MG1655
W3110
Search for
Japanese | English
Deletion Report : 2-2
General information
Deletion 2-2  
Location (BP) 3,723,613 - 3,769,767   Go Linear View
Length (BP) 46,155
Related strains
     Strains ME5080    ME5081    ME5114    ME5115    ME5116    ME5117    ME5118    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer 02_2_RarC_Lar  
Sequence TGATAAACGTGAATCCGAGGCAGATGCGTTATGCAAGGATCAGGCGGCAA  
3' Primer 02_2_LarC_Rar  
Sequence TTGCCGCCTGATCCTTGCATAACGCATCTGCCTCGGATTCACGTTTATCA  

 Linear View (Whole Mode)
View Location
   3720.0  –  3770.0 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence in neighbor 100bp
000001 TTCCATATTC AACGAACGCA GAGGATCAAC CTTTACCCGT TGTGCTTTCT GCACGGGTGA CGGTATAGAA 
000071 CAACCCACTA GCACCATAAG CGCCATTGCC GGAAAGAAAG CGTTCATCAT CATTAAATTA CCGTCTGGTT 
000141 TGCAGGTGAG TCTTATTATT TATATCGGTA TAGTGGCTGA TATCTTACGA ATTTCCTTAA GCCTCTATAA 
000211 GCTGTAGTGA TAAAACTCAG ATTATTCCAG TGCGCCAACC AAATGATTTA TCGGTCAGAC TTTTTTTAAC 
000281 CAGATACAGA GACACAGATG CAGCCCAAAA TTTACTGGAT TGATAACCTG CGAGGGATAG CGTGTTTAAT 
000351 GGTGGTGATG ATTCACACCA CTACCTGGTA TGTGACCAAT GCTCATAGTG TTAGCCCCGT CACATGGGAT 
000421 ATCGCCAATG TTCTGAATTC TGCCTCTCGT GTCAGCGTGC CGCTATTTTT CATGATTTCC GGCTATCTCT 
000491 TTTTTGGCGA ACGCAGCGCC CAGCCGCGCC ATTTCTTGCG TATCGGCTTA TGTCTGATTT TTTATAGCGC 
000561 AATCGCACTG CTCTACATTG CGCTGTTTAC CTCCATCAAT ATGGAGTTAG CGCTGAAAAA CCTGCTGCAA 
000631 AAGCCAGTGT TTTACCACTT GTGGTTTTTC TTCGCGATTG CGGTGATTTA TCTGGTTTCA CCGCTGATTC 
000701 AGGTGAAGAA CGTCGGCGGA AAAATGTTGC TGGTGCTAAT GGCGGTGATT GGCATTATCG CTAACCCAAA 
000771 CACAGTGCCG CAGAAAATTG ACGGTTTTGA ATGGCTGCCA ATTAACTTAT ATATCAATGG CGATACTTTT 
000841 TACTACATTC TGTATGGCAT GTTGGGCCGC GCTATAGGGA TGATGGACAC ACAGCATAAA GCACTGTCGT 
000911 GGGTGAGCGC CGCGCTGTTT GCGACGGGGG TTTTTATTAT CTCTCGCGGG ACATTATATG AATTGCAGTG 
000981 GCGCGGAAAT TTTGCCGATA CCTGGTATCT TTACTGTGGG CCGATGGTTT TTATCTGCGC AATCGCGCTA 
001051 TTGACTCTGG TTAAAAACAC GCTGGATACG CGTACCATTC GCGGACTTGG CTTAATCTCC CGCCATTCAT 
001121 TGGGTATATA CGGATTCCAC GCCTTGATTA TCCATGCGCT GCGCACCCGG GGAATTGAGC TTAAAAATTG 
001191 GCCAATACTG GATATTATTT GGATCTTTTG CGCGACGTTG GCAGCGAGTT TGTTACTTTC TATGCTGGTA 
001261 CAACGAATCG ACAGAAACAG ATTAGTGAGT TAAGTAAAAG CCCGGTCACA TTGGACTGAC CGGGCTTACG 
001331 TGAGTTATTC GCTGTATTCT TCCTGGGTAA CCTGTGTTTC TTTTGGTGGG TTTATTCCGG CATCACGAAT 
001401 ATTTTTCTGC ACCGCTACTG CACCAAACAA GCTTAAGAAG AAAGCCAGTC CATAAAAACC TTTTTCGCTG 
001471 AGTAATAATG TCGCATTCCA CAGACCTACC ATCAGTAATG CAACAGAGAT AATAAAGACA GTCAGGCAGG 
001541 TCATATAATA AATGGAAGTG GTCGGTATGC CTTCATACTT GTCCCGAACG GTCTTTTGAT AAGACGCCGC 
001611 AGAAAACAGT CCTAATACCA GTACGGCAAA ATAATATCCT TTTTCATTTA ACTGCATCTC TGCATTCCAT 
001681 AGCCCTAACA GATAGGTAAC GATACCACCA ACGAGAGCTA TCCATGACAC AATACTAAAG GCCGGTGAAT 
001751 AGGTTGATAT TTTGTTGTCC ATCACAGTAT TCCTTTCATT CCTGAATATG TAAGAGCTTT ATGTTGCTCA 
001821 TGCCGAGCGA AACAAACGCA TTTGACCAAA CAAGCAGACA AAAAAGGCGA TGGGATAGAT CACCATTTCA 
001891 TAAGTATTGA TAGGTGCGTT TAAAACACCG ATAAACAAGA GACCGATAGT GATTAACGCA ACTAACTGGC 
001961 AGATATGGGT AAAAAAATCA TCCAGTTGCC CGAGTTTTTC TGCGCGAAGA TATGCATAGT TGCCAAAAGT 
002031 TGCTGTCATT AACACGCCAA GAAAATAGCC TTTTCCACTT AACAATGGGC ATGAGATCCA TAGCCCAACC 
002101 AGATAAACCA GCGCCCCGAC AACAAATAAT AGTTTTGCCA CAGTCTTTGA GGTTTTCATA ACGATCTCCA 
002171 TATCTACCAG CGATACATTA CGAGTAACCA ACGAAAGACA AAACTGAAAA ATGCCATTAA CAAATGATTT 
002241 TCAGAATAAA TTCATACTAA ATATTAATTA ATTACTGAGA TATATAGATG TGAATTATCC CCCACCCGGT 
002311 CAGGCAGGGG ATAACGTTTA CGCCATTAAT GGCAGAAGTT GCTGATAGAG GCGACGGAAC GTTTCTCGTC 
002381 GTGGCTGATA AGCGGCATAA CGCTGCGCAT CTGGTAGATG CGACTGTTCT AACGGTAGTT GCGGCAACAA 
002451 TTCAATGAGC GATTTCTCTG GATTCGCCGC GATCTGCGCC AGCCTTGCTG CGCCCAGTGC TGGCCCCACA 
002521 TCCCCCCCCG TACGGTAATC GAGCTGCTGA CCGCTGATAT CCGCCAGCAT CTGACGCCAG TACTCACTAC 
002591 GCGCCCCGCC CCCAATCAAC GTAACACTTT GCGGTTTAAT ACCGCAGGCA TGCACGACAT CCATGCCATC 
002661 TGCCAGCGCA TAACCCACGC CTTCCAGCAC TGCTCGCGCC AGTTCATTGG GGCCATGTTG ATGAGTCAAA 
002731 CCAAAGAAAA CCCCCTTCGC CTGGGGATTA TTGTGTGGCG TACGCTCGCC GGAAAGATAA GGCAGAAACC 
002801 AAACTGGCTC GGCACTTTCA TCAGCCTGTT GAGCTGCAGC GATTAAAGCT GGGACATTGC TCAGGCCGGT 
002871 TAATTTCGCG GCCCAATCCA GACACGACGC TGCACTCAGC ATCACAGACA TTAAATGCCA ACGTTGCGGT 
002941 AGCGCATGGC AAAAGCTATG TACGGCGCTT TCTGGCTTGC TTAAGAACCC TTCGCTGACA GCAAAATAGA 
003011 CCCCCGACGT CCCCAGCGAT AACATTGCCT GATTAGCATC AACCATTCCC ACACCAACTG CACCAGCTGC 
003081 ATTGTCGCCA CCGCCTGCGA CAACTGGCAC CGTCGCCATA CCCCACGCTT TCGCAACTTC AGGTAACAAA 
003151 GCACCAGTAA TTTCGCTGCC TTCGTATAAT GCGGGCATCT GGTCACGAGA TAAGTCGCAA GCCTGCAGCA 
003221 TGACGTCACT CCAGTCACGC TTTGCGACAT CCAGCCACAT GGTGCCAGCT GCGTCAGACA TATCGCTGGC 
003291 AAACTCCCCC GTCATACGCA GACGCAAGTA ATCTTTCGGT AATAATACTT TGTCGATTTG ACGGAATATC 
003361 TCCGGCTCAT GCCGCTGAAC CCATAGCAAT TTAGGCGCAG TAAATCCGGG CATCATCAGG TTGCCGGTAA 
003431 TCACCCGCGA TTGCGGAACT CGCGCTTCCA GCAAAGTGCA CTCTTGCGCA CAGCGCCCGT CGTTCCACAA 
003501 AATGGCAGGG CGTAACACCC GTTGCTGAGC ATCCAGCAAG GTTGCTCCGT GCATCTGGCC GGCAATACCC 
003571 AATGCTTTAA CGTCCTGCAG AGAATGCTGA TCGCCCAGAG CTTTCATTGC GCGATCAGTT GCCTGCCACC 
003641 ACTGTTCCGG GTCTTGTTCC GACCAGAGTG GATGCGGGCG CGAAACGGTC AGCTTTTCCG TTTGCGCAGC 
003711 AACCACCTCA CCCTGCTCGT TGAGCAAAAT AACTTTTACG CCCGAGGTGC CAAGATCTAT CCCGATATAC 
003781 ATATCGATCG TTCCTTAAAA AAATGCCCGG TATCGCTACC GATAACCGGG CCAACGGACT GCACAGTTAG 
003851 CCGTTATTTG TCGAACAGAT AATGGTTTAC CAGATTTTCC AGTTGTTCCT GGCGACCACT CTGATGCACC 
003921 GGAGACAAAT GATGTTCCTG AGCATATTTG GCTAAATCTG CCAGTGACAT TTGGCCTTTC AGGATTTGCT 
003991 GGCCCAATTC GCTATTCCAG CCGGAATAAC GCTGCGCGAT GCGTTTATCC AGCTCGCCAT CTTCAATCAT 
004061 GCGCGCTGCA ATTTTCAGCG CCAGTGCCAT CGTATCCATC GCGCCGATAT GACCGTAAAA CAGATCATAT 
004131 TTATCAGTAC TTTGACGACG TACTTTGGCA TCGAAGTTCA GACCACCGGT GGTGAAACCG CCTGCTTTGA 
004201 GAATTTCATA CATCACCAGC GCATTCTCTT CCACACTGTT CGGGAACTGG TCGGTGTCCC AGCCCAGTTG 
004271 CGCATCGCCA CGGTTGGCGT CGACAGAACC GAACAGGCCA AGCGCAATGG CGGTGGCTAT TTCATGATGG 
004341 AAAGAGTGAC CTGCCAGCGT CGCGTGGTTA GCTTCAATGT TCAGTTTAAT CTCTTTTTCC AGACCAAACT 
004411 GTTTCAGGAA GCCATAGACC GTCGCGGCAT CGTAATCATA TTGATGTTTG GTCGGTTCTT GCGGTTTCGG 
004481 TTCGATAAGC AACGTGCCCT GGAAACCGAT TTTATGTTTA TGCTCAACCA CCATCTGCAT AAAGCGGCCC 
004551 AGTTGTTCAC GCTCCTGACG CAAGTCGGTA TTTAACAGCG TTTCGTAACC TTCACGACCG CCCCACAGGA 
004621 CATAGTTTTC ACCGCCCAAT TTATGGGTTG CTTCCATCGC TGTAACAACT TGCGTTGCCG CCCAGCTGAA 
004691 GACTTCAGGA TCTGGGTTCG TCGCCGCACC CGCGCCGTAG CGAGGGTTTG TAAAGCAGTT GGCCGTTCCC 
004761 CACAGCAGCT TCACGCCGCT CTCTTCTTGC TTGCCTGCCA GGACATCAAC CATTTGCGCA AAATTATTGA 
004831 TGTACTCTTT TAACGACGCG CCCTCAGGGG AAACATCCAC ATCGTGGAAG CAATAAAATG GCACATGTAA 
004901 CTTGTGGAAA AACTCAAATG CGACATCTGC TTTACGCTTC GCCAACGCCA GTGCCTCACC AGGCTGCTGC 
004971 CACGGACGAT TAAACGCCCC CACACCAAAC ATATCCGCCC CGTTCCAGCA GAAGGTGTGC CAGTAGCAGG 
005041 CGGCAAAACG CAAGTGCTCT TCCATACGCT TACCCAACAC CAGTTCGTCG GGATTGTAGT GACGGAATGC 
005111 TAACGGGTTT GAGGATTTTG AGCCTTCATA ACGAACGCGA TCGAGCTGGT CAAAATAGGC TTGCATATTG 
005181 AACTCCATAA TCAGGTAATG CCGCGGGTGA TGGATGATGT CGTAATATTG GGCACTCCCT TTCAGTTGCT 
005251 CAATTATGTT ATTTCACACT GCTATTGAGA TAATTCACAA GTGTGCGCTC GCTCGCAAAA TAAAATGGAA 
