT
TACGGGTACAGGGACAGGAGCATAGACCGTCATCTCTTCAAAAAAATGCATGTACATGTT
TTTGTCATCGACGGCCTGCGCCACATCAGCGCCACATAAAATGACGCCAGGAATAAGAAC
TCGCTTCATTTATTTATATCTCCGTACAGCAGGGCTTTTATTGTTTTTATAAAACCGCGC
TAATGTCACAAATATCATCGGCCAGGTTCCAGACACCGGGTTGATGTGTAACCATAATGA
CGCCGCTTGTGGGTAGTTTTTCACGCACTAAACGCAGTAAGCGGATAGCCTCTTGTTCCT
CAAGATGAGAGGTAGTTTCGTCAAGAAATATCCATTTCGGACGTCGTAAAATTAATCGTG
CCAGGGCGATACGTTGTTTTTCGCCGCTGGAAAGAATATCTCCCCAGCGATCGTGGTCAT
GAATACGCGCAGCCAATTTCCCAAGACCAACCTGATGCAGTACTTCGCTCAACGATTTAT
CGTCTACGGGCAGGGGAAGTGCTTTACAAATAATCTCTTTCAGTAAGCCGGTTTTGATTA
ACGGTGTTTGTGACACATACCAACTGTCAGCAGGAGAAGAAATATCACCTTTAAACCACG
GCCAGCAGTGGGATAATGTTTTAAGCAGTGTGGTTTTTCCCGCGCCAGAGTAGCCTTTCA
GTAATAGCCATTTGCCTGGCGAAACATGAAAGTTCAGGTTCTCTAATATGATCTTATTAT
CAGGCGTACGAATACTCGCATCAGCCACTTGTACCGCATGTTGGCAATTTTTAGGCTTAT
TCGTAGGGCGCTGTTCAGTGAGTTGATGGAACTCATACAAGCGATCGATAACCGCAGCCA
GTTCAGCAAGTTCGTCATATTTATAAATAAACCAGCTTAAATTGTTCGATACCAGCATAA
ATGCCTGGCGCGATTTCATCAGTCCGCCCAGATTGATCTGCCCGCTAATAAACTGCGGCA
ATAACAGAAAGTAGGGAAGAACGCTAAGCGAGCGCGAATAAATATTCTGCCAGTAATCAA
GCCACCGCTGACGATTCATTAAACGATGCCAGTTCTCTTTAATGGTATGAAAATTGTCGC
TCAACTCCTGGCGTTGTAGAGACTCAGCATTGCTTAGCGCAATCAGTTCTGCCTGCTTAT
TATGCTGCACAAGATTTGTTCGAAATGTCGCTTCGCTACGTTGTTTTTCCACATTAAGCG
GACGAATACGTTTACCCACCTTATGGGTAAATAAAGTTCCACCGATCACAATGAGCACGA
CGGTATAGACCATATACCCCTGGATATTCCATTCTGTTCCACCAACAGTGAATGAGAGCG
TACCCGCGCTTTCCCAAAGAATAACGGTAAAGGTGATCAGCATGCTAAGTGACTGGATGA
AGCCAAATGAAAGACTGAGCGTTTTGCTGATCAGTAAGAGAATGTCTTCAGCGATACGTT
GGTCAGGGTTATCTGTATTTTTATGCTCGCCGTAGATCTGCGTGAAGTAGTAGTTTTTAT
CTGCAAACCACCGATTAAGGTAGTAATCTGTTAACCATTCGCGCCAGCGAATAGTCAGTA
GTTTAATTAACCATGTTTTGTTTACGGATATTAATACAAAGATCCCCAGCAGGGCAGGGA
ACCAAAGGACAAGCTGCCAAAGCTTATCGGTTTCTTTCTGGCTTAGCGCATTGAAAAAAT
CATTATTCCAGTCGTTTAACCAGACCTGAATTTTAACCACGCCAAGGATCATGGCGAGGA
TAATAATGATTAACAACACTGAAGTTTTATTATTCTTACGCAGCCAAAAGGGCTTCAACA
GACAGAGATACTTTGCTATCAACATACGAAGCGTAATGGGAATGGTTATCATTAGCGAAA
