MG1655
W3110
Search for
Japanese | English
Deletion - Fasta Format
Fasta Format
 Download OCR33,35-4 (AK4-2 / BK5-2).seq
 Deletion OCR33,35-4 (AK4-2 / BK5-2)
 Length 28963
 Fasta Format

>OCR33,35-4 (AK4-2 / BK5-2)
GTGGGATGAATACCGACGTCTGATGGCCGTAGAACAATAACCAGGCTTTTGTAAAGACGA
ACAATAAATTTTTACCTTTTGCAGAAACTTTAGTTCGGAACTTCAGGCTATAAAACGAAT
CTGAAGAACACAGCAATTTTGCGTTATCTGTTAATCGAGACTGAAATACATGAAAAAAAC
CACATTAGCACTGAGTGCACTGGCTCTGAGTTTAGGTTTGGCGTTATCTCCGCTCTCTGC
AACGGCGGCTGAGACTTCTTCAGCAACGACAGCCCAGCAGATGCCAAGCCTTGCACCGAT
GCTCGAAAAGGTGATGCCTTCAGTGGTCAGCATTAACGTAGAAGGTAGCACAACCGTTAA
TACGCCGCGTATGCCGCGTAATTTCCAGCAGTTCTTCGGTGATGATTCTCCGTTCTGCCA
GGAAGGTTCTCCGTTCCAGAGCTCTCCGTTCTGCCAGGGTGGCCAGGGCGGTAATGGTGG
CGGCCAGCAACAGAAATTCATGGCGCTGGGTTCCGGCGTCATCATTGATGCCGATAAAGG
CTATGTCGTCACCAACAACCACGTTGTTGATAACGCGACGGTCATTAAAGTTCAACTGAG
CGATGGCCGTAAGTTCGACGCGAAGATGGTTGGCAAAGATCCGCGCTCTGATATCGCGCT
GATCCAAATCCAGAACCCGAAAAACCTGACCGCAATTAAGATGGCGGATTCTGATGCACT
GCGCGTGGGTGATTACACCGTAGCGATTGGTAACCCGTTTGGTCTGGGCGAGACGGTAAC
TTCCGGGATTGTCTCTGCGCTGGGGCGTAGCGGCCTGAATGCCGAAAACTACGAAAACTT
CATCCAGACCGATGCAGCGATCAACCGTGGTAACTCCGGTGGTGCGCTGGTTAACCTGAA
CGGCGAACTGATCGGTATCAACACCGCGATCCTCGCACCGGACGGCGGCAACATCGGTAT
CGGTTTTGCTATCCCGAGTAACATGGTGAAAAACCTGACCTCGCAGATGGTGGAATACGG
CCAGGTGAAACGCGGTGAGCTGGGTATTATGGGGACTGAGCTGAACTCCGAACTGGCGAA
AGCGATGAAAGTTGACGCCCAGCGCGGTGCTTTCGTAAGCCAGGTTCTGCCTAATTCCTC
CGCTGCAAAAGCGGGCATTAAAGCGGGTGATGTGATCACCTCACTGAACGGTAAGCCGAT
CAGCAGCTTTGCCGCACTGCGTGCTCAGGTGGGTACTATGCCGGTAGGCAGCAAACTGAC
CCTGGGCTTACTGCGCGACGGTAAGCAGGTTAACGTGAACCTGGAACTGCAGCAGAGCAG
CCAGAATCAGGTTGATTCCAGCTCCATCTTCAACGGCATTGAAGGCGCTGAGATGAGCAA
CAAAGGCAAAGATCAGGGCGTGGTAGTGAACAACGTGAAAACGGGCACTCCGGCTGCGCA
GATCGGCCTGAAGAAAGGTGATGTGATTATTGGCGCGAACCAGCAGGCAGTGAAAAACAT
CGCTGAACTGCGTAAAGTTCTCGACAGCAAACCGTCTGTGCTGGCACTCAACATTCAGCG
CGGCGACAGCACCATCTACCTGTTAATGCAGTAATCTCCCTCAACCCCTTCCTGAAAACG
GGAAGGGGTTCTCCTTACAATCTGTGAACTTCACCACAACTCCATACATCTTCATCATCC
TTTAGGCATTTGCACAATGCCGTACGTTACGTACTTCCTTATGCTAAGCCGTGCATAACG
GAGGACTTATGGCTGGCTGGCATCTTGATACCAAAATGGCGCAGGATATCGTGGCACGTA
CCATGCGCATCATCGATACCAATATCAACGTAATGGATGCCCGTGGGCGAATTATCGGCA
GCGGCGATCGTGAGCGTATTGGTGAATTGCACGAAGGTGCATTGCTGGTACTTTCACAGG
GACGAGTCGTCGATATCGATGACGCGGTAGCACGTCATCTGCACGGTGTGCGGCAGGGGA
TTAATCTACCGTTACGGCTGGAAGGTGAAATTGTCGGCGTAATTGGCCTGACAGGTGAAC
CAGAGAATCTGCGTAAATATGGCGAACTGGTCTGCATGACGGCTGAAATGATGCTGGAAC
AGTCGCGGTTGATGCACTTGTTGGCGCAGGATAGCCGTTTGCGGGAAGAACTGGTGATGA
ACCTGATTCAGGCAGAGGAGAATACTCCCGCACTTACTGAATGGGCGCAACGGCTGGGGA
TCGATCTCAATCAACCGCGAGTGGTGGCTATTGTTGAGGTCGACAGCGGTCAGCTTGGCG
TGGACAGCGCAATGGCGGAGTTACAACAACTGCAAAACGCGCTGACTACGCCCGAGCGTA
ATAATCTGGTGGCGATTGTCTCGCTAACCGAAATGGTGGTGTTGAAACCGGCGTTGAACT
CTTTTGGGCGCTGGGATGCAGAAGATCATCGTAAGCGAGTTGAACAACTGATTACCCGCA
TGAAAGAGTACGGCCAGCTGCGTTTTCGCGTTTCACTGGGCAACTATTTTACCGGTCCTG
GCAGTATTGCCCGATCCTATCGTACGGCGAAAACGACGATGGTGGTGGGTAAACAGCGGA
TGCCAGAAAGTCGCTGCTATTTTTATCAGGATCTGATGTTACCTGTGTTACTCGACAGTT
TGCGTGGCGACTGGCAGGCCAACGAACTGGCGCGACCGCTGGCGCGGCTGAAAACGATGG
ACAATAACGGCTTGCTGCGACGAACGCTGGCGGCGTGGTTTCGCCACAATGTGCAACCGC
TGGCAACGTCAAAGGCGTTGTTTATTCATCGTAATACCCTGGAGTATCGGCTTAATCGTA
TATCGGAACTGACCGGGCTTGATTTGGGCAATTTTGATGACAGGTTGCTGCTGTATGTGG
CGTTACAACTGGATGAAGAGCGGTAGGTTATGCGTTAAGGTTGAGGCGGCGCTGGCTCAT
TCCCCTCAGCCCGAAGGGTAGAGGGGAATGCCCGAATTAACCGTCAGTTCGGGATTATTT
ACGCGTTAGTTTTTCCAGATCGGCTTCAATCTCGCTGATCTTATTGGTTACGACTGACTC
CAGGTGACGTAAGTCGTCGAGGATCTTACGCTTAAGATCAACTTCGCTGCGGTCACGCTG
GCAGATTTGATCAAGCTCATCAATGATATACCGTAGATTCGGGCTGATTTCCTGGACTTC
TTTATAACCCTGACCCACACCATCAGCGACGACCGTTTTACGCTGACGCGGATATTTAAA
CTTAACGCTCTTGGCGAAAAACTCGCCTTTGTCTTTCTGGAAATAGATTTTCAGAATATC
GTTGTTGGCTTCCTGCCGGAGGCTGTAACGATCAATTTCTTCAGGATTGGTAATACCCAG
ACTTTTCAGATTGTCGTACATAGCGTTACCTCAAAATGAGTCAGTAAATTGTGCTTATTT