005321 TGATGAAACT GGGTAATTCC TCGAAGAGAA AAATGCAATA AGTACAATTG CGCAACAAAA GTAAGATCTC 
005391 GGTCATAAAT CAAGAAATAA ACCAAAAATC GTAATCGAAA GATAAAAATC TGTAATTGTT TTCCCCTGTT 
005461 TAGTTGCTAA AAATTGGTTA CGTTTATCGC GGTGATTGTT ACTTATTAAA ACTGTCCTCT AACTACAGAA 
005531 GGCCCTACAC CATGAAAATA AAGAACATTC TACTCACCCT TTGCACCTCA CTCCTGCTTA CCAACGTTGC 
005601 TGCACACGCC AAAGAAGTCA AAATAGGTAT GGCGATTGAT GATCTCCGTC TTGAACGCTG GCAAAAAGAT 
005671 CGAGATATCT TTGTGAAAAA GGCAGAATCT CTCGGCGCGA AAGTATTTGT ACAGTCTGCA AATGGCAATG 
005741 AAGAAACACA AATGTCGCAG ATTGAAAACA TGATAAACCG GGGTGTCGAT GTTCTTGTCA TTATTCCGTA 
005811 TAACGGTCAG GTATTAAGTA ACGTTGTAAA AGAAGCCAAA CAAGAAGGCA TTAAAGTATT AGCTTACGAC 
005881 CGTATGATTA ACGATGCGGA TATCGATTTT TATATTTCTT TCGATAACGA AAAAGTCGGT GAACTGCAGG 
005951 CAAAAGCCCT GGTCGATATT GTTCCGCAAG GTAATTACTT CCTGATGGGC GGCTCGCCGG TAGATAACAA 
006021 CGCCAAGCTG TTCCGCGCCG GACAAATGAA AGTGTTAAAA CCTTACGTTG ATTCCGGAAA AATTAAAGTC 
006091 GTTGGTGACC AATGGGTTGA TGGCTGGTTA CCGGAAAACG CATTGAAAAT TATGGAAAAC GCGCTAACCG 
006161 CCAATAATAA CAAAATTGAT GCTGTAGTTG CCTCAAACGA TGCCACCGCA GGTGGGGCAA TTCAGGCATT 
006231 AAGCGCGCAA GGTTTATCAG GGAAAGTAGC AATCTCCGGC CAGGATGCGG ATCTCGCAGG TATTAAACGT 
006301 ATTGCTGCCG GTACGCAAAC TATGACGGTG TATAAACCTA TTACGTTGTT GGCAAATACT GCCGCAGAAA 
006371 TTGCCGTTGA GTTGGGCAAT GGTCAGGAAC CAAAAGCAGA TACCACACTG AATAATGGCC TGAAAGATGT 
006441 CCCCTCCCGC CTCCTGACAC CGATCGATGT GAATAAAAAC AACATCAAAG ATACGGTAAT TAAAGACGGA 
006511 TTCCACAAAG AGAGCGAGCT GTAAGCGTTA CGCCCCAGCG CGGAGCGGGG GCGTGATTTC TCTCCATGCC 
006581 GCGTGAATGA ATTGGCTTAG GTGGAGTCGT TATGCCTTAT CTACTTGAAA TGAAGAACAT TACCAAAACC 
006651 TTCGGCAGTG TGAAGGCGAT TGATAACGTC TGCTTGCGGT TGAATGCTGG CGAAATCGTC TCACTTTGTG 
006721 GGGAAAATGG GTCTGGTAAA TCAACGCTGA TGAAAGTGCT GTGTGGTATT TATCCCCATG GCTCCTACGA 
006791 AGGCGAAATT ATTTTTGCGG GAGAAGAGAT TCAGGCGAGT CACATCCGCG ATACCGAACG CAAAGGTATC 
006861 GCCATCATTC ATCAGGAATT GGCCCTGGTG AAAGAATTGA CCGTGCTGGA AAATATCTTC CTGGGTAACG 
006931 AAATAACCCA CAATGGCATT ATGGATTATG ACCTGATGAC GCTACGCTGT CAGAAGCTGC TCGCACAGGT 
007001 CAGTTTATCC ATTTCACCTG ATACCCGCGT TGGCGATTTA GGGCTTGGGC AACAACAACT GGTTGAAATT 
007071 GCCAAGGCAC TTAATAAACA GGTGCGCTTG TTAATTCTCG ATGAACCGAC AGCCTCATTA ACTGAGCAGG 
007141 AAACGTCGAT TTTACTGGAT ATTATTCGCG ATCTACAACA GCACGGTATC GCCTGTATTT ATATTTCGCA 
007211 CAAACTCAAC GAAGTCAAAG CGATTTCCGA TACGATTTGC GTTATTCGCG ACGGACAGCA CATTGGTACG 
007281 CGTGATGCTG CCGGAATGAG TGAAGACGAT ATTATCACCA TGATGGTCGG GCGAGAGTTA ACCGCGCTTT 
007351 ACCCTAATGA ACCACATACC ACCGGAGATG AAATATTACG TATTGAACAT CTGACGGCAT GGCATCCGGT 
007421 TAATCGTCAT ATTAAACGAG TTAATGATGT CTCGTTTTCC CTGAAACGTG GCGAAATATT GGGTATTGCC 
007491 GGACTCGTTG GTGCCGGACG TACCGAGACC ATTCAGTGCC TGTTTGGTGT GTGGCCCGGA CAATGGGAAG 
007561 GAAAAATTTA TATTGATGGC AAACAGGTAG ATATTCGTAA CTGTCAGCAA GCCATCGCCC AGGGGATTGC 
007631 GATGGTCCCC GAAGACAGAA AGCGCGACGG CATCGTTCCG GTAATGGCGG TTGGTAAAAA TATTACCCTC 
007701 GCCGCACTCA ATAAATTTAC CGGTGGCATT AGCCAGCTTG ATGACGCGGC AGAGCAAAAA TGTATTCTGG 
007771 AATCAATCCA GCAACTCAAA GTTAAAACGT CGTCCCCCGA CCTTGCTATT GGACGTTTGA GCGGCGGCAA 
007841 TCAGCAAAAA GCGATCCTCG CTCGCTGTCT GTTACTTAAC CCGCGCATTC TCATTCTTGA TGAACCCACC 
007911 AGGGGTATCG ATATTGGCGC GAAATACGAG ATCTACAAAT TAATTAACCA ACTCGTCCAG CAGGGTATTG 
007981 CCGTTATTGT CATCTCTTCC GAATTACCTG AAGTGCTCGG CCTTAGCGAT CGTGTACTGG TGATGCATGA 
008051 AGGGAAACTA AAAGCCAACC TGATAAATCA TAACCTGACT CAGGAGCAGG TGATGGAAGC CGCATTGAGG 
008121 AGCGAACATC ATGTCGAAAA GCAATCCGTC TGAAGTGAAA TTGGCCGTAC CGACATCCGG TGGCTTCTCC 
008191 GGGCTGAAAT CACTGAATTT GCAGGTCTTC GTGATGATTG CAGCTATCAT CGCAATCATG CTGTTCTTTA 
008261 CCTGGACCAC CGATGGTGCC TACTTAAGCG CCCGTAACGT CTCCAACCTG TTACGCCAGA CCGCGATTAC 
008331 CGGCATCCTC GCGGTAGGAA TGGTGTTCGT CATAATTTCT GCTGAAATCG ACCTTTCCGT CGGCTCAATG 
008401 ATGGGGCTGT TAGGTGGCGT CGCGGCGATT TGTGACGTCT GGTTAGGCTG GCCTTTGCCA CTTACCATCA 
008471 TTGTGACGCT GGTTCTGGGA CTGCTTCTCG GTGCCTGGAA CGGATGGTGG GTCGCGTACC GTAAAGTCCC 
008541 TTCATTTATT GTCACCCTCG CGGGCATGTT GGCATTTCGC GGCATACTCA TTGGCATCAC CAACGGCACG 
008611 ACTGTATCCC CCACCAGCGC CGCGATGTCA CAAATTGGGC AAAGCTATCT CCCCGCCAGT ACCGGCTTCA 
008681 TCATTGGCGC GCTTGGCTTA ATGGCTTTTG TTGGTTGGCA ATGGCGCGGA AGAATGCGCC GTCAGGCTTT 
008751 GGGTTTACAG TCTCCGGCCT CTACCGCAGT AGTCGGTCGC CAGGCTTTAA CCGCTATCAT CGTATTAGGC 
008821 GCAATCTGGC TGTTGAATGA TTACCGTGGC GTTCCCACTC CTGTTCTGCT GCTGACGTTG CTGTTACTCG 
008891 GCGGAATGTT TATGGCAACG CGGACGGCAT TTGGACGACG CATTTATGCC ATCGGCGGCA ATCTGGAAGC 
008961 AGCACGTCTC TCCGGGATTA ACGTTGAACG CACCAAACTT GCCGTGTTCG CGATTAACGG ATTAATGGTA 
009031 GCCATCGCCG GATTAATCCT TAGTTCTCGA CTTGGCGCTG GTTCACCTTC TGCGGGAAAT ATCGCCGAAC 
009101 TGGACGCAAT TGCAGCATGC GTGATTGGCG GCACCAGCCT GGCTGGCGGT GTGGGAAGCG TTGCCGGAGC 
009171 AGTAATGGGG GCATTTATCA TGGCTTCACT GGATAACGGC ATGAGTATGA TGGATGTACC GACCTTCTGG 
009241 CAGTATATCG TTAAAGGTGC GATTCTGTTG CTGGCAGTAT GGATGGACTC CGCAACCAAA CGCCGTTCTT 
009311 GATTTTGATA AAAATTTTCT CAAAGCCGGT TACGTATTAC CGGTTTTGAG TTTTTGCATG ATTCAGCAGG 
009381 AAAAGAACCA TGTTTACTAA ACGTCACCGC ATCACATTAC TGTTCAATGC CAATAAAGCC TATGACCGGC 
009451 AGGTAGTAGA AGGCGTAGGG GAATATTTAC AGGCGTCACA ATCGGAATGG GATATTTTCA TTGAAGAAGA 
009521 TTTCCGCGCC CGCATTGATA AAATCAAGGA CTGGTTAGGA GATGGCGTCA TTGCCGACTT CGACGACAAA 
009591 CAGATCGAGC AAGCGCTGGC TGATGTCGAC GTCCCCATTG TTGGGGTTGG CGGCTCGTAT CACCTTGCAG 
009661 AAAGTTACCC ACCCGTTCAT TACATTGCCA CCGATAACTA TGCGCTGGTT GAAAGCGCAT TTTTGCATTT 
009731 AAAAGAGAAA GGCGTTAACC GCTTTGCTTT TTATGGTCTT CCGGAATCAA GCGGCAAACG TTGGGCCACT 
009801 GAGCGCGAAT ATGCATTTCG TCAGCTTGTC GCCGAAGAAA AGTATCGCGG AGTGGTTTAT CAGGGGTTAG 
009871 AAACCGCGCC AGAGAACTGG CAACACGCGC AAAATCGGCT GGCAGACTGG CTACAAACGC TACCACCGCA 
009941 AACCGGGATT ATTGCCGTTA CTGACGCCCG AGCGCGGCAT ATTCTGCAAG TATGTGAACA TCTACATATT 
010011 CCCGTACCGG AAAAATTATG CGTGATTGGC ATCGATAACG AAGAACTGAC CCGCTATCTG TCGCGTGTCG 
010081 CCCTTTCTTC GGTCGCTCAG GGCGCGCGGC AAATGGGCTA TCAGGCGGCA AAACTGTTGC ATCGATTATT 
010151 AGATAAAGAA GAAATGCCGC TACAGCGAAT TTTGGTCCCA CCAGTTCGCG TCATTGAACG GCGCTCAACA 
010221 GATTATCGCT CGCTGACCGA TCCCGCCGTT ATTCAGGCCA TGCATTACAT TCGTAATCAC GCCTGTAAAG 
010291 GGATTAAAGT GGATCAGGTA CTGGATGCGG TCGGGATCTC GCGCTCCAAT CTTGAGAAGC GTTTTAAAGA 
010361 AGAGGTGGGT GAAACCATCC ATGCCATGAT TCATGCCGAG AAGCTGGAGA AAGCGCGCAG TCTGCTGATT 
010431 TCAACCACCT TGTCGATCAA TGAGATATCG CAAATGTGCG GTTATCCATC GCTGCAATAT TTCTACTCTG 
010501 TTTTTAAAAA AGCATATGAC ACGACGCCAA AAGAGTATCG CGATGTAAAT AGCGAGGTCA TGTTGTAGCG 
010571 ATGATGAGAA TTGTCGGCGT CACATCAGGT AACGCTGCGT GGTTGTCGGA TGCGGCGTGA ACGCCTTATC 
010641 CGACCTACCC GCCAGGCATG ATAAAACGCA CCAACAACGC TTCAGGCTCG TAGCTCAACT GCCTGAGACA 
010711 AAGTAAAAAG CCTTATCCGA CTGACAAGTC GGATAAGGCT CAAGGAAATG CAATTACATA TGCGCCGCGA 
010781 TTAACCGTTG GTTATCCTGG TACATTGCGA ACAGGTAGTT GTTATAACTC TTCCCTTTGG TCGAGTAGCC 
010851 CTTCAGCTTG TGAATCATCG CTGTGGCAGT CACTTCCTGA TCCGCTTTAC GCAGCTGCGC ACGCGATTTA 
010921 CGGAACGAAG AGTAAGCCGG GTGCGTATTC AGGTTAGTGA CATAGGCGCT CACCGATTCT TTGACAGAAC 
010991 TAAACTGTGA GTACCCTTTC ACTTTACCTG GCGCATTGGT ACAACGTCCT TTCATGCATT TCATGCCGAA 
011061 CAGGTTGTTG TTGTTGCGCG CCAGCTTCGA CGTTCCCCAA CCGCTTTCTG CTGCAGCCAT CGTCGCCACC 
