MG1655
W3110
Search for
Japanese | English
Deletion Report : 17
General information
Deletion 17  
Location (BP) 1,042,179 - 1,114,732   Go Linear View
Length (BP) 72,554
Related strains
     Strains ME5098    ME5099    ME5118    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer R_1042178_C_17_B_L  
Sequence TCTTCTTATGTTCACCGCGCCTGGCAGTGAAACCGAAAAAAGCGTTGAAC  
3' Primer L_1114733_U_17_B_R  
Sequence GTTCAACGCTTTTTTCGGTTTCACTGCCAGGCGCGGTGAACATAAGAAGA  

 Linear View (Whole Mode)
View Location
   1017.179  –  1091.912 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             CCACGACGCA ACATCGCACG CGCCAGCACG 
-00070 GCACCCACAG AAATAAACAG GCCAAGAATA AAACCAAGCA CCACGTTCAA CGCTTTTTTC GGTTTCACTG 
000001 GCTGCGGCTG AGTGACTGCC GGGTCGATAA TCCGCACGTT ACCAATGGCA CTGGATTTCG AAATACTCAA 
000071 CTCCTGCTGG CGGTTAAGTA ATTGCAGATA TACCGCACGG CCCGCTTCTA CGTCACGACT TAAACGCAAC 
000141 ACTTCCTGTT GGGTGGAAGG CATTGCCGAT ACCCGCTTAT TCAGGCGTTT GCGTTCTTGC TCCAGCGTCT 
000211 GGCGTTTTTC CAGCAGCGCA CGATAAGTTG GGTGATCTTT CTTATACAGC TGGGAGATCT CTGCCTCGCG 
000281 GAAGGTCAGC TCATTGAGTT GATTATCAAC GTTCACAATC TGCTCAAGAA CGGCTTTGGC TTCCAGGTTA 
000351 AGGTCAACCG AATCGCGCTG CTGGCGATAA ACGTTGAGTT TTTCTTCCGC TTGGTCCAGC TCGCTGCGCA 
000421 CTTCAGGTAA CTGGCGCTGT AAGAATTCAA GGCTTTGTGA ATCCTGCGCC GCCTGGCGAG CGATATTCTG 
000491 TTGCAAATAG TTGTTAGCGA TGCTGTTCAG AATACGAGTA ATCAACTGGG GATCATCACC AGTCATGGTA 
000561 AGTTCCAGCA TCCCGCTTTC TTTACTGCGT TCGCTAACGG TAAAGGTTTC CTGCAATGCG TTAATCGCTT 
000631 CCAGTTCGGT ACGCTGGCTC AGGACAAACT GTGTTCCTGG TTTGGCCTTA ATGTCCGCGA TAGTCAGCGC 
000701 AACGCCATCT TTTTCCAGAC GCTGGCCGAC CATACCATTG ACGGTGAACT CTTCACCTTC CAGTGTATAG 
000771 TGGCCGTTTT CCCCAACCGT GAGTGTCAGT TGCTGATCCT GACCATTCAG TTGTGGAATA TGCATCCAGC 
000841 TGATCGCCAG CTCACCTGGT TTTTCTTTGG TTAATCTCGC CCAGCCGCGA CCCACAATCG GAAAATACTT 
000911 CTGCTCAACT ATGTCGCGCA GATTCAGTTC AGCAATGGTT TTACCGAGAA TCATGCGCGA TTGCAGCAGT 
000981 TGGATCTCCG GTGCAGACTC GGGCGATGAG TTAGGGATCA TATCGCTCAG GCCGCTGAGA ATGGCGTTGC 
001051 CCTGTTTTTG CTCAACCTGG ACCAGAGTAT CTGCCTGATA AATTGGTGTG CTTAACAGCG AGTAAGCGAC 
001121 AGCGATCAGC GTGAATAACG CGGTCACGCT GATAATAAAC TTACGGTGAT CCCATAACTC GCCGACCAGA 
001191 CGAAGCAGAT CGATCTCATT TTCCTGAGTG CTGCCTGGTG GCGTATTCAT ATTTTTAGTT GTCATCGTAT 
001261 TTTATAAACT CAAATTACCG GCTGAGGCGC TTCGCCCATT CCTGACTGGC GCGCTCCAAC ATACCGTAGA 
001331 CATGTTCAAA TGCGTCCTGA CTTTTACGAT AGGGATCCGG GATCTCTTTC TGTTCCAGCC ATTGCCCAAA 
001401 CAGCATTGTC TTCCCGCGGA CCTCGGGAGC AATTGCGGTA ACCTGAGCAA TATGTTCCGA CTCCATTGCC 
001471 AGAATCAGAT CGTAATTTCG TGCCATCTCA GCAGTGAGCT TACGTCCGGC ATGTCCTTCA AGAGATACGC 
001541 CATGATTAGC GGCAACATCT GCCGCTGTCG CATCTGCAGG GTGTTTTACC AGACCATGAA CACCTGCCGA 
001611 TTTGACTTTT ACGCCCGGCA GACGTTTACG CAGCAAGCGC TCGCCAATGG GCGAACGGCA AATGTTGCCG 
001681 GTACAAACCA CCAGGATTGA GTTAAATTTT AGTTGGGCCA TGTTTGAATC CACCGTGAAG TCTCTGTCAG 
001751 GTCATGCACC CCGGAAATCG TCGGTACCAG CAGAGAAATC ACACGGTTCC AACGAGCCAG CGGCGCGGTA 
001821 GTGACATAAA CAATGTCGTA AGGTTCAAGC TGGAATTCCG TTCCGAGTAT CATTGCCGAT GCGTCCTTCG 
001891 CATTCAGCTG ATAAATATTG GCGATTTTGC CATTCTGCTT GTTTTGCGTT GCACGAATAA CAAAAATCCC 
001961 CGTCGCATCA GCGACATCCT GATTCATACC CTCAGCGTTA CCCAGCGCTT CCGCCAGGGT CATACCGCTG 
002031 CGGTCCATTT TCAGCGTGCT CTGTTTACCC ACTTCACCCA TCACGAAGAC TTTCAGATCA TCGTTGCGCG 
002101 GAATAAATAA AATATCGCCC GGGTGCAGCA GTTTGTTCTG GCGCAAGTCG CCACGCTGCA TCAGCGCATA 
002171 GAGGTTCACT TTGGTCTTTA CGCCATTCTG GGTGAGCACC ACGTTGCGCC AGTCTGCATC TGCGGTCAGA 
002241 CCGCCCGCGG CGTTAATCGC ATCCATGATG GTCAGAGGAA TATTGGTAAT CGGCTGCTGA CCCGATTTGC 