ATTGATTGTGCCATCCAATGATTATCTATGGCAATGATTTACTGATGAAATTTATTTAAG
TATCATTTAACAATATGAAATATAAAGGAATATTTCATTTTCAGTGGTTATGGTTATGCT
ATTGATAATCAAGGATATTGCTAATGCCCTGATGCATACCACGTAAGCCAGGATTTTCGC
AAGGGAAGATGATGATGACGAAACACCCGACAGGAATTTATGTCGGGTGCCTTGTTAAGG
TCATAAGAAGGAGGCTAAGAATGGAGTTAAAAGAGAGCGTTATTAATTATTCTCCATTTG
TTTTGCAACATCCATAATGTGGTAAAGCGGTACTCTGTTCTTAGCTAACTCTACCATGGC
GTTCATATAAGGTACCATGGTTGAAAAAAGGATTTTATAACCTTCGCAAAAATAAGAAAC
AGTCTCATTGTTTACTTTAGTAATACGATGCTTAGGACAACCGCCATTGCAGATAGGTTT
ATATGCACATTGCTGACATTTCGCTGGAATCCGTTTTTTTTGCGCTGTCAGTTGTACACT
GTTCATCGTTTTGAGTTCAGATTTATTAATGTTTCCAATTTTGTACTGTGGATAGACAAA
ATGGTCGCATTCGTAAATGTCTCCATTACTTTCAACAACCAGATTATCCTTGCAGGACTC
CTGGAAAATACAACTGGTATGCCCATTCCCCAAAAAACGGCTGACAAAGCTTTCAAACTG
ACGGATGAAAATTTCACCCACATCGTTTTTAACCCATTGCATAAAAATGGTTGACATAAA
CTTGCCATAAGCCGTGGGAGGCACAGAAAAATCAATGATACGGAATGTGTTCTCACTATG
ACCACTGAAATCAATATTCGGCGTCCCGGTTTCTAGCAATTCGATAAATTGCATATGTTT
ACTGCCGATAGATTTTAAAAAATGATAAACCTCAAGAGGGTAATGGACATTAACGTTATT
AATGACGGTTAACGTATTAAACTCTACTTGATATGATTTCAGACGCTCGATGGCTGCTAT
CACTTTTGCAAAAGTACCGTTACCTGAATTACTGCGTCTGTAACGGTCATGTAACTCCTG
GGGGCCATCGATCGAGATACCAACCAGAAATTCATGTTCTTTGAGAAAGGCACACCATTC
ATTATTCAATAAAATGCCATTCGTTTGTAATGCATTAAAAATACGTTTTTGGCCTGCATA
GCGTTGTTGATAGTGAATAACTTTACGGAAAAAATCCAGGCCAGCCAGAGTGGGTTCACC
GCCTTGCCAGGTAAAATAGACCTGATTGCCAGACGCTGCGATATATTGTTTGATGAACTC
TTTCAGAGTGCTGTCATCCATCCATTTTTCATGAGTAAACTGCGACTCTTTTTCAAGGTA
AAAACAGTAATCACATTTGAGATTACATTGAAAACTGGAGGGCTTGGCTGTAACGTGCAT
CGCTATCTCGCTCAATAAGGCGGCGGAAAAATCCGCCGCATGAAGGTTTAGTTATTTCGC
TTCGCTTAGTGCTTTCTTGATATTGTTAAACTTCTCCTGATTTACCTCGCTAAGCGGTGG
CTGGCTGCTGTCGATAAACTCTCTTACCACGCCTTGCATCTCTTTAACGACCTGCGGATT
GGCGGCGGCAAGGTTATCTTTTTGCTGTAGATCCGTCAGTTTGTAGAGACCTAACTGATT
GTTTTCTACTGTATAGACAAGCGAATAATCGTTATTTCTCACCGTATAAGAGAATTGGCT
TAAGTCCTCAGTGTTGGGGTTATGCGGGTAATCGTCTGACTGATGGCGAACAAATTTGTG