011131 ATACTGGTGG GGATAATGTC TACGCGTTCA AGCAAGGTAT TCCACGGGAT TTTTCGCGTA TTACCGGACC 
011201 ACTTCACCTT GTAGCGTTTG GCGATGTCTT TCAGACGCGC ACGCTCAGCA GGTGACCATT GGCCCTGATA 
011271 CTGTTTTGAA ATGAGCCAGT TACGTTCCGC AGTAATGGCC GCATTTTGGC TGGTAATGTA AGGCATTACG 
011341 GTCCGGAGAA ACGCCTTTTT CCTTGGTGTT CCGGAAGGGT ATTTTCGCAA ATCAGGAAGT GAACTACTCT 
011411 TTGCACTATT GCGAGAATAC TCTTGTTTAC TGCTTACCTG TTTATTACTA GCTTTAGTTA AGTGGGACTT 
011481 TTGACTCGCT GTTGTTGTGT GCGTCTTCGC TAACACCTCA CTCGAAAACA CCAGAGTGAG TAACATAAGA 
011551 ATCATCGCCC CATATCGTCG TATGGGAGTC AAAATCATCA GGTCTCCTGG TCGGATTTAA TCATTCCAAC 
011621 ACCTTATATT TTTCACAAAT TTGAGAGTTG AATCTCAAAT CATATCAAAA ATAGCTGTCA AGAGCACCCC 
011691 AAGGAATAGT CCAAATCTGA AACTATGTCA CGTGTTAACG ATTCAGATTG GCGCTAAATC GCAGAAAATG 
011761 TGGGGGTTAT CGCAAAATTC AGCCGTTTTT TGCGCGAGAT CGCTCACCCT TGCTTCTCAT CCTGTGGACT 
011831 TACCGCTCAG GGATGAGTTT TGTTTGGCTT ATCGCTGGCA AACTGTCTGA AATCGCAGCA ATAAGGACTC 
011901 ATCCGCCATG AAACTCGCCG CCTGTTTTCT GACACTCCTT CCTGGCTTCG CCGTTGCCGC CAGCTGGACT 
011971 TCTCCGGGGT TTCCCGCCTT TAGCGAACAG GGGACAGGAA CATTTGTCAG CCACGCGCAG TTGCCCAAAG 
012041 GTACGCGTCC ACTAACGCTA AATTTTGACC AACAGTGCTG GCAGCCTGCG GATGCGATAA AACTCAATCA 
012111 GATGCTTTCC CTGCAACCTT GTAGCAACAC GCCGCCTCAA TGGCGATTGT TCAGGGACGG CGAATATACG 
012181 CTGCAAATAG ACACCCGCTC CGGTACGCCA ACATTGATGA TTTCCATCCA GAACGCCGCC GAACCGGTAG 
012251 CAAGCCTGGT CCGTGAATGC CCGAAATGGG ATGGATTACC GCTCACAGTG GATGTCAGCG CCACTTTCCC 
012321 GGAAGGAGCC GCCGTACGGG ATTATTACAG CCAGCAAATT GCGATAGTGA AGAACGGTCA AATAATGTTA 
012391 CAACCCGCTG CCACCAGCAA CGGTTTACTC CTGCTGGAAC GGGCAGAAAC TGACACATCC GCCCCTTTCG 
012461 ACTGGCATAA CGCCACGGTT TACTTTGTGC TGACAGATCG TTTCGAAAAC GGCGATCCCA GTAATGACCA 
012531 GAGTTACGGA CGTCATAAAG ACGGTATGGC GGAAATTGGC ACTTTTCACG GCGGCGATTT ACGCGGCCTG 
012601 ACCAACAAAC TGGATTACCT CCAGCAGTTG GGCGTTAATG CTTTATGGAT AAGCGCCCCA TTTGAGCAAA 
012671 TTCACGGCTG GGTCGGCGGC GGTACAAAAG GCGATTTCCC GCATTATGCC TACCACGGTT ATTACACACA 
012741 GGACTGGACG AATCTTGATG CCAATATGGG CAACGAAGCC GATCTACGGA CGCTGGTTGA TAGCGCACAT 
012811 CAGCGCGGTA TTCGTATTCT CTTTGATGTC GTGATGAACC ACACCGGCTA TGCCACGCTG GCGGATATGC 
012881 AGGAGTATCA GTTTGGCGCG TTATATCTTT CTGGTGACGA AGTGAAAAAA TCGCTGGGTG AACGCTGGAG 
012951 CGACTGGAAA CCTGCCGCCG GGCAAACCTG GCATAGCTTT AACGATTACA TTAATTTCAG CGACAAAACA 
013021 GGCTGGGATA AATGGTGGGG AAAAAACTGG ATCAGAACGG ATATCGGCGA TTACGACAAT CCTGGATTCG 
013091 ACGATCTCAC TATGTCGCTA GCCTTTTTGC CGGATATCAA AACCGAATCA ACTACCGCTT CTGGTCTGCC 
013161 GGTGTTCTAT AAAAACAAAA TGGATACCCA CGCCAAAGCC ATTGACGGCT ATACGCCGCG CGATTACTTA 
013231 ACCCACTGGT TAAGTCAGTG GGTCCGCGAC TATGGGATTG ATGGTTTTCG GGTCGATACC GCCAAACATG 
013301 TTGAGTTGCC CGCCTGGCAG CAACTGAAAA CCGAAGCCAG CGCCGCGCTT CGCGAATGGA AAAAAGCTAA 
013371 CCCCGACAAA GCATTAGATG ACAAACCTTT CTGGATGACC GGTGAAGCCT GGGGCCACGG CGTGATGCAA 
013441 AGTGACTACT ATCGCCACGG CTTCGATGCG ATGATCAATT TCGATTATCA GGAGCAGGCG GCGAAAGCAG 
013511 TCGACTGTCT GGCGCAGATG GATACGACCT GGCAGCAAAT GGCGGAGAAA TTGCAGGGTT TCAACGTGTT 
013581 GAGCTACCTC TCGTCGCATG ATACCCGCCT GTTCCGTGAA GGGGGCGACA AAGCAGCAGA GTTATTACTA 
013651 TTAGCGCCAG GCGCGGTACA AATCTTTTAT GGTGATGAAT CCTCGCGTCC GTTCGGTCCT ACAGGTTCTG 
013721 ATCCGCTGCA AGGTACACGT TCGGATATGA ACTGGCAGGA TGTTAGCGGT AAATCTGCCG CCAGCGTCGC 
013791 GCACTGGCAG AAAATCAGCC AGTTCCGCGC CCGCCATCCC GCAATTGGCG CGGGCAAACA AACGACACTT 
013861 TTGCTGAAGC AGGGCTACGG CTTTGTTCGT GAGCATGGCG ACGATAAAGT GCTGGTCGTC TGGGCAGGGC 
013931 AACAGTAACT TTTCCGGCTT CCCGTTCGTC AGTACCTCGG GAAGCCGCCA ACCAGGATAA AATGTCAGCC 
014001 CTAATCAGCG TTGCAGGATA AAGCACCGCT CACTCTTCAA CAGACCGATT TGCACCCCAG CAAATGTAGC 
014071 GTTATTGTTA CCTTCCTTGC TACAGAGTTC GACAGATATC CCGCTATGAC ATTCTCCCTT TTTGGTGACA 
014141 AATTTACCCG CCACTCCGGC ATTACGCTGT TGATGGAAGA TCTGAACGAC GGTTTACGCA CGCCTGGCGC 
014211 GATTATGCTC GGCGGCGGTA ATCCGGCGCA GATCCCGGAA ATGCAGGACT ACTTCCAGAC GCTACTGACC 
014281 GACATGCTGG AAAGTGGCAA AGCGACTGAT GCACTGTGTA ACTACGACGG TCCACAGGGG AAAACGGAGC 
014351 TACTCACACT GCTTGCCGGA ATGCTGCGCG AGAAGTTGGG TTGGGATATC GAACCACAGA ATATTGCACT 
014421 AACAAACGGC AGCCAGAGCG CGTTTTTCTA CTTATTTAAC CTGTTTGCCG GACGCCGTGC CGATGGTCGG 
014491 GTCAAAAAAG TGCTGTTCCC GCTTGCACCG GAATACATTG GCTATGCTGA CGCCGGACTG GAAGAAGATC 
014561 TGTTTGTCTC TGCGCGTCCG AATATTGAAC TGCTGCCGGA AGGCCAGTTT AAATACCACG TCGATTTTGA 
014631 GCATCTGCAT ATTGGCGAAG AAACCGGGAT GATTTGCGTC TCCCGGCCGA CGAATCCAAC AGGCAATGTG 
014701 ATTACTGACG AAGAGTTGCT GAAGCTTGAC GCGCTGGCGA ATCAACACGG CATTCCGCTG GTGATTGATA 
014771 ACGCTTATGG CGTCCCGTTC CCGGGTATCA TCTTCAGTGA AGCGCGCCCG CTATGGAATC CGAATATCGT 
014841 GCTGTGCATG AGTCTTTCCA AGCTGGGTCT ACCTGGCTCC CGCTGCGGCA TTATCATCGC CAATGAAAAA 
014911 ATCATCACCG CCATCACCAA TATGAACGGC ATTATCAGCC TGGCACCTGG CGGTATTGGT CCGGCGATGA 
014981 TGTGTGAAAT GATTAAGCGT AACGATCTGC TGCGCCTGTC TGAAACAGTC ATCAAACCGT TTTACTACCA 
015051 GCGTGTTCAG GAAACTATCG CCATCATTCG CCGCTATTTA CCGGAAAATC GCTGCCTGAT TCATAAACCG 
015121 GAAGGAGCCA TTTTCCTCTG GCTATGGTTT AAGGATTTGC CCATTACGAC CAAGCAGCTC TATCAGCGCC 
015191 TGAAAGCACG CGGCGTGCTG ATGGTGCCGG GGCACAACTT CTTCCCAGGG CTGGATAAAC CGTGGCCGCA 
015261 TACGCATCAA TGTATGCGCA TGAACTACGT ACCAGAGCCG GAGAAAATTG AGGCGGGGGT GAAGATTCTG 
015331 GCGGAAGAGA TAGAAAGAGC CTGGGCTGAA AGTCACTAAA AATTGCCTGA TGCGCTACGC TTATCAGGCC 
015401 TACATGATTT CTGCAATATA TTGAATTTGG AAGAATTTGT AGGCCGGATA AGGCGTTTAC GCCGCATCTG 
015471 GCATAAACAA AGCGCACTGT TCCGGCGTTG AGAAACGCCG GAAAACGTTT CAAACAGGCT GCTGCCGTAG 
015541 CCGATGCCGC TGCACTTTCT CGACATCCAT GCACTGCAAC GCCTTTGTCG GGCAGGCTTC AACACAGGCC 
015611 GGTCCCGTCT CCCGATGCCA GCACAGATCG CACTTAATCG CCCTCGCCTT TTTGCGCGAA GAAACGACCT 
015681 CCATCGCACC AAACGGGCAA GCCAGCATAC AGCTTTTACA GCCAATGCAA CGTGTTTGTT CAACGAAAAT 
015751 ATGCCCATGT TCGCGGCTTA TCGCGTCAAC AGGGCAGACA TTCGCGCACG GTGCATCTTC ACACTGATGA 
015821 CAGGCTACTG CCGTGGTCCA GCAGTGGTCT TTAATGACAC GAATACGGGA AATAAACTCG TCTGGTGACA 
015891 ACGCAGCGCA ATCCTGATTC TCATGATGCG ACACTGCGCA AGCCACTTCA CAGGTACGGC AACCGATACA 
015961 TTTCGTCGCA TCCGCAATAA TAAACCGGTT CATGATCACT CCTTTGCACT AAAACAGCAG AGTGCCAGAG 
016031 AGCGCGTCCC TACTGCTTTG ATCCAACGAA GGAAATGTTA AAGTTTTGGC ACTTGTCCAA AGCGTTATGT 
016101 GATCGCGCCC AGGTCATCCC TGACAGTAAA TCCCAGTTCA TTAGAAATAG CCTGCGCGGT TTCACGCAGT 
016171 GGTTTCAGGA GATTTTTCTC TCCCACCTGT TTCAGACGTG ATGTCGAAAG CGAAATCGAC ACGGCGTACG 
016241 GCACCCGCCC ATGAATATCA AACACCGGAA CAGCAATACA GGAGACGCCG AGTTCGTTTT CTTCTCTGTC 
016311 CATCGCCGCT CCGCTTTCAC GAATGTGCGC CAGTTCGTCG AACATCGCGG GCAGCTCGGT AATGGTATTG 
016381 CGGGTTAACG GCTGGATCTC ATGCTGATGG CTTTCCCAGT ATGACTTCAC GTAGTCCGGG TGACCAAACG 
016451 CCATGTAGAT CTTGCCCATT GCGGAACAGT AGAGCGGCAT ATGCTGGCCA ATATAGGCAC GGGTTCGCAG 
016521 CATCCCGGTT GTGGGTTCCA GCTTATAAAT CAAAATAGCG TGATCGTCTT CGCGGCTGGA GAAGTTAATG 
016591 GTTTCACCAG TGGCGATGTT CAGTGCCTCA AGATGCGGAG CGGCGATATG AATGATATTC AGCGAAGACA 
016661 GCGCCTTCTG CCCGACGGCA ATAAATTTGG TGGTCAGGCG ATAACTCCCT GCGGCAGGCG CGGTGGTCAC 
016731 ATAGCCGCAG GACTGTAATC CCTGCAATAA GCGATGGACG GTACTCTTAT TTAAACCAGC CAGCTCCGAA 
016801 AGATGCGCCA ACGGACAACC GTTTGGATAG TTGCTCAAAA TCTCAATCAG CATCAACCCG CGAAACAGAC 
016871 TCTGGCTTCC GGCTGGACGC TCTTTTTCCT GCGCCATCTC GTTCTCTTTT TTTCCCATCA CTTCTTTCCC 
016941 CATTTTGTCG CGTCCTGATG GTAGCGCAAA GTGTGCCGTA GTTCACGATC TCGACAGATA ATTTATAACC 
