MG1655
W3110
Search for
Japanese | English
Deletion Report : 28
General information
Deletion 28  
Location (BP) 498,306 - 550,550   Go Linear View
Length (BP) 52,245
Related strains
     Strains ME5107    ME5108    ME5112    ME5113    ME5114    ME5115    ME5116    ME5117    ME5118    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer 0498304_C_28_1_RcL  
Sequence ACAAATGTCTAATGCCTACGACTACACGGATGATGAAAACCGCCGACGAG  
3' Primer 0550552_U_28_B_LcR  
Sequence CTCGTCGGCGGTTTTCATCATCCGTGTAGTCGTAGGCATTAGACATTTGT  

 Linear View (Whole Mode)
View Location
   495.0  –  595.0 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence in neighbor 100bp
000001 AATAATGCAA AAAGGCGTGC AGCGTGCCTG GGTAGAGTTT GAACTCACAG GGCTGCTGAT GCGCCGCTAA 
000071 CGTCTGGTAA AGCAGACGGC TGTCATCCAG CAGCGGATCG AACTCCGCCC CGGCAATAAA ACAGGGCGGA 
000141 ACTTCGCGAG TGAGATCATT ATTAAACAGA CAGTAATACG GCGACTCGCG GTCCGCGTCG TTGCTTAAAT 
000211 ATGCCTCTTC GTACATCTGC AAATCCTGTT GCGTTAAGCC ATCCCAGACA CCGCCCAACA GACGACGAGT 
000281 CACGGAATCC CGTAATCCGT AAAGCCCATA CCACAGCAAA ACGCCCGCAA CTTTACCGCA ATCGATCTGT 
000351 TTATCACGCA ACCACAACGC ACTGGCGAGC GCCAGCATGG CACCTGCGGA ATCACCGGCA AAGCCAATGC 
000421 GGGACATATT GATTTGATAA TCCTCCGCCT GCTGGTGGAA ATAACAACAA GCAGCCACAA TTTCCTCTAT 
000491 CGCTTGCGGA AAACGCGCTT CAGGTGAAAG GGTGTAATCA ATACCAATCA CCGTACATTG GCTGTAGCTT 
000561 GCCAGCAGGC GCATGATGCG ATCGTGGGTA TCGAGATTGC CGAGAATAAA ACCGCCTCCA TGCAAATAAA 
000631 ATAGCGTCGC TGGGCTATCT GGCTGCGGAC AAAAGAGACG TGTTTCCACC TGCCCATATT TTGTTGGAAC 
000701 CATGTAAGCT CTGGTTGCCA TTTCTGGAGC GCCCGCATTC CAGAATCGGC GCTCAAGCGT GTAATACTGT 
000771 CGTTGCTCAG CAATCGTTCC CGTTGCGGGC CAGGGCGGTA AATCCGGCTG AAGAGTATTC ACAACGGTCT 
000841 TCATTTCAGC AGAAATAAGG TCCAGAACAG GTAGTTTGTT TTCCGGCTTC ATACAAAAAC TCCTTTCAAA 
000911 TTACGTCATT GTAAGGAACC ACTGCCATGA AAATGCGATC CCGCCTGCTG ATATTGAAAC TGGCTGCGTC 
000981 TCGCGCGCTC CCGTCAGATT GTGTTAACAT TCGCCGCTCA GTTAACCACC CGTAAAAACA ACCATGAAAT 
001051 TTCCCGGTAA ACGTAAATCC AAACATTACT TCCCCGTAAA CGCACGCGAT CCGCTGCTTC AGCAATTCCA 
001121 GCCAGAAAAC GAAACCAGCG CTGCCTGGGT AGTGGGTATC GATCAAACGC TGGTCGATAT TGAAGCGAAA 
001191 GTGGATGATG AATTTATTGA GCGTTATGGA TTAAGCGCCG GGCATTCACT GGTGATTGAG GATGATGTAG 
001261 CCGAAGCGCT TTATCAGGAA CTAAAACAGA AAAACCTGAT TACCCATCAG TTTGCGGGTG GCACCATTGG 
001331 TAACACCATG CACAACTACT CGGTGCTCGC GGACGACCGT TCGGTGCTGC TGGGCGTCAT GTGCAGCAAT 
001401 ATTGAAATTG GCAGTTATGC CTATCGTTAC CTGTGTAACA CTTCCAGCCG TACCGATCTT AACTATCTAC 
001471 AAGGCGTGGA TGGCCCGATT GGTCGTTGCT TTACGCTGAT TGGCGAGTCC GGGGAACGTA CCTTTGCTAT 
001541 CAGTCCAGGC CACATGAACC AGCTGCGGGC TGAAAGCATT CCGGAAGATG TGATTGCCGG AGCCTCGGCA 
001611 CTGGTTCTCA CCTCATATCT GGTGCGTTGC AAGCCGGGTG AACCCATGCC GGAAGCAACC ATGAAAGCCA 
001681 TTGAGTACGC GAAGAAATAT AACGTACCGG TGGTGCTGAC GCTGGGCACC AAGTTTGTCA TTGCCGAGAA 
001751 TCCGCAGTGG TGGCAGCAAT TCCTCAAAGA TCACGTCTCT ATCCTTGCGA TGAACGAAGA TGAAGCCGAA 
001821 GCGTTGACCG GAGAAAGCGA TCCGTTGTTG GCATCTGACA AGGCGCTGGA CTGGGTAGAT CTGGTGCTGT 
001891 GCACCGCCGG GCCAATCGGC TTGTATATGG CGGGCTTTAC CGAAGACGAA GCGAAACGTA AAACCCAGCA 
001961 TCCGCTGCTG CCGGGCGCTA TAGCGGAATT CAACCAGTAT GAGTTTAGCC GCGCCATGCG CCACAAGGAT 
002031 TGCCAGAATC CGCTGCGTGT ATATTCGCAC ATTGCGCCGT ACATGGGCGG GCCGGAAAAA ATCATGAACA 
002101 CTAATGGAGC GGGGGATGGC GCATTGGCAG CGTTGCTGCA TGACATTACC GCCAACAGCT ACCATCGTAG 
002171 CAACGTACCA AACTCCAGCA AACATAAATT CACCTGGTTA ACTTATTCAT CGTTAGCGCA GGTGTGTAAA 
002241 TATGCTAACC GTGTGAGCTA TCAGGTACTG AACCAGCATT CACCTCGTTT AACGCGCGGC TTGCCGGAGC 
002311 GTGAAGACAG CCTGGAAGAG TCTTACTGGG ATCGTTAAGT TATCGTCGGT TCGTAGGCCA GATAAGGCGT 
002381 TCACGCCGCA TCTGGCATTT GGCTCTCGAT GCCTGATGCG ACGCTGGCGC GTCTTATCAT GCCTACATAT 
002451 TTTTCATATT TTACATCCGG CAACCACCGT TTACCCCGTC ACCACCTCAC CCGCCGGTGG CGTTTCCAGC 
002521 AGTTCCAGCA TGGTACGGGC GATTTCACGC TCGCCCATCA CTACCTGATT CGCACCACGT TCGGTGATAT 
002591 ACGCCACTTC ATCGTCATAA TGGGCGCGGG CAATAATCTC AATATCCGGA TTTTTCGCGC GGGCAGATGC 
002661 CACAATCTCA CCCGCTTCAT AACCGTTGGG AATCGTCAGG ATCAGCCATT TTGCACATTC CAGATGCGCC 
002731 AGTTGCATAA TTTCTTCGTT CGCCGCATTG CCCAATACTG CGCGGACCCC GCGCTCTCGC AGCTCATCAA 
002801 CACGGGTTCG TGACGTCTCA ATCACCACCA GCGGAATATC AGAGGCGAGC AATTTCTCCC CCAGCAGGCT 
002871 GCCTACACGA CCGTAACCCA CCAGTAGCGC ATGGTTGCAA ATATCCACTG GGATCTGCTT CTCTTCTTCG 
002941 ATTGCCTCTT CCAGCGTCTG CTCTTCCAGC GTTTCGGTCT TCGCCAGATA TTTCTCCAGT AGTGCGAACA 
003011 GTACCGGGTT GAGCATAATC GACAGGATCG CCCCTGCCAG TACCAGGTTT TGTCCGGCCT GCGGCAGTAA 
003081 ATTCAATGCC ATTCCCAGTC CCGCCAGGAT AAACGCGAAC TCACCAATCT GCGCCAGGCT GGCGGCGATG 
003151 GTTAATGCCG TACGTTGGGA GTGACCAAAC AGTCGCACCA GGAAAAATGC GGCTAACGAC TTACCAAACA 
003221 GAATAATCGC CAGCGTCGCC AGCACTGCCA GCGGTTGCTG AATCAGAATT AACGGATCAA ACAACATCCC 
003291 GACGGAGACA AAAAACAGCA CCGCAAACGC GTCGCGCAAT GGCAGCGTAT CGTGGGCGGC ACGGTGACTC 
003361 AGTTCAGACT CGTTCAGTAC CATCCCGGCA AAGAACGCAC CGAGTGCAAA GGAGACATCA AACAGCTCTA 
003431 CCGCACCAAA GGCAACCCCT AACGCCAGCG CCAGCACCGA CAGGGTAAAC AGCTCGCGAG AACCGGTTGC 
003501 CGCGCTGCGT GCCATAATCC ACGGCACCAG ACGGCGACCT ACCAGCATCA TAATGGCGAT AAATGCGATC 
003571 ACTTTGCCGA TGGTGATCCC CATATCGACT GCAAGAGTGG CAAAGCCCAC ATCGCCCTGT TCCATCATTC 
003641 CTGCCACTGC GGGCAGCAAC ACCAGCGTCA GAACCATTAC CAGGTCTTCC ACAATCAACC AACCGATGGC 
003711 GATTTGCCCA CGCTGACTGT CAATTAATTG CCGTTCTTCA AGTGCGCGCA GTAACACCAC GGTACTGGCG 
003781 GTGGAAAGAC ATAAACCGAA CACGATACCG GTCATTAACG ACCAGCCCAG CACGGCAGAG AGCGCCATAC 
003851 CCAGCAGCGT CGCCACGGCT ATCTGGGCGA TCGCACCGGG AATGGCGATG GCCTTTACCG CCATCAAATC 
003921 CTTCAGCGAA AAGTGCAAAC CGACGCCAAA CATCAACAGA ATGACGCCCA GTTCAGCCAG TTCCGGGGCA 
003991 AGCTTGGTAT CGGCAACAAA GCCCGGAGTG AATGGTCCTG CCAGCACACC CGCTAACAGA TATCCCACCA 
004061 GAGGAGAAAT ACGTAGTTTA TTGGCCAGCA TGCCGAGGAT AAAGGCGAGC ACAAGGCCGC CAACAATGGT 
004131 GGTGATAAGC GGGGTGGCGT GATGCATTCC GTCTCCTTTT CCTGGTGGTT ATTGTCCATT TTTGGCCGGG 
004201 AAAACCAAAA TTACAGGTAA TAGTTTATGA CAATTTCATT GATGATGTTC ATGAATAATT ATTGAATTTT 
004271 GCAGAAAAAT GGAATTAGCT GCAAAAAAAG CACGGATCGG AAAACAGAAG GCGGTTTAAC AGAGGAAAGG 
004341 CTTATGGCGA CTGTAAAACG ATGCAGCCAA AGTTTGCCTT TGGCTGCAAT GAAATCAGTC TTTATGCCGG 
004411 TTATCAGGCA GGAATATGGT CAACATCCCC AATAGTGGCA GGAAAGCACA GATTTTATAG ACTAACTCGA 
004481 TGCTGGTGTG ATCGGCGATA AGCCCCAGAA CTGCCGCTCC CAGACCTCCC ATGCCAAAAG CAAAACCGAA 
004551 AAAGAGTCCA GAAACCATAC CGATACGTCC TGGAAGCAGC TCCTGAGCGT AGACCAGAAT GGCAGAGAAT 
004621 GCCGAAGCGA GGATAAATCC AATAATCACC GTTAAAACCC CCGTCCAGTG CAGGCTGGCG TAGGGTAAAA 
004691 TCAGCGTAAA CGGCGCAACG CCGAGGATAG AGCCCCAAAT CACATATTTC CGCCCAATTT TATCCCCTAC 
004761 AGGCCCGCCG ATCACCGTAC CTGCCGCAAC GGCAAACAGG AAGGCAAACA GATGAAGCTG AGCATTCTGG 
004831 ATAGATAATC CGAATTTTTG CATCAGATAA AAGGTGTAAT AGCTGCTGAT GCTCGCCATA TAGAAATATT 
004901 TCGAGAAAAT GAGGATTAAC AGAATGCTGA CCGCCAGTAC AACTTTATTG CGCGGCAGTG GATTGATAAT 
004971 CGTCGCTTTG GGTTTTCCTT TATTCATTCG GTGCTGTGCC GAGTACCAAC GGCTGATTTG CGCCAACACC 
005041 ACGATCGCCA GCAGTGCCGC AAGCACAAAC CAGGCAACGT TGCCTTTGCC ATAAGGCGCG ATAATCACCG 
005111 CCGCCAGCAA GGGTCCCAGG GAACTGCCAA AGTTGCCGCC GACCTGAAAG ATAGATTGCG CCAGGCCATG 
005181 CCGCCCGCCG GAAGCCATAC GGGCCACGCG AGAAGATTCC GGATGAAAGA CCGATGAACC GGTACCGACC 
005251 AGCGCCGCCG CCAGCAGAAC TGCGCCAAAA CTGCCCGCCA GCGCAAGCAG CACCAGACCG CTTAAGGTAA 
005321 AGCACATGCC AATTGGCAAC GACCATGGCA TCGGATATTT ATCGGTCCAG TAGCCGACCA CTGGTTGCAG 
005391 TAGCGAAGAG GCGAGCTGGA AGGTGAGGGT TATCATGCCA ATCTGCATAA ATGTCAGAGA AAATTCTGAC 
005461 TGAAGCAGCG GATAAATCGC CAGAATCAGC GATTGGATCA TGTCGTTCAG CAGATGTGAG AGGCTGATAG 
005531 CACCTAAAAT ACCAAACGAT GTTCGGGCCT TGGTCGTTGA CGCAGCCGCG CCCGCCACAG GCTGGGGTTG 
005601 TTCACTCATT GCCATAGGAA AGTCACTTTT TCAGGGTTGC GATGTAAAGA ATGATCTTAT TTGTGATTAT 
005671 TACCAGACTA ACATACCTGT ATGCGTCGTC TGAAGGAAGT CTCAACGCCG AATACAGAAT TTCTAATCTG 
005741 GATGCAGATT TATCTTCACC GGACGCAGAC TTGTCTATGA TGTCGCGTCA TACTATTTTT CAACACGTTG 
005811 AAATCAGGTC AGGGAGAGAA GTATGAAATT ATTGCAGCGG GGCGTGGCGT TAGCGCTGTT AACCACATTT 
005881 ACACTGGCGA GTGAAACTGC TCTGGCGTAT GAGCAGGATA AAACCTACAA AATTACAGTT CTGCATACCA 
005951 ATGATCATCA TGGGCATTTT TGGCGCAATG AATATGGCGA ATATGGTCTG GCGGCGCAAA AAACGCTGGT 
006021 GGATGGTATC CGCAAAGAGG TTGCGGCTGA AGGCGGTAGC GTGCTGCTAC TTTCCGGTGG CGACATTAAC 