GTAATTATCCCAGAATGGAATATTTTCCTCGTCAAACCAGTGAGAATAAGAGGTTATCCA
GGTCAGATTTTTATGTGGCTCGCCTTGTTTCTTATCTTGCAACCAGGGCAGCAAGGAAAC
GCCATCCAGCTTAAGGTCTTTTGGAATGCTGATATCGGCTGCATCAAGAGCTGTCGGGTA
GAAATCCATTGCGGAAATCAGCTTGTCATAATTACCGGGTTGAAGTTTTCCTTTCCACCA
CATAAACATTGGGGTGTGAGTACCGCCAGGATAGGTCTGACTCTTATAGCCTTTTTGCGC
CCCGTTCAGCGGCAGAGGACCATCGATAACCGCACCATTATCGGAGGTAAAGAGAATAAT
TGTATTGTCATACTGTCCGTTTTTCTTCAGTTGTTCGAGAATGCGTTTTACACCCTGATC
AACAGAATAAACGGAAGCGTAGTAGTTATCTGCTGTTTGACTACCGGTATTAAATTGCTT
CTGATATTGATCCGGTGCAGGATTATCATTTGGCAGGTGCGGAGCATTATAAGCCAGGTA
AAGCATAAAAGGCTGGTCAAGTGTTTTGGCACGATCAACAACGCCAATTGCCTCATCGGT
TAACTGATCGCTGATATAACCTTTTGCGGGGACACGTTCACGATTTTTGAACAGTGAAGG
GGAGTTGTAATATGCCGTTCCTGCAGCGTGGAATCCCATAAAGTAATCAAAGCCACGGTT
TTGAGGTTGCCATTCTTCCGCAGAAAATGTGGTGAAGTTGTCATGATAGTCACGCGTTTG
TTTATCTTCCGGTACCGGCACATTACTGATTTTTGACAAGTGCCATTTACCTACTGCTGC
AGTGTAATAACCATGATTCTGGAATAATTCAGGCAAGAAAGTTTCTGTTAGCGGAATACC
ATCCTGAGCATCGGTATTGGAATAGACACCAAAGCGGGCGGGAGCTCGACCGGTCATTAT
TGCGGCGCGGGAGGGGCCGGAAACACCGTGTGCCACATAGCCGTTAGTAAAACGTACGCC
TTCATCCATTAATGAAAGGAGCGTCGGCGTTGATTTTTGTGCAGCTTCAATGGCTTTATC
TATCCCTATTTTGTAGGTATCGACAACTTCACGATTTTCCATTGTTTTTGGGTCAAAAGA
TCCCTTATCAAAAGGAAGTTGTCCATAACCAAGATCATCCATGGTCAGTACGATAATATT
TGGCTTTCCTTTGGTACTGTATTCTGTCGGCGTAAAGTCTGAGAAAGCAACGTTTGTTTT
GGTTGCTTTCAGCTTTACATCATCTGCCGCATGAGCAGCAAATGCAGCCATACCAGATGC
CAGTATCAAAGATATCGAGGTACTTACGACACTTTTCTTTAATGCAGACTTCATAAATGT
TCCTCTTCTTATTGTACTTAATTCCAAAGTAATTTTACGAAGAGAAATAAGTGGATGTAA
GTGAAGTTAGTCACATAAAGAGATAGCAGATTTAGCTAAAAAAAGGGAAAAAACAGTCCA
TAAAGCGTTGACATTACTTTCTGTTCTATTAAGTAATTTCTCGCCGATAAACAACTAATT
TATTGATATTTAATAAATTATTGCATTTTACTGACAAAATGCAGAATTGAGATCATAAAT
AATCATGCAACAGGTTATGCAAGTGCATAAATATGTGATGGATGTCACTTATTTATTTCA
ATAAATATATCGCCTAAAAACAACGCGGGGCAGGGAATGGCTGCCCCATTTAATTCTTAC
GCAGCGTGTGTGGTTGACTACTCGTTAGCAAATAATCAAATAGCTAAAGCATTCATCGTG
TTGCCCGTATTCATACCCGTGTGACTTTGACAACGGTACTCCTTAGAAACTCTCTTCGGA