017011 AATTGATTTT TATGTCTTTT GAAATTCATC AATCAGATTG CCTTGTTAAA AAGTGATCGA TATATTTGAA 
017081 ATCAAGTTTC GCATATTGAA ATTTTAAGCC AAAAAAGCGA TCAAAAAAAC AAGGAAGCCT GGGATGAAAG 
017151 TGACATTTGA GCAGTTAAAA GCAGCCTTTA ATCGGGTCTT AATTTCACGC GGCGTTGACA GCGAAACGGC 
017221 TGACGCCTGT GCAGAGATGT TCGCCCGCAC CACCGAATCC GGCGTTTATT CTCACGGCGT TAATCGTTTC 
017291 CCTCGTTTCA TTCAACAACT GGAAAACGGC GATATCATTC CTGATGCCCA ACCCAAACGT ATAACCAGCC 
017361 TCGGCGCAAT TGAACAGTGG GACGCCCAGC GTTCGATCGG TAACCTGACA GCGAAAAAGA TGATGGATCG 
017431 CGCCATTGAA CTGGCTGCCG ATCACGGTAT TGGTCTGGTG GCACTACGTA ATGCCAACCA CTGGATGCGC 
017501 GGCGGCAGCT ACGGCTGGCA GGCGGCGGAA AAAGGCTATA TTGGCATTTG CTGGACCAAC TCCATCGCCG 
017571 TAATGCCGCC GTGGGGCGCA AAAGAGTGTC GCATAGGCAC TAACCCGCTG ATCGTCGCCA TTCCTTCCAC 
017641 GCCGATCACC ATGGTCGATA TGTCGATGTC GATGTTCTCT TACGGCATGT TAGAAGTTAA CCGTCTGGCA 
017711 GGTCGTCAGC TCCCGGTCGA TGGTGGCTTT GATGATGAGG GCAATTTGAC CAAAGAACCT GGCGTTATCG 
017781 AGAAGAATCG CCGCATTTTG CCGATGGGCT ACTGGAAAGG TTCTGGCATG TCGATTGTGC TGGATATGAT 
017851 CGCTACTCTC CTTTCCGACG GCGCATCCGT TGCCGAAGTC ACCCAGGACA ACAGCGACGA ATACGGCATT 
017921 TCACAAATTT TTATTGCCAT TGAAGTGGAC AAGCTTATCG ACGGTCCCAC CCGCGATGCC AAGCTGCAAC 
017991 GCATCATGGA TTACGTTACT AGTGCCGAGC GTGCTGACGA AAATCAGGCC ATTCGCTTAC CCGGCCATGA 
018061 ATTTACTACC CTGCTGGCCG AAAACCGCCG TAACGGCATC ACTGTTGATG ACAGCGTGTG GGCCAAAATC 
018131 CAGGCGTTAT GAGGAGATAA GTCATGATTT TTGGACATAT CGCGCAGCCC AATCCGTGCC GTTTGCCCGC 
018201 CGCCATTGAA AAGGCGCTCG ATTTTCTGCG CGCTACCGAT TTCAACGCCC TGGAGCCGGG CGTTGTCGAA 
018271 ATCGACGGCA AAAATATTTA TACGCAAATT ATCGATTTAA CCACACGCGA AGCGGTGGTA AACCGTCCGG 
018341 AAGTGCATCG TCGGTATATC GATATTCAGT TTCTGGCGTG GGGCGAAGAG AAAATCGGCA TTGCTATTGA 
018411 TACGGGAAAT AATAAAGTCA GCGAATCACT ATTAGAGCAG CGCAATATTA TTTTTTATCA CGACAGTGAA 
018481 CATGAATCAT TTATAGAAAT GATACCGGGC AGCTACGCAA TTTTCTTTCC GCAGGATGTT CACCGACCAG 
018551 GTTGTATTAT GCAAACAGCC TCTGAGATAC GAAAAATTGT GGTTAAAGTC GCATTAACGG CGCTGAATTA 
018621 ATCGAATAAT CGTCTACGCC AGAACGCCTG GGTAATGTTA TTGCTCTAAC TATATTAATA ATTCAGGTTG 
018691 CTGCACATGC GACTTGAATT ATGACAGACA TAGCCTCAAG GAATAGCTAT GAAAAAAATA CTCGAAGCAA 
018761 TACTGGCGAT TAATCTCGCC GTACTTTCCT GTATTGTATT TATAAACATT ATTTTAAGAT ATGGTTTTCA 
018831 GACAAGCATT TTATCTGTTG ATGAATTGTC ACGTTATTTA TTTGTCTGGT TAACGTTTAT TGGCGCGATT 
018901 GTAGCTTTTA TGGATAACGC CCACGTTCAG GTCACCTTTC TGGTGGAGAA ACTCTCCCCC GCATGGCAGC 
018971 GACGAGTCGC TCTGGTTACC CATTCCTTAA TCTTATTTAT TTGTGGCGCA CTGGCCTGGG GCGCAACGCT 
019041 AAAAACAATT CAGGACTGGA GCGATTATTC ACCGATCCTC GGTTTACCCA TCGGCCTGAT GTATGCCGCT 
019111 TGTCTGCCCA CCAGCCTCGT TATCGCATTC TTTGAACTGC GTCATTTATA TCAACTCATC ACGCGTAGCA 
019181 ATTCTCTAAC GTCGCCACCG CAAGGAGCTT AATCATGGCT GTGCTGATTT TTCTGGGCTG TCTGTTGGGT 
019251 GGTATTGCTA TCGGTTTGCC TATTGCCTGG GCACTGTTGT TGTGCGGGGC GGCGTTAATG TTCTGGCTGG 
019321 ACATGTTTGA TGTCCAGATC ATGGCACAAA CGCTGGTGAA CGGAGCCGAT AGCTTCTCCC TGCTGGCGAT 
019391 TCCGTTCTTT GTGCTGGCGG GTGAAATCAT GAATGCGGGC GGCTTGTCAA AACGCATTGT TGACCTGCCG 
019461 ATGAAACTGG TGGGGCATAA ACCAGGCGGG CTGGGCTACG TCGGCGTGCT GGCAGCTATG ATTATGGCGA 
019531 GCCTTTCTGG TTCTGCCGTT GCGGATACCG CCGCCGTTGC CGCTCTACTG GTGCCGATGA TGCGCAGCGC 
019601 CAACTATCCG GTCAACCGGG CGGCGGGGCT GATTGCCTCT GGCGGCATTA TCGCGCCAAT TATTCCCCCT 
019671 TCCATTCCGT TTATTATCTT CGGCGTTTCC AGCGGATTAT CCATCAGTAA GCTGTTTATG GCGGGCATTG 
019741 CCCCTGGCAT GATGATGGGC GCAACGCTGA TGCTTACCTG GTGGTGGCAG GCCAGTCGCC TTAATTTACC 
019811 CCGCCAGCAA AAAGCAACGA TGCAGGAAAT CTGGCACTCT TTTGTCTCCG GTATCTGGGC GCTGTTTCTT 
019881 CCAGTCATCA TTATTGGCGG GTTTCGCTCC GGCCTGTTTA CCCCTACCGA AGCCGGGGCC GTTGCTGCTT 
019951 TCTATGCGCT GTTTGTCGCC ACAGTTATTT ACCGTGAAAT GACCTTCGCC ACACTTTGGC ATGTACTCAT 
020021 TGGCGCGGCG AAAACCACCT CAGTGGTTAT GTTTCTGGTG GCCTCGGCAC AAGTTTCCGC CTGGCTGATT 
020091 ACCATTGCTG AACTGCCGAT GATGGTTTCT GATTTACTGC AACCGTTGGT CGATTCACCG CGTCTGCTGT 
020161 TTATCGTCAT TATGGTGGCT ATCCTGATTG TCGGCATGGT CATGGATTTA ACGCCGACGG TATTAATTCT 
020231 TACCCCGGTA TTAATGCCTT TAGTTAAAGA GGCAGGAATC GATCCGATTT ATTTCGGTGT CATGTTTATC 
020301 ATTAACTGCT CAATCGGCTT AATTACACCG CCTATCGGTA ATGTACTTAA CGTTATTTCA GGGGTGGCAA 
020371 AACTCAAATT CGATGATGCA GTCAGAGGCG TTTTCCCTTA CGTCCTGGTT TTATATTCAT TATTAGTCGT 
020441 ATTTGTTTTT ATTCCCGATC TCATCATCCT CCCTTTGAAA TGGATTAATT AAAAGGAAAA TATTATGAAA 
020511 TTACGCTCTG TAACCTACGC ATTATTCATT GCTGGCCTGG CTGCATTCAG CACATCTTCT CTGGCGGCAC 
020581 AATCTTTACG TTTCGGTTAT GAAACATCAC AAACCGACTC GCAACATATT GCGGCGAAAA AATTCAATGA 
020651 TTTATTGCAG GAGAGAACCA AAGGCGAGCT GAAATTAAAA CTGTTCCCGG ACAGCACTCT CGGTAACGCG 
020721 CAGGCGATGA TCAGCGGCGT ACGTGGCGGC ACCATCGATA TGGAAATGTC CGGCTCGAAT AACTTTGCCG 
020791 GGTTATCACC AGTGATGAAC TTGCTTGATG TCCCTTTCCT GTTCCGCGAT ACCGCTCACG CGCATAAAAC 
020861 GCTCGACGGC AAAGTCGGTG ATGATCTGAA AGCCTCACTT GAAGGTAAAG GACTGAAAGT ACTGGCCTAC 
020931 TGGGAAAACG GCTGGCGCGA TGTCACCAAC TCGCGCGCAC CGGTTAAAAC CCCCGCCGAC CTGAAAGGGC 
021001 TGAAAATCCG CACCAACAAT AGCCCGATGA ATATCGCCGC ATTCAAAGTC TTTGGCGCTA ACCCGATCCC 
021071 GATGCCGTTT GCCGAAGTCT ATACCGGGCT GGAAACCCGC ACTATCGACG CTCAGGAACA CCCGATCAAC 
021141 GTCGTCTGGT CAGCAAAATT TTTCGAAGTG CAGAAGTTCC TTTCTCTGAC GCACCACGCC TATTCCCCGC 
021211 TTCTGGTGGT GATCAACAAA GCGAAGTTTG ATGGCTTAAG TCCGGAGTTC CAGCAGGCGC TAGTTTCATC 
021281 TGCACAAGAA GCGGGTAACT ATCAGCGCAA ACTGGTTGCT GAAGATCAGC AAAAAATCAT CGACGGCATG 
021351 AAAGAAGCGG GCGTGGAAGT CATCACCGAT CTCGACCGCA AAGCCTTTAG CGACGCACTG GGGAATCAGG 
021421 TTCGCGACAT GTTTGTTAAA GATGTGCCGC AGGGAGCTGA TCTGCTGAAA GCCGTGGATG AGGTGCAATA 
021491 AACCATGACG CAATACTGGC TGGGGTTAGA TTGTGGCGGT AGCTGGCTGA AAGCCGGGCT GTATGACCGC 
021561 GAAGGCCGGG AGGCAGGCGT GCAGCGCCTG CCGCTGTGCG CATTAAGCCC GCAGCCAGGC TGGGCAGAGC 
021631 GCGATATGGC AGAACTGTGG CAATGCTGCA TGGCTGTCAT TCGCGCCCTG CTTACTCATT CTGGTGTTAG 
021701 CGGGGAACAA ATTGTCGGTA TCGGCATCTC CGCACAGGGA AAGGGCTTGT TTTTGCTGGA TAAAAACGAC 
021771 AAACCGCTCG GGAATGCTAT TTTGTCCTCG GACCGCCGGG CGATGGAAAT CGTTCGTCGC TGGCAGGAAG 
021841 ATGGCATCCC GGAAAAACTC TACCCGCTGA CCCGACAAAC CTTGTGGACC GGGCATCCGG TGTCGCTGTT 
021911 ACGCTGGCTG AAAGAGCACG AACCAGAACG CTACGCGCAA ATTGGCTGCG TGATGATGAC GCACGACTAC 
021981 CTGCGCTGGT GTTTAACTGG CGTCAAAGGC TGTGAAGAGA GCAATATTTC CGAGTCCAAC CTCTACAACA 
022051 TGAGTCTTGG GGAATATGAC CCGTGCCTCA CCGACTGGCT GGGGATCGCT GAAATCAATC ACGCCCTGCC 
022121 GCCTGTTGTC GGATCTGCCG AAATCTGCGG GGAGATCACC GCTCAGACAG CCGCCCTGAC CGGTCTGAAA 
022191 GCGGGTACGC CCGTTGTTGG CGGCCTGTTT GATGTGGTTT CCACCGCACT CTGCGCCGGG ATCGAAGACG 
022261 AATTTACCCT CAATGCGGTG ATGGGGACCT GGGCGGTGAC CAGCGGCATA ACCCGCGGTT TACGTGACGG 
022331 TGAAGCGCAT CCGTATGTCT ATGGTCGCTA CGTTAACGAT GGTGAATTTA TCGTTCACGA AGCCAGCCCT 
022401 ACCTCTTCCG GCAACCTCGA ATGGTTTACC GCACAGTGGG GAGAAATCTC GTTTGATGAG ATCAATCAGG 
022471 CCGTTGCCAG CTTGCCGAAG GCTGGGGGCG ATCTCTTTTT CCTGCCGTTC CTGTACGGCA GCAACGCCGG 
022541 ACTCGAGATG ACCAGTGGTT TCTACGGGAT GCAGGCCATT CACACCCGCG CGCACCTGTT GCAGGCCATC 
022611 TATGAAGGGG TGGTGTTCAG CCATATGACC CACCTCAACC GAATGCGCGA ACGTTTTACT GATGTTCACA 
022681 CCCTACGCGT CACTGGCGGC CCGGCGCACT CCGATGTCTG GATGCAAATG CTGGCGGACG TCAGCGGTCT 
022751 GCGTATCGAG CTGCCGCAGG TGGAAGAAAC CGGCTGCTTT GGTGCGGCCC TTGCCGCCCG CGTCGGCACC 