TAGCATTTGGCCTGGCCCGCCCGGCTCGACTGTGATCGCAGAAAGCCTTTTTCTTCCAGA
CTTCTATCATGGCGTAAAAATCAAAAAATTACCTGCTTTATTCTGGTGATAAAATTCACG
ATCTACACCAGTTCCAGCATCGTTACTTCCGGGCGGCAGTTCAGACGCAAACCATACAAA
CTGCCCACGCCACGGGTTGTGTAGATGTGTCTTTCGCCAAAGGCATTTAATCCGGCGACG
TAACGTTTATCTTCGACAGGGGCAAAAGGTTCACCAACCAACGGTACGCGCAGTTGCCCG
CCGTGAGTATGGCCGCACAGCATCAGATCCCAGGGTTCATCACGCATGACTTCTTTGCTG
TCGGGATTATGCGCCAGCACCAGTCTTGGCAGATTGGCTTCGCTGGCGGGAGGCGGTTTG
CATTGTCCGGCCCATAAGTCACCAGTGCCTACCAGTTCGAATTGCCTGTTCGGCGTGGCG
ATCACCGTAGCCTGGTTAAACAACACCGTGATGCCCGCTGATTTCAACGTCTCGCCAATT
AAGTGATTTTTTTCTGTACCAACAGGGCGATCGTGGTTGCCGAAGCAGGCAAACGTCGGC
GCACATTCGGCAAGGGGGGAGAGTACGTCACTAAACGCCGAAAAATTCAGCGACATATCA
AATAATACGTAATCGCCGCCCAGTAATATCAAATCGGGCTTTTGTTCTATGCCAAGAGCA
ATCGCGTCAGAAATCAGGCTTAAAGGAACAAAACGAGAGTAATGGAGATCGGCCAGAAAA
AGAATTTTGAATGGTGCTGCGTTGTCTTTAAAAAAGGCGAGGCGGTGACGGATTAATTCA
AACCAGCCTGGCTCACAGTAATGCATATAACCGAAACCTGAGCTCGTGGCTATCGTCGCG
GCAGTAGCCTGCAAAAATCGGCGGCGTGAAATCATCGCTCATCCCTGCAAAAAAATCGGG
CAGCGTCGTGCTGCCCGTGTGCATACTTTTAGTCGATGGTACGCAGCAGTTCGTTAATGC
CGACTTTGCCGCGAGTTTTCGCGTCAACTTTCTTAACGATAACCGCACAGTAGAGGCTGT
ATTTGCCATCTTTTGACGGCAGATTACCTGAAACAACCACAGACCCCGCCGGAACGCGAC
CGTAGTGGATTTCGCCGGTTTCACGGTCGTAAATACGGGTGCTCTGACCAATGTATACGC
CCATGGAAATGACGGAACCTTCTTCGACAATCACCCCTTCAACCACTTCAGAGCGCGCGC
CGATGAAGCAATTATCTTCAATGATGGTTGGGTTAGCCTGCAGCGGTTCCAGCACGCCGC
CGATGCCCACGCCACCGGAAAGGTGGACGTTTTTACCAATCTGCGCACAAGAACCGACGG
TCGCCCAGGTATCAACCATGGTGCCTTCATCAACATATGCGCCGATGTTGACGTAAGACG
GCATCAGCACGGTGTTACGGGCAATAAACGCACCCTGACGTACCGCCGCTGGTGGCACAA
CGCGGAAGCCTTCTTTCTGGAAACGTGCTTCGTCGTAGTCGGCGAATTTCATCGGCACTT
TGTCGAAGTAGCGGCTTTCTGCCCCTTCGATCACCTGATTATCATTAATACGGAAAGAGA
GCAGCACCGCTTTTTTCAACCACTGATGCGTCACCCACTGACCGTCAATTTTTTCCGCTA
CACGCAGTGCGCCGGAATCCAGCAGGGCGATCACCTGATTTACCGCTTCGCGGGTAACGG
TGTCTGCATTGGCTGGCGTGATCTCGGCACGGCGTTCAAAAGCGGTTTCAATAATGTTCT
GTAACTGCTGCATTGTTAAACTCTTTTCATATCAGTAAACACATCACCCTTTATCGTTTG
GATTGAGGGCCTCTGTCAACCGCTGATGCACTTCCTGCTGCAACTCGTTATTAAGCGCAC
GCCGGTCAGCGGTGGCAATTATGAATAAATCTTCTACTCGCTCGCCAATGGTTGTAATTC
GGGCACCATGAAGCGAAATTCCCAGATCGGCAAAAATTTTCCCGACTCGCGCCAGCAGTC
CAGGTTGGTCGAGGGCGATCAGTTCGAGGAACGATTTGCGGTCGGTATGGGTCGGCAAAA
ACGTTACTTCGGTTTCAACAGTAAAATGGCGTAATTTGGCGGGTTGGCGACGGGGCTGCG
GTGGCTGCCAGCTACTTTGCGTCAGTACTTGCTCCAGACCAAACCGAATAACCTCATGAC
GATCTGCGGACAGCGGGTTGCCATCGGGTTCCAGCACGATAAAGGTATCCATCGCCATAC
CGTCGCGAGTGGTGAAAATTTGTGCGTCGTGAACACTTAAATTGCGGCGGTCTAATTCGG
CACAGACGGCGGCAAACAGATAAGGGCGGTCCGGGCTCCAGATAAAAATCTCGGTGCCTC
CACGCGTAGCCTGCGGGCTAAGCAATACCAGCGGTTTGCTTAAATCATGCTGTAATAAAT
GGCGGGCATGCCAGGCCAGTTGATTTGGGCTATGGCGGACAAAATAGTTAGCACGACAGC
GTGACCAAATTTGGTGCAGCGCCTCTTCGTCGATGTTATCCATGCGCAGTAGTGCCAGTG
CCTGGAGTTGGTGATGGCGAACCCGTTCGCGCATATCCGGCGTGTTTTGCATTCCGCGTC
GTAGCTGCTTTTCGGTGGCAAAGTAGAGCTCACGCAACAGACTTTGCTTCCAGCTATTCC
ACAGCGTTTCGTTGGTGGCGCAAATGTCAGCCACAGTCAGGCATACCAGATAGCGCAGAC
GATTTTCCGTTTGCACTTCTTCGGCAAACTGCTTGATGACTTCCGGGTCCTGAATATCGC
GGCGTTGGGCGGTCACCGACATCAACAGGTGCTGGCGAACCAGCCAGGCGACCAGCTGTG
TTTCGCGTGAGTTCAGCCCGTGGAGTTCGGCAAAATGCACTACATCCTGAGCACCGAGAA
TGGAGTGGTCGCCGCCGCGTCCTTTGGCGATATCGTGAAACAGCGCGGCGATGAAAATCA
GCTCAGTTGACGGCAGGCGCGGCCAGACGTCCACACACAACGGATGGCGCTGGCGCGTTT
CTTCACTGGCAAAACTCTCCAGTTTCAGCATCACGCGGATAGTATGTTCATCCACCGTGT
AGGCGTGGAACAGATCAAACTGCATCTGCCCGACGATATGCGACCATTGCGGCATATACG
CGCCGAGCACGCTATGGCGATGCATTGGCAATAGCCCGCGCCGCACCGCTCCGGGGTGAC
GCAGAATGCTCAAAAACAGTTTTCGTGCTTCCGGAATATTACACAGCGGTTGTTGCAGAT
GGCGACGGGCATGGCGTAACTGGCGCAGCGTGGTGGAGTAAATGCCGGTGATCGCACTGT
TGTGCACCATGGTGTAGAACATACGCAAGATGGCTTCCGGCTGGCGCATAAATAGTGTTT
CATCACGCAGGTCGATTAGCGTACCGCGTAGCTGAAACTCATCGTCGATTGGACGTGGTT
TTTCGTCGGCGGGAAGGGCGAGGATGGCTTCATCGAACAGTTGCAGCAGCATCTGGTTGA
GTTCACTGACGCGGCGTGTAACGCGGAAGTAATCCTTCATCATCCGCTCGACCGGTTCGT
TACCTTCACCACTGTAATTCAGACGCTGGGCGACGCTAAGCTGGCGATCGAATAACAGGC