CTGTTGCCGAAATGTTTGCGGAACGCATAAATAAAATAAGATGTACTGGCATAACCACAT
TGTTCGGCAATTTTATTGACTGAACCTTCTACGCGTATCAAATTTTTTGCGTGCTGCATT
CTTGCATCTAAAAGAATCTGTGAGAATGTCGTTTGCTCTTGCTTAAGTTTTTTCTTCAAC
AGGCTTTCACTGATGTACAGGCAGTCACAAATATCTTTCAGCTTCCATGGGTGCGCCGGC
TTCATGTTGACAATATTTCTCACTTTCCCAGAAACGGATAGCACACCGTTAGTTAATAGT
GTAATGAAACCTTTGCATGCGGCAAAAATAGACAGGCAAGAAAAAAGCAAAAGTTCTGAA
AAATTATGATGATTGCGTTCTTCCGAGTTGAGATAAGCAATCATTTCATTAAGCAATCCA
GTCGGTACATTTGAAGCACGTAAAAACTTCGCAGGAACAGGCACCGTCACTGTCTGGATG
TTAGTGCATTGTAGATATTTTTTAATGGTATTTTCAGTAAATCCGATCTCTTTAAAATGC
CGCTCATAAGGTTCAAAATGCGTACGAACAGCGTTATCTACCATCAGGATCTCGCCGTCA
GAGAAGGCGTAATCTTTATCTAAAATGTTAGCGTTGAAGGCATGATGAATAAATATAACA
GAACAAACGAGCGACATTTTATCTCCTTAAAACAATAAAGTTTTTATCGATACTTTTTTA
ACATTTCATATTTATAATTTGCTGTTTGTTTTCAGCCTTGCAAACTATTGATAATGAAAT
GTGTAAGATCTCTTGCAATGCGACCCATTTCTGAAATACTCAGCTGATCAATTGCCGAAA
AAATGGCTATCAACGTAAGTGTCAGTAATAAGACAACCACAATTGCAGACATGATTTCTT
TATAGTTGTCTCTTTGCGTGATTTTGTTTTTCACTGTGGTCGCATGCATTTCAAATATGT
TTATTTAGCGGATAACGTTAAAAATCGTTAATCAGTATGCTTAATATAACAGGCTGGAGA
AAAGAGGAAATAGGACTGGTGCTTCAGTACTGAGCGGAGTTTCTTACAGCTGTAGGCAGA
AGTTTATATCTTATAGTATGTAGTTTAATTTAATCCATGTGAGCAAATTGCGAAATAATA
GTCAATGAGGAATTCTTCTGCTGTGCGGATGACAGCAGAAGAAATGAGAAGAGGCATTAA
TTTGATGGTTCTAATTCAACCGGAATACTTTTATAGCCAGGAATGCCACTTAATGGATCG
TGGTTATCAAGTGTTAGCATGTGATTCGATTCTGGAAAATAGGTCACCAGTGAGCGGTCA
GCCATAGGGTAAATGACCACTTTTAATCTATCCATGCGGCGTGAGCTGCGCTTACCGTCT
GGCGTAAGCGCAATAAGATTAACTCTTTCGCCGTTTTTTACACGGCAAATTTTAGCTTGT
TTAGCACTCATAAAGACCACATCTCGTTGACCGAATACCCCTCGATAGCGATCATCCATA
CCATAAATCGTCGTGTTGTACTGATCGTGGCTGCGTACTGTCGCCATGACCAGCTTACTG
TTAAACGCTGAAGAGGGATCTTCTAACAGCCCTTTGCTGGTAATGAAATTAGCCTTACCT
GACGGCGTCATCCAGCGCCTTTCAGCAGCTGCATTTATCAGGTGAAAACCACCGGGATGA
CGGATGCGCTGGTTATAGTCGGCGAACTCTGGCAGCACAGCTTCAATGTCATTGCGAATG
CGATCATAATCTTCCACCAGATACTCCCAGGCTACCACGCTCTGGGGTAGTGCTGCCTGC
GCGATTCCCGCGACCACTGCACACTCTGATTTCAGCATTACACCGGCGGGTTTTAACACG