006091 ACTGGCGTGC CCGAGTCTGA CTTACAGGAT GCCGAACCTG ATTTTCGCGG TATGAATCTG GTGGGCTATG 
006161 ACGCGATGGC GATCGGTAAT CATGAATTTG ATAATCCGCT CACCGTATTA CGCCAGCAGG AAAAGTGGGC 
006231 CAAGTTCCCG TTGCTTTCCG CGAATATCTA CCAGAAAAGT ACTGGCGAGC GCCTGTTTAA ACCGTGGGCG 
006301 CTGTTTAAGC GTCAGGATCT GAAAATTGCC GTTATTGGGC TGACAACCGA TGACACAGCA AAAATTGGTA 
006371 ACCCGGAATA CTTCACTGAT ATCGAATTTC GTAAGCCCGC CGATGAAGCG AAGCTGGTGA TTCAGGAGCT 
006441 GCAACAGACA GAAAAGCCAG ACATTATTAT CGCGGCGACC CATATGGGGC ATTACGATAA TGGTGAGCAC 
006511 GGCTCTAACG CACCGGGCGA TGTGGAGATG GCACGCGCGC TGCCTGCCGG ATCGCTGGCG ATGATCGTCG 
006581 GTGGTCACTC GCAAGATCCG GTCTGCATGG CGGCAGAAAA CAAAAAACAG GTCGATTACG TGCCGGGTAC 
006651 GCCATGCAAA CCAGATCAAC AAAACGGCAT CTGGATTGTG CAGGCGCATG AGTGGGGCAA ATACGTGGGA 
006721 CGGGCTGATT TTGAGTTTCG TAATGGCGAA ATGAAAATGG TTAACTACCA GCTGATTCCG GTGAACCTGA 
006791 AGAAGAAAGT GACCTGGGAA GACGGGAAAA GCGAGCGCGT GCTTTACACT CCTGAAATCG CTGAAAACCA 
006861 GCAAATGATC TCGCTGTTAT CACCGTTCCA GAACAAAGGC AAAGCGCAGC TGGAAGTGAA AATAGGCGAA 
006931 ACCAATGGTC GTCTGGAAGG CGATCGTGAC AAAGTGCGTT TTGTACAGAC CAATATGGGG CGGTTGATTC 
007001 TGGCAGCCCA AATGGATCGC ACTGGTGCCG ACTTTGCGGT GATGAGCGGA GGCGGAATTC GTGATTCTAT 
007071 CGAAGCAGGC GATATCAGCT ATAAAAACGT GCTGAAAGTG CAGCCATTCG GCAATGTGGT GGTGTATGCC 
007141 GACATGACCG GTAAAGAGGT GATTGATTAC CTGACCGCCG TCGCGCAGAT GAAGCCAGAT TCAGGTGCCT 
007211 ACCCGCAATT TGCCAACGTT AGCTTTGTGG CGAAAGACGG CAAACTGAAC GACCTTAAAA TCAAAGGCGA 
007281 ACCGGTCGAT CCGGCGAAAA CTTACCGTAT GGCGACATTA AACTTCAATG CCACCGGCGG TGATGGATAT 
007351 CCGCGCCTTG ATAACAAACC GGGCTATGTG AATACCGGCT TTATTGATGC CGAAGTGCTG AAAGCGTATA 
007421 TCCAGAAAAG CTCGCCGCTG GATGTGAGTG TTTATGAACC GAAAGGTGAG GTGAGCTGGC AGTAATCCGA 
007491 AAGTGCCGGA TGTTTGCATC CGGCACAATG CTTAATCGCG GCGGGCGATA TCAGCAAATT TGGCATCGAG 
007561 GATCTTTGCC AGATCGCCTG CCGCCAGTTC GATATCCAGT CCGCGCTTGC CGCCGGAAAC ATAAATAGTG 
007631 GCAAATTCTT GTGCGGGGGC GTCGATAATC GTTGGCAGAC GTTTTTTCTG CCCCAGTGGG CTAATCCCCC 
007701 CAACCAGGTA TCCCGTCGAA CGCTGCGCGA CCATCGGATC GGCCATCTCA ACTTTCTTGG CACCCAGCGC 
007771 TTTTGCTACT TTTTTAAGAT CCAGTTGACC TGCGACCGGC GTAACGGCCA CGGCAAGGTG TTTCATATCA 
007841 CCGTTCACTG CCACCAGCAG CGTTTTGTAG ACCTGATCCG GATTCAAACC TAATTTTTTG ACGACTTCAT 
007911 CGCCAAAATT GGTTTCAGCC GGATCGTGCT CGTAGGTATG GATTTGAAAC GAAATCTTGT TTTTTTCGAG 
007981 TAATTTAACT GCGGGTGTCA TGGTAATTTT CCTGCCTTAA ACAAAAAAAC GAAGCAAGCA TACGCCTGAT 
008051 GGCGGTCCAA AAAAAAGAGT CATCTTGCCT AAGAGTATTG GCAGGATGGT GAGATTGAGC GACAATCGAG 
008121 TTACACCGTC GCTTAAAGTG ACGGCATAAT AATAAAAAAA TGAAATTCCT CTTTGACGGG CCAATAGCGA 
008191 TATTGGCCAT TTTTTTAGCG CAACATTTGC GGCAAATTCC CTTCTCCATA CAGGTGTAGT GCACCGACCG 
008261 CGACCACATA TCGCCCCGGC GGCATGGCGC GTAATTTATC CCGCCAGGCG AGATTTCGCT GATGCATCAG 
008331 CACATCGTAC AGCGACTGAC TGAACGTATT GGGCAGCGTT ATATCATTAT TTTGCGGCGG TGCATTCAGC 
008401 CACCAGCTCA TCATTTGTTG CAGCAACCGT GCGTTGGTAT GCCAGTGGGT CAGCGTATCG TCCAGCAGCG 
008471 CCAGTCCTTT GTCAGGGAGC TGGAGCAACA TGGCAATCTG GTTTTCAGCC CCTTCCAGTT CAATCACGGG 
008541 TTTATGTTGT TGCTTCGCCG CCTGCAATAG CTGGTAATCG ATACCGTATT CTGCCCGCAG CCCCAGTTTT 
008611 TGTGCCTGCG TCGCCTGAAG AACCATCGCG ATTTGCCACA GCGGTTGGGT AGAAAAGAGT GAGGGAGAAA 
008681 TGCCCATCTC CTGGCTAATG TGCTGCAGGT TTTGGAGTTG CTCCTCGCTA ATGCGCTCTT CCAGCGCCTC 
008751 GCAGGCAGGC AAATTAGCAA AAGGCGTATC GCTGGTGGAA ACATCCGCCT CGACGATCAG CGCATCGGCG 
008821 TTTTTGAGCT TTTTGAGCAA ACGGGTGGGC AGGGGAGCCA TATCGTGGCT ACCCATATGA ATACTGCCAA 
008891 TCAGATGAAA ATGGCGATTG CCGGGGAGGG TGATATCGAT GGCAGGCCAG GTGTAATGAT TACCGCGCAG 
008961 CGCGGCCCAA AGCGTTTTTA CCCGGTACAA CAGATCCATA CGACCTCCCT TTGTGAAATA TCATGCTAGC 
009031 GCGCGGTGAG GGATGGCGCA AATGGAGTTG GAGACTTGTT TAATGTGTTT GTATGATTCA GTATGTTCTT 
009101 GCATCGCTAT TCACAAGGAA GCAACAGTTA AAAACCATGA AACAGGCAAC AAGAAAACCG ACGACACCCG 
009171 GAGATATTCT TCTCTATGAA TATCTGGAAC CGCTCGATTT GAAAATCAAT GAGTTAGCAG AGTTGCTGCA 
009241 TGTTCATCGT AATAGCGTCA GTGCACTGAT CAATAACAAT CGTAAACTCA CTACTGAGAT GGCATTTCGT 
009311 CTGGCGAAAG TTTTTGATAC CACAGTCGAT TTTTGGCTAA ACCTCCAGGC GGCGGTTGAT CTTTGGGAAG 
009381 TTGAAAACAA CATGCGCACC CAGGAAGAAT TGGGACGGAT TGAAACAGTG GCTGAATATT TGGCACGCCG 
009451 TGAAGAGCGT GCAAAAAAGG TCGCGTAAGG CCAAAACATC GCTTCATCTC GTAGGCCGGA TAAGGCGTTC 
009521 ACGCCGCATC CGGCATCCGA GCACCATTGC CTGATGCGAC GCTTACCCGT CTTATCAGGC CTACAAACTT 
009591 GTGCCTGAAC CGTAGGCCGG ATAAGGCGTT TACGCCGCAT CCGGCATCCG AGCACCATTG CCTGATGCGA 
009661 CGCTTACGCG TCTTATCAGG CCTACAAACC TGTGCCTGAA CCGTAGGCCG GATAAGGCGT TTACGCCGCA 
009731 TCCGGCAGTC ATGCGTCGAT GCCAAATGCG CCACCCTAAA GCAGCGCATC CGCAATGATG TACTTATTCC 
009801 TTCGGTTTAA ACCGCAGCAA CCGGTTGGCG TTACTCACTA CGGTAATCGA CGAGAGCGCC ATTGCCGCTC 
009871 CGGCAACTAC CGGGTTAAGC AGTGTTCCAG TGAACGGCCA CAAAATACCG GCGGCGACCG GAATACCGAT 
009941 ACTGTTGTAG ATAAACGCAC CGAGCAGGTT CTGCTTCATG TTGTGCAGCG TTGCGCGGGA AATAGCGAGC 
010011 GCATCCGCAA CGCCCATCAG GCTATGGCGC ATCAGGGTAA TCGCCGCGGT TTCAATGGCA ACATCACTGC 
010081 CGCCACCCAT CGCAATGCCG ACATCCGCCT GAGCCAGCGC TGGCGCGTCG TTAATGCCGT CGCCCACCAT 
010151 TGCCACCTGA CGTCCTTCAC TTTGCAGATG TTTGATCGCT TCGGCTTTAC CGTCCGGCAG CACCCCGGCG 
010221 ATCACCTCAT CAATCCCTGC TTCTTTGGCG ATCGCATTGG CGGTGGTTGG GTTATCCCCG GTCAACATCA 
010291 CCAGACGATA TCCCGCTTTA TGCAGGCGTT GCAGCGCCGC CACGCTATCA CTACGCAACG GATCGCGTAC 
010361 TGCCAGCAGG GCTACCGCTT TCCCGTCAAC CGCCAGCAGC ACAGGCGTTG CCCCTTGCGA TGCCTGAGCA 
010431 GTAATCTCCG CTTCGATAGC TTTGGTACCA ACCTGTTGCT CATTTAACAG CGCCTGATTG CCCAGCAATA 
010501 ACGCATGACC TTCAGCTTCA CCGCTCACGC CCAGCCCGCG CAATGTGCGG AAACCGTTGA CCTGCGGTAG 
010571 CTGCATATCA CCTGCTTTAT CGAGGATCGC TCGTGCCAGC GGATGGCTGG AACCTTGCTC CAGTGCCGCC 
010641 GCCAGACGCA ATGCCTGCGC TTCATCAACA TCAGCAAATG TTTTCACTGC GACAACCTGC GGCTTCCCTT 
010711 CAGTCAGCGT CCCGGTTTTA TCGAACACTA CAGTGTCGAG TGTACTGGCG CGTTGCAGCG CGTCAGCGTC 
010781 CCGCACCAGC ACGCCAAACT CAGCCGCCCG CCCGACGCCG GAAATAATCG ACATCGGCGT CGCCAGCCCC 
010851 AGCGCACACG GACAGGCAAT AATCAGTACC GTGGTGGCAA TCACCAGGGT ATAGACAATC TGCGGTGCCG 
010921 GACCAAAGAA ATACCAGATT GCCGCACTGA CAAGCGCAAT AACCACCACT ACCGGCACAA ATACGGCTGA 
010991 GATTTTATCC GCCAGCTGAC CGATTTCTGG CTTGCTGCTC TGGGCCTGGC GCACCATGCG AATGATTCGT 
011061 GACAGCGTAG TATGGCTGCC AACCGCACTG GCACGAAACA GCACACTGCC GTCCTGTACC ACTGTCCCGG 
011131 CATGGACGCT ATCGCCTTCG CCTTTTTGCT GCGGGATTGG TTCGCCCGTC AGCATCGCTT CATCCAGCCA 
011201 TGCTTCGCCC TGGGTAATCT CGCCATCTAC CGGCACGCGA TCGCCGGTCG TCAGGCGCAG CAACATACCT 
011271 GGCTGCACTT CTGCCAGAGG CACGCTTTTT TCACCTTCGT CAGTAACCAG GCGTGCCGTC GGCGGGGTTA 
011341 AATCGAGTAA CTTTTCCAGC GCCTTAGAAG AACGCTGGCG TGCGCGCGCT TCCAGCATAT GGCCGAGATT 
011411 GATCAGACCG ATAATCATCG CGCTGGCTTC GTAATAAAGA TGTCGCGCTT CCATCGGGAA CCACTGCGGC 
011481 CACAGGTTGA CGCTCATCGA ATAGAGCCAC GCCACGCCAG TACCCAGCGC CACCAGCGTA TCCATCGTCG 
011551 CCGCACCGTT CAGCAGGCTT TTCCATGCAC TGCGGTAAAA ATGGCCGCCG GCGAAAACCA TCACTGCCAG 
011621 GGTTATCAGG CCGATAACCA ACCACAGGCT GCGGTTGTCA GCGGTGACCA TCATGTTATC GCCGATCATC 
011691 CCCCAGACCA TCACCGGGAT ACCCACCGCC AGTGCGACAA TTGCCTGCCA GCGGAAGCGC TTCATCGTAG 
011761 CGACGGCGGT TTCTTGCTGG CGCTCGCGGC GTTTAGCGTC ATCTTCAATC GCTTCCGCGC CGTAGCCCGC 
011831 TTTTTCCACC GCCTGCACTA AATCTTGTGG GGAGGCACTG CCCATCACCA GCGCAGTACG CTCCGCCAGG 
011901 TTTACCCGTG CCTGAGTGAC GCCCGGTACG CTTTGCAGCG CATTTTGTAC GCGGGTGACA CAGCTGGCGC 
011971 AGCTCATGCC GCTCAGCAGC AACTGCTGGC TGTCATCGTC ATCGGCGGTC GCTGCCGGAA GCGCCTCAGA 
012041 AACCGCTGTC AGTGCTTCCG ACGGGATTGA TGACTCCGCC AGCGGTTTAG CCTTTGGGTG GCTTACAGAT 
012111 GCGTCATAAC CCGCTTGTTT GATGGTTTCG ATCAGCTGTT CTGCACTGGC AGTCCCGGTA ACGTGCGCTT 
012181 CAGTGATAGA CACATCCGCC TGCTCAACAT CCGGACGCTG TTCAAGACTT TCTTTCACGC GTTTAACGCA 
012251 GTGACCGCAG GACAGGCCGT CCAGGGTCAG GTCGATAGTT TGTGACATAA AACACTCCTT TAAGACAGTT 
012321 TTGACTGGCT GTGATAAAGG TTAAACCTTC CAGCAAGGGG AAGGTCAAGA AATTAATAAA CCAGGCGGGT 
012391 AAAAGTCCGT AAAGATTAAA AAATCGGCTC GATTTGCATC AGGATTAGAC ATTTATCTCT TTGTTTTCCT 
012461 GTAGTTAAGT TGCGGGTGCT AAGTTAAATC AGGATGCCTG AAAATCGGCA CCGGGGTGAG GAATTACCTC 
012531 CCGCATCTAT AAAAAGGAGT TAACAAAAGA TGTTAGATGC AAACAAATTA CAGCAGGCAG TGGATCAGGC 
012601 TTACACCCAA TTTCACTCAC TTAACGGCGG ACAAAATGCC GATTACATTC CCTTTCTGGC GAATGTACCA 