022821 GGGGTTTATC ACAACTTCAG CGAAGCCCAA CGTGACTTGC GACACCCGGT GCGCACCCTG CTGCCAGATA 
022891 TGACCGCCCA TCAGCTTTAC CAAAAAAAAT ATCAACGTTA TCAGCATCTC ATTGCCGCAC TTCAGGGCTT 
022961 TCACGCCCGC ATTAAGGAGC ACACATTATG AGCCGACCAC TTCTGCAACT GGCCCTCGAC CACTCATCAC 
023031 TTGAAGCCGC GCAGCGCGAC GTGACGCTGT TAAAAGACAG CGTCGATATC GTCGAAGCGG GCACCATTCT 
023101 CTGTTTAAAC GAAGGGCTTG GCGCGGTGAA AGCCTTGCGC GAACAGTGCC CGGACAAAAT CATCGTTGCT 
023171 GACTGGAAGG TCGCCGACGC TGGTGAAACG CTCGCGCAAC AGGCGTTTGG CGCAGGCGCT AACTGGATGA 
023241 CCATCATCTG CGCCGCGCCG CTCGCGACGG TAGAAAAAGG CCACGCAATG GCACAACGCT GCGGGGGTGA 
023311 AATTCAGATA GAGCTGTTCG GTAACTGGAC GCTGGACGAC GCCCGCGACT GGCATCGTAT TGGCGTGCGG 
023381 CAGGCCATTT ATCATCGCGG TCGTGATGCA CAGGCCAGCG GGCAACAGTG GGGCGAAGCC GATCTGGCAC 
023451 GCATGAAGGC GCTTTCAGAT ATCGGCCTTG AGCTTTCCAT TACTGGCGGG ATTACCCCTG CTGACCTGCC 
023521 GCTGTTTAAA GATATCCGCG TGAAAGCGTT TATTGCCGGG CGGGCACTGG CAGGCGCGGC AAATCCGGCG 
023591 CAAGTGGCTG GCGATTTCCA TGCGCAAATC GACGCTATCT GGGGAGGTGC GCGTGCGTAA TCATCAGTTA 
023661 GGGATTTATG AAAAAGCGCT GGCGAAAGAT CTCTCCTGGC CGGAGCGGCT GGTGCTGGCA AAAAGCTGCG 
023731 GTTTTGATTT TGTCGAAATG TCGGTGGATG AAACCGACGA ACGGCTCTCA CGTCTTGACT GGAGCGCCGC 
023801 ACAAAGGACT TCGCTGGTTG CCGCGATGAT CGAAACAGGT GTTGGGATCC CGTCGATGTG CCTGTCCGCA 
023871 CATCGTCGCT TTCCCTTTGG TAGCCGTGAC GAGGCAGTGC GCGAACGGGC GCGGGAAATC ATGAGTAAAG 
023941 CGATTCGCCT GGCGCGCGAT CTCGGCATTC GCACCATCCA GCTGGCAGGT TATGACGTCT ATTACGAAGA 
024011 CCACGACGAA GGCACCCGGC AACGTTTTGC TGAAGGGCTG GCGTGGGCAG TCGAACAGGC GGCGGCATCA 
024081 CAAGTAATGC TGGCGGTGGA GATTATGGAT ACCGCGTTTA TGAACTCCAT CAGCAAATGG AAAAAATGGG 
024151 ACGAGATGCT CGCCTCACCG TGGTTCACCG TCTACCCGGA CGTCGGCAAC CTCAGCGCCT GGGGCAATGA 
024221 TGTTCCCGCC GAACTGAAAC TGGGCATTGA CCGTATCGCC GCGATCCACC TGAAAGACAC CCAGCCAGTC 
024291 ACCGGGCAAA GTCCCGGACA GTTCCGCGAC GTGCCGTTTG GCGAAGGCTG CGTCGATTTC GTTGGCATCT 
024361 TCAAAACGCT GCATAAACTG AACTATCGCG GTTCTTTCCT GATTGAGATG TGGACCGAAA AAGCCAAAGA 
024431 GCCGGTGCTG GAGATTATTC AGGCGCGGCG TTGGATTGAA GCGCGTATGC AGGAGGCTGG ATTTATATGT 
024501 TAGAGCAACT GAAAGCCGAC GTGCTGGCGG CGAATCTGGC GCTTCCCGCT CACCATCTGG TGACGTTCAC 
024571 CTGGGGCAAT GTCAGCGCGG TAGACGAAAC GCGGCAATGG ATGGTAATCA AACCTTCCGG CGTCGAGTAC 
024641 GACGTGATGA CCGCCGACGA TATGGTGGTG GTTGAGATAG CCAGCGGTAA GGTGGTGGAA GGCAGCAAAA 
024711 AACCCTCTTC CGATACACCA ACGCATCTGG CGCTCTACCG TCGCTATGCC GAAATTGGCG GTATTGTGCA 
024781 TACCCACTCG CGCCACGCCA CCATCTGGTC ACAGGCCGGG CTGGATCTCC CCGCCTGGGG CACCACCCAC 
024851 GCCGATTATT TTTACGGTGC CATCCCCTGC ACGCGACAGA TGACCGCAGA GGAGATTAAC GGCGAATATG 
024921 AATATCAGAC CGGCGAAGTG ATCATTGAAA CCTTCGAAGA ACGTGGCAGG AGTCCGGCAC AAATCCCGGC 
024991 GGTGCTGGTG CATTCTCACG GCCCGTTCGC ATGGGGTAAA AACGCCGCCG ATGCCGTGCA TAACGCCGTA 
025061 GTACTCGAAG AATGCGCCTA TATGGGTCTA TTCTCGCGCC AGCTTGCGCC GCAGCTCCCT GCGATGCAAA 
025131 ACGAACTGCT GGATAAGCAC TACCTGCGTA AGCATGGGGC CAATGCCTAT TACGGGCAGT AATCCCTCAC 
025201 GCCGGGGCTT CATCGCCCCG GCACTACGAA TTGATATGTT CCTTGCTGTA ACGCCGCTTC CACGCTGCTG 
025271 GCGTTAAACC AGTATGTTTC TGAAAAATCT GCCGGAAATA GCCAACGTCA TTAAACCGTA TTGCATGGAG 
025341 CAGGCCGACA ACGTCGAGTC ACTGCATAAC CTGTTGCTGC CCGCCGATGC GCCATTTACG ACATTTGAAG 
025411 GCAAGGGATT GTTCAGCCAT AAGATCCTGA TTCAGACGCC AGGTTCCCGG TATGAACAGA GCAATCCAGA 
025481 GCAACAACCT TTGTGGCATT ACGACGGAGC ACCAGCCGCA CCGACATCCA CCGGTGAATT AAAAACGCCA 
025551 GCTCACCCCG GTGACAAAGG TAAAACTCTC ATTACGATCA ATCATCGGGC TGTCGGTAAT CTCTTCCGGC 
025621 AGCTCGCTGT ATCCTGCGCT CGCCATCAAT ACGACGTGCT CTCCTATCGG GTATTTTGCC GTCAGGCTGA 
025691 CATAGGGCAC CCAGGCATCC TGCGCGGAAT AACTTGCCAG ACCGCTACGA CGGGACTCAC TCTCTGAAAT 
025761 GCCATAGTAA TAGTCACTGA AATTCTCGTC ATAATAGAGA ACGCCCAGCG CAGGTGTCAG CGACAGACGA 
025831 CCTATCTGCA TTTTGTGGAA TACCGATAGC TCCCCCACCC AGCCGTTGCT GTTATCCAGA ACGTCCGCAG 
025901 CTGCAGAGGC TTTCACGGTT CCCCAACGCT CGTGGTGATA CCAGGCAACC CCCGCCATAG CCGTACTATC 
025971 ACGCTTATCA AGCTGTTGCA TGGCATAATC GTCATTATCG GTAGGGTCAA ATTCCAGCGG CATCCAGGAT 
026041 GCGGTCAGGC TAAGTTCATT TTTTTCACTT TGCGACAGAA TAAAACCTAA CGTGGTCTGA CGAACATAAA 
026111 AAGTATCACC TTCATAACTA ATCAGCGGAA TTGCCTTCGT ATTTTCATTA TAACCGCGAT AAGGCGATTC 
026181 ATTATAAGCC GCACCAGCAC CAATGGATAA TTCAGAAGCA GTTGCGCTTG CCATAAAAGG CAACGCAAAT 
026251 AACGCCACAA TATTGCGATT AATTAACATG TCCGGTATTC CATTTTAAAA TAAGATAAAA AAGAGTCGGC 
026321 ATAATAATGC TTACAATTTC TCCGGTGCAA GATTCATATT TATATAGTAA TATATAAAAT TATATATAAT 
026391 TGGGCTGTTG CGATGACAAA ATTACAACTT AAGTACCGGG AGTTAAAAAT TATCTCGGTA ATCGCTGCCA 
026461 GTGAAAATAT CAGCCATGCC GCGACTGTAC TTGGCATCGC ACAGGCCAAC GTCAGCAAAT ATCTTGCTGA 
026531 TTTTGAATCA AAAGTGGGTT TAAAAGTCTT TGACCGAACC ACCCGGCAGC TGATGCTCAC ACCTTTTGGC 
026601 ACCGCGCTGT TACCGTACAT CAACGACATG CTGGACAGAA ACGAGCAACT TAATAATTTT ATTGCAGATT 
026671 ATAAGCATGA GAAACGTGGT CGGGTCACCA TCTACGCCCC AACCGGCATA ATTACCTATT TATCCAAACA 
026741 TGTAATCGAT AAAATTAAAG ATATCGGTGA TATCACCTTA TCGCTAAAAA CCTGCAATCT TGAGCGTAAT 
026811 GCCTTTTATG AAGGCGTCGA ATTTCCTGAT GATTGTGATG TTTTAATCAG CTACGCTCCA CCAAAAGATG 
026881 AATCGCTGGT TGCCAGTTTT ATTACCCAAT ATGCCGTAAC CGCTTATGCC AGCCAGCGCT ATCTTGAGAA 
026951 ACATCCCATT AGCCGTCCTG ACGAACTCGA ACATCACTCC TGTATTTTGA TCGACTCGAT GATGATCGAC 
027021 GACGCGAATA TCTGGCGCTT CAACGTCGCC GGGAGTAAAG AGGTGCGGGA TTATCGCGTG AAGGGAAATT 
027091 ACGTTTGCGA CAACACGCAA TCTGCGCTGG AGCTGGCACG AAATCACCTG GGGATTGTGT TTGCGCCAGA 
027161 CAAAAGTGTG CAGAGCGACC TGCAAGACGG CACGCTGGTG CCCTGCTTTC AGCAACCCTA TGAATGGTGG 
027231 CTGGATCTGG TGGCTATCTT CCGTAAACGG GAATACCAGC CCTGGCGGGT CCAGTATGTG CTGGATGAAA 
027301 TGCTGCGTGA AATTCGCCAC CAGCTTGCTC AGTCGCAGCA ACTGCGGCCT GAACAAGCGG CGGAAAGCGA 
027371 AGATTAATGA TCGAGATAAA GGTAATGCAC CCAGCTGGTC ATGCGTAATA GCACTTTGCG CATCACCGAG 
027441 ACATGGCTGA AATGATCAGA GTAAACCGCC ACCTGGGCGT AAATACCGTC TGGTAAAGCG CTCAAATCAG 
027511 TGTGCTCATC CAGTTCAATG GTCGCGATAA CGCCATCTGA ACCCGGCGCT GTGTTTAACG TCTGTAAGGT 
027581 GCCGGTCGAC TGATAAGCTC CGCCGGGAAC GGCTGGACTA ATGGCTGCCA GCTTACCGCT GAATACCTTA 
027651 CCTGGCAGAG CATTAAACAC CACTTCCGCA TCGTCGCCAG GAGCCAGTCG CAGCAAGGAG TTCTGACGGA 
027721 ACTGCGCCAC GATTTGTCGT TTCTGATCGG GTATAAACAC CATCACCGGA CGTAGCGGCA GCGACGCGGC 
027791 ATAGGTACCC GGACGAATCA GTACCTGGGT CACATAACCA TCGCTCGGCG CACGCACTAT CGTCTGCTCA 
027861 AGGTTATATT TTGCTTCCGC GAGCTGTGCT TTCAGGCTGG CGATTTGAGA ATGTTCACCC AACACCAGGC 
027931 TATCCAGCTG GCTCTGGATC TGTTTTTGTT CCGCCGCCGA TGACTTCACG GAGGCTTCCT GCGCCAGATA 
028001 ATTTTGCCGC GCCACATCGA TATCGCGTTC TGAAAACGGG TTTACTTTCG CCTGGCTGCC ACGTGCGTAA 
028071 CGCTGATACT CTTTAGCGAA TTTATCCCGC GTGGCCTTTG CCTGCTGAGT ATTCGCCGCC ATCTCATCTA 
028141 ACTCTGCGCC CAACGCCCGC TGTTTATGTT CTGCGGTAAC GATATCCGCC ATCAGCCGAT CCACCCGCGC 
028211 CTGATAACGC GTCGGGTCCA GTCGAAATAG CACCTCACCT TTTTTAATCA GCGTATTTTT CTTATCCGTC 
028281 ACTTCAATCA CCACACCAGT CACCTGTGGG ACAACAGGAA TAGAAATAAC CGCTTTTTGC GCTTTAAAGG 
028351 TATACGGATG GTTATAGTTC ATTAACAGAA TTAGACCGCT GACAATAAAT ATTCCACCCA GGGCCGCTGT 
028421 GGGAATGGTC CATTTATTTA CGGGAATTTT GAAGATCTTA AACATTGCCC ATGCAAAAGC CACATAGGTC 
028491 AAAATAATCA GTAAATCCAT AAGTATTACT CGGCAGAAGA GGATTTGATG TCGGCGAGCT GTTTCTCCAG 
028561 CCCGGCAATG CGCTGTTGCA GTTGCATAAC GGATGAATCA TGGCTTTGCA TTCCCCATCC CCGCTCCGGG 