002311 TGACTTCGCC GGTGACGTAC GCTTTTTGCG ATCGGAACGC CGCGACGCTG ACATCGACTT GCGGGCTTTC 
002381 AATGACTGAA TCGAGACGCG CTGTAATCTC GTTGCGTACC TGGGTAAGTG TTTTCCCGGC CACTTTCAGG 
002451 CGACCAATAT AGGGGTAGAA AATCGCACCA TCGGCGTTAA CCCAGTTGCC GGTATCACTG GCGCTACGGT 
002521 ATTGCCCTGC GGGGGTGGTT AGTTCCGGGT GATCCCAGAC CGTAACCATC AACACATCAC CAATCCCGAT 
002591 ACGATATTCA TAGTTTGCGA TTTGCTGCTC CAGCTCCGGG TTAGCCTGCG ACATAATCGG TTTGGCGCGC 
002661 AACTGATCAA TCAATCCTGG CGTGACGGGA TAGATATTGA CCATTTTGTC CAGGTCATAC TGATTGTCAG 
002731 GTAGTTCAAT GACATCCTTG TTACTGGTCG ATAAATTCTG ACCAGGAACA AGGGTACATG CTGTCAAAGA 
002801 CAGAACAGCC AATGTCAGTA CCGAAAACTT AAAAATGTTC TTTTTCATTG GTTTATATTT ATCAGTCAAT 
002871 GTAATGTTAT GAATTACGTC AGGTTATTGT CCAACCGGTA CTTCTCGCTC TGCCGTCATT GGATAGAGCT 
002941 GGTATTTGCG TGACAGCATT TGTCCACCAT CACGCGTCAA TGGTGTCCAC GAAACCACCG CGCGGTTGCG 
003011 GTTAGGTCCA ATGGTCATCA AGTCGAATGG AATCGAGATA TAAAAACCTT TACTAAAGCC GCCTTCGCCG 
003081 TAGTCATCTT TAGATACGTT ACTGATTGCC GCCCATACCC CTACCGCCAC GCCGCTGTCA AAGCGTTTGG 
003151 CGACGTCGAT CGTTGCGCCT TTATCTTTTG CCAGATATTG CCCAACGCTA AGTTTCATCA GTACGCCATT 
003221 GAGCGTCGGC GGGTTCCAGT AAGCCGTCAC GAAACCTGTT GGCGTGGAAT AATCGGTGAA ACGCATCATG 
003291 TTGTCCCAGT CACGTTGCTT CACGTAGTTA ACGTCCACAC CCAGCGCCCA GCAGGCATCT AGCGGGCGAT 
003361 AAAGCAGCTC GGAACCGACA CCGGCGTACA TCGTTTCCAG ATAACCGCCA TACACCTGGC CATAGAAACC 
003431 ATTGCCTAAG TCAGCAAAAT AGTTCGCCTG CAAGTTGTTG AGATAAACGT CATTGCGAAC GTAGTCACGG 
003501 ATATGCGTGC GCACGCGGGG CAGGGTAGAG TCCGCGGGCA ACAGCGAAGA CTTAAACTTG TCGTAGTTGT 
003571 TGTAAATATT GGTGAAAATA CCGCCATCAA GCAGCAGGTG GTCGGTAAAC CAGTAGCGGG CACTGGACAT 
003641 CAGCCCCAGC TGGAACATAT AGAAATCTTC CGGGCCGCCC AGCGACTGTG AAAGTGTTGG GTTGAAAGAG 
003711 TAGCTAAAGC GATCTTCACG AATACGGTAG CCCCGACCAA AGGCAGAAAG ATCTTCAGCT TCAACACGTT 
003781 GTTGTTGCAG TGGCTCTGAT TGACCAGGCG CTGTACCTGC CAGCTGTTTG CGCAGGCTGG CTACGTCGGT 
003851 TTCGGTAGTC ACCATCGCCA TATGCTCGCG CTTTTGCGTC ACGCTAATCT TCTCAACGCC TTGCGGCAGG 
003921 TTATTCACCA GAATCCGGTT GGCACGATCG ACCGCTTCAC GAGAGTCACG GTATTTGTAT TGCTGACCAG 
003991 ACATATACAG TGTCTTATCG CGTAGCTGAA TTTCTGGCGC GTCAAAGCCC GCGTTATACT TCAGGGCGGT 
004061 AAGTTGGTTT GCTACCGTGG TGTACTGCAA TCCTTCAGAT TCAGGCGCAG GTTGATATGC CGGTTTTGGC 
004131 GTATCGCGCA GGGCAGGGCG CAGATCGTTG AAATTGGTCC GTAACGTGAA GCCAAACATC AACGTGTTAC 
004201 CGCGTTCATA ACTCAGGTTG AGATCTGCCC AGCTGGCAGC GCGATAAACT GCGCCGACGT TGAAATGGCT 
004271 TGCCTGAGGC AGTTTGCCAG CGAAATCATT CTGGTAATTG TTTCCATCGT ATTCGAGTTT CAGACGCAGG 
004341 GGATTCCACG GCGTTTGATA CTCAATGCCG CCAAAGATGG AAGCCGGGCC ACGAAAGATA TCGCTAAAGC 
004411 TGATATCGCC CGCATCGTGA GACTCTGCGC GATGACAATA TTTATCGCTC ACCCGGCAAA ACGGGTTGGT 
004481 AATATTGCCC GCATTACCGG CGTAGCCCCA TGCCATCCCG AGGGTGAAAT CAAATGGCCC CGCTTGCTTG 
004551 CTGGCCACCA GATACTCACC GTCAAACAGA CCCGTACCAG CAATATCACG TTTACCAAAC GCCACTTGCG 
004621 GTAGCCAGTA ACCTTCTTCC CACAGGCGAA GTTTAAAATC GAATGATTTG TCTTTGTATG ACTGATCGCC 
004691 GCTGAAATCT TCCCACTGGC TATATTTGCG TGTGCGCACA TCCGTATAAC GAATGGTGCC TTCCAGCCAT 
004761 GGGAACAGCG CCACGGAGGT GGAGTAGAAC CGGTATTGAT CGTTATCCCG GTAGTTGACG CTGAATTCAC 
004831 CTTCCGGTGC GATGCGCGCA TTTGGCATCT GCAACAATCC TGTGCCGCCA AAGTCTGATT GCGACGAACC 
004901 CAGCGGATCC GGGTAGGTTA ATACTTCAGC ATGACAGGCA CTGGAGACGG CAATGGCCAG GCAGCTTAAA 
004971 AGATAAGAAT TCTTCTTCAT CAGTCAGGAA CACGTTGCGT TAAAACAGAC ACAATCTGGT CATTTAAATC 
005041 AGCATATTTT TCGGGCAGTA CATGCGCAGA AAAGCCCAAC CAAAGCTGGC TGCCAGGCGG TGGTTCCACA 
005111 TGTCTTTTAT TCCACAGGGC AACAGGGGCG ACGACAGTCT CACCCTCAGG CGTAATCACC ATAACGTTAT 
005181 TCTTGTCCGC GCCTGCAAGG CGGGGGTGAT CTTGCAGATA ATCGGTAACG CTACGGCCTG CCTGCCAGGG 