012671 GGTCAACTGG CGGCAGTGGC TATCGTGACC TGCGATGGCA ACGTCTATAG TGCGGGTGAC AGTGATTACC 
012741 GCTTTGCACT GGAATCCATC TCGAAAGTCT GTACGTTAGC CCTTGCGTTA GAAGATGTCG GCCCGCAGGC 
012811 GGTACAGGAC AAAATTGGCG CTGACCCGAC CGGATTGCCC TTTAACTCAG TTATCGCCTT AGAGTTGCAT 
012881 GGCGGCAAAC CGCTTTCGCC ACTGGTAAAT GCTGGCGCTA TTGCCACCAC CAGCCTGATT AACGCTGAAA 
012951 ATGTTGAACA ACGCTGGCAG CGAATTTTAC ATATCCAACA GCAACTGGCT GGCGAGCAGG TAGCGCTCTC 
013021 TGACGAAGTC AACCAGTCGG AACAAACAAC CAACTTCCAT AACCGGGCCA TAGCCTGGCT GCTGTACTCC 
013091 GCCGGATATC TCTATTGTGA TGCAATGGAA GCCTGTGACG TGTATACCCG TCAGTGCTCC ACGCTCCTCA 
013161 ATACTATTGA ACTGGCAACG CTTGGCGCGA CGCTGGCGGC AGGTGGTGTG AATCCGTTGA CGCATAAACG 
013231 CGTTCTTCAG GCCGACAACG TGCCGTACAT TCTGGCCGAA ATGATGATGG AAGGGCTGTA TGGTCGCTCC 
013301 GGTGACTGGG CGTATCGTGT TGGTTTACCG GGCAAAAGCG GTGTAGGTGG CGGTATTCTG GCGGTCGTCC 
013371 CTGGAGTGAT GGGAATTGCC GCGTTCTCAC CACCGCTGGA CGAAGATGGC AACAGTGTTC GCGGTCAAAA 
013441 AATGGTGGCA TCGGTCGCTA AGCAACTCGG CTATAACGTG TTTAAGGGCT GATCATGATG AACACGGAAG 
013511 GTAATAACGG TAACAAACCT CTCGGTCTAT GGAACGTCGT TTCCATCGGC ATTGGGGCAA TGGTGGGGGC 
013581 GGGGATCTTC GCGCTGCTGG GGCAGGCTGC ATTGCTAATG GAAGCCTCGA CCTGGGTCGC CTTTGCTTTT 
013651 GGCGGTATTG TGGCGATGTT TTCCGGTTAT GCCTATGCGC GTCTGGGGGC GAGCTATCCC AGCAATGGCG 
013721 GCATTATCGA CTTCTTTCGT CGCGGATTAG GCAACGGCGT CTTTTCGCTG GCGCTCTCGT TACTGTACCT 
013791 GTTGACGCTG GCGGTGAGCA TCGCCATGGT CGCCCGTGCT TTTGGCGCTT ATGCCGTGCA GTTTTTGCAT 
013861 GAAGGCAGCC AGGAGGAGCA CCTTATTTTG CTCTACGCGT TGGGGATCAT TGCGGTGATG ACGCTTTTCA 
013931 ACTCCTTAAG CAACCATGCG GTAGGGCGGC TGGAAGTGAT CCTCGTCGGC ATTAAAATGA TGATCCTGTT 
014001 ATTGCTGATT ATTGCCGGTG TCTGGTCGCT GCAACCGGCG CATATTTCCG TCTCTGCGCC CCCCAGCTCC 
014071 GGTGCGTTCT TCTCCTGTAT TGGGATAACT TTCCTTGCCT ATGCGGGCTT TGGCATGATG GCGAACGCGG 
014141 CGGATAAAGT GAAAGATCCG CAGGTCATTA TGCCACGGGC GTTTCTGGTG GCGATTGGCG TTACCACGTT 
014211 GCTTTATATC TCGCTGGCAC TGGTTTTGCT TAGCGATGTA TCGGCATTAG AGTTAGAAAA ATATGCCGAT 
014281 ACCGCCGTAG CGCAGGCTGC TTCTCCGCTG CTCGGGCATG TGGGTTATGT GATCGTCGTC ATCGGCGCTT 
014351 TACTGGCGAC GGCTTCAGCC ATTAACGCGA ACCTGTTCGC CGTGTTTAAC ATCATGGACA ACATGGGCAG 
014421 CGAACGCGAA CTGCCGAAGC TAATGAATAA ATCCCTGTGG CGGCAGAGTA CCTGGGGCAA CATTATTGTC 
014491 GTGGTGTTGA TTATGCTGAT GACGGCGGCA CTGAATTTAG GCTCACTCGC CAGCGTTGCC AGCGCCACCT 
014561 TTTTGATTTG CTACCTGGCG GTGTTTGTGG TGGCGATCCG CCTGCGTCAT GATATTCACG CCTCGTTGCC 
014631 GATTCTTATC GTTGGTACGT TGGTGATGTT GTTGGTGATC GTTGGCTTTA TCTACAGTCT GTGGTCCCAG 
014701 GGTAGCCGTG CGTTGATATG GATTATTGGC TCACTCTTAC TCAGCCTTAT TGTGGCAATG GTCATGAAGC 
014771 GCAATAAAAC CGTATAACAT CTCTCTGTGC GCAGTACTTC CTGTATTATT GTGGTGGCGG TCGATATTCG 
014841 CACTGGCAAA AAAACGTGCT TGAATATCTG TTGAAACCCT TTAACAAAGC ACAGGAGGCG TTGCGCGAAC 
014911 GATGAACATC AGCGATGTAG CAAAAATTAC CGGCCTGACC AGCAAAGCCA TTCGCTTCTA TGAAGAGAAG 
014981 GGGCTGGTGA CGCCGCCGAT GCGCAGCGAA AACGGTTATC GCACCTACAC GCAGCAGCAT CTCAACGAAC 
015051 TGACCTTACT GCGCCAGGCA CGGCAGGTGG GCTTTAACCT GGAAGAGAGC GGCGAGCTGG TGAATCTGTT 
015121 TAACGACCCG CAGCGGCACA GCGCCGACGT CAAACGGCGC ACGCTGGAGA AGGTGGCGGA GATCGAACGA 
015191 CACATTGAGG AGCTGCAATC CATGCGCGAC CAGCTGCTGG CACTGGCGAA TGCCTGCCCT GGCGATGACA 
015261 GCGCCGACTG CCCGATTATC GAAAATCTCT CCGGCTGCTG TCATCATCGG GCAGGGTGAT TAAGACGAGA 
015331 CGGCTCGGAT ATGTAGGGTT ATCCCTTCTA TCGCAATGAC TTCAACATGC GTACCTGCAC CGAGATCCTC 
015401 GCTGGCGCTG ACAGGCCATG AACTGTCACC GACGCGCATA TGACCGCGCC CGTTGACCAG CGGAGATTCC 
015471 AGCACAAAAC GTCGGCCAAT CAGCTGCTGC CCGCGCTGGT TTAAATGACT ATCGCTGTGC TTTTGTTCGC 
015541 GCACCCGCCG CGACAACCAT TTCCACCACA GCCAGGCGGC GAGCAGCGTC AGGATGGCAA ACATTACCCC 
015611 TTGCCACTCC CAACCCAGCG GCACCAGCCA GACCACCAGG CCGGTAATCA CCGCTGCCAC GCCGCTCCAC 
015681 AACAAATAAC CATTTCCGCC CAGCATCTCG GCTGCCAGCA GCAAACCGCC GAGACTGAGC CAGAAAATAT 
015751 GTGGATGAAC GACCATTAAC TCCATCATGG CTGAGTCCGT TTGTTGGCGC TGTCTTTCAC CAGCTCGGCA 
015821 ATCCCGGCAA TCGACCCCAT CAGGCTGCTG GCCTCTAATG GCATCATCAC TACTTTGCTG TTACTGGAGG 
015891 AACCGATCTG CTGTAACGCT TCGGTGTATT TCTGCGCTAC GAAGTAGTTC ACCGCCTGAA TATCACCGGA 
015961 GGCGATAGCT TCAGACACCA TTTTGGTGGC GCGGGCTTCT GCTTCGGCGG AACGTTCACG CGCTTCAGCC 
016031 TGTAAAAACG CCGACTGACG TTCGCCTTCC GCTTTCAGGA TTTGCGACTG TTTTTCACCT TCGGCTTTGA 
016101 GGATTTCCGC CTGACGGATC CCTTCCGCTT CAAGAATGTA AGCGCGTTTG GTACGTTCCG CTTTCATCTG 
016171 CGCGTTCATT GAAGAGATAA GCTCTGCCGG TGGGCGCACG TCGCGAATTT CAATACGGGT GACTTTAATC 
016241 CCCCACGGGT TGGTGGCTTC ATCGACAATA CGCAGCAGGC GTGAGTTGAT GCTGTCGCGC TGAGAGAGCA 
016311 TTTCGTCAAG TTCCATTGAA CCCAGCACGG TACGGATGTT AGTCATGGTC AGGTTGATGA TCGCCAGCTC 
016381 CAGATTGCTG ACTTCATAAG CCGCGCGCGG CGCGTCAATC ACCTGAATAA AGCACACGGC GTCGATGGTA 
016451 ACGTTGGCGT TATCTTTCGA GATAACTTCC TGGGAAGGGA TATCGAGCAC TTGCTCCATC ATATTGATCT 
016521 TGCGACCAAT GCGATCCATA AACGGCACCA CCAGACTGAG CCCCGGCTGT AACGTTTTGG TATAGCGACC 
016591 AAAGCGTTCT ACTGTCCACT GATAGCCCTG CGGTACGATT TTGACACCCG CGCCGACAAT GACCAGCGCG 
016661 ACAAAAATGA GAATCGGGAT AAAGATAAGC ATCGGAAAAA CCTCCTGTTG TACCGTCCAT AATCAGCAAA 
016731 ATTGCTGCTT GATTAAACAA ATTATACCTG ATTACTGAAA GAGAGTTCCC CCTTATTCCT GCGAAGGATA 
016801 AACTGTTTTT AGTAAAAATC AGAAAAAGGG AACAGCGATG CAGGAAAATA GTCCTTTGCT TCAGCTACAA 
016871 AACGTAGGAT ATCTGGCGGG TGATGCGAAG ATTCTTAATA ACATCAATTT TTCGCTGCGT GCTGGCGAAT 
016941 TTAAGTTAAT TACCGGTCCT TCTGGTTGTG GCAAAAGTAC GCTGCTAAAA ATAGTTGCTT CATTGATCAG 
017011 CCCAACCAGC GGAACGTTAC TGTTTGAAGG TGAGGATGTC AGCACACTAA AGCCAGAAAT CTACCGCCAA 
017081 CAAGTCTCTT ACTGCGCCCA GACACCGACG CTGTTTGGCG ATACGGTATA CGATAATCTG ATCTTTCCCT 
017151 GGCAGATCCG TAACCGGCAG CCTGACCCAG CCATTTTTCT CGATTTTCTC GAACGCTTCG CCTTGCCGGA 
017221 CAGCATTTTG ACGAAGAATA TCGCCGAGCT ATCTGGTGGT GAAAAACAAC GCATCTCATT GATTCGTAAC 
017291 CTGCAATTTA TGCCGAAGGT TTTATTGCTG GATGAAATAA CCAGTGCGCT GGATGAAAGT AATAAACATA 
017361 ACGTCAATGA GATGATCCAT CGTTATGTGC GCGAGCAAAA TATTGCCGTG CTGTGGGTGA CACACGATAA 
017431 AGACGAAATT AATCATGCGG ATAAAGTGAT TACACTGCAA CCGCATGCCG GAGAAATGCA GGAAGCACGC 
017501 TATGAACTCG CATAATATTA CTAACGAATC ATTAGCACTG GCATTAATGC TGGTGGTGGT GGCAATCTTA 
017571 ATTAGCCATA AAGAAAAACT GGCGCTGGAG AAAGATATTC TCTGGAGCGT CGGGCGAGCG ATAATTCAGC 
017641 TGATTATTGT CGGCTATGTG CTGAAGTATA TTTTCAGCGT GGATGATGCC AGCCTGACAT TATTGATGGT 
017711 GTTATTTATC TGCTTTAATG CGGCGTGGAA CGCGCAAAAA CGCAGTAAAT ATATTGCTAA AGCTTTTATC 
017781 TCATCGTTTA TTGCCATTAC GGTCGGGGCG GGAATTACCC TGGCGGTGCT GATTCTCTCA GGGTCGATTG 
017851 AATTTATCCC GATGCAGGTG ATCCCTATCG CCGGGATGAT TGCCGGTAAC GCCATGGTAG CGGTGGGGTT 
017921 GTGTTACAAC AATTTAGGGC AACGGGTCAT TAGCGAACAG CAACAGATTC AGGAGAAACT GAGTCTTGGT 
017991 GCGACGCCGA AGCAGGCTTC AGCGATATTG ATTCGCGACA GTATTCGCGC GGCTTTAATT CCGACGGTCG 
018061 ATTCAGCAAA AACGGTTGGC TTAGTGAGTT TACCAGGAAT GATGTCCGGG CTGATATTTG CCGGGATTGA 
018131 TCCGGTGAAG GCGATTAAAT ATCAGATTAT GGTGACCTTT ATGCTGCTCT CAACCGCCAG CTTGTCGACC 
018201 ATTATTGCCT GCTATTTAAC CTATCGTAAG TTTTATAATT CGCGCCACCA GTTGGTGGTG ACGCAATTGA 
018271 AGAAGAAATG ATGCGATGCC GGATGCGCAG CATCGCATCC GGCGTTGTGG TTCATGTGCC GATCAACGGA 
018341 ATATCAATAC AACAATGCAT ACAGCTGGCG GCGATACTTC GACGCCAGTG CATCACCCGT ACCCAGCGCA 
018411 GCGAGGATCT CCTGGAACGT TTTACGCGTC TGACCGTCTG CGGCGGTGAG ATCTTTACGC AGATGCCCGA 
018481 ACAGCAACTC CAGCGCCTCT TCATTGCGCC CAACCTGATG CAGTTGCAGC GCCAGTTGCG TCGCCAGTGC 
018551 GGCATCTTCT GGATTCTCCG CCACCTGCTG TTGCAACTGT TGAATTTCCG GCGTATCAGC CGCCTGCTTC 
018621 AGCAGTTCGA TTTGCGCCAC CAGCCCCTGG TAGCGGGTGT CCTGATCCTG CAACGGAATG GTTTTCAGCA 
018691 CCGCTTCCGC ATCTTCAGAA CGGTTCAGCG CAATCAGCGT TTCTGCCAGC AGCAGGCCGA TCTCCCCGTT 
018761 CTGATTCGAC AACTGCCAGG CGTCTTTCAG CAATGGCAGG GCATCGGTGT AATTGCTTTC CTGCATCAGT 
018831 TGCATCGCCT GCTGCGCTTT CAGCTCTTCT TCGCGCGGCA GCACTTTATC CAGCAGGGCG CGGATCGCCT 
018901 CTTCCGGTTG CGGCCCCTGG AAGCCATCTA CCGGTTGCCC GTTCTGGAAC AGATACACGG TCGGAATCGC 
018971 ACGCAGACCA AACTGCGCGG CAATCATCTG CTCCGCGTCG CAGTCCAGCT TCGCCAGAAT AAATTGCCCG 
019041 TTGTACTGCG CCGCGAGGCT TTCCAGAATT GGGGTTAACT GCAAACAGTG CTGGCTACGT TCAGACCAAA 
019111 AATAGAACAG CACCGGAGTG GTCATCGACT GTTCAAGAAC CTGTTGCAGG TTAGATTCGT TAATGTTGAC 
019181 AATATTTTCT ACGGACATGG AGTCGCTCTC TGTTGTCGAT ATTTTCTTTG ACATGGGGGC TTAAGCGCGC 