GATTATCGTAACGGCTGACGACCAGATGCAGGGCAAAGCGAATACGCCACAATATATGCA
GACATTCGTTTAATTCCGCCCGCTCCGCTGAGGTTAAGAAGCCAAACCCGACCATTTCAT
CCAGCGATGTTGCGCCAAAATGACGGCGGGCCACCCATTGCAGAGTGTGGATATCGCGCA
AGCCGCCAGGGCTGCTTTTGATGTCTGGTTCAAGGTTGTAGCTGGTGCCATGGTAACGCT
GATGGCGCTGGTTCTGTTCTTCAACTTTCGCCGCGTAGAACTTGTCGGAAGGCCAGAATC
CTTCGCTGAAAATATGTTTTTGCAGTTCGAGGAACAGCGCAACATCGCCAATTAATAAGC
GGGATTCGATTAAATTGGTGGCGACGGTTAAATCCGATAACCCTTCCAGCATGCACTCTT
CAAGCGTGCGCACGCTATGACCGACTTCCAGCTTTACATCCCAGAGCAGCGTTAACAGCT
CGCCCACTTTTTGCGCCTGATCGTCCGGGAGCTTTTTACGGCTTAAAATCAGTAAATCGA
CGTCTGAAAGTGGATGCAGCTCGCCACGACCGTAGCCACCGACGGCGACCAATGCCAGGT
CGGCAATCTGGCTGAATCCCGCTTCAATCCATAATCGTTGCAGGAGCTGGTCGATAAACT
CGGTGCGCGCCTCAATCAACTGTTCTGCAGAGATCCCATTGTCAAAGGCATCACCCAGCC
AACGCTGGAAAGTATCGATATGGGCTTTTATCCCACCGACGGTTAATTCATCACGGGGCC
AGACGCATGGATTTTGCGGTTGACCGGGCAGGGTGGGGAGAGCGGTGTTTGCGTACTGTT
CTGGAAGGGTATTCATTGTGCGCCACCCATAAGATTAAATTATCGCATTAAAAAAGCCGG
CATTCGCCGGCTTCATCTTATTCGTCGTGCGAGATTATCGCCGGGATGGTGTCATCCTTG
CGTAGCGTCAGAATTTCGCAGCCGTTATCAGTCACCACAATAGTATGCTCATATTGTGCA
GACAAGCTGCGATCTTTGGTTTTTACCGTCCAGCCATCTTTCATGGTGCGGATCTCTTTT
TTACCCGCGTTGACCATTGGCTCGATGGTGAACGTCATCCCAGGTTTCAGTACGACGTTG
GTTTCACGGGAGTCATAGTGCAGCACCTGCGGTTCTTCATGGAAGCCGCGACCAATACCG
TGTCCGCAATATTCACGAACGACGGAGAAGCCTTCTGCTTCGACAAATTTCTGAATCGCC
GCACCGATTTCGCGCAGATTAATGCCTGGTTTTACCATGCGTAGCGCCAGGTACAGGCTT
TCTTGCGTGATGCGGCACAGACGTTCGCCCATGATGGTCGGCTTACCGACGATAAACATT
TTCGAGGTATCGCCGTGGAAACCATCTTTGATTACGGTGACATCAATGTTAACGATATCG
CCATCTTTCAGCAGCTTAGCATCGTCCGGGATACCGTGGCACACCACTTCATTAATAGAG
ATGCAAACGGATTTCGGATAGCCGTGATAGCCGAGGCAGGCAGAAACCGCGTGTTGTTCA
TTAACAATGTAATCATTACAGATGCGATCCAGCTCGCCGGTGCTGACGCCCGGTTTAACA
TACGGTTCGATCATCTCCAGCACTTCGGCAGCCAGTCGGCCAGCGACGCGCATTTTTTCG
ATATCTTCTGGGGTCTTGATTGAGATAGCCATTAATTCTGTCCATCAGCGTCGGTGATAC
CGACAATATATATGTAAGTGCCGTCAATGGTATCACACCCGGGCAAATTGAGAATCATTC
TGAATTTCGCCAAACGTGCCACTGAAGGTTTTCTATAATAGAAAATTCGACGTCTGATGC
TGTACACAGCGCCAACAATTATTGGTGTCCACGACGTATTTGTGGTATAAAGCGCGCCGG
ACTTCCGATCCATTTCGTATACACAGACTGGACGGAAGCGACAATCTCACTTTGTGTAAC
AACACACACGTATCGGCACATATTCCGGGGTGCCCTTTGGGGTCGGTAATATGGGATACG
TGGAGGCATAACCCCAACTTTTATATAGAGGTTTTAATCATGGCAACTGTTTCCATGCGC
GACATGCTCAAGGCTGGTGTTCACTTCGGTCACCAGACCCGTTACTGGAACCCGAAAATG
AAGCCGTTCATCTTCGGTGCGCGTAACAAAGTTCACATCATCAACCTTGAGAAAACTGTA
CCGATGTTCAACGAAGCTCTGGCTGAACTGAACAAGATTGCTTCTCGCAAAGGTAAAATC
CTTTTCGTTGGTACTAAACGCGCTGCAAGCGAAGCGGTGAAAGACGCTGCTCTGAGCTGC
GACCAGTTCTTCGTGAACCATCGCTGGCTGGGCGGTATGCTGACTAACTGGAAAACCGTT
CGTCAGTCCATCAAACGTCTGAAAGACCTGGAAACTCAGTCTCAGGACGGTACTTTCGAC
AAGCTGACCAAGAAAGAAGCGCTGATGCGCACTCGTGAGCTGGAGAAACTGGAAAACAGC
CTGGGCGGTATCAAAGACATGGGCGGTCTGCCGGACGCTCTGTTTGTAATCGATGCTGAC
CACGAACACATTGCTATCAAAGAAGCAAACAACCTGGGTATTCCGGTATTTGCTATCGTT
GATACCAACTCTGATCCGGACGGTGTTGACTTCGTTATCCCGGGTAACGACGACGCAATC
CGTGCTGTGACCCTGTACCTGGGCGCTGTTGCTGCAACCGTACGTGAAGGCCGTTCTCAG
GATCTGGCTTCCCAGGCGGAAGAAAGCTTCGTAGAAGCTGAGTAATAAGGCTTGATAACT
CCCCCAAAATAGTTCGAGTTGCAGAAAGGCGGCAAGCTCGAGAATTCCCGGGAGCTTACA
TCAGTAAGTGACCGGGATGAGCGAGCGAAGATAACGCATCTGCGGCGCGAAATATGAAGG
GGGAGAGCCCTTATAGACCAGGTAGTACACGTTTGGTTAGGGGGCCTGCATATGGCCCCC
TTTTTCACTTTTATATCTGTGCGGTTTAATGCCGGGCAGATCACATCTCCGAGGATTTTA
GAATGGCTGAAATTACCGCATCCCTGGTAAAAGAGCTGCGTGAGCGTACTGGCGCAGGCA
TGATGGATTGCAAAAAAGCACTGACTGAAGCTAACGGCGACATCGAGCTGGCAATCGAAA
ACATGCGTAAGTCCGGTGCTATTAAAGCAGCGAAAAAAGCAGGCAACGTTGCTGCTGACG
GCGTGATCAAAACCAAAATCGACGGCAACTACGGCATCATTCTGGAAGTTAACTGCCAGA
CTGACTTCGTTGCAAAAGACGCTGGTTTCCAGGCGTTCGCAGACAAAGTTCTGGACGCAG
CTGTTGCTGGCAAAATCACTGACGTTGAAGTTCTGAAAGCACAGTTCGAAGAAGAACGTG
TTGCGCTGGTAGCGAAAATTGGTGAAAACATCAACATTCGCCGCGTTGCTGCGCTGGAAG
GCGACGTTCTGGGTTCTTATCAGCACGGTGCGCGTATCGGCGTTCTGGTTGCTGCTAAAG
GCGCTGACGAAGAGCTGGTTAAACACATCGCTATGCACGTTGCTGCAAGCAAGCCAGAAT
TCATCAAACCGGAAGACGTATCCGCTGAAGTGGTAGAAAAAGAATACCAGGTACAGCTGG