028631 CGGTAAAGCG TGGCCCAAAT CCACAAAAAC GGCCAGATAA CATGTAACGT AAAAAGACTC ACCCAACCAG 
028701 CAACATGAAT GGCGTCGGCA TGAGGATGAT TACGTTTTTT GGCAATCAGG TAGGGAATAT CATGTAAAAT 
028771 AATGATCCCA TAGAAGATCA CCAGAAATAC AAAAATAAGC ACTCCCAGTG CAAAATAGTC CAGGAACATA 
028841 TTTCCCTCAA AGAATATAAA AAAGAACAAT TAACGCATAT TATGAAATGC CATGATGCAG TGCAATTTCC 
028911 TTATTTATAT AACGACATAT TGTTTTTTAT ATACTTTCTT AAATGTGCTG TCTGGTTTTT CAACAGGACG 
028981 AGGTTTATCA TATTGAAATA GTGGAACTAT TGGCCAAACT AATGAATAAC TCCAGTAAAA CATCCACAGT 
029051 ACAGATTAAG CGTATTAAAC CTTCAATTAT CTACCGTTTA TTGCTGATTG GCCTCGGATC ACCAATGGTG 
029121 ATTTACGGCC TGGTTCGCCC GCTCACCATC GAAACGCGAG ATTAAACTCC TGACAAAACA CGCCCCAGAA 
029191 ACGTACTTCT GTTGGCGTAG TCTGGGTTAT TGCGCACGTA GGTTTAAAAC GTAAATTGTA ACAACGTGCG 
029261 CTTTGTTTAT GCCGGATGCG GCGTGTACGC CTTATCCGGC CTACGGTCAG GTTCCCGTAG GCATGATAAG 
029331 ACGCGTAAGC GTCGCATCAG GCAATGAATA CCCAATGCGA CCAGCTTCTT ATATCAGAAC AGCCCCAACG 
029401 GTTTATCCGA GTAGCTCACC AGCAGGCACT TGGTTTGCTG GTAATGCTCC AGCATCATCT TGTGGGTTTC 
029471 GCGACCGATA CCTGATTGTT TGTAGCCACC AAACGCCGCA TGTGCCGGGT AAGCGTGATA ACAGTTGGTC 
029541 CACACGCGCC CAGCCTGTAT GCCGCGCCCC ATCTTATAGG CCAGATTACC GTTGCGGCTC CAGACGCCCG 
029611 CGCCCAGGCC ATATTGCGTA TCGTTCGCCA GCTCCAGCGC TTCTTCCATC GTTTTGAAGG TGGTCACCGC 
029681 CAGCACCGGG CCAAAAATCT CCTCCTGGAA CACCCGCATA TTGTTCTGAC CAAACAGAAT CGTCGGTTCG 
029751 AGGTAGTAGC CGTCTTTCAG TTCACCTTCC AGCAGCTTGC GCCGCCCGCC TGTGAGCACG TCAGCGCCCT 
029821 CTTTTTTACC GATATCAATG TAGTTGAGGA TGGTTTCCAG TTGCCCGTGA GAAACCTGCG CGCCCATTTG 
029891 CGTCACGCTG TCGAGCGGGT TACCGCTACG AATGCTTTCG ACACGGCGGA TGGCGCGTTC CATAAAGCGT 
029961 TCGTAGATAG ATTCCTGCAC TAAAGCACGA CTCGGACAGG TGCAAACTTC GCCCTGGTTA AAGGCAAACA 
030031 GTGCAAAGCC TTCCAGCGCT TTATCGAAAA AGGCATCTTC TTCATCCATC ACATCAGCAA AGAAGATATT 
030101 TGGCGACTTA CCGCCCAACT CCAGCGTCAC CGGAATAATG TTTTGCGTTG CGTATTGCAT AATTTGTTGG 
030171 CCCACTTCCG TTGAGCCGGT AAACGCCACT TTGGCGATGC GTTTCGAGGT CGCCAGATAT TCGCCAATTA 
030241 CCCCACCTGC GCCATTGACC ACGTTCACCA CGCCCGGCGG CAGTAAATCA CCGACAATTT CCATTAGCAG 
030311 CAGTACAGAA AGCGGGGTAA GACGTGCGGG TTTCAGCACC ACACAGTTGC CCGCCGCCAG CGCGGGAGCC 
030381 ATTTTCCAGC TCGCCATCAG CAGCGGGAAG TTCCACGGGA TAATCTGCCC CACCACGCCT AACGGTTCAT 
030451 GGAAATGATA GGCCACGGTT TCGCTATCAA CTTCACTGAT CCCACCTTCC TGCGCCCGAA TACACGAGGC 
030521 GAAATAGCGG AAATGGTCAA TCGCCAGCGG TACATCCGCA GCACTGGTTT CGCGAATGGG TTTGCCGTTA 
030591 TCCCAGGTTT CAGCTGTCGC TAACAGCTCG AGGTTTTGTT CCATTCGATC GGCAATCTTA AACAGAATCG 
030661 CCGCACGATC CTGCACCGAG GTGTGCGCCC ATTTATCTTT CACTTTGTGC GCAGCATCCA GCGCCAGATC 
030731 GATGTCTCGT TTGCCCGAAG ACGCCACTTC GCACAGCAGC TGCCCGGTCA CCGGCGTCAG ATTCTGGTAA 
030801 TACTCGCCGT CGGCAGGGGC TACCCATTCG CCGCCAATAA AGTTGTCATA GCGGGCTTTT AACTTGAGGG 
030871 GGAAACCATA CTCGCCGGGC TTAATCTGTG CTGAAGGGGG ATTATTGGTC ATGATCGTCT CCTTGCGGTG 
030941 TGAGGTATAA CAAGGGTAGA CGTGACTGGC GAAATCTTCG CCAGTCGGTA ACAGCTTTAC GACAGCTATC 
031011 ACGAATTTAC GGGCAAGGGT TACAGAGATA GTTGAAAAAG CGGCTAACAA TTTGCCAGCC GTTGTGGAAA 
031081 TGATGATTAC ATCGCTGCGC GATAAATCGC CACAATTTCT TCGTGAGTTG CCTGGATCGG GTTAGTAAAG 
031151 CCACAGGCAT CTTTCAGGGC ATTAGTCGCC AATACCGCGA AATCTTCTTC TTTCACGTTC AGGTCGCGTA 
031221 GGCCTGCCGG GATATCCACT TTCTTCGCCA GTTCACGGAT GGCGTTAATG CAGGCTTCAG CACCTTCCGC 
031291 GTCGTTTTTA CCTGTCACGT TCACGCCCAT TGCAGCGGCA CAGTCACGCA GACGTGCAGC GGCGACTTTG 
031361 CTGTTGAATA CCTGAACGTG CGGCAGCAAA ACGGCGTTAC ATACACCGTG TGGCAGGTTG TAGAAACCGC 
031431 CCAGCTGGTG CGCCATCGCA TGAACATAAC CCAGAGAAGC ATTATTGAAC GCCATACCGG CGAGGAACTG 
031501 GGCATAAGCC ATTGCTTCAC GCGCTTTCGC ATTACTGCCA TCTTCAACGG CTAACGGCAG GTTTTCGGCA 
031571 ATCATGGTCA CGGCTTTCAG TGCACAAGCG TCAGTGATCG GCGTGGCGGC AATAGAAACA TATGCTTCGA 
031641 TAGCGTGCGT TAAGGCATCC ATACCCGTTG CGGCGGTCAG TGACTTCGGC ATACCAATCA TCAGAGAGGA 
031711 GTCATTGACA GAAAGCAGCG GAGTGACATG TTTATCAACA ATCGCCATTT TGATATGACG CGCTTCGTCA 
031781 GTGATGATGC AGAAACGGGT CATTTCAGAG GCCGTACCCG CCGTGGTATT GATGGCGATC ATCGGCAGCT 
031851 GCGGTTTTGC AGAGCGGTCA ACGCCTTCGT AATCGCGAAT ATCGCCGCCA TTGGCTGCCA CCAGCGCAAT 
031921 ACCTTTTGCG CAGTCGTGTG GAGAACCACC GCCTAAGGAG ATCACGCTAT CGCAATTATT CTCTTTAAGT 
031991 AATTTCAAAC CTGCGGCGAC GTTTTCCGTG GTGGGGTTAG GTTGGGTGCC ATCATAAATA ACGCTAAAAA 
032061 TATTGCGTTC TTCCAGTGCT TTTTGCACAT CGCCCGCCAT ACCTAATTTC GTTAACATAT TGTCAGTGAC 
032131 AATTAAGGTA CGGGTAAATC CATAATCTGC CATCATATTC ATTGCATCAG TCAATGAATC AGCGCCGATG 
032201 ACATTCACAG AAGGAATAAA GAACGTTGAA GCTGCCATAA CACACTCCTG AAAGTGTAAA AAAGGGCGGG 
032271 CAGCTTACTG AGGATTTTCA TTCGAAAATA TGATCAGTAT TATTGATTAT CAAAATTAAT CTAATAAAAA 
032341 GCACATTGTA TTCATTAAAC AATGTGCTTT TTTTAAATTC ATAAGAATTT TGTATTAATT TATTTTAAAA 
032411 CTTAATTAAT CATTTCCTTA TTTTTCCGGA AATAATAATG CGTCGCGCAA TAAATGATCA TTTCCACGAC 
032481 GACGCGTAAA GCCAATGCGG TCAAAATATT CCAGAATCTG AATTGCCAGC TTTCGGCCTA CGCCTAAGCG 
032551 ATCGCGGAAA TCCGCCGCGC AGGTTGAACC ACACTCCTGA TCGAGATCGC GGATCATATT GGCAAACTCG 
032621 ACAATCCGAT CGTTACGGTA ATAACGATCT TTAACGATCG CGGTAATTAT TCCTTGCTGC GCCGCCTGGC 
032691 GTAGAGTCAG GCGCATTGCC TGCTCGTCGG TTCCCGTCTC TTTTGCCAGG TCACGCACCC ACCACGGTTC 
032761 GTCACCAAAC AGTGGCTCTG CTTTTTGCCA GATGGCCTGC TGCTCTTCGC TGAAGCCCGC TTTGTGATCT 
032831 GGCAGATGCA GCCAGCCGTG ATGGCTGTGG ATGTCGCCGC TTTCGCGCAT CTTTTCAATC AGCAACAGTA 
032901 CCAGCGCTTC ATCTTCCATT GGCAACGCCA TACGTCGCAG ACGTTCGCGC CCAGGGCCAG GTTCATCGCG 
032971 ATGTTGCTCA TGATAAGTCG CTAATGTGTC GAGAATTTTC CGCTGCCAGC GGGCGGCAAC CGGCGCATTC 
033041 AACAAGCTAT AACCAGCCTG AATATAACCA GGCTGTTGCA GCAATTCGCG CATCCCTTCG CCGTTGAGCT 
033111 GGCGCGCCCA GGCGAAATCC GCAAGGTTAA CCGCGCCGCG TTCCAGATGA ACAGATAACG CATCGGCATC 
033181 GCTCTGCGCC CGTGCAAGAG ACGCCAGCCA TTGCAGATAT TCCGGCTTAC GTTTACCGCG ACGCGGCGGG 
033251 TTAAGCATCA CGACGCGCGC TCCGGCCAGC GTGTTGCGGG CAGAGATATC GCGCAATACC AGGCGGTCGT 
033321 TATCTGCCAG CCATAACGGG GTGTCGAAGA CCAGTTCAGC AAGGTTATCT TCCAGCAGTG AAACGCGTCC 
033391 CGTGACGTGG CTGGCGGCGT GGTGAATATG CAGCGGCTGC CACTGGGTCA GCGGTGTATG GGTTTGAAGC 
033461 TCGACAATCA CCCGTGTGAA CGGCTCTGGC GGCACATCGG CAAGCAGCCA GTCGCCACGG TTAATCTGCT 
033531 CTTTTTCCGC ATCACCCGCG ATGTTAAGCG CGATACGCTG CCCGGCATTG GCGGTTTCTG TTGGCTGGTT 
033601 TTGCGCATGC AGCGCACGTA CACGCATCGG TTTATTTACA CCAGTCAGCC AGAGTGAATC GCCTACCTTC 
033671 ACTTCCCCGC TTAACGCCGT ACCGGTGACG ACCAGCCCGG CACCTTTTAC GGTAAATGCG CGGTCAATCG 
033741 CGAGGCGGAA ACTATGTTGG CTGGCGTGCT CGCGTTCCGG CAACTGAAGC AGATGCTCGC GCAGGGCATC 
033811 CATTCCCCGA CCTTCGGTTG CTGCGGTGAT AAACAGTTTT GCCTCAGCAA AACCGTATTC CCGCAGAACC 
033881 TCCTTTACCT GGCGTTCAAC CTCATCAACA CGCGCTTCGT CCACGCGATC GGCTTTGGTC AGCGCCACTG 
033951 TCAGCATCGG GTTACCGGTC AGCTGCAAAA TCGCCAGATG CTCACGGGTC TGTGCCATCA CGCCGTCATC 
034021 GCACGCCACC ACCAACAGCG CGTGATCGAT ACCACCAACG CCCGCCAGCA TGTTGGAAAG AAACTTTTCA 
034091 TGACCGGGAA CGTCGATAAA ACCAGGCACG CGACCATCCG GCTGCGGCCA GTAGGCATAG CCGAGATCGA 
034161 TGGTCATGCC GCGCTTTTTT TCTTCCGGCA GACGGTCAGC ATTTACGCCA GTAATCGCCT GCAATAAGGT 
034231 TGTTTTGCCG TGGTCAACGT GTCCGGCAGT CGCAATAATC ATTTCAACAA CATCTCCAAA AACCGTTGCT 
034301 CATCTTCAAG GCAGCGTAAA TCCAGCCACA ATCGTCCGTC ATAAATACGA CCAATCACCG GCACTGGCAA 
034371 TTCACGCCAG CGGGCGGCTA ATGACTCAAG GTGGCTACCG CGTCCATCAT GGGGTGTAAA CGTTAATGCC 
034441 GCGCTCGGCA GGCGATCAAC CGGCAGCGAA CCACTGCCAA TCTGCGAAAG ACATGGCATA ACCTGTACCG 