019251 GCTTCAACTC ACCCCTGCAA TATTTTGTCC ATCACGCGCC CCGGCAGCAG GCGCTTAAGC ACCATTACCG 
019321 CCCAGGTCAC CAGCGTCACC GGATAGCGCA TCTTCGGCTT CTCGCTAATA AAAGCATGGC GTACTTTGTC 
019391 CACCACCGCT TCCGGTCCCA ACGTAAAGCG GGCGGCGATG CCGGGATTTT CGACTGGTTT ATCACTTTGC 
019461 GTCTGGTTGA CGTTGTCGGT GAAGCGAGTA CGAATGGGAC CGGGTTCGAT CAGGCTGACT TTAATTCCGC 
019531 TGTGGCGCAG CTCCATGCGC AGTGCATCTG ACCACGCCTC CAGCGCATAT TTACTGGCCG CGTAAGCGCC 
019601 ACGACCCGGC GTGGAGATTA ATCCCATCAC CGATGATGTC ATCACAATAC GCCCTTCACC GTGCGGTAAC 
019671 ATCGCGGGTA ACAGGCGCAT GGTGAGCTGG TGTGCGCCGA AAAAGTTGGC GGAAAACTGC TGTTCCATCT 
019741 GCGCACGGCT GATGGTGGAA AGGGGGCCAT ACATGCCGAA TCCGGCATTG TTAAAGATCC CATACAGACA 
019811 ATTATCGGTC AGGGCGATCA CCTCGTCGGC TGCGCGATCA ACACTTTCTG GTGAATCCAG ATCGATCAAC 
019881 ACGCCGGTAA ATCCCATGCT GTTCATGCGC TCAACATCAT CCGGTTTCCG GCAACCTGCC AGCACATGAA 
019951 AACCCTGGCG TTTTAATTCG AGCGCGCTTT CCAGGCCAAT TCCACTGGAA CATCCGGTAA TTAAGACCGA 
020021 TTTTTGCATA ACTTTACCTG TCAGGATCTC CGTTGCTTTA TGAGTCATGA TTTACTAAAG GCTGCAACTG 
020091 CTTCGCCATC CAGTCGGCAA TAAACGGCTG GGCGTCGCGG TTGGGATGAA TACCGTCATC CTGCATCCAT 
020161 TGTGGCTTGA GGTAGACCTC TTCCATAAAA AAGGGCAGCA GCGGAACATC AAACTCTTTG GCGAGTTTGG 
020231 GGTAAATGGC GCTAAAGGCT TCATTATAAC GGCGACCATA GTTTGCAGGC AGACGTATTT GCATTAACAA 
020301 TGGTTCAGCG TTGGCGGCTT TGACATCCTG CAAAATCTGG CGCAGCGTTT GCTCGGTTTG CTGTGGCTGA 
020371 AAACCACGCA AACCGTCATT GCCGCCCAGT TCAACCAGCA CCCAACGCGG CTGATGCTGT TTCAGCAGAG 
020441 CCGGAAGGCG CGCCAGTCCT TGTTGCGAGG TGTCGCCGCT GATGCTGGCA TTAACTACCG ACGTTTTACT 
020511 CTGCCACTTA TCATTCAACA AGGCAGGCCA GGCCGCGCTG GCAGACATTC GATACCCGGC GCTCAGGCTA 
020581 TCACCCAGAA TCAATAACGT GTCCGCTGCG GCGGCACGGA AGGTTAACAG GACCAGGAAC AGGAAGGGCA 
020651 AATGCCAGCG GAAAACATTG TTGAAGTTCA TCATCTTAAG AAGTCCGTCG GTCAGGGGGA GCATGAACTC 
020721 TCCATCCTCA CCGGAGTTGA GCTGGTTGTC AAACGTGGCG AGACCATCGC ACTGGTGGGC GAGTCGGGAT 
020791 CGGGTAAGTC AACCTTGCTG GCGATCCTCG CCGGGCTTGA TGACGGCAGC AGTGGCGAAG TGAGTCTGGT 
020861 GGGACAACCG CTACATAATA TGGACGAAGA AGCGCGGGCA AAGTTGCGCG CGAAGCACGT CGGCTTTGTT 
020931 TTTCAGTCAT TTATGTTAAT TCCTACCCTT AACGCGCTGG AAAACGTCGA GCTTCCGGCT CTGCTGCGCG 
021001 GTGAGAGTAG CGCGGAAAGT CGTAACGGGG CGAAAGCGTT GCTCGAACAG TTAGGGCTGG GTAAACGTCT 
021071 GGATCATCTT CCGGCACAGC TTTCCGGCGG TGAACAGCAA CGAGTGGCGC TGGCACGAGC CTTTAATGGT 
021141 CGACCTGATG TGCTGTTTGC CGACGAACCC ACCGGCAACC TTGACCGCCA GACGGGCGAT AAAATTGCCG 
021211 ACCTGCTGTT TTCCCTCAAC CGTGAACATG GCACCACGTT GATTATGGTG ACCCACGACC TGCAACTGGC 
021281 GGCACGCTGC GACCGCTGCT TACGGCTGGT GAACGGGCAG TTGCAGGAGG AAGCATGATT GCACGTTGGT 
021351 TCTGGCGCGA ATGGCGTTCG CCGTCGCTAT TAATTGTCTG GCTGGCGCTA AGCCTGGCGG TGGCCTGCGT 
021421 GCTGGCGCTG GGCAATATCA GCGATCGCAT GGAGAAGGGC TTAAGCCAGC AAAGCCGTGA GTTTATGGCG 
021491 GGCGATCGGG CGTTGCGCAG TTCACGCGAA GTGCCGCAAG CGTGGCTGGA GGAAGCGCAA AAGCGCGGCC 
021561 TGAAAGTCGG CAAGCAGCTG ACTTTCGCCA CAATGACCTT TGCAGGCGAC ACACCGCAGC TGGCGAACGT 
021631 CAAAGCGGTG GATGATATCT ACCCGATGTA TGGCGATCTG CAAACTAATC CCCCTGGCCT GAAACCGCAG 
021701 GCGGGCAGCG TATTGCTGGC CCCACGCCTG ATGGCACTGC TTAACCTGAA AACGGGCGAC ACCATTGACG 
021771 TGGGCGATGC CACCTTGCGG ATTGCCGGAG AAGTGATTCA GGAACCGGAT TCCGGTTTTA ACCCCTTCCA 
021841 GATGGCTCCG CGTCTGATGA TGAATCTGGC GGATGTCGAT AAAACCGGAG CCGTGCAGCC GGGGAGTCGG 
021911 GTCACCTGGC GTTATAAATT CGGCGGCAAC GAGAACCAGC TCGACGGCTA TGAGAAATGG TTGTTACCTC 
021981 AGCTTAAACC CGAACAACGC TGGTACGGTC TGGAACAGGA CGAAGGCGCG CTGGGGCGAT CGATGGAACG 
022051 CTCGCAACAG TTCCTGCTGC TTTCGGCGCT TCTGACCTTG CTGCTGGCAG TGGCAGCGGT GGCGGTAGCG 
022121 ATGAATCATT ACTGTCGCAG TCGCTACGAT CTGGTGGCGA TCCTCAAAAC GCTGGGGGCA GGGCGAGCGC 
022191 AACTGCGTAA GCTAATCGTC GGTCAGTGGT TGATGGTGCT GACGCTTTCA GCCGTTACCG GTGGGGCCAT 
022261 AGGCCTGTTG TTCGAAAACG TGTTGATGGT GCTGCTCAAG CCCGTTCTGC CTGCTGCACT ACCGCCAGCC 
022331 AGCCTCTGGC CGTGGCTGTG GGCGCTTGGC ACCATGACGG TCATCTCGCT GCTGGTGGGG CTACGACCAT 
022401 ATCGCTTGTT GCTGGCAACG CAGCCTTTAC GCGTATTACG TAATGATGTG GTAGCGAACG TCTGGCCGCT 
022471 GAAGTTTTAT CTGCCGATTG TCAGTGTGGT GGTTGTGCTG CTGCTCGCCG GATTAATGGG TGGCAGCATG 
022541 CTGCTTTGGG CGGTGCTGGC GGGCGCGGTA GTACTGGCTT TGCTGTGCGG TGTGCTGGGC TGGATGCTGC 
022611 TGAATGTACT TCGCCGCATG ACGCTGAAAT CGCTGCCTCT GCGCCTGGCG GTTAGCCGCC TGTTACGTCA 
022681 GCCGTGGTCA ACGTTAAGTC AGCTTTCGGC ATTTTCGCTC TCCTTTATGC TGCTGGCACT GCTGCTGGTG 
022751 TTGCGTGGCG ATCTGCTCGA CCGCTGGCAG CAGCAGCTAC CTCCAGAAAG CCCGAACTAC TTTTTAATTA 
022821 ACATCGCCAC AGAACAGGTA GCACCGCTAA AAGCGTTCCT CGCGGAACAT CAGATAGTCC CGGAATCGTT 
022891 TTATCCGGTG GTGCGGGCGC GGCTGACGGC GATTAACGAT AAGCCGACAG AAGGTAATGA AGATGAGGCG 
022961 CTTAACCGCG AACTCAATCT TACCTGGCAA AATACGCGGC CCGATCATAA TCCGATTGTC GCCGGTAACT 
023031 GGCCGCCAAA AGCCGATGAA GTGTCGATGG AAGAGGGGCT GGCGAAACGC TTAAACGTTG CCCTCGGTGA 
023101 TACCGTGACT TTTATGGGCG ATACCCAGGA GTTCCGCGCT AAAGTGACCA GCCTGCGCAA AGTGGACTGG 
023171 GAAAGTCTGC GGCCTAATTT CTATTTTATT TTCCCTGAAG GGGCATTAGA CGGGCAACCG CAGAGCTGGC 
023241 TTACCAGTTT CCGCTGGGAG AATGGCAACG GCATGTTGAC ACAACTCAAC CGCCAGTTCC CGACCATTAG 
023311 CCTGTTAGAT ATTGGCGCGA TTTTAAAACA GGTCGGTCAG GTGCTGGAGC AGGTAAGTCG GGCGCTGGAA 
023381 GTGATGGTGG TACTGGTCAC CGCCTGCGGT ATGTTGCTGT TGCTGGCACA GGTGCAGGTG GGAATGCGTC 
023451 AGCGTCATCA GGAGCTGGTG GTGTGGCGCA CACTCGGTGC GGGGAAAAAA CTGCTGCGTA CCACGTTGTG 
023521 GTGTGAGTTC GCCATGCTTG GGTTTGTTTC CGGCCTGGTG GCCGCAATTG GTGCGGAAAC GGCGCTGGCA 
023591 GTGTTGCAGG CGAAAGTGTT TGATTTTCCG TGGGAGCCAG ACTGGCGATT GTGGATTGTT CTGCCGTGCA 
023661 GCGGAGCGCT GCTGCTGTCG CTTTTCGGCG GCTGGCTGGG TGCGCGACTG GTTAAGGGTA AGGCGCTGTT 
023731 CAGGCAGTTT GCGGGGTGAT GAGAGTAAAT AAGGGGCGTT CTGGTTGAAT GGAACGCCTT GTTTAAATTA 
023801 ATTCTACAAT ATGTTTCATT GATGATGTTA TTGAATTGGT GATTTCCTAT CTTTCTATTG CTGATATTAA 
023871 TCTGAATCGG TGGAGTTTAT TGATTTTAAA TATAGCCCTA CAAAAATAAC TCAGACTAAT AAAATCATAA 
023941 ATCATATGCG TTGAATGGAT ATTATCCATA TAGTGAATTT GTTGATGATG AATTCATCTG TGCTAAAAAT 
024011 GTTAGTTTAA TAAAATATTG AAAGTGACCT GTAATAACAG TTGTTGTTGA TTGAGAACAA ATAAGTTTAT 
024081 GTGAAAAATA TATAAATACA TTAGCTGGTC TTGTGTGTCA TTTTATTTTT TTTTGTTGCT AACACAGGGA 
024151 TATGAACAAT AACTAAAAGG GCACTTTATA TGAGCGGAAA ACCAGCGGCG CGTCAGGGAG ATATGACTCA 
024221 GTATGGCGGT CCCATTGTCC AGGGTTCGGC AGGTGTAAGA ATTGGCGCGC CCACCGGCGT GGCGTGCTCG 
024291 GTGTGTCCGG GCGGGATGAC TTCGGGCAAC CCGGTAAATC CGCTGCTGGG GGCGAAGGTG CTGCCCGGCG 
024361 AGACGGACCT TGCGCTGCCC GGCCCGCTGC CGTTCATTCT CTCCCGCACC TACAGCAGCT ACCGGACGAA 
024431 GACGCCTGCA CCGGTGGGCG TTTTCGGCCC CGGCTGGAAA GCGCCTTCTG ATATCCGCTT ACAGCTACGT 
024501 GATGACGGAC TGATACTCAA CGACAACGGC GGGCGGAGCA TTCACTTTGA GCCGCTGCTG CCGGGGGAGG 
024571 CGGTGTACAG CCGCAGTGAG TCAATGTGGC TGGTGCGCGG TGGTAAGGCA GCACAGCCGG ACGGCCATAC 
024641 GCTGGCGCGG CTGTGGGGGG CGCTGCCGCC GGATATCCGG TTAAGCCCGC ATCTTTACCT GGCGACCAAC 
024711 AGCGCACAGG GGCCGTGGTG GATACTGGGG TGGTCTGAGC GGGTGCCGGG TGCTGAGGAC GTACTGCCAG 
024781 CGCCGCTGCC GCCGTACCGG GTGCTTACCG GGATGGCGGA CCGCTTCGGG CGGACGCTGA CGTACCGGCG 
024851 TGAGGCCGCC GGTGACCTGG CCGGGGAAAT CACCGGCGTG ACGGACGGTG CCGGGCGGGA GTTCCGTCTG 
024921 GTGCTGACCA CGCAGGCGCA GCGTGCGGAA GAGGCCCGCA CCTCTTCGCT ATCTTCTTCT GACAGTTCCC 
024991 GCCCTCTCTC AGCCTCAGCG TTCCCCGACA CACTGCCCGG TACCGAATAC GGCCCCGACA GGGGTATCCG 
025061 CCTTTCGGCG GTGTGGCTGA TGCACGACCC GGCATACCCG GAGAGCCTGC CCGCTGCGCC ACTGGTGCGG 
025131 TACACGTATA CGGAAGCCGG TGAACTGCTG GCGGTATATG ACCGCAGCAA TACGCAGGTG CGCGCTTTCA 
025201 CGTATGACGC GCAGCACCCG GGCCGGATGG TGGCGCACCG TTACGCGGGA AGGCCGGAGA TGCGCTACCG 
025271 CTACGACGAT ACGGGGCGGG TGGTGGAGCA ACTGAACCCG GCAGGGTTAA GCTACCGCTA TCTTTATGAG 
025341 CAGGACCGCA TCACCGTCAC CGACAGCCTG AACCGGCGTG AGGTGCTGCA TACAGAAGGC GGGGCCGGGC 
025411 TGAAACGGGT GGTGAAAAAA GAACTGGCGG ACGGCAGCGT CACGCGCAGC GGGTATGACG CGGCAGGAAG 
025481 GCTCACGGCG CAGACGGACG CGGCGGGACG GAGGACAGAG TACGGTCTGA ATGTGGTGTC CGGCGATATC 
025551 ACGGACATCA CCACACCGGA CGGGCGGGAG ACGAAATTTT ACTATAACGA CGGGAACCAG CTGACGGCGG 
025621 TGGTGTCCCC GGACGGGCTG GAGAGCCGCC GGGAATATGA TGAACCGGGC AGGCTGGTAT CGGAGACATC 
025691 GCGCAGCGGG GAGACAGTAC GCTACCGCTA CGATGACGCG CACAGTGAGT TACCGGCGAC GACAACGGAT 
025761 GCGACGGGCA GCACCCGGCA GATGACCTGG AGCCGCTACG GGCAGTTGCT GGCGTTCACC GACTGCTCGG 