ATATCGCGATGCAGTCTGGTAAGCCGAAAGAAATCGCAGAGAAAATGGTTGAAGGCCGCA
TGAAGAAATTCACCGGCGAAGTTTCTCTGACCGGTCAGCCGTTCGTTATGGAACCAAGCA
AAACTGTTGGTCAGCTGCTGAAAGAGCATAACGCTGAAGTGACTGGCTTCATCCGCTTCG
AAGTGGGTGAAGGCATCGAGAAAGTTGAGACTGACTTTGCAGCAGAAGTTGCTGCGATGT
CCAAGCAGTCTTAATTATCAAAAAGGAGCCGCCTGAGGGCGGCTTCTTTTTGTGCCCATC
TTGTAAATTCAGCTAACCCTTGTGGGGCTGCGCTGAAAAGCGACGTACAATGTCGCTAGT
ATTAATTCATTTCAATCGTTGACAGTCTCAGGAAAGAAACATGGCTACCAATGCAAAACC
CGTCTATAAACGCATTCTGCTTAAGTTGAGTGGCGAAGCTCTGCAGGGCACTGAAGGCTT
CGGTATTGATGCAAGCATACTGGATCGTATGGCTCAGGAAATCAAAGAACTGGTTGAACT
GGGTATTCAGGTTGGTGTGGTGATTGGTGGGGGTAACCTGTTCCGTGGCGCTGGTCTGGC
GAAAGCGGGTATGAACCGCGTTGTGGGCGACCACATGGGGATGCTGGCGACCGTAATGAA
CGGCCTGGCAATGCGTGATGCACTGCACCGCGCCTATGTGAACGCTCGTCTGATGTCCGC
TATTCCATTGAATGGCGTGTGCGACAGCTACAGCTGGGCAGAAGCTATCAGCCTGTTGCG
CAACAACCGTGTGGTGATCCTCTCCGCCGGTACAGGTAACCCGTTCTTTACCACCGACTC
AGCAGCTTGCCTGCGTGGTATCGAAATTGAAGCCGATGTGGTGCTGAAAGCAACCAAAGT
TGACGGCGTGTTTACCGCTGATCCGGCGAAAGATCCAACCGCAACCATGTACGAGCAACT
GACTTACAGCGAAGTGCTGGAAAAAGAGCTGAAAGTCATGGACCTGGCGGCCTTCACGCT
GGCTCGTGACCATAAATTACCGATTCGTGTTTTCAATATGAACAAACCGGGTGCGCTGCG
CCGTGTGGTAATGGGTGAAAAAGAAGGGACTTTAATCACGGAATAATTCCCGTGATGGAT
AAATAAGGGTAAGATTCCGCGTAAGTATCGCGGGGGCGTAAGTCTGGTTATAAGGCGTTA
TTGTTGCAGGCAGTTTGGTCACGGCCAGCGCGCAGCAACCGGAGCGTACAAAAGTACGTG
AGGATGGCGAGCACTGCCCGGGGCCAAAATGGCAAATAAAATAGCCTAATAATCCAGACG
ATTACCCGTAATATGTTTAATCAGGGCTATACTTAGCACACTTCCACTGTGTGTGACTGT
CTGGTCTGACTGAGACAAGTTTTCAAGGATTCGTAACGTGATTAGCGATATCAGAAAAGA
TGCTGAAGTACGCATGGACAAATGCGTAGAAGCGTTCAAAACCCAAATCAGCAAAATACG
CACGGGTCGTGCTTCTCCCAGCCTGCTGGATGGCATTGTCGTGGAATATTACGGCACGCC
GACGCCGCTGCGTCAGCTGGCAAGCGTAACGGTAGAAGATTCCCGTACACTGAAAATCAA
CGTGTTTGATCGTTCAATGTCTCCGGCCGTTGAAAAAGCGATTATGGCGTCCGATCTTGG
CCTGAACCCGAACTCTGCGGGTAGCGACATCCGTGTTCCGCTGCCGCCGCTGACGGAAGA
ACGTCGTAAAGATCTGACCAAAATCGTTCGTGGTGAAGCAGAACAAGCGCGTGTTGCAGT
ACGTAACGTGCGTCGTGACGCGAACGACAAAGTGAAAGCACTGTTGAAAGATAAAGAGAT
CAGCGAAGACGACGATCGCCGTTCTCAGGACGATGTACAGAAACTGACTGATGCTGCAAT
CAAGAAAATTGAAGCGGCGCTGGCAGACAAAGAAGCAGAACTGATGCAGTTCTGATTTCT
TGAACGACAAAAACGCCGCTCAGTAGATCCTTGCGGATCGGCTGGCGGCGTTTTGCTTTT
TATTCTGTCTCAACTCTGGATGTTTCATGAAGCAACTCACCATTCTGGGCTCGACCGGCT
CGATTGGTTGCAGCACGCTGGACGTGGTGCGCCATAATCCCGAACACTTCCGCGTAGTTG
CGCTGGTGGCAGGCAAAAATGTCACTCGCATGGTAGAACAGTGCCTGGAATTCTCTCCCC
GCTATGCCGTAATGGACGATGAAGCGAGTGCGAAACTTCTTAAAACGATGCTACAGCAAC
AGGGTAGCCGCACCGAAGTCTTAAGTGGGCAACAAGCCGCTTGCGATATGGCAGCGCTTG
AGGATGTTGATCAGGTGATGGCAGCCATTGTTGGCGCTGCTGGGCTGTTACCTACGCTTG
CTGCGATCCGCGCGGGTAAAACCATTTTGCTGGCCAATAAAGAATCACTGGTTACCTGCG
GACGTCTGTTTATGGACGCCGTAAAGCAGAGCAAAGCGCAATTGTTACCGGTCGATAGCG
AACATAACGCCATTTTTCAGAGTTTACCGCAACCTATCCAGCATAATCTGGGATACGCTG
ACCTTGAGCAAAATGGCGTGGTGTCCATTTTACTTACCGGGTCTGGTGGCCCTTTCCGTG
AGACGCCATTGCGCGATTTGGCAACAATGACGCCGGATCAAGCCTGCCGTCATCCGAACT
GGTCGATGGGGCGTAAAATTTCTGTCGATTCGGCTACCATGATGAACAAAGGTCTGGAAT
ACATTGAAGCGCGTTGGCTGTTTAACGCCAGCGCCAGCCAGATGGAAGTGCTGATTCACC
CGCAGTCAGTGATTCACTCAATGGTGCGCTATCAGGACGGCAGTGTTCTGGCGCAGCTGG
GGGAACCGGATATGCGTACGCCAATTGCCCACACCATGGCATGGCCGAATCGCGTGAACT
CTGGCGTGAAGCCGCTCGATTTTTGCAAACTAAGTGCGTTGACATTTGCCGCACCGGATT
ATGATCGTTATCCATGCCTGAAACTGGCGATGGAGGCGTTCGAACAAGGCCAGGCAGCGA
CGACAGCATTGAATGCCGCAAACGAAATCACCGTTGCTGCTTTTCTTGCGCAACAAATCC
GCTTTACGGATATCGCTGCGTTGAATTTATCCGTACTGGAAAAAATGGATATGCGCGAAC
CACAATGTGTGGACGATGTGTTATCTGTTGATGCGAACGCGCGTGAAGTCGCCAGAAAAG
AGGTGATGCGTCTCGCAAGCTGAGGATAATCCGGCTACAGAGAGTCGCGCTATTTGTTAG
CGTAGGGCTTCAGTGATATAGTCTGCGCCATCTGATCGTAAGTAGTTGGCTTTATAAGGT
CAGATATGCCGTGGTTTTACACGGCTTTTTTTTGTATAGGCTTCAGTATTCCTGAGTACC
GTAAACCCTGTCAGGGAATAAAAAACGCGTGATGTTGTCTGCTACTCAACCACTTAGCGA
AAAATTGCCAGCGCATGGCTGCCGTCATGTTGCGATCATTATGGACGGCAATGGCCGCTG
GGCAAAAAAGCAAGGGAAGATTCGTGCCTTTGGGCATAAAGCCGGGGCAAAATCCGTCCG
CCGGGCTGTCTCTTTTGCGGCCAACAACGGTATTGAGGCGTTAACGCTGTATGCCTTTAG