034511 CAAACTCCGC GCCGTAATGT GCGGCAAGGG GGGCCTGTAA ACGTTGTGCC TGGATTTGAA TGACCTCTGC 
034581 GCTGCGGGTA AGCAGGCGCA GGGTCGGTAA TTTTTCACTC AGAGCTTCAG GGTGTAAATA AAGACGCAAC 
034651 GTGGCTTCCA GCGCCGCGAG GGTCATTTTA TCCGCGCGTA ATGCACGCTT CAGCGGGTGG CTTTGCAGGC 
034721 GGGCGATCAT CTCTTTTTTA CCAACAATAA TTCCTGCCTG CGGCCCGCCT AACAACTTGT CGCCGGAGAA 
034791 ACTCACCAGA CTGACGCCCG CCGCAATCAA CTCCTGCGGC ATTGGCTCTT TCGGCAAACC GTACTGGCTA 
034861 AGATCGACCA GCGAGCCACT GCCTAAATCA GTCACTACGG GAACATCCAG CTCTTTGCCG AGCGCCACCA 
034931 GTTCCGCTTC ATCTATCGCT TTGGTGAACC CCTGAATGCT GTAGTTACTG GTATGTACTT TCATCAACAG 
035001 TGCGGTATTT TCATTCACCG CCTGACGATA ATCATTCGCG TGCGTGCGGT TGGTGGTCCC TACTTCGTGT 
035071 AGGGTGCAGC CTGCCTGACG CATAACATCG GGAATACGAA ACGCGCCGCC AATCTCCACC AGTTCGCCGC 
035141 GAGATACCAC CACCTCTTTT CCGCTGGCAG TGGCCGCCAA CATCAATAAC ACCGCCGCCG CATTGTTATT 
035211 GACGATACAG GCATCTTCCG CCCCCGTAAT ACGGCACAGC AGCTGCGCCA GCGCCCGATC GCGATGTCCG 
035281 CGTCCGGCGT CGTCCAGATC ATACTCGAGG GTCACTGGCG AACGCATAGC CTGCGCAACG GCTTCCACCG 
035351 CGGCTTCCGC CTGTAAAGCT CGCCCAAGGT TGGTATGCAG CACGGTTCCC GTCAGGTTGA TCACCGGACG 
035421 CAGCGCGCTC TGCGCTTCTT TCGTCAACCG GGCATCGACT TCTTGCGCCC AGTTTTCACA CCACGCAGGC 
035491 AGCGTCTGGC TGCCACGAAT CACTTCTCGC GCTTCGTCGA GCATCTGACG CAACAATTCC ACCACGCGGG 
035561 TGTGACCATA AGTATCACGC AAAGAAAGGA AGGAGCTATC GCGCAATAAG CGATCAATAG CCGGAAGTTG 
035631 ACTATAGAGG GAACGCGTTT CGGTTGTCAT AGGAAACCTG GCTGATCAAG GCCCTCTCAC ACGGAGAAGG 
035701 GCGTTTAACA TAACCACGGA TTGTAACGTG AGATGGGTCA GGAGGACATA TCGCGCATCA AGCCTTTGGC 
035771 GGTTCGGTGC GAGCAAAACT TTCGCGGCTA AACAGGTTTT CGACCAGTTT GACTAAGTGT GGGCGGTCGA 
035841 CACACCAACC TGGCGCAACG CGGCGGAAAT TGAGATATCC GACGGCACAG GCAATGGCGA TAGTCGCCAG 
035911 ATTGACCGTA TCGGTTTTGA GTGTGCCATC GACCAGATAT CCTTCCAGCA CATCCAGACT GCGGTTGATT 
035981 TTCTCCCGCT GGCGTAACAA TTCATCTTCA GACTGCTGCG CCGCTGGACG CGCCTGTTCA CGCACCGATA 
036051 CCAGCCCGGC ATCCATAATG CCATCCGCCA GTGCCTCAAT TTTGCGCACC CGCAACGACT CCAGCGGATC 
036121 GCGCGGCAAC ATCGCCGGAG CGACATTCAT TAATTCAATA TATTCAGCGA TGATCGGCGA ATCAAACCAG 
036191 CATTCGCCCT CTTCGGTCAC CAGCACCGGC ACTTTTCCTA ACGGGTTAAA TTGCGCCACG CCGTTGTCCG 
036261 CGTTATAGGG CAGTTCATTA ATAAATTCGA AAGTTATGCC CTTTTCTAAC AACAGAATAG AAAGTTTGCG 
036331 TACAAACGGG CTGGTGTAGC TACCGACGAG TTTCATGCCG AGTCCTTTGT GCGAGGAAAA ATATCAGTAT 
036401 GGCCTGGTGA TGGGAAAAAG GGCAGAAAAT GTTGATGGTT TGTTACTTCC AAATAAATCA CATATTTATC 
036471 ATGGTGATAT AAATATTTTC CTAATTATTT CACTCTGATG GATATCTCAC TTCAGGCTTT CTTATAAATC 
036541 TGTAGGGTTT CGCCTGTCAG CAGACAAATA ACCCGATAAA ACAAGGATGA GAAATGAGCG GAAAACCGGC 
036611 AGCGCGTCAG GGCGACATGA CGCAGTATGG CGGTAGCATT GTTCAGGGTT CAGCCGGGGT GCGCATTGGT 
036681 GCCCCCACCG GCGTGGCCTG TTCGGTGTGC CCCGGCGGAG TGACGTCCGG CCATCCGGTC AATCCCCTGC 
036751 TCGGTGCAAA GGTCCTTCCC GGTGAAACCG ACATCGCCCT GCCCGGCCCG CTGCCGTTCA TCCTCTCCCG 
036821 CACCTACAGC AGTTACCGGA CAAAAACGCC CGCGCCGGTG GGGAGCCTCG GCCCCGGCTG GAAAATGCCT 
036891 GCGGATATCC GCTTACAGCT GCGCGATAAC ACACTGATAC TCAGTGATAA CGGCGGCAGA AGCCTGTATT 
036961 TTGAGCACCT GTTTCCCGGT GAGGACGGTT ACAGCCGCAG CGAGTCACTG TGGCTGGTGC GCGGCGGCGT 
037031 GGCGAAACTG GATGAAGGTC ACCGGCTGGC CGCACTCTGG CAGGCGCTGC CGGAAGAACT CCGCTTAAGT 
037101 CCGCATCGTT ATCTGGCGAC AAACAGTCCG CAGGGGCCGT GGTGGCTGCT CGGTTGGTGT GAGCGGGTGC 
037171 CGGAAGCGGA TGAGGTGCTG CCTGCGCCGC TGCCGCCGTA CCGGGTACTG ACCGGGCTGG TGGACCGCTT 
037241 CGGGCGCACA CAGACGTTCC ACCGCGAAGC CGCCGGTGAA TTCAGCGGCG AAATCACCGG CGTGACGGAT 
037311 GGTGCCTGGC GTCACTTCCG GCTGGTACTG ACCACGCAGG CGCAGCGGGC AGAAGAAGCC CGGCAGCAGG 
037381 CCATTTCCGG CGGGACGGAA CCGTCCGCTT TTCCTGATAC CCTGCCGGGT TACACCGAAT ATGGCCGGGA 
037451 CAACGGCATC CGTCTGTCTG CCGTGTGGCT GACGCACGAC CCGGAATACC CGGAGAATTT ACCTGCCGCG 
037521 CCGCTGGTGC GCTATGGCTG GACGCCACGC GGCGAACTGG CGGTGGTGTA TGACCGTAGT GGCAAACAGG 
037591 TGCGCAGCTT TACTTACGAT GATAAATACC GGGGCCGGAT GGTGGCGCAC CGTCACACGG GCCGGCCGGA 
037661 AATCCGTTAC CGTTACGACA GCGACGGGCG GGTGACAGAA CAGCTAAACC CGGCAGGCTT AAGCTACACG 
037731 TATCAGTATG AGAAAGACCG CATCACCATC ACCGACAGCC TGGACCGCCG TGAAGTGCTG CACACGCAGG 
037801 GCGAAGCCGG GCTGAAGCGG GTGGTGAAAA AGGAACACGC GGACGGCAGC GTCACGCAGA GTCAGTTTGA 
037871 CGCCGTGGGC AGGCTCAGGG CACAGACGGA TGCCGCAGGC AGGACAACAG AGTACAGCCC GGATGTGGTG 
037941 ACGGGCCTCA TCACGCGCAT AACCACGCCG GATGGCAGGG CATCGGCGTT TTACTATAAC CACCACAACC 
038011 AGTTAACGTC AGCCACCGGG CCTGACGGGC TGGAATTGCG CCGGGAATAT GATGAATTGG GCCGTCTGAT 
038081 TCAGGAAACT GCCCCTGACG GCGATATCAC CCGCTACCGT TATGATAATC CACACAGTGA CTTACCCTGC 
038151 GCAACGGAAG ATGCCACCGG CAGCCGGAAA ACCATGACGT GGAGCCGTTA CGGTCAGTTG CTGAGCTTCA 
038221 CCGACTGTTC CGGTTATGTA ACCCGTTATG ACCATGACCG CTTCGGGCAG ATGACGGCGG TGCACCGCGA 
038291 GGAAGGGCTG AGTCAGTACC GCGCATACGA CAGCCGTGGA CAGTTAATTG CCGTGAAAGA CACGCAGGGC 
038361 CATGAAACGC GGTATGAATA CAACATCGCC GGTGACCTGA CCGCCGTCAT TGCCCCGGAC GGCAGCAGAA 
038431 ACGGGACACA GTACGATGCG TGGGGAAAGG CCGTCCGTAC CACGCAGGGC GGGCTAACGC GCAGTATGGA 
038501 ATACGATGCT GCCGGACGGG TCATCCGCCT GACCAGTGAA AACGGCAGCC ACACCACCTT CCGTTACGAT 
038571 GTACTTGACC GGCTGATACA GGAAACCGGC TTTGACGGCC GCACACAGCG TTATCACCAC GACCTGACCG 
038641 GCAAACTTAT CCGCAGCGAG GATGAGGGTC TGGTCACCCA CTGGCACTAT GACGAAGCAG ACCGCCTCAC 
038711 GCACCGCACC GTGAAGGGTG AAACCGCAGA GCGGTGGCAG TATGACGAAC GTGGCTGGCT GACAGACATC 
038781 AGCCATATCA GCGAAGGGCA CCGGGTGGCG GTGCATTACA GGTATGATGA GAAAGGCCGG CTGACCGGTG 
038851 AGCGTCAGAC GGTGCATCAC CCGCAGACGG AAGCACTGCT CTGGCAGCAT GAGACCAGAC ATGCGTACAA 
038921 CGCGCAGGGG CTGGCGAACC GCTGTATACC GGACAGCCTG CCCGCCGTGG AATGGCTGAC CTACGGCAGC 
038991 GGTTACCTGG CAGGCATGAA ACTCGGCGAC ACACCGCTGG TGGAGTACAC CCGCGACCGC CTGCACCGGG 
039061 AAACGCTGCG CAGCTTCGGC CGTTATGAAC TCACCACCGC TTATACCCCT GCCGGGCAGT TACAGAGCCA 
039131 GCACCTGAAC AGCCTGCTGT CTGACCGCGA TTACACCTGG AACGACAACG GCGAACTCAT CCGCATCAGC 
039201 AGCCCGCGCC AGACCCGGAG TTACAGCTAC AGCACCACCG GCAGGCTGAC CGGCGTTCAC ACCACCGCAG 
039271 CGAATCTGGA TATCCGCATC CCGTATGCCA CAGACCCGGC AGGTAACCGC CTGCCCGACC CGGAGCTGCA 
039341 CCCGGACAGC ACCCTCAGCA TGTGGCCGGA TAACCGTATC GCCCGTGACG CGCACTATCT TTACCGGTAT 
039411 GACCGTCACG GCAGGCTGAC AGAGAAAACC GACCTCATCC CGGAAGGGGT TATCCGCACG GATGATGAGC 
039481 GGACTCACCG GTACCATTAC GACAGTCAGC ACCGGCTGGT GCACTACACG CGGACACAAT ATGAAGAGCC 
039551 GCTGGTCGAA AGTCGCTATC TTTACGACCC GCTGGGCCGC AGGGTGGCAA AACGGGTGTG GCGGCGTGAA 
039621 CGGGACCTGA CGGGCTGGAT GTCGCTGTCA CGGAAACCGC AAGTGACCTG GTACGGCTGG GACGGCGACC 
039691 GGCTGACCAC AATACAGAAC GACAGAACCC GCATCCAGAC GATTTATCAG CCGGGGAGCT TCACGCCACT 
039761 CATCAGAGTT GAAACCGCCA CCGGTGAGCT GGCGAAAACG CAGCGCCGCA GCCTGGCGGA TGCGCTTCAG 
039831 CAGTCCGGCG GCGAAGACGG TGGCAGTGTG GTGTTCCCGC CGGTGCTGGT GCAGATGCTC GACCGGCTGG 
039901 AAAGTGAAAT CCTGGCTGAC CGGGTGAGTG AGGAAAGCCG CCGCTGGCTG GCATCGTGCG GCCTGACCGT 
039971 GGAGCAGATG CAAAACCAGA TGGACCCGGT GTACACGCCG GCGCGAAAAA TCCACCTGTA CCACTGCGAC 
040041 CATCGCGGCC TGCCGCTGGC CCTTATCAGC AAGGAAGGGA CAACAGAATG GTGCGCAGAA TACGATGAAT 
040111 GGGGCAACCT GCTGAATGAA GAGAACCCGC ATCAGCTGCA GCAGCTTATC CGCCTGCCGG GGCAGCAGTA 
040181 TGATGAGGAG TCCGGCCTGT ATTACAACCG CCACCGCTAT TATGACCCGC TGCAGGGGCG GTATATCACT 
040251 CAGGATCCGA TTGGGCTGAA GGGGGGATGG AATTTTTATC AGTATCCGTT GAATCCAGTT ACGAATACAG 