025831 GCTACCAGAC CCGTTATGAA TACGACCGCT TCGGCCAGAT GACGGCGGTC CACCGCGAGG AAGGCATCAG 
025901 CCTTTACCGC CGCTATGACA ACCGTGGCCG GTTAACCTCG GTGAAAGACG CACAGGGCCG TGAAACGCGG 
025971 TATGAATACA ACGCCGCAGG CGACCTGACT GCCGTTATCA CCCCGGACGG CAACCGGAGC GAGACACAGT 
026041 ACGATGCGTG GGGAAAGGCG GTCAGCACCA CGCAGGGCGG GCTGACGCGC AGTATGGAGT ACGATGCTGC 
026111 CGGACGTGTC ATCAGCCTGA CCAACGAGAA CGGCAGCCAC AGCGTCTTCA GTTACGATGC GCTGGACCGG 
026181 CTGGTACAGC AGGGCGGCTT TGACGGGCGG ACGCAACGTT ATCATTATGA CCTGACCGGA AAACTCACAC 
026251 AGAGTGAGGA TGAGGGACTT GTCATCCTCT GGTACTACGA TGAATCGGAC CGTATCACTC ACCGCACGGT 
026321 GAACGGCGAA CCGGCAGAGC AGTGGCAGTA TGATGGCCAC GGCTGGCTGA CAGACATCAG CCACCTGAGC 
026391 GAAGGCCACC GTGTTGCCGT CCACTATGGC TATGACGATA AAGGCCGCCT GACCGGCGAA TGCCAGACGG 
026461 TGGAGAACCC GGAGACGGGG GAACTGCTGT GGCAGCATGA GACGAAACAC GCATACAACG AGCAGGGGCT 
026531 GGCAAACCGC GTCACGCCGG ACAGCCTGCC GCCGGTGGAG TGGCTGACGT ATGGCAGCGG TTACCTGGCG 
026601 GGAATGAAGC TGGGCGGGAC GCCGCTGGTC GAGTATACGC GGGACAGGCT GCACCGTGAG ACGGTGCGCA 
026671 GCTTCGGCAG CATGGCAGGC AGTAATGCCG CATACGAACT GACCAGCACA TACACCCCCG CAGGCCAGTT 
026741 ACAGAGCCAG CACCTGAACA GCCTGGTATA TGACCGTGAC TACGGGTGGA GTGACAACGG CGACCTGGTG 
026811 CGCATCAGCG GCCCGCGACA GACGCGGGAA TACGGCTACA GCGCCACGGG CAGGCTGGAG AGTGTGCGCA 
026881 CCCTCGCACC AGACCTGGAC ATCCGCATCC CGTATGCCAC GGACCCGGCG GGCAACCGGC TGCCGGACCC 
026951 GGAGCTGCAC CCGGACAGTA CACTCACAGT GTGGCCGGAT AACCGCATCG CGGAGGATGC GCACTATGTC 
027021 TACCGCCACG ATGAATACGG CAGGCTGACG GAGAAGACGG ACCGCATCCC GGCGGGTGTG ATACGGACGG 
027091 ACGACGAGCG GACCCACCAC TACCACTACG ACAGCCAGCA CCGCCTGGTG TTCTACACGC GGATACAGCA 
027161 TGGCGAGCCA CTGGTCGAGA GCCGCTACCT CTACGACCCG CTGGGACGGC GAATGGCAAA ACGGGTCTGG 
027231 CGGCGGGAGC GTGACCTGAC GGGGTGGATG TCGCTGTCGC GTAAACCGGA GGTGACGTGG TATGGCTGGG 
027301 ACGGAGACAG GCTGACGACG GTGCAGACTG ACACCACACG TATCCAGACG GTATACGAGC CGGGAAGCTT 
027371 CACGCCGCTC ATCCGGGTCG AGACAGAGAA CGGCGAGCGG GAAAAAGCGC AGCGGCGCAG CCTGGCAGAG 
027441 ACGCTCCAGC AGGAAGGGAG TGAGAACGGC CACGGCGTGG TGTTCCCGGC TGAACTGGTG CGGCTGCTGG 
027511 ACAGGCTGGA GGAAGAAATC CGGGCAGACC GCGTGAGCAG TGAAAGCCGG GCGTGGCTTG CGCAGTGCGG 
027581 GCTGACGGTG GAGCAACTGG CCAGACAGGT GGAGCCGGAA TACACACCGG CGCGAAAAGC TCATCTTTAT 
027651 CACTGCGACC ACCGGGGACT GCCGCTGGCG CTTATCAGCG AAGACGGCAA TACGGCGTGG AGCGCGGAAT 
027721 ATGATGAATG GGGCAACCAG CTTAATGAGG AGAACCCGCA TCATGTGTAT CAGCCGTACC GTCTGCCAGG 
027791 GCAGCAGCAT GATGAGGAAT CAGGGCTGTA CTATAACCGT CACCGGTACT ACGATCCGTT GCAGGGGCGG 
027861 TATATTACTC AGGACCCGAT GGGGTTGAAA GGGGGATGGA ATTTATATCA GTATCCTTTA AATCCACTAC 
027931 AACAAATTGA CCCTATGGGA TTATTGCAGA CTTGGGATGA TGCCAGATCT GGAGCATGTA CGGGGGGAGT 
028001 TTGTGGTGTT CTTTCACGTA TAATAGGACC AAGTAAATTT GATAGTACTG CAGATGCTGC GTTAGATGCT 
028071 TTGAAAGAAA CGCAGAATAG ATCTCTATGT AATGATATGG AATACTCTGG TATTGTCTGT AAAGATACTA 
028141 ATGGAAAATA TTTTGCATCT AAGGCAGAAA CTGATAATTT AAGAAAGGAG TCATATCCTC TGAAAAGAAA 
028211 ATGTCCCACA GGTACAGATA GAGTTGCTGC TTATCATACT CACGGTGCAG ATAGTCATGG CGATTATGTT 
028281 GATGAATTTT TTTCAAGTAG CGATAAAAAT CTTGTAAGAA GTAAAGATAA TAATCTTGAA GCATTTTATC 
028351 TCGCAACACC TGATGGACGA TTTGAGGCGC TTAATAATAA AGGAGAATAT ATTTTTATCA GAAATAGTGT 
028421 CCCGGGATTG AGTTCAGTAT GCATACCGTA TCATGATTAA TTTTAGTGCT TTTATTAGTG GGGCCTATAA 
028491 GGAGATTCAA TGAAATATAG TTCAATATTT TCGATGCTTT CATTTTTTAT ACTATTTGCC TGTAATGAGA 
028561 CAGCTGTTTA CGGTTCTGAT GAAAACATTA TTTTTATGAG GTATGTGGAA AAATTACATT TAGATAAATA 
028631 CTCTGTTAAA AATACGGTAA AAACTGAAAC AATGGCGATA CAATTAGCTG AAATATATGT TAGGTATCGC 
028701 TATGGCGAAC GGATTGCAGA AGAAGAAAAA CCATATTTAA TTACGGAACT ACCAGATAGT TGGGTTGTTG 
028771 AGGGAGCAAA GTTACCTTAT GAAGTTGCGG GTGGTGTATT TATTATAGAA ATTAATAAGA AAAATGGATG 
028841 TGTTTTGAAT TTCCTACATA GTAAATAATG CTGGCGCTGA TGGATGCGGA TGGAAACATT GCGTGGAGCG 
028911 GGGAGTATGA TGAGTGGGGC AACCAGCTGA ATGAAGAGAA CCCGCATCAC CTGCACCAGC CGTACCGGCT 
028981 GCCGGGGCAG CAGTATGATA AGGAGTCGGG GCTGTACTAC AACCGGAACC GGTACTACGA TCCGTTGCAG 
029051 GGGCGGTATA TCACTCAGGA CCCGATAGGG CTGGAGGGGG GATGGAGTCT GTATGCGTAT CCGCTGAATC 
029121 CGGTGAATGG TATTGATCCA TTAGGGTTAA GTCCCGCAGA TGTAGCGCTA ATAAGAAGAA AAGATCAACT 
029191 AAACCATCAA AGAGCATGGG ATATATTATC TGATACTTAT GAAGATATGA AGAGATTAAA TTTAGGTGGG 
029261 ACTGATCAAT TTTTCCATTG TATGGCATTT TGTCGAGTGT CTAAATTAAA TGACGCTGGT GTTAGCCGAT 
029331 CGGCGAAAGG GCTGGGTTAT GAAAAAGAGA TTAGAGATTA CGGGTTAAAT CTGTTCGGTA TGTACGGCAG 
029401 AAAAGTAAAG CTATCCCATT CTGAAATGAT TGAAGATAAT AAAAAAGACT TGGCTGTAAA TGACCATGGG 
029471 TTGACATGTC CATCAACAAC AGATTGCTCA GATAGATGTA GTGATTATAT TAATCCAGAG CATAAAAAAA 
029541 CGATAAAGGC TTTACAAGAT GCTGGCTATC TCAAGTAATC TATCAAAGAT GATAATATTT ATTTTTGCTA 
029611 TTATAATCAT TGTTGTTTTA TGCGTAATTA CTTATCTTTA TTTATACAAA GATGAATCTC TTGTAAGTAA 
029681 ACATTACATA AACTATATGG CAATACCAGA AAATGATGGA GTTTTTACAT GGCTCCCAGA TTTTTTTCCG 
029751 CACGTAGCGG TGGATATATC AATATACACA AATGTAGAAG ATGATTATTT TTTTCTTATT TTTCCCTAAC 
029821 AAATGATGAT GGGGGTAGGT TTAAGAAAAC ATTGACAGTG AGGGCCAGGG AACAAGTGGC GAAAATCGTA 
029891 TCAAAGAATG ATCCAGATAC AAAAAAAGTG TGGTGTAAAT ATGGTAAGAT ACCAGGGCAA GGGGATGGTG 
029961 TAAACCTTTT TTTTGTTGGT GAAATTAATG TTACGCATTA TTTTATAACA AATATTGGAG CTGGATTGCC 
030031 TGATGCTTGT GCAGAGTAAT TGCTTGAATT AAGAGTCTAT CCCATATCGA AGTCGTCAAC TTCGTAGTGA 
030101 GGAAAAGTAA AATTCCTGAC TGAGAAAAGA CATGTCGGCT ATTGTGTAAA GCCATATAGC TCAGACGATG 
030171 AATATCTACT CGTATTCAGT TGTTTATTGA GGGTGAGTTC CGACCCTGAA ACAACAAATA AAATGAACAG 
030241 TCAGAGAGTT TACATAGAAT TGCACTGGTC TTTTACGATA TCTGACATTG TGTAATACAT ATTCAGCCAT 
030311 GCATTAATTA AAATGTTACG TGTTTAATGT GAGTCCCTAT CTGAAAATAA ATAATCCTTC CGGATTAAAA 
030381 TAAATTCTTG CCGGGAAAGA AAGAGGAAAT AAACCATTAG CGGAAAACCA GCGGCACGCC AGGGTGACAT 
030451 GCCCCAGTAC GGCGGCCCGA TAGTCCAGGG TTCAGCGGGG GTACTGATAG TCGCGCCGAC TGCATCGAGA 
030521 ACTCCATACA ACTTTTTACG GAACGTCACC TGATAAAATT TGTTCAGTAT CGTCTTTTGA GATTCTCAAG 
030591 GTTATGGAGT AACCAGACAG AACGGACACC ACTGTCGGAG ATAAAAACCC CCTGTTTACG CAGCTCGTTG 
030661 CTGGCCCGGT GCTGACCATG TGTCGGGAAA GCGACGGCGT AATCAACAAC AGCCTGTTCA GTTGCCTCAT 
030731 CGGTACGGTT CTTAAGGTTA GGAGCGCGGC GACTACGATT AATCTGCGCA TCCACACCGC CTTCAGCGAC 
030801 CAGTTCGCGG TAACGATAAA ACGTATCACG CGAAACGCCC ATGATTTTAC AGGCTTTTGA TACGTTGCTG 
030871 AGTTCTTCAG CCAGATTGAG CAAACCGGCT TTGTGTTTGA TGACGGGATT GGCAGTATGA AGCATGAGAG 
030941 TTACCTCTTG TTTTGGATAA GGATTCGACA CTCATATCAA AACCGGTAAC TCTCAACCTT TCAAGGCCAT 
031011 GTGTCAGATC AAGTCGCGAC TAATACAAAT ACGTCCCTCA TTACCGCGCC TTAACCCATT CCGCCACTTC 
031081 CGCCCACTCA CCGCGAAAGA CAACTTTTTC CGCTTTTTTC TCAAGCTGAT AGCGATACAT CGGGTCGTAA 
031151 TATTCTTCAA GTAACGGCAC CAGCCAGGCC AGATGACCGT CGGTGCTGCC GGTGGTGAGT TGCGTTGTCA 
031221 GTGCTGCATC CAGCCTTGCA GCCAGTTCGT TATAGCGCTG TAGCCCCAGC CGACGCTTAA TCGCCGAAAG 
031291 TCCGTGATGC AGGTATTCGC AATACTCCTG CCAGCCCTGT TCGTCGCCGT ACGCGTGGGT AAAATCATGA 
031361 TGCATACGCA AGAAATACTC TTCGTTCAGG CGCTCAAGAC GGATCTCAAA CGGATCTTCT ACCACCGCAA 
031431 TCGCCGCCTG AGTCATTCGC TCGCGCAGGC ATTCCGGCAG GTGATTCGAA CCGATCATCC GGCTTTCGTC 
031501 TTCCAGCACC CACAGGCGCA AATTCTGACG GGCGTCGGTT TTTAGCATTT CGGCAGCCAG CAGGTTTTCA 
031571 AAACTCGCCT GGCTAAGTTG TGGTTGTAAC GTGCGACCAA ACGCCGAACC GCGATGACGC GCCAACCCTT 
031641 CCAGATCAAC ACCGTTCGGC TGTTGCTGCA CTAACAGCGT TTTACCGCTG CCGGTACAAC CGCCAATCAG 
031711 CACTATCGGT TTTTGTGCCA GTTCAATAGT CGCCTGAATC GCGGTCTGGC GCAGTGCCTT ATAACCGCCT 
031781 TCCACCAGCG GATAATCAAT CCCCGCTGCA TGCAACCAGC TTTGCACAAT ATGTGAGCGC TGACCGCCAC 
031851 GGGCGCAGCA GAGAATACCT TGCGGATTTT GCAGGCACGC TGCCCGCCAG GCGTCCATGC GCTGCTGACG 
031921 AATTTCACCC GCCACCAGTT TATGTCCCAG CGCCAGCGCT GCGTCTGAGC CTTGCTGTTT ATAGCAGGTG 
031991 CCAACGGCGG CGCGTTCATC GTTATTCATT AACGGCAGAT TGATAGCGGC GGGCATTGCG CCGTGCTCAA 
032061 ACTCGATAGG GGCGCGAACA TCAATAATGG GCGTATCAGC AATCAGCAGG GCACGATAGT CCTGTTCCGT 
032131 GTGTCTCTCT TGCATAGTTA AAAGTGAACC TCAAATCAGC TTGCGCGCTA TTTTACGCGC CAACGCGCAA 
032201 GGAAACTTGA TTTTTAACTG CGTGGGTTGC CGAAAATTTC TAAAAATCCG CTGATTTCCG GCCTGCGCTG 
032271 GGTAAACAAG GTCACAATAT CTTCTACCGC TTTGCCGCTG CCAAATTTGC GCCATGCCAG ACTCAATGGC 
032341 GAAGGAGGGC GCATCGTTGG GATTACCCGG CTGACCAGTT GTTGATTATC GATCATTGAC TGGCAAAGCG 
032411 ATTTTGGCAA AAAACCAATG CCAACGCCCG CCAGATGGGC GGCGATTTTC GTTTCCATAT CGGGAACAAT 