005251 CAATTGCCCG GCCCCAGAAA CCGCACCCAG CAGAGTAATA GTCACCGGAC GCTGTACGGT ATAGAGCGTA 
005321 TAGTCCCCGA CCAACGGGGG ATTGCTGTTC TCATCCACTC GTACAAAATC AGGGTCCAGT TTGACCGGTA 
005391 AGCGACCAGT GATATTGAGA TTGAGTAACT GCTGGCGCAC GGATTTAATC GTTGCCGCCA CATCGTCGTC 
005461 AGCTTCTGCT TCCCAGGAAG CAAGCTGTGC CATGACATGT TGGTAGTCTT TAAGCGCTTT AGCTTTCGCC 
005531 GCAGAGTCGG TCAGCAAGGC ACCAGGCCAC CAGAGGCGAT CGCGCAGTTG CGGTTGTGTC ACCAACTGGA 
005601 CAACATTTTC CACGGGGCCA ACGGAAAGTG TCTGTTGTTC GCCAGGCAGA TAAATAGTCA CCGTTCCTTG 
005671 CGCAAAGGCA TGGGGTGTCA TTACGTAAAG TACGCTGGCA ATGAAATACG ACTGTAATTT ATTCATGGTG 
005741 CGGGTTTAAG AAACGTCATT TCTACGGGAA TAACCCCTGC GCCTAACATT TGCCGACTTT GACGAACCTG 
005811 GCCAGTAGCC GAATCGACCC AGAATGTGTT TTGCCACTGT TTTTCTGGCC GCGTGGAAGT CACCTCTTCC 
005881 TGCCAGACAT TACACAGCAC ATTGCGACCC GCAATATTCA GCGTCTCTAA TCCAGCAAAG GAAAAAGTAG 
005951 AACTCAGGGT CGCAGAGCGA AAATGGTTGT CTTCACTCCA GAGAATATCG CGCGTCCAGC GGCTGCCATC 
006021 TTTTATTGCC AGCGCGTTAC GCAGAGGGTC CTGCCCGGAA TTTGTCACTT CCAGCAGATT ATTATTAAGT 
006091 TTGACGGTTT TTAAAAGACG TCCATTGTGG GTAACCAGCA TGGCGTTATC CTGGGATAAC CATTTGCTTT 
006161 GTTCTTGTTC TATATATCCC AGTACCACAA AGATTCGTTG CCCTTCATTA AGGCGTAAAT ACATAGTGGA 
006231 ATAAGGCAAC GCCTGGATCT GCTGATCCGC TACGGTGATA TCCTGATTAT CGAAAAGGCT GGCGCGAAAT 
006301 GTATCGACCA TACTTTGCTG GCTGTGCGTA CATCCCGCAA GAAATAGTGC GAAAATCGAT AAAATAAGAG 
006371 GGCGCACCTT TAATCCTTGA AAGGTTAATT AAAAAAATGC AAATCTCTAA AGCCCGGTAC GAATATCGCA 
006441 ACCGGGTATC ATTTAACTTT AATTTCGACG CGTTAAAGCA GTATTAGCGT GTAGTGGACG TGGTGGTTGA 
006511 GGTGTTATGA GAACCGCCAT CGCCACTGTC ATTTGCTGCA ACAACTGCCA ACGTCGCCAC ACCAACAGCC 
006581 GTTGCCACAC CGACAACTGT CGCCGTGCCG ACAGCGCCAG CAGCCACGCC ACCAGTGGTA GTAGCAGTCG 
006651 TGGTTGCGCC GGTAGTGGTC GTTGTGGTGC CAGTAGTACC CGTCGTTGCC TCGGTCCCGT TTGTTGCTTC 
006721 AGGGGCAGCA AACGCAGCTG GCGTCGTCAA CATGAAGGCC ATAAGGATTG CAGAAAGCTT GTGTTTCATA 
006791 ACTTTTCCTT TATTCATCGC ATGGACAATA CGGGTGATGC TGCCAACTTA CTGATTTAGT GTATGATGGT 
006861 GTTTTTGAGG TTCTCCAGTG GCTTCTGTTT CTATCAGCTG TCCCTCCTGT TCAGCTACTG ACGGGGTGGT 
006931 GCGTAACGGC AAAAGCACTG CCGGACATCA GCGCTATCTC TGCTCTCACT GCCGTAAAAC ATGGCAACTG 
007001 CAGTTCACTT ACACCGCTTC TCAACCCGGT ACGCACCAGA AAATCATTGA TATGGCCATG AATGGCGTTG 
007071 GATGCCGGGC AACAGCCCGC ATTATGGGCG TTGGCCTCAA CACGATTTTC CGCCATTTAA AAAACTCAGG 
007141 CCGCAGTCGG TAACCTCGCG CATACAGCCG GGCAGTGACG TCATCGTCTG CGCGGAAATG GACGAACAGT 
007211 GGGGATACGT CGGGGCTAAA TCGCGCCAGC GCTGGCTGTT TTACGCGTAT GACAGGCTCC GGAAGACGGT 
007281 TGTTGCGCAC GTATTCGGTG AACGCACTAT GGCGACGCTG GGGCGTCTTA TGAGCCTGCT GTCACCCTTT 
007351 GACGTGGTGA TATGGATGAC GGATGGCTGG CCGCTGTATG AATCCCGCCT GAAGGGAAAG CTGCACGTAA 
007421 TCAGCAAGCG ATATACGCAG CGAATTGAGC GGTATAACCT GAATCTGAGG CAGCACCTGG CACGGCTGGG 
007491 ACGGAAGTCG CTGTCGTTCT CAAAATCGGT GGAGCTGCAT GACAAAGTCA TCGGGCATTA TCTGAACATA 
007561 AAACACTATC AATAAGTTGG AGTCATTACC GACAATACGT ACGCTTGAGA TCAGGATTGT CTACTTTGAG 
007631 TATAACATCC TTGTGAAATC TCCCTTTCCT CATACCGCTT GCACTATATA CTGCGGGTAG GAAAGGCGCG 
007701 CAGAGGGAAA TATAAGATTG TTAACTATCC CCCTCTGGAA ATACGACTTG TGAGCATAAG ATAAATCTTA 
007771 GCAAAATACA AATTAAAGAT AAGGAAATTG TTACGAAAGC TATTAATTAT TGTTGGTAAT ATAGTTTCAA 
007841 GTGGTACTAT AACTGGCTGT TAAATGGCAT TTATAACTAT TAGGTGCAGA GATATTCGCT TAAATGGATT 
007911 AGTTTCTTTG TGGAAAAGTA ACTGATGTTA TAATGTATGA TGTTGACTAT TTCACTATTC CAATAAAACC 
007981 AGTCAGCTTT AAACAAGCAG CGTCATATTA AGAGAGATAA ACATTTGCCG CTGTTGGTCC TCGCAGGCCA 
008051 TTTACGCGGC AAAATTCCAC ACGTAATCCT GGTATAAGCA CTTCTGCGTC GCGGGGAGTG AATGCGGAAA 
008121 TATGGACCTG AACTTCTTTA CGACCGTCGG AGGGGATAAT GAATCCTTTG CCGCTTTTGC GATCAAAGGT 