CCACGCGAGGCATGAATCATCGACATTGAATCCTCAACGGTTACCGCCTGCGCACCGTTT
TTTTGCATGTCAATCTCGCTACGTCCCAGGACCGGCAGAATATAGCTATGCCGTGCGGTC
AACAGATGAGAGCGGTTAAGCTTAGTGGCTACGTGTACCGCCAAATCTAATTGCGTTAAC
GGTACAGCGCTCGCTTCCCGATCTGGCATTGCCAGCGCAAAATTGCCCCCCATGCAGATC
AATGCTCGAGCCTGCCCCGTACATATTGCTTGCATGCTGGCAATTGCAGCATGTCCAGGT
GCATGAGGTGGGGTGAAGCCATAGCGCTCACCCAGACGAGCCAGAAACTCTGCAGACGGT
TTCTCGGTGATACCGACGGTTCGGTCGCCCTGTACATTAGAGTGTCCACGTAGTGGGCAG
ATACCCGCACCAGGCTTGCCAATGTTACCTTTCATCAACAGCAGATTGACCAGTTGCTGT
ACGTTCTGGGTACCATGTTCGTGCTGAGTGATCCCCATTCCGTAACAGATAATGGTGCGT
TCGGCAGCGGCATATGCGTCAGCCAGTTCGGCGATTTGTGTCTGACTTAGTCCAGAAATA
CGTTCGATATCTTTCCACTCGGAATTGAGAACGTCACGGCGTAGCTCGTCAAAGCCGACG
GTATGCGTTTGAATAAACTCGTCATCAAGCAATGAAGGCCGACCTGCGGCGCTTGCAGCA
TCATCGCGCTCAATTAACAGGCGCATCATCCCCTTGAGCAACGCCATATCGCCACCAATG
CGCACGTTATAGTAGGCACTGGCCAACTGAGTCTCAGAGTTCGTCAGCATTTCAAACGGG
TTTTGCGGTGCGGTAAATCGCTCCAGGCCACGTTCCTGTAGAGGATTGATGGCGATCATT
TTCGCTCCCCGTTTCACTAAAGCGCGCAACGAAGTCAGCATGCGAGGGTGGTTTGTACCA
GGGTTATGCCCAATGCAAATGACTAAATCGCACTTCTCAAAGTCTTCCAGCAACACGGTC
CCTTTACCTACACCGATACTCGCTGCCAAACCCACGCTTGTCGGTTCATGGCACATGTTG
GAGCAGTCGGGAAAGTTATTGCTCCCGTATTCACGGGCAAAAAGCTGATAAAGAAAGGCA
GCTTCATTGGAAGTGCGGCCCGAAGTATAGAATTCAACCTGATTGGGATCACTATAGCTT
TGAAGGCGTGCGCCAATTTCGTCGAAAGCTTGTTGCCAGCTTAATGGCTTGTAACAGTCG
CTGACGGCATCATATTTCAAAGGCTGAGTGAGTCGCCCCGCAGCCTCAAGCTCGTGGTCT
CCCCAGGTAAGTAATGATTGAACCGTATTCTCAGCAAAGAAAGAGGCGTTTACCTGCTTA
TCCGTGACTTCCCAGGCGATTGCTTTTGCGCCGTTTTCACAAATGTCGAATGACGCACTG
TGCTTAGGATCTGGCCATGCACAACCCGGACAGTCAAAGCCCTCTGGCTTATTCATGTCA
AACATGGCAATAACATCCTGGCGTATATCCATCTGCTTACGTACTGCATTCGCTACGGAT
TTAACAGCACCCCAACCACCTGCAGCACCCTGGTAGGATTCAATTTTTTTCTTCATCTAC
TTATCCTGTGTGGAAATGAATTATTAGGATTTGTAATAGCGATGATGCACAGTACATACA
AAGGGATTATCGCCAACATGGATATATAAGAGTAGGGGACTACTCTCTTTCTATTTTTAA
TCTATTATCGTTAAACAATAGATTAAATACGATAAGTTAAGCATCATCTCTCATAGTGTT
TAAATTAACATATTTTTCAATATAAAAAATAAGACTCTGGCTTCAATTGTGCGCGGATTT