TAGTGAAAACTGGAACCGACCAGCGCAGGAAGTCAGTGCGTTAATGGAACTGTTTGTGTG
GGCGCTCGATAGCGAAGTAAAAAGTCTGCACCGACATAACGTGCGTCTGCGTATTATTGG
CGATACCAGTCGCTTTAACTCGCGTTTGCAAGAACGTATTCGTAAATCTGAAGCGCTAAC
AGCCGGGAATACCGGTCTGACGCTGAATATTGCGGCGAACTACGGTGGACGTTGGGATAT
AGTCCAGGGAGTCAGGCAACTGGCTGAAAAGGTGCAGCAAGGAAACCTGCAACCAGATCA
GATAGATGAAGAGATGCTAAACCAGCATGTCTGTATGCATGAACTGGCCCCTGTAGATTT
AGTAATTAGGACTGGGGGGGAGCATCGCATTAGTAACTTTTTGCTTTGGCAAATTGCCTA
TGCCGAACTTTACTTTACAGATGTTCTCTGGCCCGATTTCGATGAACAAGACTTTGAAGG
GGCGTTAAATGCCTTTGCTAATCGAGAGCGTCGTTTCGGCGGCACCGAGCCCGGTGATGA
AACAGCCTGATGGGGGTCGCTTTTGCTGAAGTATCGCCTGATATCTGCTTTTGTGTTAAT
ACCCGTCGTCATCGCGGCGTTGTTTCTGTTGCCGCCGGTGGGGTTCGCCATTGTAACGCT
GGTGGTCTGCATGCTGGCAGCGTGGGAATGGGGACAGCTTAGCGGTTTTACCACTCGTTC
GCAGCGAGTATGGTTGGCGGTGTTATGCGGGTTATTGTTGGCGCTGATGCTTTTTCTGTT
GCCGGAATATCACCGAAATATTCATCAACCGCTGGTTGAAATCTCACTTTGGGCTTCGCT
GGGTTGGTGGATTGTCGCGCTATTGCTGGTGCTGTTTTACCCAGGTTCCGCAGCAATCTG
GCGTAACTCTAAAACATTGCGCCTTATTTTTGGCGTGCTAACCATTGTTCCCTTCTTCTG
GGGCATGCTGGCGTTACGGGCCTGGCACTATGACGAGAATCATTACAGTGGCGCAATATG
GCTGCTCTATGTCATGATCCTGGTATGGGGCGCTGACTCCGGCGCATATATGTTTGGCAA
ATTGTTTGGTAAACATAAGCTGGCACCGAAGGTTTCTCCGGGTAAAACCTGGCAAGGCTT
TATCGGTGGACTCGCTACTGCAGCGGTAATCTCATGGGGTTATGGCATGTGGGCGAATCT
CGACGTCGCTCCCGTCACCTTACTCATTTGCTCTATTGTCGCAGCGTTAGCCTCAGTGCT
CGGCGATCTGACCGAGAGTATGTTTAAGCGTGAAGCAGGAATTAAGGACAGCGGTCATTT
AATTCCAGGACACGGTGGTATTTTAGATCGTATTGATAGCCTGACGGCTGCGGTACCGGT
CTTTGCTTGCTTGTTGTTACTGGTATTCAGGACGCTTTAACGGAAGGTAATATGCTGAGT
TTTCTCTGGGATTTGGCTTCGTTCATCGTTGCACTGGGTGTACTTATCACCGTGCATGAA
TTTGGTCATTTCTGGGTTGCCCGGCGTTGTGGTGTTCGCGTTGAGCGTTTCTCAATAGGG
TTTGGTAAGGCGCTCTGGCGGCGAACTGATAAGCTCGGCACCGAATATGTTATCGCCCTG
ATCCCGTTGGGCGGTTATGTCAAAATGCTGGATGAGCGCGCAGAACCGGTCGTTCCGGAA
CTCCGCCACCATGCCTTCAATAATAAATCTGTCGGCCAACGAGCGGCGATTATTGCCGCA
GGTCCGGTTGCAAACTTCATTTTTGCTATCTTTGCCTACTGGCTGGTTTTTATTATTGGT
GTGCCTGGCGTACGTCCGGTGGTTGGCGAAATAGCAGCCAATTCGATAGCTGCGGAAGCA
CAAATTGCACCAGGTACGGAACTAAAAGCCGTAGATGGTATCGAAACGCCTGATTGGGAT
GCCGTGCGTTTGCAGTTGGTCGATAAAATTGGCGATGAAAGCACCACCATTACAGTAGCG
CCATTTGGCAGCGACCAACGGCGGGATGTAAAGCTCGATTTACGTCACTGGGCGTTTGAG
CCTGATAAAGAAGATCCGGTATCTTCGCTGGGGATTCGTCCTCGTGGGCCGCAAATTGAA
CCTGTACTGGAAAATGTGCAGCCAAACTCGGCGGCAAGCAAGGCAGGTTTGCAAGCAGGC
GACAGGATCGTTAAAGTCGATGGTCAGCCCTTAACGCAGTGGGTGACCTTTGTGATGCTT
GTCCGGGATAACCCGGGTAAATCCTTAGCGTTAGAAATCGAAAGGCAGGGGAGTCCCTTG
TCTTTGACATTAATCCCGGAGAGTAAACCGGGTAATGGTAAAGCGATTGGTTTTGTCGGT
ATTGAGCCGAAAGTCATTCCTTTGCCAGATGAGTATAAAGTTGTACGCCAGTATGGGCCG
TTCAACGCCATCGTCGAAGCCACGGACAAAACGTGGCAGCTGATGAAGCTGACGGTCAGT
ATGCTGGGAAAATTGATCACCGGTGATGTGAAACTGAACAACCTCAGTGGGCCGATCTCT
ATCGCCAAGGGGGCTGGGATGACAGCGGAACTCGGGGTTGTTTATTACCTGCCGTTTCTT
GCGCTTATTAGCGTGAACTTAGGGATAATTAACCTGTTTCCGTTGCCCGTACTTGACGGG
GGGCATCTGCTGTTCCTTGCGATCGAAAAGATCAAGGGCGGACCGGTATCCGAGCGGGTT
CAAGACTTTTGTTATCGCATTGGCTCGATTCTGCTGGTGCTGTTAATGGGGCTTGCACTT
TTCAATGATTTCTCTCGGTTATGAGAGTTAGTTAGGAAGAACGCATAATAACGATGGCGA
TGAAAAAGTTGCTCATAGCGTCGCTGCTGTTTAGCAGCGCCACCGTATACGGTGCTGAAG
GGTTCGTAGTGAAAGATATTCATTTCGAAGGCCTTCAGCGTGTCGCCGTTGGTGCGGCCC
TCCTCAGTATGCCGGTGCGCACAGGCGACACGGTTAATGATGAAGATATCAGTAATACCA
TTCGCGCTCTGTTTGCTACCGGCAACTTTGAGGATGTTCGCGTCCTTCGTGATGGTGATA
CCCTTCTGGTTCAGGTAAAAGAACGTCCGACCATTGCCAGCATTACTTTCTCCGGTAACA
AATCGGTGAAAGATGACATGCTGAAGCAAAACCTCGAGGCTTCTGGTGTGCGTGTGGGCG
AATCCCTCGATCGCACCACCATTGCCGATATCGAGAAAGGTCTGGAAGACTTCTACTACA
GCGTCGGTAAATATAGCGCCAGCGTAAAAGCTGTCGTGACCCCGCTGCCGCGCAACCGTG
TTGACCTAAAACTGGTGTTCCAGGAAGGTGTGTCAGCTGAAATCCAGCAAATTAACATTG
TTGGTAACCATGCTTTCACCACCGACGAACTGATCTCTCATTTCCAACTGCGTGACGAAG
TGCCGTGGTGGAACGTGGTAGGCGATCGTAAATACCAGAAACAGAAACTGGCGGGCGACC
TTGAAACCCTGCGCAGCTACTATCTGGATCGCGGTTATGCCCGTTTCAACATCGACTCTA
CCCAGGTCAGTCTGACGCCAGATAAAAAAGGTATTTACGTCACGGTGAACATCACCGAAG