040321 ATCCTCTGGG GTTAGAAGTT TTTCCTAGAC CATTCCCCTT GCCAATTCCA TGGCCCAAAA GCCCTGCACA 
040391 GCAGCAAGCA GATGATAATG CTGCAAAAGC ATTGACAAAA TGGTGGAACG ATACAGCATC ACAAAGAATA 
040461 TTTGACTCTC TAATATTGAA TAATCCGGGA CTAGCATTAG ATATAACAAT GATAGCTTCT CGTGGAAATG 
040531 TTGCAGACAC AGGGATAACT GATCGTGTCA ATGACATAAT AAATGACAGA TTCTGGAGTG ATGGGAAAAA 
040601 ACCCGACAGA TGTGACGTAC TTCAGGAACT AATTGATTGT GGTGATATTA GTGCTAAAGA TGCAAAAAGC 
040671 ACACAGAAAG CCTGGAATTG TCGTCACTCC AGACAGTCAA ACGATAAAAA AAGATAGCCC TTGTGGAGGT 
040741 TCCTGCAATG TCAAATACAT ACCAGAAAAG AAAGGCAAGT AAAGAGTATG GTTTATATAA TCAATGTAAG 
040811 AAACTAAATG ATGATGAATT ATTTCGCTTA CTTGATGATC ACAATTCCTT GAAAAGGATT TCATCTGCCA 
040881 GAGTATTACA GTTAAGAGGT GGGCAAGACG CTGTTAGATT GGCAATTGAG TTCTGCTCTG ATAAAAATTA 
040951 TATCCGTAGA GATATCGGAG CATTTATACT CGGGCAAATA AAAATTTGCA AAAAATGCGA AGATAATGTT 
041021 TTTAATATTT TGAACAATAT GGCATTGAAT GATAAGAGCG CTTGCGTTCG AGCTACGGCA ATCGAGTCAA 
041091 CGGCTCAGCG ATGCAAGAAA AACCCAATTT ATTCACCTAA AATAGTAGAA CAATCTCAAA TTACTGCTTT 
041161 TGATAAATCG ACTAATGTCA GACGTGCTAC AGCATTTGCT ATTTCTGTTA TCAATGATAA AGCAACAATT 
041231 CCACTATTGA TTAATCTGTT AAAAGATCCA AATGGAGATG TCAGAAACTG GGCCGCATTT GCAATAAATA 
041301 TCAATAAATA TGATAATAGT GATATTAGGG ATTGTTTTGT GGAGATGCTT CAGGATAAAA ATGAGGAAGT 
041371 CCGTATTGAA GCAATAATCG GACTTTCCTA CAGAAAAGAT AAAAGGGTTT TATCTGTTTT ATGCGATGAG 
041441 TTAAAAAAAA ATACTGTTTA TGATGATATC ATTGAAGCTG CGGGTGAATT AGGTGATAAA ACGCTACTTC 
041511 CTGTTTTAGA TACTATGTTG TACAAGTTTG ATGACAATGA AATTATAACT TCCGCTATTG ATAAGCTGAA 
041581 GCGTTCATAG CGTGAGTTGC CTATGCACAG TGGGGGATTC CCGCCGGCAC GGTGCAGATG CTCGACCGGC 
041651 TGGAAAGTGA AATCCTGGCT GACCGGGTGA GTGAGGAAAG CCGCCGCTGG CTGGCATCGT GCGGCCTGAC 
041721 CGTGGAGCAG ATGAAAAACC AGATGGACCC GGTGTACACG CCGGCGCGAA AAATCCACCT GTACCACTGC 
041791 GACCATCGCG GCCTGCCGCT GGCGCTCATC AGCACGGAAG GGGCAACAGC GTGGTGCGCA GAATATGATG 
041861 AATGGGGCAA CCTGCTGAGT GATGAGAACC CGCATCATCT GCAGCAGCTC ATTCGCCTGC CGGGTCAGCA 
041931 GTATGATGAG GAGTCCGGCC TGTATTACAA CCGCCACCGC TATTATGACC CGCTGCTGGG GCGGTATATC 
042001 ACTCAGGATC CGATTGGACT GAAGGGGGGA TGGAATTTTT ATCAGTATCC GTTGAATCCG GTCATAAATG 
042071 TAGATCCGCA AGGTTTGGTT GATATAAATT TATACCCCGA AAGTGATCTT ATCCATTCTG TAGCTGATGA 
042141 GATTAATATC CCAGGCGTTT TCACAATCGG GGGGCATGGT ACCCCCACAT CTATTGAATC CGCAACGCGC 
042211 AGTATCATGA CAGCTAAAGA TCTAGCATAT CTAATTAAAT TTGATGGGAA TTATAAAGAT GGGATGACAG 
042281 TTTGGTTATT TTCTTGTAAT ACAGGTAAAG GACAAAATTC ATTTGCTAGC TAATTAGCTA AAGAGTTACA 
042351 TACAAATGTA ATAGGACCTG ACACGCTATG GACGTGGTGG GGGCGAGGAA CTAATGGTAA GTTAAAAATG 
042421 GATACAGTGC TAACAGCACC AACGAACCTT AATTCAAATA AGGATCTAAT GGCTATAACA ACAAAAGACC 
042491 TTGGTAATTG GATAACATAT GGGCCATCTG GGCACCCCAT TTCTAATATG CAAGGTACGC CAGAAAAACC 
042561 CAGTGATATA AGATAGGTTG TAGATGTATG AAAGCATGCT TGTTACTATT TTTTTATTTC TCTTTTATTT 
042631 GTCAATTGCA TGGTGCTGAT GTGAAAATAA AACAAAACGA AAGTATGATG GGGTCTACAG CAATGACCTA 
042701 TGATTTAAGT GAAGAAAAGT TGATGAAACT GAAGTATAAA TCACAACATG GTGATTCAGA GGCATCATTT 
042771 CGACTATATC AATATTACTG CTTTACTAAA AATAACATTT ACAAACAATT GCGATTCTTG GAAAGATCAG 
042841 CATCTCAGGG GAATGTTACA GCGCAGTTTA ATTATGGGGT CTTTTTATCA GATACAAATC CAACATTATC 
042911 AGAATATTAT AATTTGAATA GAGCTATTTA TTGGATGGAA TTCGCTGTAA ATAACGGTAA TATTGATGCA 
042981 AAGAGCAAAC TTCAAGAGCT CAAAAAGCTA AAGCGAATGG ATAGAAGGAA GAATAAGGAG AATCCGTAAA 
043051 AGCAATAGTT CATCAGACTG CCGCAGCAGT AGTATGATGA TGAATCAGGG CTGTACTATA ACTATTATCG 
043121 GTAACATTAA CCGCAGCAGG GGCGGTATAA CACTCAGGCT CCGATTGGGC TGGAAGGTAG GTGGAATTTT 
043191 TATCAGTATC CGTTGAACCC GATTTCTGGA ATCGATCCCC TTGGGATTAG CCACCTGTTT ATACAGCATA 
043261 ACTTTAGGTA TGCTTTCGTG TGTTTCAGAT ATACCATGTG ATGATAATTT TTATGATGTG CTTAGTATTC 
043331 CAGTCGCTTC TGGTAATAAT ATGCAATGTA AAAATAATCC CCGTTGTACA CATTTATAAA TAGATGGCCA 
043401 ATACCTCAAG GCCTATGGAG TTGGAATGTT AATGACCCGG GAGCAAGCAA TAGAAAACCT GACGGCATAC 
043471 GATTAGTACC GTCAGTTAAT ACAGGAACTT ATAATCGCAA TGGATTTTCA ATACATAGTT GTTTAAACGC 
043541 TTTTGGTCCG TCTTTAGGAC CTCGATTCTG TTCCGAGGGT TGTATAACTG GTTTATCTAA TGACATGCAA 
043611 AAATTAAATG AGTTAATATT TTCAGAGCCA GATAGCACAT TAACAGTTAC GGACTAAAAA ATATGGCAAG 
043681 GTTATTAACA ATTGTATTTT TTTCTCTATT TCTGCGAGTG CAGTTACTGC AAGACAATTT CAGAGAGAGT 
043751 TAGATTTGGC AGACAAAGCA ATATTATGGG CACTAATATC AGCCAGTACT AAAGAGGGAC GAAAAGCGTG 
043821 TTCACTAAGC TATTTTGCCT GTAAGGCCGC AGAGGCTGAA CTCGGACTGG CATATATGGC TGCGAATGAT 
043891 AACAAGGAAT TTCTCACATC CTTATCTAAT ATAATGAGGT ACAAAATAGA TGCTGGACTT TCCGAATCCT 
043961 ATACATGCTA TTTATTAAGT AAGGGAAAGA TCATAAGACC ATATCTGAAA AATCTAAATC CACTCCAACT 
044031 TGCCGCTGAT TGCATTGAAA CAGTAAATAA AATAAAAGAT AAGAATAAAA AAAATCATTG ATATAAATTC 
044101 AGTTAATATT TGTAGTGATG ATAAAAATAT AAAATTGAGA GTTAATAGTA CTATTATGGC CATTGATGAT 
044171 TCTATAAAGT GCATCGATGA ATGATAACTT AATTTTATTT AAAAATATAT TAATAACTCA CTCTCCAGGA 
044241 GTTTTTTTAA CTTAGTTTTA TAATGAATAC GATAATTAAA AGTGAAGAAG AAAATAGTTG TATACATATA 
044311 TTCCATGACC CTACATTGTG ATCTATAGAT TAAATATTTT TTAAATGTGA CTGTCATCCT TCAGATAATA 
044381 AAGCCATCAT CGCAATAGAT GGAAAAGCAC TCCTGCTCTT TTTTGATTAG AGCCGTCGCA GGAGGAACAA 
044451 CTCATATCAT CATTGCGATC TCGACGATGT ATAGTCTCAT CCTGCGGCAG AACAAGACGG ATAAAAAATC 
044521 CAATGAGAGC ACACTCATCC AGAACTTATT AACATAATGA ATATTAAAGA AAAATCATCG AAGCTAATGA 
044591 AGTAATATGC AAAAATAATT AGTCCTTACA AGGAGCAAAG TTCCATAATC TCCCCCCTCC CCCTCAATGA 
044661 TCCAAATAAA GATAATGCAT CCAGCTGGTC ATTCTTAGCA GCACTTTCCG CATCACCGAA ACATGGCTGA 
044731 AATGGTCGGA GTAAACCGCC ACCTGGGCGT AGATGCCGTC GGGTAAGGCA TCGATATCAT CGTTAGGGTC 
044801 CAGTTCAATG GTTCCCAGCA CACCGTCCGT GCCGGGCACG ACCGTTAATG ATTGCAATAC CCCCTGCGCC 
044871 TGATAAGAAC CGCCTGGCAC GACAGGTAAA ATACTAGTCA GTTTGCCGTG AAACACCTGC CCAGGTAGCG 
044941 CGTTAAACAC CACTTCCGCA TCATCGCCAG GTTTCAGACG TAACAGCGAG TTTTGCCGAA ATTGGGCGAC 
045011 AATTTGCCGT TTTTGCTCGG GGATGAAGAC CATCACCGGA CGCAGCGGCA AGGCAGCTGC GTATGTACCT 
045081 GGGCGGATCA GTACCTGAGT AACGTAGCCA TTGCTCGGCG CGCGAATGAC AGTCTGCTCA AGGTTATATT 
045151 TTGCTTCAGT AAGTTGCGCT CTTAAGCTCA CAATCTGCGA TTGCTCGCCG TTAACCATAC TGTCGAGCTG 
045221 GCTCTGGATC TGCGCCTGCT CCGCCACCGA GCCTTTCACC AGCGCATCCT GCGCGAGGAA ATTTTGCCGC 
045291 GCATCGTCGA TGTCACGTTC CGAGAACGGA TTCACCGCCG CCTGGCTGCC TTTCAAGTAA CGTTGATAAT 
045361 TTTTAAACAG ACGGTCGCGC TCCGCTGAAA CCTGGGTGGT GTTGGCCTGC GCTTCAGTGA GCTGCGCACG 
045431 CAGCGTCTTT ATATTATGCG TCGCCGTCAT CAGGTCAGCC TGAAGTCTGT CAACTCGCGC CTGGTAACGA 
045501 ACCGGGTCGA GCTTAAAAAG CACCTCGCCC TTTTGAATAA GCTGATTATT CTTGTCAGTG ACTTCAGTAA 
045571 CAATTCCCGT CACCTGTGGC GTGATAGGGA TCGCTATCAC TGCCTTTTGC GCGGTAAAAG TGTAAGGGTG 
045641 GTTGTAGTTC ATCAACAAAA TCAAACCACT CACCAGAAAC ACGCCTCCCA GCGCCGCCGT CGCCAGCGTC 
045711 CACTGATTTA CCGGAATGCG GAAGATTTTA AAGACCGCCC ACGCCAGCGC CACGTAAGTT AAAACAATCA 
045781 ATAGATCCAT AATTAGATCT CCGGGAACGT GGAATAGTCA GTCTTTTTCT CGGCGGCGAG TTGATGCTCC 
045851 AGCCGGGAAA TTCGGTCAGA AAGTGCGGCG ATTTCCGGGT CAGTCGCTTT CTCCTGCGAC GCAACATGTG 
045921 ACTGCATACC CCAGCCACGC TCCGGTTGAT AGAGCGTCGC CCAGATCCAC AGAAACGGCC AGATAACATG 
045991 CAGAGTAAAC AGGCTCACCC AGCCCGCCGT ATGAATAGCG TCGGCATGGG GATGGTTGCG CTTTTTGGCA 
046061 ATCAGATAAG GGATGTCATG TATCGCGATG ATTCCATAAA AAATCACCAG AAAGACGAAG ATCAGCACTC 
046131 CCAACGCGAA ATAGTTTAGA AACAT