TCTTACAGGTGTAGGCTAATAGCCTTCACAAAATAATTATCCGCGCAATTTTCGTGAATG
GAGCGCATAGACTAAGGTCAAAATCACAATTATTCATAGATAAAAGTGACACCAATGACT
GACTGGACGGTTCCGGCTGAAACCTTGTTTCCTGTTTGTCCATAGGTTGCGCTTAAACCC
AGAGGTACTTTGCTTTTATTTACTGTCCCCAGGGAGACATTTTCTCCCGTAGCCAGTATT
TTTCCATTACGCATTAGAGTGACACCCACTCCCGATGCTTTTGTTGCATCAGGTGCTGTG
TTAGCAAACACTTGTCGGCTACTGTCAGTGGTGGCACCCGAAAGATAAAATGAGAGCTTT
TGTTCGCTTGAGCAATATACGCCAAGGGGTATTTCTGCGCTTCCAGGAAAGTCCGGGAGA
TCCACGGTGACATTTCGACTATCAACGGTGCAGCCGCCTGTTGGCATAACAACATTGTTA
TTTGAAATAATATTCCACGTAAAATTACGCGGATTTCCGCTTCCTAATGTTGCAATTTTA
TACATATGAATACGGGCAATGACTTCCCCCGCTTTTATGACAACTCCACCGGCCGCCCCA
ACTGGGGTAATATAGAGTTTTAACGGTAATGGCATCGGTGTCTTATCACCAATATCCAAT
ACGTTGGTATTTGTCGTCAACGGGAAGGGGTAGGTCACATTATTCCAGTACAGCGATCCT
TTATATGACTGTAGGGAGCCTGCGAAAGCTGAGCCTTGTACCAGGTTTATATGATCAGTG
TCGTACCAGCCGCCGTAATCATTCCAGCAACTTATATGCTGAGACAAGTCTACAACCAGA
TTCTGGCCCGGCTGTATTACAGGGTCGAGATTAACATAAACAGAGGTTGTACCTGCTCCA
ATACTTGACCCGCCATCGACATTACAACTGAAGGCAAAAACTTTGCCTGCCATTAATAGA
AGATAAATACCGAACAGGACCTTTATACTGATTGTTTTACCCATGATATATCCTAAGGTT
AAAAATTGATTTAAAAAGAAGGCTAAGAAAATCGAATCGACGTTATTGCCAGGTGTAGAT
CACATTGATTAGCGCCTCGATCGTTCCCTGGCTTGCGTTTCCATTCACCGTGATAGCTCT
TGCCTTAAGTGGAAACTGTGCATTACGAGTGATCTCATCAACAATAACCGTTTTGCTATC
GCCATTTTTTAACGCAGCATCCTGGTCATCCCTCAGCTCTATCTGAATATTTTCGGCAGT
ACCTTCATTTTTGTAATAACCCGTATTGTCAGTTGAACCTGTCACGATTGCCGTCACTGC
ACTTGTTTCAACCGGACAATCGGTTAATGACAAAGTAATATTGTGCCAGCCAGATGCAGA
ACCAGGTTGTTGCAGATTGCGCGTATAAAGATCCCCGAGATTAACGTTAGCTTCTTTGGT
TTGAATAGTGCAGGGTTTAGCGACTACCCGACCATTAACAGTGATAGTGACATCGGCGGC
CTGGAGAGTTGCTGTGAATAACGCGCAAAACGTAGCTAACAGGAACCTCTTGTGAAGTCT
TTTCATATCTGACTCTGATTATTGAAATTCAAGGGTAAAGGTTGCCGAAGCCCTCACCAG
TCCCGGATTGACGGACTTCTGAGTTGACTTCAGACGAGCGGAGTAAGGCAAAATATTGTT
CTGTTCTGGTACCAGTGGGATCCACTGCATCCCGGCATGAAGATCATTCAGTTTCACCGG
ACGCATATTTGCGTCCAATATTTCTATACCCAAACCGGAGGCCGTATTGCTTCCTTCATC