GCGATCAGTACAAGCTTTCTGGCGTTGAAGTGAGCGGCAACCTTGCCGGGCACTCCGCTG
AAATTGAGCAGCTGACTAAGATCGAGCCGGGTGAGCTGTATAACGGCACCAAAGTGACCA
AGATGGAAGATGACATCAAAAAGCTTCTCGGTCGCTATGGTTATGCCTATCCGCGCGTAC
AGTCGATGCCCGAAATTAACGATGCCGACAAAACCGTTAAATTACGTGTGAACGTTGATG
CGGGTAACCGTTTCTACGTGCGTAAGATCCGTTTTGAAGGTAACGATACCTCGAAAGATG
CCGTCCTGCGTCGCGAAATGCGTCAGATGGAAGGTGCATGGCTGGGGAGCGATCTGGTCG
ATCAGGGTAAGGAGCGTCTGAATCGTCTGGGCTTCTTTGAAACTGTCGATACCGATACCC
AACGTGTTCCGGGTAGCCCGGACCAGGTTGATGTCGTCTACAAGGTAAAAGAGCGCAACA
CCGGTAGCTTCAACTTTGGTATTGGTTACGGTACTGAAAGTGGCGTGAGCTTCCAGGCTG
GTGTGCAGCAGGATAACTGGTTAGGTACAGGTTATGCTGTTGGTATCAACGGGACCAAAA
ACGATTACCAGACCTATGCTGAACTGTCGGTAACCAACCCGTACTTCACCGTAGATGGCG
TAAGCCTCGGTGGTCGTCTCTTCTATAATGACTTCCAGGCAGATGACGCCGACCTGTCCG
ACTATACCAACAAGAGTTATGGTACAGACGTGACGTTGGGCTTCCCGATTAACGAATATA
ACTCGCTGCGTGCAGGTCTGGGTTATGTACATAACTCCCTGTCCAACATGCAGCCTCAGG
TTGCGATGTGGCGTTATCTGTACTCTATGGGTGAACATCCGAGCACCTCTGATCAGGATA
ACAGCTTCAAAACGGACGACTTCACGTTCAACTATGGTTGGACCTATAACAAGCTTGACC
GTGGTTACTTCCCGACAGATGGTTCACGTGTCAACCTGACCGGTAAAGTGACCATTCCTG
GATCGGATAACGAATACTACAAAGTGACGTTAGACACGGCGACTTATGTGCCGATCGATG
ACGATCACAAATGGGTTGTTCTGGGGCGTACCCGCTGGGGTTATGGTGATGGTTTAGGCG
GCAAAGAGATGCCGTTCTACGAGAACTTCTATGCCGGTGGTTCCAGCACCGTGCGTGGCT
TCCAGTCCAATACCATTGGTCCGAAAGCAGTTTACTTCCCGCATCAGGCCAGTAATTATG
ATCCGGACTATGATTACGAATGTGCGACTCAGGACGGCGCGAAAGACCTGTGTAAATCGG
ATGATGCTGTAGGCGGTAACGCCATGGCGGTTGCCAGCCTCGAGTTCATCACCCCGACGC
CGTTTATTAGCGATAAGTATGCTAACTCGGTTCGTACTTCCTTCTTCTGGGATATGGGTA
CCGTTTGGGATACAAACTGGGATTCCAGCCAATATTCTGGATATCCGGACTATAGTGATC
CAAGCAATATCCGTATGTCTGCGGGTATCGCATTACAATGGATGTCCCCATTGGGGCCGT
TGGTGTTCTCCTACGCCCAGCCGTTCAAAAAGTACGATGGAGACAAGGCAGAACAGTTCC
AGTTTAACATCGGTAAAACCTGGTAAGTGTTCTCCACAAAGGAATGTAGTGGTAGTGTAG
CGATGACTTTAGGCGATCAATATAAGATCGCCGGGCCACGCAAAGAACTGCACCCTCCGG
TGCAAATGGGATGGTAAGGAGTTTATTGTGAAAAAGTGGTTATTAGCTGCAGGTCTCGGT
TTAGCACTGGCAACTTCTGCTCAGGCGGCTGACAAAATTGCAATCGTCAACATGGGCAGC
CTGTTCCAGCAGGTAGCGCAGAAAACCGGTGTTTCTAACACGCTGGAAAATGAGTTCAAA
GGCCGTGCCAGCGAACTGCAGCGTATGGAAACCGATCTGCAGGCTAAAATGAAAAAGCTG
CAGTCCATGAAAGCGGGCAGCGATCGCACTAAGCTGGAAAAAGACGTGATGGCTCAGCGC
CAGACTTTTGCTCAGAAAGCGCAGGCTTTTGAGCAGGATCGCGCACGTCGTTCCAACGAA
GAACGCGGCAAACTGGTTACTCGTATCCAGACTGCTGTGAAATCCGTTGCCAACAGCCAG
GATATCGATCTGGTTGTTGATGCAAACGCCGTTGCTTACAACAGCAGCGATGTAAAAGAC
ATCACTGCCGACGTACTGAAACAGGTTAAATAAGTAATGCCTTCAATTCGACTGGCTGAT
TTAGCGCAGCAGTTGGATGCAGAACTACACGGTGATGGCGATATCGTCATCACCGGCGTT
GCGTCCATGCAATCTGCACAAACAGGTCACATTACGTTCATGGTTAACCCAAAATACCGT
GAGCATTTAGGCTTGTGCCAGGCGTCCGCGGTTGTCATGACCCAGGACGATCTTCCTTTC
GCGAAAAGTGCCGCACTGGTAGTGAAGAATCCCTACCTGACTTACGCGCGCATGGCGCAA
ATTTTAGATACCACGCCGCAGCCCGCGCAGAACATTGCACCCAGTGCGGTGATCGACGCG
ACGGCGAAGCTGGGTAACAACGTATCGATTGGCGCTAACGCGGTGATTGAGTCCGGCGTT
GAACTGGGCGATAACGTGATTATCGGTGCCGGTTGCTTCGTAGGTAAAAACAGCAAAATC
GGTGCAGGTTCGCGTCTCTGGGCGAACGTAACCATTTACCATGAGATCCAGATCGGTCAG
AATTGCCTGATCCAGTCCGGAACAGTGGTAGGCGCAGACGGCTTTGGTTATGCCAACGAT
CGTGGTAACTGGGTGAAGATCCCACAGATTGGTCGCGTAATTATTGGCGATCGCGTGGAG
ATCGGTGCCTGCACAACCATCGATCGCGGCGCGCTGGATGACACTATTATTGGCAATGGC
GTGATCATTGATAACCAGTGCCAGATTGCACATAACGTCGTGATTGGCGACAATACGGCG
GTTGCCGGTGGCGTCATTATGGCGGGCAGCCTGAAAATTGGTCGTTACTGCATGATCGGC
GGAGCCAGCGTAATCAACGGGCATATGGAAATATGCGACAAAGTGACGGTTACGGGCATG
GGTATGGTGATGCGTCCCATCACTGAACCAGGCGTCTATTCCTCAGGCATTCCGCTGCAA
CCCAACAAAGTCTGGCGCAAAACCGCTGCACTGGTGATGAACATTGATGACATGAGCAAG
CGTCTGAAATCGCTTGAGCGCAAGGTTAATCAACAAGACTAACGTTCCATCTTTTGTTCG
CCAAACTTTACGGCCTGTCTCATTCTTACGATTGCGGCAGGCCGTGTTATTATTGTCGTT
TCTTATATTTTGACAGGAAGAGTATCTTGACTACTAACACTCATACTCTGCAGATTGAAG
AGATTTTAGAACTTCTGCCGCACCGTTTCCCGTTCTTACTGGTGGATCGCGTGCTGGATT
TTGAAGAAGGTCGTTTTCTGCGCGCAGTAAAAAATGTCTCTGTCAATGAGCCATTCTTCC
AGGGCCATTTCCCTGGAAAACCGATTTTCCCGGGTGTGCTGATTCTGGAAGCAATGGCAC
AGGCAACAGGTATTCTGGCGTTTAAAAGCGTAGGAAAACTGGAACCGGGTGAGCTGTACT