008191 TTTGACAATT CCTGTCATTT TACGGGACAA ACAAATTCCT TACTGAAAAT ACTGCGCTGC ACTATACGGG 
008261 GTTAATAAAA TAAAGCCAGC GATATTTAAG ACCGCCGGAC GGCTAAAATA AAATTTGCTT AATCTCAATT 
008331 ATCATGCGTT AATAGCTGCG TCGGTTTGAA AGACAGACAG CATACAAAGT AGTTTACTAA AGCAGTTCTC 
008401 ATTATCAGGC ATTATCCCCT TCTTTTGAGT CTCTCTCCTG AACACTAAGT AGTTTCTGTA TTAAAGCCCT 
008471 GTTTGCCGAA AGGCCCAAAA TGAAGGAAGT AAAATATGTC TAATAAAATG ACTGGTTTAG TAAAATGGTT 
008541 TAACGCAGAT AAAGGTTTTG GCTTTATCAC TCCTGATGAT GGCAGCAAAG ACGTTTTCGT CCATTTCACC 
008611 GCCATCCAGA GCAATGAATT CCGCACGCTG AACGAAAATC AGAAAGTTGA ATTTTCTATT GAGCAGGGGC 
008681 AACGTGGCCC CGCGGCAGCG AACGTTGTTA CGCTCTAAGG TTGCCATTAT TACTCAACAT CTCCATTTCC 
008751 GCTGTCCATG TTGTCATGGT TCACAGTACC GCACATCGGC ATTCGATGTG ACGGAGCGAA ACCCTTTGGG 
008821 CGCTAAGTGT ATTTTTTGTA AATCGACGAT GATCACCTTT GATAACGTCG CGCTGCAAAT ACGCACTGAC 
008891 CATGCGCCGC TGGATTTCAC AAAATAATAT CAGGCTCCCT CGTGGAGCCT TTTTTATATC TGCCTTATTT 
008961 TTCTTCAACG CTGTATGTAT AGTAAGCGAT AACCTGTTGA TTATTGAATC TTTCGGGGAG ATGGCTTATA 
009031 ACATTTCTTA CCTGACCAGG GTACCGGGAA CCAACACCTT ACTGGCGTGT TGCTGTCTTT TAAGACCAGA 
009101 AGAGGTTAAC AGTGAATATT GAAGAGTTAA AAAAACAAGC CGAAACGGAA ATCGCCGACT TTATCGCGCA 
009171 AAAAATCGCC GAGCTGAACA AGAATACAGG GAAAGAAGTC TCTGAAATTC GCTTCACCGC ACGAGAAAAA 
009241 ATGACCGGGC TTGAAAGTTA TGATGTCAAA ATCAAAATAA TGTGATTTTG TGAACATCAC CCCGTGCGAG 
009311 GTGATGTTCC GCTTGTTGCT AATTTAGTGA CCAATCATTG GCGCTTGTGG AATTAAGCGT CGGTACAATT 
009381 CCTCCGGCAC CGGGCTTTGC CATACTCCCG CATACATTGC GTAACCAATC ACCGCAAACA TAATCCCCAG 
009451 AACCAGTAGC GTCATTAACC AGCCAGACAA CGCAAAGGCT TTTTTATTTG CCGCAGGTTT TTGCAGTGAA 
009521 AAGGTCAATG TTGAGGCTAC CGGACATGAC TCTACGCAAG TCATACAGCC GGTACATTCC ACTGTTCGTA 
009591 CCTGAATTAA TTTATCGACC GGGATCCGTG ATGGGCAATT TTTTGCGCAT TTGCCACAGT CGATACAACT 
009661 TTCGGCATTG CGACGAATCT TAAACGGCGA CAATAGCGAA ACCACGCCCA TCAGCGCGCC ATATGGGCAA 
009731 AGATAACGAC ACCAGGCATG GCGAATAAAC AGGCTGGCAA TCAGCAAAAC GGTCACGCTG ATTAATGTCG 
009801 CGGTCCCCAT ATGACGAAAG AAATCGAGCA TTTTAACGTC CATCACCACG CTGTAGGGCG ACAACATAAA 
009871 ATAGTGAATC GCCTGAGCGG GCATCAATAA CGCGATATAG ATAAAAAAAC TCAACAGCAA ATACTTCACG 
009941 CCGCGCAGAG GAATATCCAG CCAGCGGGGA AGGACACATT GCCGACCAAA CAGTTTGTTA CCGAGATCGC 
010011 CGATTAATTC AGAAAGCGTA CCAACCGGGC ATAACCATGA GCAAAAGGCC TTTTTGAGTA ATAGACTGAT 
010081 GACGATAAAA GCGACCAATA ACAGCATCGC GGCGGCGTGG ACGGACGGTA ACTGACCTGT TACAAGGCTA 
010151 TATTTCAGAT TCATCAGCCC GGCAATCGGT AGCCAGCCTT CGATACCTCC CGGTCTGGCG ACAAATGTCG 
010221 TGCTACTTGC CGTTTCGTAA TAGCGCACCC AATACCAGAA CGTGATGGCA ATATAAATAT TCATTGCCAA 
010291 CAGTAATAAT TGCGTCGCTT TACGCCAGGT CGTGGCATTA CGCCAGTCAT TCCACGGTAA TTTGCCGCCC 
010361 GTCGTGCCTG GCCGCCGCTG CCAGCGGGTT CTTTTATTCT CTGCCATGAT TTTGCCAGTC CGTTAAGTTG 
010431 TATACCAAAT GCCACTATTC TAGTTGTTCT TAACTGGCTG ATATTGATTC AAATCGCGTT CAGGTCTTTC 
010501 TTATGCAACC ATGCTTCCAG AGCGGCAACA CTGCGTGTAA TTTCTTCGTG TGGAAGGGGG GCAGATAATG 
010571 GCTGCTGCTC CAGTTGTGCG CATAGCTGGC TGGCGATATG CATTCCCAGA CTCGAGCAAC TGCTTTTTAG 
010641 CTGATGCGCG GCACGCTTTA TTTTCTCGCT ATCCTGACTG GCGCGGGCAA TGTCGATTTC ATCGAGAAGC 
010711 GGCAGGGCAT GTTGTGTAAA TAATACCAGC CATTCGTGGA TCTTCTCCGT CCCCATTAAC TGAGCATCTT 
010781 CATTGAGTTG CGATACATCC AGCGATTGAT CATTATTGAC TTGCAGTTGG AGATAGTGCG CCAGTAACTG 
010851 ACCGAGCACT TCACGCGGCA CCGGTTTAGG GATAATCCCG CGGAATAATG AACTGGTACG CTGGCGCAGC 
010921 GTTTCGTCAA TGACATGGGC GCTAAAGCCA ATCAAAACCA GCGACGGATA TTGCTGTGCC AGTTGTCGGG 
010991 CAAGCGTAAT GCCGTCGATA TCCGGCAGAT CAAAATCCAC CAGTGCGGCA GCAAACGGTT CGCTATTTTG 
011061 CAGTGTCTCT AAAGCCTGCG CGGCATTGCC AACAGCAACA ATCTGCGCAC CACTGGTTTT CAGCATCTCA 