032481 AATCTCTTTT TGCCCTGGCA ATCGCCAGGC GACGCGTTTG GTTAAGGTGC GGGCGCTGTC TTCAATATTG 
032551 ACCGCCGGAA AGCGCCGCAA CTGCGCTTCT GTTAGCGGCT CTTCAACGTT CGCCAGCGGA TGATCCGCCG 
032621 CCATGACAAA GCGCCATTGC ACCGATCCTA AGGGATCAAG ACTAAAGGTA TTTGCCAGCG CCTCAGTTCC 
032691 CGTGACGCCG ATAGCCAGCG AAAAACCTTC GTACAATAGC GAGTCCCAGA CGCCCATATA GATTTGTCGG 
032761 GAGATGTGAA ACTGGGTAAA GGGGTAACGC TCATTCAGCC ACGCCAGCAA CTGGGCGACG GCCTGGGGGT 
032831 TGTAGAGCAG GTTGTTGATG ACAATATTCA CCTGGCGTTC CACGCCATCA TTCACCTGTT GCAGCTCGCT 
032901 TGGCATACTT TCCAGCCAGC TCAGCCAGTC TCTGGCCTGG GAAAGTAGAT GCTCGCCAGC CGCTGTCAAC 
032971 GTCACGCTGC GAGTCGTACG GAAAAACAGC GCTACTCCGG TATTCTCTTC CAGAAGTTTA ATGCGATAAC 
033041 TGATCGTCGC CGTGGTTTTA CATAATCGTT CTGCCGCTTT TGAAAAACTT CCTGTTTCAG CAACCGCAAT 
033111 GAAAGTCCGC AAGGTTTCTG GATCGAACAT CTTCAGGTAT CCCCTTTTAA ATCCGCAAGT TGCGTGATTT 
033181 TCTTATCCTC TGATTTATCA GTATTTTTAC ATGATAACCC TGTTCAATTT GTGGACTAAA TCTAGTTTTG 
033251 GAAAAATATT CCAACTTTTG TATTGATGTT GTTCTCTTAA GGTTTTAGAT TGCCTGTTAT TGAAACCAAG 
033321 CTGACCGGTC GGCGGTGGTT GAACGGAATT ATGTTACAAG GACAAAAAGA TGAAACTTCA GGTATTACCG 
033391 TTAAGTCAGG AAGCCTTTAG TGCTTATGGC GACGTAATCG AAACGCAGCA ACGGGATTTT TTCCATATTA 
033461 ACAATGGCCT GGTGGAGCGT TACCACGATT TGGCGCTGGT TGAGATTCTT GAGCAAGACT GTACGCTTAT 
033531 CAGCATTAAC CGCGCGCAAC CGGCGAATCT GCCGCTGACC ATTCACGAAC TCGAACGTCA TCCGCTGGGT 
033601 ACTCAGGCCT TTATCCCGAT GAAAGGTGAG GTGTTTGTGG TGGTCGTGGC GTTAGGTGAC GACAAACCAG 
033671 ACCTGTCAAC GCTGCGGGCG TTTATCACCA ACGGCGAACA GGGAGTGAAT TACCATCGTA ACGTCTGGCA 
033741 TCACCCACTT TTCGCCTGGC AGCGCGTCAC CGATTTTCTG ACCATCGATC GCGGCGGCAG TGACAACTGT 
033811 GATGTTGAAA GTATTCCTGA ACAGGAACTC TGTTTTGCGT GACGCCTGCA ACCGACTTGC ATAAGATAAA 
033881 CTAATTGTTC ATTGTTTATG CTCACTTGTA GGTCGGAGTT AACGTAGGTA TGACGGAAGT TAGACGGCGC 
033951 GGCAGGCCAG GACAGGCGGA GCCTGTGGCA CAGAAGGGCG CACAGGCGTT AGAGCGGGGA ATTGCGATTC 
034021 TGCAATATTT GGAAAAAAGT GGGGGAAGTT CGTCGGTTAG CGATATTTCT CTCAATCTGG ATTTGCCGCT 
034091 CTCCACGACC TTTCGCTTGC TGAAGGTTTT ACAGGCAGCG GATTTTGTCT ATCAGGACAG TCAATTAGGC 
034161 TGGTGGCATA TAGGATTAGG TGTCTTTAAC GTCGGTGCGG CGTACATCCA TAACCGCGAT GTCCTCTCCG 
034231 TCGCCGGGCC GTTTATGCGC CGCCTGATGT TACTTTCCGG CGAAACGGTC AATGTCGCGA TCCGTAACGG 
034301 CAATGAAGCG GTATTAATTG GTCAGTTAGA GTGTAAATCG ATGGTCAGGA TGTGTGCGCC ACTGGGCAGT 
034371 CGTCTGCCAC TGCATGCTTC CGGTGCGGGC AAAGCGCTGC TTTATCCGCT GGCGGAAGAG GAGTTGATGA 
034441 GCATCATTCT GCAAACCGGT TTGCAGCAGT TTACGCCAAC TACGCTTGTG GATATGCCCA CCTTGCTGAA 
034511 GGACCTGGAA CAAGCGCGTG AACTGGGCTA TACCGTAGAT AAAGAAGAGC ATGTTGTAGG TCTGAATTGC 
034581 ATAGCTTCAG CAATTTACGA TGATGTCGGT AGTGTTGTTG CCGCTATCTC CATCTCCGGG CCTTCATCAA 
034651 GACTGACAGA AGATCGTTTT GTCAGTCAGG GTGAGCTGGT CAGAGACACC GCCCGCGATA TCAGCACGGC 
034721 GTTGGGACTG AAAGCACATC CATAATGTCT GTCGCATCCC GCTCTGCGGA GCGGGTTTTT TTGACAAAAT 
034791 TTGAAAGTTG GAAAAATTTT CCAATAAATA GAGGTAGGAA TAAAATGGCA AAAATGAGAG CCGTTGACGC 
034861 GGCAATGTAT GTGCTGGAGA AAGAAGGTAT CACTACCGCC TTCGGTGTTC CGGGAGCTGC AATCAATCCG 
034931 TTCTACTCAG CGATGCGTAA GCACGGCGGT ATTCGTCACA TTCTGGCGCG TCATGTGGAA GGTGCTTCGC 
035001 ACATGGCGGA AGGTTATACC CGCGCAACGG CAGGGAATAT CGGCGTATGT CTGGGGACTT CCGGTCCTGC 
035071 GGGCACGGAC ATGATCACCG CGCTCTATTC CGCTTCTGCT GATTCCATTC CTATTCTGTG CATTACCGGC 
035141 CAGGCACCGC GCGCCCGTCT GCATAAAGAA GATTTTCAGG CCGTAGATAT TGAAGCAATT GCTAAACCGG 
035211 TCAGCAAAAT GGCGGTTACA GTTCGTGAAG CGGCGCTGGT GCCTCGCGTG CTGCAACAGG CATTTCACCT 
035281 GATGCGTTCT GGTCGTCCGG GTCCGGTACT GGTGGATTTA CCGTTCGACG TTCAGGTTGC GGAAATCGAG 
035351 TTTGATCCTG ACATGTACGA ACCGCTGCCG GTCTACAAAC CTGCTGCCAG CCGTATGCAG ATCGAAAAAG 
035421 CTGTAGAAAT GTTAATCCAG GCCGAACGTC CGGTGATTGT TGCCGGGGGC GGGGTAATTA ATGCTGACGC 
035491 AGCTGCACTG TTACAACAGT TTGCTGAACT GACCAGCGTT CCGGTGATCC CAACGCTAAT GGGCTGGGGC 
035561 TGTATCCCGG ACGATCATGA ACTGATGGCC GGGATGGTGG GTCTGCAAAC CGCGCATCGT TACGGTAACG 
035631 CAACGCTGCT GGCGTCTGAC ATGGTGTTTG GTATCGGTAA CCGTTTTGCT AACCGTCATA CCGGCTCGGT 
035701 AGAGAAATAC ACCGAAGGGC GCAAAATCGT TCATATTGAT ATTGAGCCGA CGCAAATTGG TCGCGTGCTG 
035771 TGTCCGGATC TCGGTATTGT CTCTGATGCT AAAGCGGCGC TGACACTGCT GGTTGAAGTG GCGCAGGAGA 
035841 TGCAAAAAGC GGGTCGTCTG CCGTGTCGTA AAGAATGGGT CGCCGACTGC CAGCAGCGTA AACGCACTTT 
035911 GCTGCGCAAA ACCCACTTCG ACAACGTGCC GGTGAAACCG CAGCGCGTGT ATGAAGAGAT GAACAAAGCC 
035981 TTTGGTCGCG ATGTTTGTTA TGTCACCACC ATTGGTCTGT CACAAATCGC TGCGGCACAA ATGCTGCATG 
036051 TCTTTAAAGA CCGCCACTGG ATCAACTGTG GTCAGGCTGG TCCGTTAGGC TGGACGATTC CGGCTGCGCT 
036121 AGGGGTTTGT GCCGCTGATC CGAAACGCAA TGTGGTGGCG ATTTCTGGCG ACTTTGACTT CCAGTTCCTG 
036191 ATTGAAGAGT TAGCTGTTGG CGCGCAGTTC AACATTCCGT ACATCCATGT GCTGGTCAAC AACGCTTATC 
036261 TGGGGCTGAT TCGTCAGTCA CAACGCGCTT TTGACATGGA CTACTGCGTG CAACTCGCTT TCGAGAATAT 
036331 CAACTCCAGT GAAGTGAATG GCTACGGTGT TGACCACGTA AAAGTAGCGG AAGGTTTAGG TTGTAAAGCT 
036401 ATTCGGGTCT TCAAACCGGA AGATATTGCG CCAGCCTTTG AACAGGCGAA AGCCTTAATG GCGCAATATC 
036471 GGGTACCGGT AGTCGTGGAA GTTATTCTCG AGCGTGTGAC CAATATTTCG ATGGGCAGCG AACTGGATAA 
036541 CGTCATGGAA TTTGAAGATA TCGCCGATAA CGCAGCGGAC GCACCGACTG AAACCTGCTT CATGCACTAT 
036611 GAATAAGGGA GATAAATAAT GTTACGTTTC TCTGCTAATT TATCGATGTT ATTTGGAGAA TATGATTTTC 
036681 TCGCCCGTTT TGAGAAAGCT GCGCAGTGTG GTTTTCGCGG CGTTGAATTT ATGTTTCCTT ATGACTACGA 
036751 CATTGAAGAA TTAAAACATG TGCTGGCGAG TAATAAACTC GAACATACGC TGCACAATTT ACCGGCGGGT 
036821 GACTGGGCGG CGGGGGAGCG CGGTATTGCC TGTATTCCTG GCCGTGAAGA AGAGTTTCGG GATGGCGTAG 
036891 CAGCAGCGAT TCGTTATGCC CGTGCGCTGG GTAATAAAAA AATTAACTGT CTGGTCGGTA AAACGCCGGC 
036961 TGGTTTCAGC AGTGAACAGA TTCACGCAAC GCTTGTAGAA AACCTGCGTT ATGCCGCGAA TATGCTGATG 
037031 AAAGAAGATA TTTTATTACT GATTGAACCT ATTAACCATT TTGATATTCC TGGTTTCCAT CTCACCGGAA 
037101 CTCGGCAGGC GCTGAAATTG ATTGATGATG TTGGTTGCTG CAATTTGAAA ATTCAGTATG ACATTTATCA 
037171 TATGCAGCGG ATGGAAGGTG AATTAACCAA CACCATGACT CAGTGGGCTG ATAAAATTGG TCACCTGCAA 
037241 ATTGCCGATA ATCCGCATCG CGGCGAACCG GGAACCGGAG AAATTAATTA TGATTATCTC TTTAAGGTAA 
037311 TCGAAAATTC TGACTACAAC GGTTGGGTTG GGTGTGAATA TAAACCCCAA ACCACCACGG AAGCCGGTTT 
037381 ACGCTGGATG GATCCGTACC GTTAAAACGT AACGCTATTC AGACAATGCT TTTTTAGGCC GCTAAGTTGG 
037451 CAGGGGATCG TGTTGTCTGA ATTCAGGAAA AGCGAAATTT AAAAGAGGTT AATTATGAAA CTGGGATTTA 
037521 TTGGCTTAGG CATTATGGGT ACACCGATGG CCATTAATCT GGCGCGTGCC GGTCATCAAT TACATGTCAC 
037591 GACCATTGGA CCGGTTGCTG ATGAATTACT GTCACTGGGT GCCGTCAGTG TTGAAACTGC TCGCCAGGTA 
037661 ACGGAAGCAT CGGACATCAT TTTTATTATG GTGCCGGACA CACCTCAGGT TGAAGAAGTT CTGTTCGGTG 
037731 AAAATGGTTG TACCAAAGCC TCGCTGAAGG GCAAAACCAT TGTTGATATG AGCTCCATTT CCCCGATTGA 
037801 AACTAAGCGT TTCGCTCGTC AGGTGAATGA ACTGGGCGGC GATTATCTCG ATGCGCCAGT CTCCGGCGGT 
037871 GAAATCGGTG CGCGTGAAGG GACGTTGTCG ATTATGGTTG GCGGTGATGA AGCGGTATTT GAACGTGTTA 
037941 AACCGCTGTT TGAACTGCTC GGTAAAAATA TCACCCTCGT GGGCGGTAAC GGCGATGGTC AAACCTGCAA 
038011 AGTGGCAAAT CAGATTATCG TGGCGCTCAA TATTGAAGCG GTTTCTGAAG CCCTGCTATT TGCTTCAAAA 
038081 GCCGGTGCGG ACCCGGTACG TGTGCGCCAG GCGCTGATGG GCGGCTTTGC TTCCTCACGT ATTCTGGAAG 
038151 TTCATGGCGA GCGTATGATT AAACGCACCT TTAATCCGGG CTTCAAAATC GCTCTGCACC AGAAAGATCT 
038221 CAACCTGGCA CTGCAAAGTG CGAAAGCACT TGCGCTGAAC CTGCCAAACA CTGCGACCTG CCAGGAGTTA 
038291 TTTAATACCT GTGCGGCAAA CGGTGGCAGC CAGTTGGATC ACTCTGCGTT AGTGCAGGCG CTGGAATTAA 
038361 TGGCTAACCA TAAACTGGCC TGATACCCGC AATAAAAATG GCCGATATCA GAAAATGAAT CGGCCAGCAA 
038431 TATTAAAAAA GAAAGCAGCC AAAGATGTTG CTTCAGTATT AAAAATAATA TTTTTATTTT ATTTGTTCCT 
038501 CATAGCTAGA TTAAAACAAC GTTATTCGAT ACGTGAAATT AAGAGGGATT TATGGAACAT CAGAGAAAAC 
038571 TATTCCAGCA ACGCGGCTAT AGCGAAGATC TATTGCCGAA AACGCAAAGC CAGCGGACCT GGAAAACATT 
038641 TAACTATTTT ACCTTATGGA TGGGTTCGGT TCATAACGTT CCCAATTATG TGATGGTCGG CGGCTTTTTT 
038711 ATTCTCGGCT TGTCTACCTT TAGTATTATG CTGGCAATTA TCCTCAGCGC CTTTTTCATT GCCGCGGTAA 
038781 TGGTATTAAA CGGTGCTGCG GGCAGTAAAT ACGGTGTGCC TTTTGCCATG ATCCTGCGTG CTTCTTACGG 
038851 TGTACGTGGT GCACTGTTTC CCGGATTATT AAGGGGCGGA ATTGCCGCCA TCATGTGGTT TGGTTTGCAA 
038921 TGTTACGCGG GGTCACTGGC CTGCTTGATT CTGATTGGCA AAATCTGGCC GGGATTTTTA ACTCTCGGTG 
038991 GTGATTTCAC TCTGTTAGGC CTTTCTCTAC CGGGCTTAAT TACTTTCTTA ATCTTCTGGC TGGTCAACGT 