ACTTCGCTGGTATTGACGAAGCGCGCTTCAAGCGCCCGGTCGTGCCTGGCGATCAAATGA
TCATGGAAGTCACTTTCGAAAAAACGCGCCGCGGCCTGACCCGTTTTAAAGGGGTTGCTC
TGGTCGATGGTAAAGTAGTTTGCGAAGCAACGATGATGTGTGCTCGTAGCCGGGAGGCCT
GATACGTGATTGATAAATCCGCCTTTGTGCATCCAACCGCCATTGTGGAAGAGGGCGCGT
CAATTGGCGCGAACGCACACATTGGTCCTTTTTGTATCGTTGGACCCCATGTCGAAATTG
GTGAGGGTACCGTACTGAAATCTCACGTTGTCGTGAATGGTCATACTAAAATTGGCCGCG
ATAATGAGATTTATCAGTTCGCCTCCATCGGCGAAGTTAACCAGGATCTGAAATATGCTG
GCGAACCGACCCGTGTGGAAATCGGCGATCGTAACCGCATTCGCGAAAGCGTCACCATTC
ATCGTGGCACAGTCCAGGGCGGTGGATTGACGAAGGTGGGCAGCGACAACTTACTGATGA
TCAACGCGCACATTGCGCACGATTGTACGGTAGGTAACCGCTGTATTCTCGCCAACAACG
CAACGCTGGCGGGTCACGTATCGGTTGACGACTTCGCGATCATCGGCGGCATGACCGCAG
TCCATCAGTTCTGCATCATTGGTGCGCACGTGATGGTTGGCGGCTGCTCCGGTGTGGCGC
AGGACGTCCCTCCTTATGTCATTGCGCAGGGTAACCACGCAACGCCGTTCGGTGTCAATA
TCGAAGGGCTGAAGCGCCGCGGATTCAGCCGTGAGGCGATTACCGCTATCCGCAATGCGT
ATAAGCTGATTTATCGTAGCGGTAAAACGCTCGATGAAGTGAAACCGGAAATTGCTGAAC
TGGCGGAAACATATCCGGAAGTGAAAGCCTTTACCGATTTCTTTGCACGCTCAACGCGCG
GTCTGATTCGTTAATGACTGAACAGCGTCCATTAACGATTGCCCTGGTCGCCGGAGAAAC
CTCCGGCGATATCCTGGGGGCCGGTTTAATCCGCGCTCTGAAAGAACATGTGCCCAACGC
CCGCTTTGTTGGTGTTGCCGGGCCACGAATGCAGGCTGAAGGCTGCGAAGCCTGGTACGA
AATGGAAGAACTGGCGGTGATGGGCATTGTTGAAGTGCTCGGTCGTCTGCGTCGCTTACT
GCATATTCGTGCCGATCTGACAAAGCGTTTTGGCGAACTGAAGCCAGATGTTTTTGTTGG
TATTGATGCGCCTGACTTCAATATTACTCTTGAAGGTAACCTCAAAAAGCAGGGTATCAA
AACCATTCATTACGTCAGTCCGTCAGTCTGGGCGTGGCGACAGAAACGTGTTTTCAAAAT
AGGCAGAGCCACCGATCTGGTGCTCGCATTTCTGCCTTTCGAAAAAGCGTTTTATGACAA
ATACAACGTACCGTGCCGCTTTATCGGTCATACCATGGCTGATGCCATGCCATTAGATCC
AGATAAAAATGCCGCCCGTGATGTGCTGGGGATCCCTCACGATGCCCACTGCCTGGCGTT
GCTACCGGGGAGCCGTGGTGCAGAAGTTGAAATGCTTAGTGCCGATTTCCTGAAAACGGC
CCAGCTTTTGCGCCAGACATATCCGGATCTCGAAATCGTGGTGCCACTGGTGAATGCCAA
ACGCCGCGAGCAGTTTGAACGCATCAAAGCTGAAGTCGCGCCAGACCTTTCAGTTCATTT
GCTGGATGGGATGGGCCGTGAGGCGATGGTCGCCAGCGATGCGGCGCTACTGGCGTCGGG
TACGGCAGCCCTGGAGTGTATGCTGGCGAAATGCCCGATGGTGGTGGGATATCGCATGAA
GCCTTTTACCTTCTGGTTGGCGAAGCGGCTGGTGAAAACTGATTATGTCTCGCTGCCAAA
TCTGCTGGCGGGCAGAGAGTTAGTCAAAGAATTATTGCAGGAAGAGTGTGAGCCGCAAAA
ACTGGCTGCGGCGCTGTTACCGCTGTTGGCGAACGGGAAAACCAGCCACGCGATGCACGA
TACCTTCCGTGAACTGCATCAGCAGATCCGCTGCAATGCCGATGAGCAGGCGGCACAAGC
CGTTCTGGAGTTAGCACAATGATCGAATTTGTTTATCCGCACACGCAGCTGGTTGCGGGT
GTGGATGAAGTCGGACGCGGGCCGTTAGTTGGCGCGGTCGTCACCGCTGCGGTGATCCTT
GACCCGGCGCGCCCGATTGCCGGGCTGAATGATTCCAAAAAGCTGAGCGAAAAACGCCGT
CTGGCGCTCTATGAAGAGATCAAAGAGAAAGCGTTGAGCTGGAGTCTGGGCCGCGCGGAA
CCCCACGAAATCGACGAGCTGAACATTCTTCATGCGACCATGCTGGCGATGCAGCGTGCC
GTCGCTGGGCTGCATATTGCGCCGGAATATGTGTTGATTGATGGTAACCGCTGCCCGAAA
TTACCGATGCCTGCGATGGCTGTGGTGAAAGGCGATAGCCGCGTACCGGAAATCAGTGCC
GCGTCTATCCTGGCGAAAGTGACGCGTGACGCCGAAATGGCGGCGCTGGATATTGTTTTC
CCGCAATATGGTTTTGCCCAACACAAAGGGTACCCAACCGCTTTTCATCTGGAAAAACTG
GCTGAACACGGCGCGACCGAACACCATCGGCGCAGCTTTGGGCCTGTCAAACGCGCACTG
GGACTTGCGTCCTGATTCTTGTGTCGAGATTAAGTAAACCGGAATCTGAAGATGTCTGAA
CCACGTTTCGTACACCTGCGGGTGCACAGCGACTACTCGATGATCGATGGCCTGGCCAAA
ACCGCACCGTTGGTAAAAAAGGCGGCGGCGTTGGGTATGCCAGCACTGGCGATCACCGAT
TTCACCAACCTTTGTGGTCTGGTGAAGTTCTACGGAGCGGGACATGGCGCAGGGATTAAG
CCTATCGTCGGGGCAGATTTTAACGTCCAGTGCGACCTGCTGGGTGATGAGTTAACCCAC
CTGACGGTACTGGCGGCGAACAATACCGGCTATCAGAATCTGACGTTGCTGATCTCAAAA
GCGTATCAGCGCGGGTACGGTGCCGCCGGGCCGATCATCGATCGCGACTGGCTTATCGAA
TTAAACGAAGGGTTGATCCTTCTTTCCGGCGGACGCATGGGCGACGTCGGACGCAGTCTT
TTGCGTGGTAACAGCGCGCTGGTAGATGAGTGTGTCGCGTTTTATGAAGAACACTTCCCG
GATCGCTATTTTCTCGAGCTGATCCGCACCGGCAGGCCGGATGAAGAAAGCTATCTGCAC
GCGGCGGTGGAACTGGCGGAAGCGCGCGGTTTGCCCGTCGTGGCGACCAACGACGTGCGC
TTTATCGACAGCAGCGACTTTGACGCACACGAAATCCGCGTCGCGATCCACGACGGCTTT
ACCCTCGACGATCCTAAACGCCCGCGTAACTATTCGCCGCAGCAATATATGCGTAGCGAA
GAGGAGATGTGTGAGCTGTTTGCCGACATCCCCGAAGCCCTTGCCAACACCGTTGAGATC
GCCAAACGCTGTAACGTAACCGTGCGTCTTGGTGAATACTTCCTGCCGCAGTTCCCGACC
GGGGACATGAGCACCGAAGATTATCTGGTCAAGCGTGCAAAAGAGGGCCTGGAAGAGCGT