CAGTTTCAACAAAGTATTATTTTCTGCATCCTCAATACCGTTAAATGCAACCCGAACCCC
CGTTGTCCCTTTGCTGCATTCACTTAACGTAATCTGAAAAGGGACGGCTGGACTTGTGCT
ACCGGTCGTTGGAAATTGTCTGGCACTGTTTTTTTGGAGATCTACGGTAAAATTAAGCGA
ATCCGATGAGACTGTGCAGCCATAATCGAGGACGCGCCCGCTAATTTTAATAACGCTATC
TGCGGATAAAGCAGAATAGGTGGTTAACCCCAGACATAAACCGAGGAAAATAATGTTATT
GTATTTCATAATCTATTGTTCCTTAGCGACAGATTGCTGTCTGCTGGTTCAGTAAGGTAC
CAGGAGAAACTTCAGGAAGCTTGTACTCGACAATACAGTTTGAGTTTTTATCTTTGCCCC
ATGAAACCTGTAATTGCCCTGACTGTGGAAGTCCAGTCAGATAAACCTGACCATTTTCCG
CGACAATGCTGCCATTTTTATTCTCTCCGTGTGTGACAATTGCACCGAATGGAACGCTCT
TATTACCGTACTTCAACGTCATTAATACTTTCCCGCCGATTTGTGCATTAAATGTTGCTC
TGGCAATAGCACCGTGAGTTGGGATGACAGTGACCACGGTTTCATCCAGTTCAACATTAT
CTGCAAGGGAATTCGCGTTAAGAGCAACACGGTTTTCTCTATATTCTGTCGCAAATGGTA
ATATGGCATAGCCACGCCAGTCGGTATGAATTCCGGTCTGGTTCTCTATTTTGACATTAT
CAGCACCAGGAGCCTTAACCAGAACCATTGTGTCGCCCAGCGGCTGTCCAAAGGTGATGC
CATCAGCATGAGCAATAATCCCACCACTCATTCCGTAATAAATCTGGCTGCTGTCACCAC
TCCGACTGTAACCGACATTAGTATTACCATAAGCTCCACGATAATTAAGAGAACTGTAAC
CACTGGTGCCAGACGATGTATTACCTCCGTGGGTGTTACCGACCTGAACGCTATAATTCA
GGTTATTATCCGGCAGCAGAGTGCCATAAACCCCCGATAGATTGGTCATGCCGCCTTTCA
AATCGTTTGACATACTGTAACTGGCGTTTGAATTACGAAATGCCGACTGACTGTCTGTAC
GCATCCAATGACTGAAGGGAACATTAAGCGTAAAAGCGAGTAAATGATCCCGATCGTTTT
GCCATATATTATTGGAATAGCTGTAATTCAGCGAAGTCGTAATATCACCAAACGGCACAT
TTAATCCAAATGATATTTGCTGGTCGCTGCGTGACGTGTTCCAGTAACTTTGGCGACTGG
CACTGAAAAATGTCGTACCGTAATTTCCAAGCTGCTGAGAGATGCTTATTTGTTCCTGAC
CACGCTTACTGTAGAACAGATTAAAATAATCAATAAATTGTGTCTGCTCATTGGTGTCTC
CGGTAGGAGGCTTGACGGTGTAACCACTCATTCGACTGTAGGCACTGTCGGATAAGTTAT
AAAAACCTTGCGTAGAATAGCGATATCCTGCGACCTGGATATTGGTTCCACAACAAGTTT
ATTGCTGCACTTGTTGAAGAGAGTATTTGCAAAAACATTTTATGTCGCTAAATAACATGA
CGATTTCATTATGCATGTTATTTATAAACCGTGACTAAACAGAATATTATTGCGAACAAG
GGAAGTGTCAGGAAAGGTCAAGAGCTACCAATGGTTAATATGGCTATAAATCATTAGCTA
TGGTTAATGTTTGCTTGCTGAAACTAACACCGAATTGCTCTAAACAGATAAGTGCAGGGT
TTATTAAAGCTGTCCGACAGACTTTCTTAACCTGGTAATATCTCTCTTGGGTGACTCTCC
AAACA