039061 TGGTATAGGT TTTGGCGGTG GCAAAGTTTT AAATAAATTC ACTGCCATTC TTAACCCGTG CATCTATATC 
039131 GTTTTCGGCG GTATGGCGAT TTGGGCGATT TCACTGGTCG GGATCGGTCC AATCTTTGAC TACATTCCGA 
039201 GCGGTATTCA GAAAGCAGAA AACGGTGGCT TCCTGTTCCT GGTGGTGATT AACGCGGTAG TTGCGGTCTG 
039271 GGCGGCACCG GCGGTGAGCG CATCCGACTT TACGCAAAAC GCCCACTCGT TTCGTGAGCA GGCGCTGGGG 
039341 CAAACGCTGG GTTTAGTTGT GGCCTATATT CTGTTTGCGG TCGCCGGGGT ATGTATTATT GCCGGAGCCA 
039411 GTATTCACTA CGGCGCTGAT ACCTGGAACG TGCTGGATAT TGTTCAGCGT TGGGACAGCC TGTTCGCCTC 
039481 GTTCTTTGCG GTACTGGTTA TTCTGATGAC AACTATCTCC ACTAACGCGA CCGGTAATAT TATTCCAGCC 
039551 GGTTATCAGA TTGCCGCCAT TGCACCGACA AAACTGACCT ATAAAAACGG CGTACTGATT GCCAGTATTA 
039621 TCAGCTTGCT GATCTGCCCG TGGAAATTAA TGGAAAATCA GGACAGCATT TATCTTTTCC TCGATATTAT 
039691 CGGCGGAATG CTTGGTCCGG TAATTGGTGT CATGATGGCG CATTATTTTG TGGTGATGCG CGGACAAATT 
039761 AATCTTGATG AACTGTATAC CGCACCTGGC GATTATAAAT ATTACGATAA CGGTTTTAAC CTCACTGCGT 
039831 TTTCAGTAAC TCTGGTGGCC GTTATTTTAT CTCTTGGCGG TAAGTTTATT CACTTTATGG AACCGTTATC 
039901 GCGTGTTTCA TGGTTTGTCG GCGTCATCGT CGCCTTTGCG GCCTACGCCT TATTAAAGAA ACGTACAACA 
039971 GCAGAAAAAA CAGGAGAGCA AAAAACCATA GGTTAATTAA TCCCGATATT GAACATTGAG TTAAAAACCA 
040041 ATCTGTATTT TACAAGGAGT TTGTTATGTC TTTTGATTTA ATCATTAAAA ACGGCACCGT TATTTTAGAA 
040111 AACGAAGCTC GCGTTGTAGA TATCGCCGTT AAAGGCGGAA AAATTGCTGC TATCGGTCAG GATCTGGGCG 
040181 ATGCAAAAGA AGTTATGGAT GCGTCTGGTC TGGTGGTTTC GCCGGGCATG GTTGATGCGC ACACCCATAT 
040251 TTCTGAACCG GGTCGTAGCC ACTGGGAAGG TTATGAAACC GGTACTCGCG CAGCGGCAAA AGGTGGTATC 
040321 ACCACCATGA TCGAAATGCC GCTCAACCAG CTGCCTGCAA CGGTTGACCG CGCTTCAATT GAACTGAAGT 
040391 TCGATGCCGC TAAAGGCAAG CTGACTATTG ATGCGGCACA ACTCGGTGGC CTGGTGTCTT ACAACATCGA 
040461 CCGTCTGCAT GAGCTGGATG AAGTGGGCGT TGTCGGCTTC AAATGCTTCG TTGCGACCTG TGGCGATCGC 
040531 GGTATCGACA ACGACTTCCG TGATGTAAAC GACTGGCAGT TCTTCAAAGG TGCGCAGAAG CTGGGCGAAC 
040601 TGGGTCAGCC GGTGCTGGTG CACTGCGAAA ACGCGCTGAT TTGTGACGAA CTGGGCGAAG AAGCGAAGCG 
040671 TGAAGGTCGC GTAACCGCTC ATGACTATGT GGCTTCGCGT CCGGTATTTA CCGAAGTGGA AGCAATTCGC 
040741 CGCGTACTGT ATCTGGCGAA AGTTGCTGGT TGCCGTCTGC ACGTTTGCCA CGTCAGCAGC CCGGAAGGTG 
040811 TTGAGGAAGT GACTCGTGCA CGTCAGGAAG GTCAGGACGT TACTTGTGAA TCCTGCCCGC ATTACTTTGT 
040881 ACTGGATACC GATCAGTTCG AAGAAATCGG TACTCTGGCG AAGTGTTCAC CGCCGATCCG CGATCTGGAA 
040951 AACCAGAAAG GCATGTGGGA AAAACTGTTT AACGGTGAAA TCGACTGCCT GGTTTCCGAC CACTCTCCAT 
041021 GCCCGCCGGA AATGAAAGCC GGTAACATCA TGAAAGCATG GGGCGGTATC GCCGGTCTGC AAAGCTGCAT 
041091 GGACGTGATG TTCGATGAAG CGGTACAGAA ACGCGGTATG TCTCTGCCAA TGTTCGGCAA ATTAATGGCG 
041161 ACTAACGCAG CAGATATTTT CGGTCTGCAG CAAAAAGGCC GTATCGCCCC AGGAAAAGAT GCCGACTTCG 
041231 TCTTCATTCA GCCGAATAGC AGCTATGTTC TTACCAATGA CGATCTGGAA TATCGCCACA AAGTCAGCCC 
041301 GTATGTTGGC CGTACCATTG GCGCGCGTAT CACGAAAACC ATCTTACGTG GTGATGTGAT TTACGACATT 
041371 GAACAGGGCT TCCCTGTTGC GCCGAAAGGT CAATTTATCC TTAAACATCA GCAGTAATCT GGCCCCTGCA 
041441 ATGCCCGTCC TTGCGGCGGG CATTCTCCGG TTAAGGTGTG TTTATGTTCA ATTTTGCAGT CAGCCGCGAA 
041511 AGCCTGTTAT CAGGATTTCA GTGGTTTTTC TTTATTTTTT GCAACACGGT TGTGGTTCCT CCTACGCTAC 
041581 TTTCTGCTTT TCAGTTGCCG CAAAGTAGCC TGCTTACGCT CACGCAATAT GCTTTTCTTG CTACCGCACT 
041651 GGCCTGCTTC GCTCAGGCGT TTTGCGGTCA TCGTCGCGCT ATTATGGAAG GGCCAGGTGG CCTGTGGTGG 
041721 GGAACCATCC TTACTATCAC CCTTGGTGAA GCATCGCGCG GGACACCGAT CAACGATATC GCCACCAGCC 
041791 TGGCAGTGGG GATTGCACTC TCCGGCGTGC TGACGATGTT GATTGGTTTT AGCGGATTAG GCCATCGCCT 
041861 GGCACGGTTA TTTACGCCGT CGGTGATGGT CTTGTTTATG TTGATGCTGG GCGCGCAGCT GACCACTATC 
041931 TTTTTCAAAG GTATGCTCGG GCTGCCGTTT GGCATAGCCG ACCCGAATTT TAAAATTCAG TTACCGCCGT 
042001 TCGCGCTCTC GGTGGCGGTG ATGTGCCTGG TACTGGCGAT GATTATCTTC CTGCCGCAAC GTTTTGCCCG 
042071 TTATGGCCTG CTGGTCGGCA CCATAACCGG CTGGTTGTTG TGGTACTTTT GCTTTCCTTC TTCGCACTCG 
042141 CTCTCCGGTG AGTTGCACTG GCAGTGGTTC CCGCTCGGCA GTGGCGGTGC TTTGTCGCCG GGAATTATTC 
042211 TGACGGCGGT GATTACAGGT CTGGTAAATA TCAGCAATAC CTACGGTGCG ATTCGGGGCA CGGATGTTTT 
042281 TTATCCGCAG CAGGGCGCAG GGAATACGCG TTATCGTCGT AGCTTTGTGG CGACCGGATT TATGACGCTG 
042351 ATAACCGTAC CGCTGGCGGT AATTCCATTT TCACCGTTTG TTTCATCCAT TGGTTTATTA ACCCAGACTG 
042421 GCGATTACAC GCGGCGTTCG TTTATTTATG GCAGCGTTAT TTGCCTGCTG GTGGCGCTGG TTCCTGCACT 
042491 CACGCGACTG TTTTGCAGTA TCCCTTTACC CGTGAGTAGT GCGGTCATGC TGGTTTCTTA TCTGCCTTTA 
042561 CTCTTTTCCG CGCTGGTGTT TAGCCAGCAA ATAACGTTTA CCGCTCGCAA TATTTATCGA CTCGCATTGC 
042631 CGTTATTTGT CGGCATATTT TTAATGGCAT TACCGCCTGT GTATCTGCAA GACCTTCCAT TAACGCTTCG 
042701 TCCTCTGCTC AGTAACGGCT TATTGGTCGG GATTTTACTG GCTGTTCTTA TGGATAACCT TATTCCGTGG 
042771 GAACGCATCG AATAATTTGT TGAAAAAGGA TTGATAATGA AGATTGTCAT TGCGCCAGAC TCTTTTAAAG 
042841 AGAGCTTAAG TGCAGAAAAA TGTTGTCAGG CAATTAAAGC CGGGTTTTCG ACCCTCTTTC CCGATGCGAA 
042911 CTATATCTGT TTGCCGATAG CGGATGGCGG CGAAGGGACG GTGGATGCGA TGGTCGCCGC GACGGGCGGC 
042981 AACATCGTGA CGCTTGAAGT CTGCGGGCCG ATGGGCGAAA AAGTGAATGC TTTTTATGGC CTTACCGGCG 
043051 ACGGGAAAAC GGCGGTGATT GAGATGGCGG CAGCAAGTGG CCTGATGCTG GTCGCGCCTG AAAAGCGTAA 
043121 TCCGTTGCTG GCCTCCAGTT TTGGTACGGG GGAGTTAATT CGTCATGCGC TGGATAACGA CATTCGCCAT 
043191 ATTATTCTCG GCATTGGCGG CAGTGCGACG GTCGACGGCG GTATGGGCAT GGCGCAGGCG CTCGGTGTGC 
043261 GTTTCCTTGA TGCCGACGGT CAGGCGCTGG CGGCAAACGG TGGTAATTTA GCGCGCGTGG CAAGCATTGA 
043331 GATGGATGAA TGCGATCCGC GTCTGGCGAA TTGCCATATT GAAGTAGCAT GTGACGTTGA TAACCCGCTG 
043401 GTAGGGGCAC GCGGCGCGGC GGCGGTGTTT GGCCCGCAAA AAGGGGCAAC GCCGGAGATG GTCGAAGAAC 
043471 TTGAACAGGG GCTGCAAAAT TACGCCCGTG TTTTACAACA GCAAACTGAA ATTAATGTCT GCCAGATGGC 
043541 GGGCGGCGGC GCTGCGGGCG GTATGGGTAT TGCGGCGGCG GTATTTCTCA ATGCGGATAT TAAACCGGGC 
043611 ATTGAAATTG TGTTGAATGC GGTCAATCTT GCGCAGGCAG TGCAGGGCGC AGCACTGGTG ATTACCGGGG 
043681 AAGGGCGCAT CGACTCGCAA ACGGCAGGCG GTAAAGCGCC GCTGGGTGTG GCGTCGGTGG CGAAGCAGTT 
043751 TAATGTACCG GTGATTGGGA TTGCTGGCGT ATTGGGTGAT GGCGTGGAAG TGGTGCACCA GTACGGCATT 
043821 GACGCGGTAT TCAGCATTTT GCCTCGTCTG GCACCTTTAG CCGAAGTGCT CGCCAGCGGT GAAACCAATC 
043891 TCTTCAACAG CGCGCGAAAT ATTGCCTGCG CCATTAAAAT AGGTCAGGGA ATTAAAAACT AACCCTTACC 
043961 TTTAAAGCGG ATGCGATTTA TATCGCATAA GAGTGCAGTA CTCATGCCGG ATGCGGCATG AGTACCATAT 
044031 CCTTCCTGAA AATCGCGCAA ATTCTATATA TTGCAGAGAT CATGTAGGCC TGATAAGCGA AGCGCATCAG 
044101 GCAATGTTAC AAAAAAAGCC ACGGTATAAA CCGTGGCAAA ATCCAACATA GCTAAAAATA ATCAGGCGAG 
044171 TGGTATGACT TAAATCTCTA CGTCGCGGTT ACAATCTTTC GAGTAAATAT AGCTGAACGC TTCACCACGC 
044241 CCTACACCAT AACCAGCCTG TAAAGAATAA GCGCCCATAA AGATGTAATC GCCTTTTTTC ACCGGGATCC 
044311 AGTTATTGTC GAGGTTATAA ACCCCCTGAC CGGAAAGAAT ATAGGCACCG TGTTCCTGAA CGTGTGTTTC 
044381 GATATAACCG TGGCTGGCAC CTGGTGCAAA AGAGAGGATA TGCATGTTCA TATCAAAACC TAACTCTTTG 
044451 GGCAGAAAAT CCAGCAGAAT AACATCGTCC ATGCCTTCAT AATGAATGCG TTCCAGTTCG CTGGCATTGC 
044521 CAGAAACCAG CCACGGTGCA TAGCCTTCTA CCGGAACATA GCGGCGCTTA TATAAAAAGA TTTGGCTGTC 
044591 TTCGGCCTGG GCGTTAACAA ACGTCATTAA GGAGCCTGGC GGGCAATAAA GATAGCCACC TTCGCTTAAG 
044661 GCAAATGTTT TGCCTTCGGC TTTGGCAGTG ATATTTCCAG AGATCACATA CAGGAACGTT TCAATGCCTT 
044731 CGCCACCGAA GCCCTGTTGG TTGCCACCGT TTTGATGCAG TGTGACCAGA TAATCAACAA AAGAGGCACC 
044801 CAGCTTTGGC GTGGAGAGGA TTGTCGCGTC ACAATTTTCA AAGCCCGGAA TAATATTTTT TACCAGACCA 
044871 TCCGGGGTTA ACAGTGCGAA ATTACCGTGT TTAACAATCG CACGGTTAGC CAGTAAATCT TCGCGGTAAC 
044941 CGGTGACGTT ATTTAAATAT CCCATTTATG ACTCCTTATT TCTGCCAGGC AAGTTGATAA AGCATGAGTG 
045011 CCAACGTTTT GACCCCTTCG GCAAGGTCGG TAATATTGGT GCGTTCCGCC GGGTTATGGC TGATCCCGTT 
045081 GATGCTGGGG ATAAAAATCA TGCAGGTTGG TACGCGAGGC GCGAAAATTT GCGCGTCGTG CCCGGCACCA 
045151 CTGTGCATCA CCCGGTAATT CAGTTTTTCT CTTTCACACA ATTCTGTCAG GGTGGCGACC AGCTCCTTAT 
045221 TCATCGGCAC GGGTTCTTCG TCCATCCATA AATCGATATC AATACCAATG TCCATTTCAT CGCAAATCGC 
045291 CCGCATGTCG TTTTCTAACT GTTGGGTGAA ATCGCGCAGC ACGGCAGCGT CGGTATGACG ACAATCAATG 
045361 GTGAACGTGG TTTTACCCGG CACCACATTT ACCGTATTCG GGCGCGGCTC TACTTTGCCA AAGGTCAGAA 
045431 CCAGCGGATC GCCCATCCTT TTCGCTTTTT CGACCGACTG ATGGCAAATG CGACTGAAAG CGTAAACTGT 
045501 ATCACGACGA TAACCCATCG GCGTGGTGCC TGCATGGTTT GATTCGCCGT TCAGCGTTAC CGTATAACGA 
045571 CGCTGCCCGA CAATTGCATT CACCACGCCA ATTGATTGCC CATTACTTTC CAGCACACAG CCCTGTTCAA 