011131 ATGGTAATTC GCTGGGTTAG CGGGTTATCT TCAATTAACA GCAAACGTAA ACCGTCAAGA CGCACCGCCT 
011201 GATTGACTGT TTTTGGCACG GGTGCCGTGG CAACACGTAA CGGCAAGCGT AAACAAAAAC AGCTTCCAAC 
011271 CTCCGGCGTG CTGGTGGCGC TCAGTTCGCC GCCCATCGCC TGGGCCAGAC GGCTACTGAT AGTCAGTCCC 
011341 AGCCCGGTGC CGCCGCGTTT GCCGCTTACC TGCACAAATG GCTGGAAGAT TTCTGCCAGT TTCGCGGGAT 
011411 CAATACCGCA GCCGCTGTCT TCCACTTCGA CCAGCCATTG CTCGCCATCA GTGCGACTAC GCAGGATAAT 
011481 GTACCCTTCG TCAGTAAAAC GCAGGGCGTT GCTCAACAGG TTGGTTATAA CCTGACGAAT ACGTCGTGGA 
011551 TCGCCCATTA ACGCGCACGG CATATCATCG GCAATTGCCG TTGCCAGGCG AATCGGGCGA CCTTTCACCC 
011621 GTCCGCTCAT TAATTGCAGG GTACTTTCCA GCAGCGGGCG CGGTTCAAAG GGCTCATCGC TGACCGAAAC 
011691 ATTCTTGCCA CCTGCTTCGA TAGCGGAATA ATCGAGAATA TCGTTGAGGA TGGTCAGCAA CGATTCACCA 
011761 GAGTCAGTAA TTGCCCGCAA ATCATCACGC TGGGCGTTAA GTGCGGGGTT ATCTGCCAGC AGTTGAGCAG 
011831 TGCCGAGAAT ACCGTACAGC GGTGTGCGGA TCTCATGGCT CATCGCCGCC AGAAACGCCG ATTTTGCCTG 
011901 GCTGGCTTTT TCTGCTTCCG CCCGTGCCTG TCGGTGTTCT ATCACCAGTT CCTGCAATTC AGCTGTACGC 
011971 GCTTTGACCT GCGCCGCCAG CTGTTCGCGG TGGCGATTCA GTGCATGAAC ATTGCTGCGA AACGCATCCA 
012041 TCAGCCGCCC GATGGTATCC AGCTCCCGTA CGCCAGCGGT TTCCGGGAAA GGGGAGTCAA TATCACCGTC 
012111 CAGCAGCCGT TGCAGCGCCT GCGTTTGTTC GGCAAGTGGA CGCGTGACTG AGCGATAAAC CACGCGCCAG 
012181 AGGATCAGAA TCAGTGCGCA AAGTGAAACC ATCCCCAGCA ATAACAGGCT GTATTGCCCG CGTGCACTCG 
012251 CTTTTTCCAG ATGCGCCAGT CCGTGCTGAT TACGCAGCTC AATGGTGTCG ACCAGCTGAC TGACTTCGCT 
012321 ACTAAACTGC GCGAACTGGG CGATGTTATT TTGTGCGAGA GTTTGTAGGT GATTGCTGAT TTCACTGTCC 
012391 TGCTGATACA GCGCCAGCAA ATCGCTATAT TGGCTAACGG TAGTTAACGT TGTTGCGACC TGCGCACGAA 
012461 CACCCGGATC TTCAATGCGT ATTTGCCGAC GTTGCAGAAT TTTCACCGCA TTATTGAGCT GCTTTTCCAG 
012531 CGTTGGTGCA TTTTTCTGGA TCTGCTCCAG CCCCAGATTC ATCACCATTT GCTGCACCCG CAGAGCGCTA 
012601 AGGCGCAGTT CATTCATCTG GTTAACATAC TCAAGATCGA TATCAATCAG CCGATCGAGT GCACTTTCAG 
012671 CAGCCTGACG CTGATCTTGT TCGATCAAAT CGTAAATCCC GGCCTGGGTC GCTCCAGCGG AAGTTGTCGC 
012741 ATTATTCGCC TGACCTTGCG CCAGGCGTGC GATCTCATCG GCGGCAGCGA CTATCTGCTG ACTGAGTTGC 
012811 TGTTGTTGCT GGCGCAGTTG CAAACGCTGC CCCACCAGTT CCCCTTGCTG ACGTAACGAA CGGGAGATCT 
012881 CCTGCTCCTG TTGTTCAATA GCGGTGGTAT CAAAACCTTG TTCCCGTAAC GCTTGCAGCA ACGCATTAAT 
012951 CTTCAGGCTT TGTGCGGTGA GCATTCGCCC CTGCGCCTGC CACATCTTTT CGTTATCGGC ACTGGTCAGG 
013021 TTCTGCGCGG CGAAAAGTTC CCAGGCGCTG GCTTCGCTCA ACTGGCGCGC CATATTCATG GTAGGAATCA 
013091 ATGCCTGAGT GTTGTCTTTT TCCACCTGGC TGATAAAGCG CAGGTTGTAC CATCCCACCA GGGTACTGGT 
013161 CAGGGTTAAC AGCGCCATCA GGGCAAAGCC CATCCAGAGT CTTCGGGTCA GGGTTAAATT CACGGTCGGT 
013231 GCACTTTAGG TGAAAAAGGT TGAGTCGCAA AGCGGAATGC ATCTAGCATA AAGCCTTATT ATTGATGAGG 
013301 CTATCATGCG CGTACTGCTA TTTTTACTTC TTTCCCTTTT CATGTTGCCG GCATTTTCGG CTGATAACCT 
013371 GTTGCGCTGG CATGATGCGC AGCATTTCAC GGTGCAAGCC TCTACGCCGC TTAAAGCCAA ACGCGCATGG 
013441 AAACTGTGCG CGCTTTATCC CAGCCTGAAA GATTCATATT GGTTATCGTT GAACTATGGT ATGCAGGAGG 
013511 CTGCTCGCCG CTACGGTGTG GATTTAAAAG TGCTGGAGGC AGGCGGCTAC AGCCAGTTGG CTACCCAGCA 
013581 AGCACAAATC GACCAGTGTA AACAGTGGGG CGCAGAGGCC ATTTTGCTCG GTAGTAGCAC GACCTCATTT 
013651 CCCGACCTGC AAAAGCAGGT AGCAAGTCTG CCGGTGATCG AACTGGTAAA TGCTATTGAT GCTCCCCAGG 
013721 TGAAAAGCCG CGTTGGTGTG CCCTGGTTTC AGATGGGCTA TCAACCGGGG CGATATCTGG TGCAATGGGC 
013791 GCACGGTAAA CCACTGAATG TGCTGTTGAT GCCCGGACCC GATAACGCCG GGGGCAGTAA GGAGATGGTC 
013861 GAGGGTTTTC GCGCAGCCAT TGCCGGAAGC CCGGTGCGTA TTGTTGATAT TGCGCTTGGT GATAACGATA 
013931 TTGAAATCCA GCGTAACCTG TTGCAGGAGA TGCTGGAACG CCATCCAGAA ATCGACGTCG TTGCCGGAAC 