CTGGCCTTTTTATTCCCTGATGAGGAAGAACGTCTTAAGCGCCGCCCGGAATATGACGAA
CGTCTGGAGACTGAACTTCAGGTTATCAACCAGATGGGCTTCCCGGGCTACTTCCTCATC
GTTATGGAATTTATCCAGTGGTCGAAAGATAACGGCGTACCGGTAGGGCCAGGCCGTGGC
TCCGGTGCGGGTTCACTGGTGGCCTACGCGCTGAAAATCACCGACCTCGATCCGCTGGAA
TTTGACCTGCTGTTCGAACGTTTCCTTAACCCGGAACGTGTCTCCATGCCTGACTTCGAC
GTTGACTTCTGTATGGAGAAACGCGATCAGGTTATCGAGCACGTAGCGGACATGTACGGT
CGTGATGCGGTATCGCAGATCATCACCTTCGGTACAATGGCGGCGAAAGCGGTGATCCGC
GACGTAGGCCGCGTGCTGGGGCATCCGTACGGCTTTGTCGATCGTATCTCGAAACTGATC
CCGCCCGATCCGGGGATGACGCTGGCGAAAGCGTTTGAAGCCGAGCCGCAGCTGCCGGAA
ATCTACGAAGCGGATGAAGAAGTTAAGGCGCTGATCGACATGGCGCGCAAACTGGAAGGG
GTCACCCGTAACGCCGGTAAGCACGCCGGTGGGGTGGTTATCGCGCCGACCAAAATTACC
GATTTTGCGCCGCTTTACTGCGATGAAGAGGGCAAACATCCGGTCACCCAGTTTGATAAA
AGCGACGTTGAATACGCCGGACTGGTGAAGTTCGACTTCCTTGGTTTGCGTACGCTCACC
ATCATCAACTGGGCGCTGGAGATGATCAACAAGCGGCGGGCGAAGAATGGCGAGCCGCCG
CTGGATATCGCTGCGATCCCGCTGGATGATAAGAAAAGCTTCGACATGCTGCAACGCTCG
GAAACCACGGCGGTATTCCAGCTTGAATCGCGCGGCATGAAGGACCTGATCAAGCGTCTA
CAACCTGACTGCTTCGAAGATATGATCGCCCTAGTGGCACTGTTCCGCCCCGGTCCGTTG
CAATCAGGGATGGTGGATAACTTTATCGACCGTAAACATGGTCGTGAAGAGATCTCCTAT
CCGGACGTACAGTGGCAGCATGAAAGCCTGAAACCGGTACTGGAGCCAACCTACGGCATT
ATCCTGTATCAGGAACAGGTCATGCAGATTGCGCAGGTGCTTTCTGGTTATACCCTCGGT
GGCGCGGATATGCTGCGTCGTGCGATGGGTAAGAAAAAGCCGGAAGAGATGGCTAAGCAA
CGTTCTGTATTTGCTGAAGGTGCAGAAAAGAACGGAATCAACGCTGAACTGGCGATGAAA
ATCTTCGACCTGGTGGAGAAATTCGCTGGTTACGGATTTAACAAATCGCACTCTGCGGCC
TATGCTTTGGTGTCATATCAAACGTTATGGCTGAAAGCGCACTATCCTGCGGAGTTTATG
GCGGCGGTAATGACCGCCGATATGGACAACACCGAGAAGGTGGTGGGTCTGGTGGATGAG
TGCTGGCGGATGGGGCTGAAAATCCTGCCACCAGATATAAACTCCGGTCTTTACCATTTC
CACGTCAACGACGACGGCGAAATCGTGTATGGTATTGGCGCGATCAAAGGGGTCGGTGAA
GGTCCGATTGAGGCCATCATCGAAGCCCGTAATAAAGGCGGCTACTTCCGCGAACTGTTT
GATCTCTGCGCCCGTACCGACACCAAAAAGTTGAACCGTCGCGTGCTGGAAAAACTGATC
ATGTCCGGGGCGTTTGACCGTCTTGGGCCACATCGCGCAGCGCTGATGAACTCGCTGGGC
GATGCGTTAAAAGCGGCAGATCAACACGCGAAAGCGGAAGCTATCGGTCAGGCCGATATG
TTCGGCGTGCTGGCCGAAGAGCCGGAACAAATTGAACAATCCTACGCCAGCTGCCAACCG
TGGCCGGAGCAGGTGGTATTAGATGGGGAACGTGAAACGTTAGGCCTGTACCTGACCGGA
CACCCTATCAACCAGTATTTAAAAGAGATTGAGCGTTATGTCGGAGGCGTAAGGCTGAAA
GACATGCACCCGACAGAACGTGGTAAAGTCATCACGGCTGCGGGGCTCGTTGTTGCCGCG
CGGGTTATGGTCACCAAGCGCGGCAATCGTATCGGTATCTGCACGCTGGATGACCGTTCC
GGGCGGCTGGAAGTGATGTTGTTTACTGACGCCCTGGATAAATACCAGCAATTGCTGGAA
AAAGACCGCATACTTATCGTCAGCGGACAGGTCAGCTTTGATGACTTCAGCGGTGGGCTT
AAAATGACCGCTCGCGAAGTGATGGATATTGACGAAGCCCGGGAAAAATATGCTCGCGGG
CTTGCTATCTCGCTGACGGACAGGCAAATTGATGACCAGCTTTTAAACCGACTCCGTCAG
TCTCTGGAACCCCACCGCTCTGGGACAATTCCAGTACATCTCTACTATCAGAGGGCGGAT
GCACGCGCGCGGTTGCGTTTTGGCGCGACGTGGCGTGTCTCTCCGAGCGATCGTTTATTA
AACGATCTCCGTGGCCTCATTGGTTCGGAGCAGGTGGAACTGGAGTTTGACTAATACAGG
AATACTATGAGTCTGAATTTCCTTGATTTTGAACAGCCGATTGCAGAGCTGGAAGCGAAA
ATCGATTCTCTGACTGCGGTTAGCCGTCAGGATGAGAAACTGGATATTAACATCGATGAA
GAAGTGCATCGTCTGCGTGAAAAAAGCGTAGAACTGACACGTAAAATCTTCGCCGATCTC
GGTGCATGGCAGATTGCGCAACTGGCACGCCATCCACAGCGTCCTTATACCCTGGATTAC
GTTCGCCTGGCATTTGATGAATTTGACGAACTGGCTGGCGACCGCGCGTATGCAGACGAT
AAAGCTATCGTCGGTGGTATCGCCCGTCTCGATGGTCGTCCGGTGATGATCATTGGTCAT
CAAAAAGGTCGTGAAACCAAAGAAAAAATTCGCCGTAACTTTGGTATGCCAGCGCCAGAA
GGTTACCGCAAAGCACTGCGTCTGATGCAAATGGCTGAACGCTTTAAGATGCCTATCATC
ACCTTTATCGACACCCCGGGGGCTTATCCTGGCGTGGGCGCAGAAGAGCGTGGTCAGTCT
GAAGCCATTGCACGCAACCTGCGTGAAATGTCTCGCCTCGGCGTACCGGTAGTTTGTACG
GTTATCGGTGAAGGTGGTTCTGGCGGTGCGCTGGCGATTGGCGTGGGCGATAAAGTGAAT
ATGCTGCAATACAGCACCTATTCCGTTATCTCGCCGGAAGGTTGTGCGTCCATTCTGTGG
AAGAGCGCCGACAAAGCGCCGCTGGCGGCTGAAGCGATGGGTATCATTGCTCCGCGTCTG
AAAGAACTGAAACTGATCGACTCCATCATCCCGGAACCACTGGGTGGTGCTCACCGTAAC
CCGGAAGCGATGGCGGCATCGTTGAAAGCGCAACTGCTGGCGGATCTGGCCGATCTCGAC
GTGTTAAGCACTGAAGATTTAAAAAATCGTCGTTATCAGCGCCTGATGAGCTACGGTTAC
GCGTAATTCGCAAAAGTTCTGAAAAAGGGTCACTTCGGTGGCCCTTTTTTATCGCCACGG
TTTGAGCAGGCTATGATTAAGGAAGGATTTTCCAGGAGGAACA