045641 TATGCAGTTC AACAAAGGCT TTAATATCCT GACGCGGAGT TAGTGGGGCG TTCGGAAGAG TAAATCCGCA 
045711 AGCCTTCATC GCATCGACAA AACTATTTCC TTTGGCATCA CAGATATTCC GCACGTCGTC AGGATTCGCC 
045781 AGCCCAAAAA TATTTTTACT GCCCCAGAAG ACATACGGGA AGCGGCTGCC TTCTTCTTCT GCCATCGCCA 
045851 CCACTTCGAC CGTACGTAGC GGCGCGCCGT ATTGCGTTTT CAGCCAGTCA ATTGCCAGCC ACGCCGCCAG 
045921 CGCGCCGAAT TGCCCGTCAA GGTTACCGCC GTTAACCACG GTATCGATAT GCGAACCGCT CAGAACCACT 
045991 TCCTGTGGAT ATTCGGTGCC ATTCAGGCGA CCGTATAAAT TCCCCACTTC ATCGAAACGT GTTTCCAGCC 
046061 CGCTTGCTGC CATTCTTTTT TTAAATTGCT GCTGGGTTTC CAGCCATTCC GGCGAATAAA GTAAACGGGT 
046131 CATCCCACCC GCTGGGTCAG CGCCAAAAGA GGAAAGCCAG GGCAGCGTTT CTTCTATAGC TTGACGGAAA 
046201 TGTGTAATCA TAAGAAAGTC CTGTCTCAAT AATTATTGCG CAAAGGGATT TTTCGTTTCG TATGACGTGT 
046271 TATAAAGCGC GTCGGAAATT AAATACTGGT AAATATCATC AACAATTTCG ATGCCTTCGA CGGCGGCTTT 
046341 GCGTTGTTTA ATATCCTGAT CCTGTCCGGG ATAATAAACC TGATTAAAAC CGGGCGCGGG GGTAATGGCA 
046411 TTTAATTCGC GCATGGTCTG GCTAAGATGT TGACGGAATA ATTCGCTGGA GGAGAAAAAG TTCGGATTAA 
046481 TAACTATATG TAATTGCCCC AAATTACGCC CTGCGTGTAA ATCGTCATAC ATCGAACTAA CCTGTCGCCC 
046551 GAACGGTAAG CCGAGTAAGA CGCCTGAGAG GACGTCAATC ATCATCATCA GGCCATACCC TTTTGGCCCG 
046621 GCGGCGGGGA GCAGAGCATG TACCGCGAAC GGATCGGTTG TTGGTACACC GTTTTTATCG ACCGCCCAGG 
046691 TATCCGGGAT AGACATATTA CGCGAGCGGG CGTCGAGCAC TTTTCCCCAT GCCTGTACGG TAGTCGCCAT 
046761 ATCAAAGGTA AGGATCTCGT CGCCTTCTCC CGGCGCGGCA AAGGCCAGGG GGTTAGTACC GTAGTAAATT 
046831 TCCGCGCCGC CAAACGGCAC CACCATTGGA TCGGACTGGC ACATCGAAAT GCCAATGAAT CCGGCGCGGG 
046901 CTGCCTGCTG CACAAAATAA GAGATTGCGC CGCTGTGACC CATCCGGCTG ATACCGACCA CCGCAACGCC 
046971 ATTTTGCTGG GCGGTTTTGA TGGCATGTTC CATACCCATT TTCGCCGCGA CCTGTCCGGC GGCATTGTCG 
047041 GCATGTAAAA TTGCCGAGCA CGGCCCGGTT TCCTCAAGAC GAAACTCCGG TTCGCGGTTG GTGCCGCCTT 
047111 TTGAAATGCG TTCCGCGTAG TATTCCACGC GCACCGCGCC ATGAGAGTGG ATCCCTCTGG CATCGGCGTA 
047181 AACCAATACT TCAGCCACGG TTGCAGCGTG CTCACGTTTT AACCCAGCCT GGCAGAGTTT ATTCTCAATT 
047251 AGCTGGTGGA GTGTTTCCCG ACTGATTTTC ATCTGTCTTC CTTTTTAACG ACGGTGTGAA GCATGACTGC 
047321 AATTAACATA CAGGGAAAAT ATCTGGATTA TGTGATCCAG ACAGGCAAAA AAATATAGTT AGAATTTATT 
047391 TGATAATCCG CTCACTTTTA ACCTGATTTT TAAAACAACA ACGCTTATTA AAAAATAATG AGTAATAGCC 
047461 TGGTGGTTAT TTGAATTCTT TTGTTAATAA TTCCTGTGTG ATATTCATCA CCTTATTTAC TCGTTGTCAT 
047531 CGATACCGTA ATCGCCACAT TAACACTGCT CGTGCAATTG CCATGGGTGC AATTTTTAAG GAGTTGTTAT 
047601 GATCCACGCC TTTATTAAAA AAGGGTGTTT TCAGGATTCG GTCAGTTTAA TGATTATTTC ACGAAAACTC 
047671 AGCGAATCAG AAAATGTTGA TGATGTTTCC GTAATGATGG GTACGCCCGC CAATAAAGCG TTATTAGATA 
047741 CCACAGGTTT CTGGCATGAC GATTTTAATA ACGCCACGCC GAACGATATT TGCGTGGCAA TTCGTAGCGA 
047811 AGCGGCGGAT GCGGGGATCG CGCAGGCGAT TATGCAGCAG CTTGAAGAGG CGCTAAAACA ACTGGCGCAG 
047881 GGGTCAGGCA GCAGCCAGGC GTTGACGCAG GTGCGTCGCT GGGACAGTGC CTGTCAGAAA TTACCCGATG 
047951 CCAATCTGGC GCTGATTTCA GTGGCTGGCG AGTATGCGGC GGAGCTGGCA AACCAGGCGC TGGATCGCAA 
048021 CCTCAACGTG ATGATGTTCT CCGATAACGT CACGCTGGAA GATGAAATCC AACTTAAAAC CCGCGCGCGG 
048091 GAAAAAGGCT TGCTGGTGAT GGGGCCGGAC TGCGGTACGT CGATGATTGC CGGCACACCG CTGGCTTTTG 
048161 CTAACGTGAT GCCGGAAGGC AATATTGGCG TCATTGGCGC TTCCGGTACC GGGATTCAGG AGCTGTGTTC 
048231 GCAGATTGCG CTGGCAGGGG AGGGAATTAC TCACGCGATT GGCCTTGGCG GGCGCGACCT CAGCCGTGAA 
048301 GTGGGCGGCA TCAGTGCGCT AACAGCGCTG GAAATGCTCA GTGCAGACGA GAAAAGCGAA GTGCTGGCAT 
048371 TTGTTTCAAA ACCACCTGCC GAAGCTGTGC GTCTGAAAAT TGTTAATGCC ATGAAAGCAA CCGGCAAACC 
048441 GACGGTGGCG CTGTTTTTAG GTTATACCCC GGCGGTGGCC CGCGACGAGA ATGTCTGGTT TGCCTCCTCG 
048511 CTGGATGAGG CCGCACGCCT GGCTTGCCTG CTTTCACGCG TCACGGCGCG ACGTAACGCA ATAGCGCCTG 
048581 TCAGCAGCGG ATTTATTTGC GGTTTGTATA CCGGCGGTAC GCTGGCTGCC GAAGCGGCGG GATTACTTGC 
048651 CGGACACCTT GGCGTGGAAG CCGACGATAC CCATCAACAT GGCATGATGC TGGACGCCGA TAGCCACCAG 
048721 ATTATTGACC TCGGCGATGA TTTCTACACC GTCGGGCGTC CCCATCCGAT GATCGACCCA ACCTTACGCA 
048791 ACCAGTTAAT TGCCGATCTC GGCGCTAAAC CGCAAGTGCG CGTGTTGCTG CTTGATGTCG TGATTGGCTT 
048861 CGGTGCGACC GCCGATCCTG CCGCCTCGCT GGTGAGCGCC TGGCAAAAAG CCTGTGCCGC GCGTTTAGAT 
048931 AATCAACCAC TGTATGCCAT TGCCACGGTG ACAGGCACTG AACGTGACCC GCAATGCCGC TCGCAGCAAA 
049001 TCGCCACGCT GGAAGATGCG GGGATTGCGG TCGTGAGTTC GCTACCGGAA GCCACCTTGC TGGCGGCAGC 
049071 GTTAATTCAT CCGCTCTCGC CTGCCGCACA GCAACACACA CCGTCATTAC TGGAAAACGT CGCCGTGATT 
049141 AACATCGGAT TACGCAGCTT TGCGCTGGAG CTACAAAGCG CCAGCAAACC GGTTGTGCAT TACCAATGGT 
049211 CGCCAGTCGC CGGTGGCAAT AAAAAACTGG CTCGTTTATT AGAACGTTTG CAATAAGGGG TTCCCATGTT 
049281 TACATCAGTG GCGCAAGCCA ATGCTGCGGT TATCGAACAA ATTCGTCGCG CTCGTCCACA CTGGCTGGAT 
049351 GTGCAACCGG CTTCTTCACT TATCAGCGAA CTAAACGAAG GCAAAACACT GCTTCACGCC GGGCCGCCAA 
049421 TGCGCTGGCA GGAGATGACC GGACCCATGA AAGGGGCGTG CGTGGGCGCA TGTCTGTTCG AAGGTTGGGC 
049491 GAAAGATGAA GCGCAGGCGC TGGCAATACT GGAGCAGGGG AAGTGAACTT CATTCCTTGT CACCATGTGA 
049561 ATGCCGTCGG GCCAATGGGC GGTATTACTT CTGCCAGTAT GCCGATGCTG GTGGTTGAGA ACGTGACCGA 
049631 CGGCAACCGG GCGTACTGCA ACCTCAACGA AGGTATCGGC AAAGTGATGC GTTTTGGCGC TTACGGCGAA 
049701 GATGTCCTGA CTCGCCATCG CTGGATGCGC GATGTGTTAA TGCCAGTATT AAGCGCGGCG CTGGGGCGCA 
049771 TGGAGCGCGG TATCGATCTC ACGGCGATGA TGGCGCAGGG CATTACGATG GGCGATGAGT TCCATCAACG 
049841 CAATATTGCT TCCTCTGCAC TGTTAATGCG TGCGCTGGCC CCACAAATTG CTCGCCTCGA TCATGATAAA 
049911 CAGCACATCG CCGAAGTGAT GGATTTCCTC AGCGTGACCG ATCAGTTCTT CCTCAACCTC GCGATGGCTT 
049981 ACTGCAAGGC GGCGATGGAT GCTGGCGCGA TGATCCGCGC AGGCAGCATC GTCACGGCAA TGACCCGCAA 
050051 CGGCAATATG TTCGGGATTC GGGTAAGCGG GCTGGGCGAA CGCTGGTTTA CTGCGCCTGT AAACACTCCG 
050121 CAAGGTCTGT TTTTCACCGG CTTCTCGCAG GAGCAGGCGA ACCCGGATAT GGGCGATAGC GCGATTACCG 
050191 AAACCTTTGG TATCGGAGGT GCGGCAATGA TCGCAGCGCC TGGCGTAACG CGCTTTGTCG GTGCGGGTGG 
050261 CATGGAAGCG GCAAGAGCGG TATCTGAAGA GATGGCGGAA ATTTACCTTG AACGCAATAT GCAGTTGCAG 
050331 ATCCCAAGCT GGGATTTTCA GGGCGCGTGC CTGGGGCTGG ACATTCGTCG CGTGGTAGAA ACCGGCATTA 
050401 CGCCACTCAT CAATACCGGT ATCGCCCATA AAGAGGCGGG GATCGGGCAG ATTGGCGCAG GCACCGTGCG 
050471 GGCACCGCTG GCGTGCTTTG AACAGGCGCT GGAAGCACTG GCTGAAAGCA TGGGTATTGG TTGAGGAACG 
050541 CGCAATGACG ATCATCCATC CTCTGCTTGC CAGTAGTAGC GCACCGAATT ATCGCCAGTC CTGGCGGTTA 
050611 GCGGGAGTGT GGCGGCGGGC GATTAACCTG ATGACGGAAA GCGGCGAACT GTTAACGTTG CATCGTCAGG 
050681 GTAGTGGTTT CGGCCCCGGA GGATGGGTGC TTCGCCGTGC GCAATTCGAT GCGTTATGCG GTGGATTATG 
050751 CGGCAATGAA CGACCACAGG TTGTGGCTCA AGGGATTCGC CTCGGGCGTT TCACGGTTAA ACAGCCACAG 
050821 CGTTATTGTT TGCTGCGTAT TACGCCGCCT GCGCATCCTC AACCACTTGC AGCTGCATGG ATGCAACGCG 
050891 CGGAGGAAAC CGGGCTTTTC GGGCCACTGG CGTTGGCGGC AAGCGATCCG CTGCCTGCTG AGTTACGCCA 
050961 GTTTCGTCAC TGTTTTCAGG CCGCGCTCAA TGGCGTTAAG ACCGACTGGC GGCACTGGCT GGGTAAAGGC 
051031 CCCGGATTAA CGCCGAGTCA TGATGACACG CTGAGCGGAA TGCTGCTGGC GGCCTGGTAT TATGGCGCTT 
051101 TAGATGCGCG CTCCGGTCGT CCGTTTTTTG CCTGTTCCGA CAATCTGCAA CTCGTTACCA CAGCGGTGAG 
051171 CGTCAGTTAT TTACGTTATG CCGCGCAAGG ATATTTCGCC TCGCCACTCC TGCACTTTGT TCATGCTCTG 
051241 AGTTGCCCGA AACGTACCGC TGTTGCGATT GATTCGCTGC TGGCGCTGGG GCATACGTCA GGGGCAGATA 
051311 CGCTGCTGGG GTTCTGGCTT GGCCAACAAT TATTACAAGG AAAACCATGA AAACACTGGT TGTGGCTCTT 
051381 GGGGGCAACG CCTTACTCCA GCGCGGTGAG GCGCTGACGG CAGAAAATCA ATATCGCAAT ATCGCCAGTG 
051451 CTGTACCCGC GCTGGCACGC CTGGCCCGTT CTTATCGGTT GGCGATTGTT CACGGCAACG GGCCGCAGGT 
051521 GGGGCTGCTG GCATTGCAGA ATCTGGCGTG GAAAGAGGTA GAACCGTATC CGCTGGATGT GCTGGTTGCG 
051591 GAAAGCCAGG GGATGATTGG CTATATGCTG GCGCAGAGTT TGAGCGCACA GCCGCAGATG CCGCCCGTGA 
051661 CGACGGTGCT GACGCGCATT GAGGTTTCGC CTGATGATCC GGCGTTTTTG CAGCCAGAGA AATTTATTGG 
051731 TCCGGTTTAT CAGCCAGAAG AACAAGAGGC ACTGGAAGCG GCTTACGGCT GGCAGATGAA ACGTGATGGT 
051801 AAATATTTGC GCCGGGTGGT GGCGTCTCCG CAACCGCGTA AAATTCTCGA CAGCGAAGCC ATCGAGTTGT 
051871 TGCTCAAAGA GGGGCATGTG GTGATTTGCA GTGGCGGCGG CGGTGTGCCT GTGACGGATG ACGGAGCAGG 
051941 GAGTGAAGCA GTGATTGATA AAGATCTCGC CGCTGCGTTG CTCGCCGAGC AGATTAATGC AGATGGACTG 
052011 GTGATCCTCA CCGATGCTGA TGCGGTATAT GAAAACTGGG GAACGCCGCA GCAACGTGCC ATTCGCCATG 
052081 CCACACCGGA TGAGTTAGCG CCATTTGCCA AAGCCGATGG TTCGATGGGG CCGAATGTAA CGGCGGTGAG 
052151 TGGTTATGTC AGAAGCCGTG GTAAACCCGC GTGGATTGGG GCGTTATCGC GAATTGAAGA GACGCTGGCG 
052221 GGCGAAGCGG GGACCTGTAT TTCGC