014001 GGCCATTGCG GCAGAGGCGG CAATGGGGGA AGGGCGTAAC CTGAAAACGC CGCTTACCGT GGTGTCGTTT 
014071 TATCTTTCAC ATCAGGTGTA TCGCGGGCTG AAGCGGGGAA GAGTGATTAT GGCTGCCAGC GATCAAATGG 
014141 TCTGGCAGGG GGAACTGGCG GTTGAGCAGG CCATCAGGCA ATTACAGGGG CAATCGGTTT CTGATAATGT 
014211 CAGCCCACCG ATTTTAGTTC TGACGCCGAA AAATGCCGAC CGTGAACATA TTCGCCGCTC GCTGTCACCA 
014281 GGGGGATTTC GTCCGGTCTA TTTTTATCAG CACACATCAG CGGCTAAGAA ATAACCTTCA CCATGTTGCG 
014351 TCACCAGTAA ATCCGCGCTG AGTTTATGAC GTAAACGACG AATTAACACA TCGACGGTGC GCAGGTCAGG 
014421 GTTTTCCACC CGACGCGCAG AAAGCATACG TAGCAGACGT TCACGGCTGA GAATTTCGCC CGGATTCGTC 
014491 ACAAATGCCA CCAACATTTC ATACTCTGCG CGGGTCAGTT TAATCGGCTC GCCATCCCGC TCCAGCGTAT 
014561 GGCGCGACAC ATTCAGGCAA TAACCGGCAA AGCGATAGCA GTTGTCCTGA GTGTGCGGTT GAGCTTGTCG 
014631 CGCGAGGTCG ATTCGCCAGA GCAGATTTTT CACCCGTACT ACCAGTTCGC GCAGTTCCAG CGGTTTGGTG 
014701 ACGTAATCGT CTGCGCCCAT TTCCAGCCCA ACAATACGGT CAATCCGATC GCTGCGTCCG GTAACCAGAA 
014771 TAATCCCCAC CGTTGAGCGT TCTCGCAGGG CGCGGGTTAA CATCAGGCCA TTTTCATCGG GTAAGTTGAT 
014841 ATCCAGCAGA ATTAAATCTA CCGACTGATT CTGCATAATT TCCCGTAGCC CAGCACCGCT CGCCGTAACG 
014911 GAAACGGTAT ACCCCTCCTG AGTGAAGTAG GATTGTAATC GCGCCTGGGT AACCGGCTCA TCTTCAACAA 
014981 TAACAATGTG ATGTGGCATC AGAGGGTTTT ACTCATTCTG TTCATATCTG TTCATATTCT GCCGTAAGCC 
015051 GTTCATCCTG ACCAGTGCCG CTGTTCATAT TTGCTCATTA AGATCGCTTC ACTAAACCAT AATTCTACAG 
015121 GGGTTATTAT GCGGAAACTC TGGAACGCGC TACGCCGACC CAGTGCTCGT TGGTCGGTAC TGGCGCTGGT 
015191 CGCAATTGGG ATTGTGATTG GCATTGCGCT GATTGTATTG CCACACGTTG GGATCAAAGT CACCAGCACA 
015261 ACCGAATTTT GTGTCAGTTG CCACAGTATG CAACCGGTGT ATGAAGAATA TAAACAGTCG GTGCATTTCC 
015331 AGAACGCCTC CGGCGTGCGA GCTGAATGCC ATGACTGTCA TATCCCGCCG GATATTCCAG GCATGGTGAA 
015401 GCGCAAACTG GAAGCGAGCA ATGATATCTA CCAGACCTTT ATTGCTCACT CCATTGATAC ACCTGAAAAA 
015471 TTCGAAGCCA AACGCGCGGA ACTTGCCGAG CGTGAATGGG CGCGAATGAA AGAAAACAAC TCGGCAACCT 
015541 GCCGCTCCTG CCATAACTAC GATGCGATGG ATCATGCGAA GCAGCATCCT GAAGCAGCAC GTCAGATGAA 
015611 GGTGGCAGCG AAAGATAATC AATCCTGCAT CGACTGTCAT AAAGGTATTG CCCACCAGTT ACCGGATATG 
015681 AGTAGCGGCT TCCGTAAGCA GTTCGATGAG CTGCGCGCCA GTGCTAATGA CAGTGGTGAC ACGCTGTACT 
015751 CTATTGATAT TAAGCCAATT TATGCGGCGA AAGGCGATAA AGAAGCCTCT GGTTCTCTGC TGCCTGCTTC 
015821 GGAAGTGAAA GTCCTTAAAC GTGACGGCGA CTGGCTGCAA ATTGAAATTA CCGGCTGGAC GGAAAGCGCC 
015891 GGACGTCAGC GTGTACTCAC CCAATTCCCA GGTAAACGCA TCTTTGTTGC CTCGATTCGT GGTGATGTGC 
015961 AGCAGCAGGT AAAAACGCTG GAGAAAACCA CCGTTGCCGA CACCAATACC GAGTGGAGCA AGTTGCAGGC 
016031 CACTGCGTGG ATGAAGAAAG GCGACATGGT GAACGATATC AAACCGATCT GGGCTTATGC GGATTCGTTG 
016101 TACAACGGCA CCTGTAACCA GTGCCACGGC GCACCGGAAA TCGCCCACTT TGACGCTAAC GGTTGGATCG 
016171 GCACGCTCAA CGGCATGATT GGCTTTACCA GTCTCGATAA ACGTGAAGAA CGCACCTTGT TGAAATATCT 
016241 GCAAATGAAT GCGTCTGACA CCGCAGGTAA GGCTCACGGC GATAAGAAGG AAGAAAAATA ATGAACAATA 
016311 ACGATCTCTT TCAGGCATCA CGTCGGCGTT TTCTGGCACA ACTCGGCGGC TTAACCGTCG CCGGGATGCT 
016381 GGGGCCGTCA TTGTTAACGC CGCGACGTGC GACTGCGGCG CAAGCGGCGA CTGACGCTGT CATCTCGAAA 
016451 GAGGGCATTC TTACCGGGTC GCACTGGGGG GCTATCCGCG CGACGGTGAA GGATGGTCGC TTTGTGGCGG 
016521 CAAAACCGTT CGAACTGGAT AAATATCCGT CGAAAATGAT TGCCGGATTG CCGGATCACG TACACAACGC 
016591 GGCGCGTATT CGTTATCCGA TGGTACGCGT GGACTGGCTG CGTAAGCGCC ATCTCAGCGA TACCTCCCAG 
016661 CGCGGTGATA ACCGTTTTGT GCGCGTGAGC TGGGATGAAG CCCTCGACAT GTTCTATGAA GAACTGGAAC 
016731 GCGTGCAGAA AACTCACGGG CCGAGTGCCT TGCTGACCGC CAGTGGTTGG CAATCGACGG GGATGTTCCA 
016801 TAACGCTTCG GGGATGCTGG CGAAAGCTAT TGCCTTGCAT GGTAATAGCG TTGGTACGGG CGGAGATTAC 
016871 TCTACCGGTG CTGCGCAGGT GATCCTGCCG CGCGTAGTCG GTTCGATGGA AGTGTATGAA CAGCAAACCT 
016941 CCTGGCCGCT GGTATTGCAG AACAGCAAAA CCATTGTGCT GTGGGGCTCC GATTTGCTGA AAAACCAGCA 
017011 AGCGAACTGG TGGTGCCCGG ATCACGATGT TTATGAATAT TACGCGCAGC TAAAAGCGAA AGTCGCCGCC 
017081 GGTGAAATTG AGGTCATCAG CATCGATCCG GTTGTCACAT CCACCCATGA GTATCTGGGG CGCGAGCATG 
017151 TGAAGCACAT TGCGGTTAAC CCGCAAACTG ACGTGCCGCT GCAACTGGCG CTGGCACATA CGCTGTACAG 
017221 TGAAAACCTG TACGACAAAA ACTTCCTTGC TAACTACTGT GTGGGTTTTG AGCAGTTCCT GCCGTATCTG 
017291 CTGGGTGAGA AAGACGGTCA GCCGAAAGAT GCCGCATGGG CTGAAAAACT GACCGGCATT GATGCCGAAA 
017361 CCATTCGTGG GCTGGCGCGG CAGATGGCGG CGAACAGAAC GCAAATTATT GCTGGCTGGT GCGTGCAGCG 
017431 TATGCAGCAC GGTGAACAGT GGGCGTGGAT GATTGTGGTT CTGGCGGCGA TGCTGGGGCA AATTGGCCTG 
017501 CCAGGTGGTG GTTTTGGTTT TGGCTGGCAC TACAACGGCG CAGGCACGCC GGGGCGTAAA GGCGTTATTC 
017571 TGAGTGGTTT CTCCGGCTCT ACGTCGATTC CGCCTGTTCA CGACAACAGT GACTACAAAG GCTACAGCAG 
017641 CACTATTCCG ATTGCCCGTT TTATCGATGC GATCCTCGAA CCGGGGAAAG TGATCAACTG GAACGGTAAA 
017711 TCGGTAAAAC TGCCGCCGCT GAAAATGTGT ATTTTTGCCG GAACTAACCC ATTCCATCGC CATCAGCAGA 
017781 TCAACCGCAT TATTGAAGGC TTGCGCAAGC TGGAAACGGT TATCGCCATA GATAACCAGT GGACCTCAAC 
017851 CTGCCGCTTT GCCGATATCG TACTGCCTGC GACCACGCAG TTTGAGCGTA ACGATCTCGA CCAGTACGGC 
017921 AATCACTCCA ACCGTGGCAT TATCGCCATG AAACAGGTGG TGCCGCCGCA GTTCGAGGCG CGCAACGACT 
017991 TCGATATTTT CCGCGAGCTG TGCCGTCGCT TTAATCGCGA AGAAGCCTTT ACCGAAGGGC TGGACGAAAT 
018061 GGGCTGGCTG AAACGCATCT GGCAGGAAGG TGTACAGCAA GGCAAAGGAC GCGGCGTTCA TCTGCCAGCG 
018131 TTTGATGACT TCTGGAATAA CAAAGAGTAC GTCGAGTTTG ACCATCCGCA GATGTTTGTT CGCCACCAGG 
018201 CATTCCGCGA AGATCCGGAT CTCGAACCGC TGGGCACGCC GAGTGGCCTG ATTGAGATCT ACTCGAAAAC 
018271 TATCGCCGAT ATGAACTACG ACGATTGTCA GGGGCATCCG ATGTGGTTTG AGAAAATCGA ACGCTCCCAC 
018341 GGTGGGCCTG GCTCGCAAAA GTATCCGTTG CATCTGCAAT CTGTGCATCC GGATTTCCGA CTTCACTCGC 
018411 AGTTATGTGA GTCGGAAACG CTGCGTCAGC AATATACGGT AGCGGGTAAA GAGCCAGTAT TCATTAACCC 
018481 GCAGGATGCC AGCGCGCGCG GTATTCGTAA CGGTGATGTG GTACGCGTCT TTAACGCTCG CGGTCAGGTG 
018551 TTGGCAGGGG CAGTGGTTTC TGACCGCTAT GCACCCGGCG TGGCACGAAT TCACGAAGGG GCATGGTACG 
018621 ATCCAGATAA AGGCGGCGAG CCTGGTGCGC TGTGCAAATA CGGTAACCCC AACGTGTTGA CCATCGACAT 
018691 CGGTACATCG CAGCTGGCGC AGGCGACCAG TGCGCACACT ACGCTGGTGG AAATTGAGAA GTACAACGGA 
018761 ACAGTGGAGC AGGTGACGGC GTTTAACGGC CCCGTGGAGA TGGTGGCGCA GTGCGAATAT GTTCCCGCGT 
018831 CGCAGGTGAA ATCATGACCA CGCTGACAGC ACAACAGATT GCCTGTGTTT ACGCCTGGCT AGCGCAGTTG 
018901 TTCTCCCGTG AGCTGGACGA TGAACAACTG ACGCAAATCG CCAGTGCGCA GATGGCTGAA TGGTTTTCGT 
018971 TGCTGAAAAG CGAACCGCCG CTCACTGCGG CGGTGAACGA GCTGGAAAAC CGTATTGCCA CGCTGACAGT 
019041 ACGTGACGAT GCCCGTCTGG AACTGGCCGC GGACTTTTGC GGCCTGTTTC TGATGACCGA CAAACAAGCG 
019111 GCGCTGCCGT ATGCATCGGC CTACAAACAG GACGAGCAAG AGATTAAACG CTTGTTAGTT GAGGCAGGGA 
019181 TGGAAACCAG CGGCAATTTC AACGAACCGG CAGATCATCT GGCGATCTAT CTCGAATTGC TCAGCCATCT 
019251 GCATTTTTCG CTGGGAGAGG GGACCGTTCC TGCGCGAAGA ATCGACAGTT TGCGGCAAAA AACACTGACG 
019321 GCGCTGTGGC AATGGTTACC AGAGTTTGTT GCGCGTTGTC GTCAGTATGA CAGCTTTGGT TTTTACGCGG 
019391 CACTAAGCCA GTTATTGCTG GTGTTAGTGG AGTGCGACCA CCAAAACAGA TAACGTCGTT TGTGCGCCTG 
019461 AAAAGACGCG TTTAGCGTCG CATCAGGCAT TATGGCGCAG TTGCCGGATG CGGCGTGAAC GTCTTATCCG 
019531 GCCCACAGGA ACTGTAATCT TTGTAGACCG GTTAAGATGC GTCATCGCAT CCGGCAAACA CACATCACGG 
019601 ATGAGCTACA AACCGGGAAA GCCGCTGGCG CAGCAGGCGG TTTTCCTGCT TCAGGTGCGC AATATCATCC 
019671 ATTAACGTCA GCGCCACCGC GATCCCCGGC CAGTCCAGAG CCAGTTCATG ACGCAGGCGT ACCGCGCGTT 
019741 GCACCACAAT GGCGGCATGG TCGTCAAATA CCCAGGTTGT TTCCTGGATC TCACGCGGTT CAACCACCCC 
019811 CAAACCGACA ATTTCATTCA ACTCCTCTTC AGAGATGCCG GTATGCAGGC AAAATTCGGT AATAGTAAAA 
019881 GTCACCGTAA CATTAGCCAT TATGCTTTCC CCCAATCTTT ACGTGGATCA AAAGACGACT GGGCGTCTGC 
019951 CAGTTGCTGC CACAGCGCGG CAGTGTTTTC ATCCGGTTTC GGCGGCATCA CGATTTTCAG TACCGCATAC 
020021 AGATCGCCGG TCTGTTTTTT GCTCACCAGA CCTTTGCCTT TAACGCGCAA TCGTTGCCCG GCCTGGCTGC 
020091 CTGGCGGGAT AGTCAGCAAA ATGCTTTCTT TCAGTGTTGG AACGGTGACT TTAGCACCCA GCGCCGCTTC 
020161 CCACGGGCTA ACCGGCACCA CAATTTCCAG ATCCTGGCCG ACAATATCAA ACAGCGGATG TGGCGCAATA 
020231 TGAATCACCA GCCACAAATC GCCATTTGGA CCGCCGTTTT CGCCCGGCGT CCCCTGGCCT TTCAGACGGA 
020301 TGCGTTGACC ATTGCCGACG CCCGCCGGGA TCTTCACATT CAGCGTTTTC GGAATTTCCT GTTCGATCAT 
020371 GCCAAAGGCG TTATAAACCG GCAGGTTATA GCTGATGGTA CGCTTATGCT CAGTAAGCGT TTCTTCGAGG 
020441 AATACCGCCA CTTCGATTTC AATATCGTGG CCGCGTGTGG CGGGGCGTTG ACGGCTCTGG CGGGCATGCT 
020511 GACCGAAAAT TGACGAGAAG ATATCGTCAA AATCTTCGGC GTTAAAACTC TGACCGTCGC CATGGTGGAA 
020581 CTGACGGTTA AATTGCGGAT CGTTGCGATG TTGCCACATC TGATCATACT CAGCGCGACG TTGTTCATCA 
020651 CTTAACACTT CCCAGGCTTC AGCGACCTCT TTGAAGCGGG CTTCGGCATC CGGTTCTTTG CTGACATCAG 
020721 GATGGTATTT GCGGGCAAGT CGACGATAGG CGGTCTTGAT TGTCTTGAGA TCGTCCGTCG GTTTCACGCC 
020791 CATGATGGCG TAATAATCCT TTAATTCCAT AGCGTTATCT CGCGTAAATC AACACAAATT GAAGGAACCC 
020861 CTGTAAGGTA ACTCCTATAA GTGTAGGGTA ATCCTCAAAA TTTCATATGC CAACACAGAA TATGTTATTG 
020931 AAATCATCGC GGAGAGGAGG TCGCCATCAA GATGGGTTGC TGAACATATT TTAAACAGGT GAAAAAGGGT 
021001 GAGCGATTTT TGATAGTTGA ACCAGGCACT TTAAGTTTAA CTAGGGCGTC ATTATTTATT AAATTTTATA 
021071 GACGCTATAT ATGGGTAGTA ATATACATGG AATTAGTTGC ACTGCAAATA ATTATTTGAA ACAGGCCTGG 
021141 AACGATATAA AAAATGAGTA CGAAAAAAAT CAAACATATT CAATCACGCT TTTTGAAAAC ACACTGGTGT 
021211 GTTTTATGCG GTTATACAAT GAACTCAGAC GTAAAGTAAA TGAAGAGGAT ACTCCATGTC TGGAATGTGA 
021281 ATCACTAGAA AAAGAATTTG AGGAAATGCA GAATGATAAT GATCTATCAT TATTTATGAG AATATTGCGT 
021351 ACTAATGATA CACAAATTTA TTCAGGGGTT TCAGGAGGTA TTACATATAC TATACAATAT GTTCGAGATA 
021421 TTGATATTGT TAGAGTGTCC TTGCCGGGCA GAGCTTCAGA GTCTATCACA GATTTTAAAG GTTATTATTG 
021491 GTATAACTTT ATGGAGTATA TTGAAAACAT TAATGCGTGT GATGATGTTT TTTCTGAGTA TTGTTTTGAT 
021561 GATGAAAATA TAAGTGTCCA GCCAGAGCGG ATAAATACGC CGGGAATATC TGATTTGGAT TCTGACATTG 
021631 ATTTGTCTGG TATATCTTTT ATTCAGCGTG AAACTAACCA GGCATTAGGA TTAAAATATG CTCCTGTAGA 
021701 TGGCGATGGA TATTGTCTGT TAAGAGCTAT ACTGGTTTTA AAACAACATG ATTATTCATG GGCGCTGGTC 
021771 AGTTATAAGA TGCAAAAGGA AGTTTACAAC GAATTCATTA AAATGGTTGA TAAAAAAACG ATCGAGGCTC 
021841 TTGTTGATAC GGCATTCTAT AATCTCAGGG AAGATGTAAA GACGTTATTT GGCGTTGATC TACAATCTGA 
021911 CAACCAAATT CAGGGGCAGA GTAGTCTTAT GTCATGGAGC TTTCTGTTTT TTAAAAAACA ATTCATTGAT 
021981 AGTTGCTTGA ATAACGAAAA ATGTATCCTG CATTTACCCG AGTTTATATT TAATGATAAC AAGAACTTGC 
022051 TTGCTTTAGA TACCGACACG TCGGATAGGA TTAAAGCGGT GAAGAATTTT CTTGTTGTTC TTTCAGATAG 
022121 CATTTGCTCA TTATTTATTG TTAATAGTAA TGTGGCATCA ATCTCCTTGG GGAATGAATC CTTTTCAACA 
022191 GATGAAGATC TTGAGTATGG TTATTTAATG AACACTGGCA ATCATTATGA CGTTTACCTC CCTCCTGAAC 
022261 TTTTTGCTCA GGCTTACAAG TTAAACAATA AGGAAATGAA TGCGCAACTC GACTATTTAA ATCGTTATGC 
022331 AATTTAATGG CAAAGGCATA TGCTAAAAAC CATTGTTATT AGTCTCACAC TTTTTTATTG GTAAATATTG 
022401 TCTCTGTATT GGTAACGCCG CAGATATTCT GTTTAGCCAC AGGTGCAATT ATCAGCGGCG TACGCGAGGC 
022471 AGGGGCTAAT CAGGCATAGT TTGCGTCAAA CCTTGCCTGT TTTTGAAGAT GTATATAGAA AAACAGGCGT 
022541 TCAACAAGCC ATTTTGCGAA CCTGTTCCCG GAAAAAAGTC ATATTTCTGT CACACTCTTT AGTGATTGAT 
022611 AACAAAAGAG GTGCCAGGAA TGAACAAAAC GCTAATCGCC GCAGCTGTGG CAGGGATAGT TTTACTCGCT 
022681 TCAAACGCTC AGGCACAAAC CGTACCGGAA GGCTATCAGC TACAGCAAGT GCTCATGATG AGCCGCCATA 
022751 ACTTACGTGC GCCGCTGGCG AACAATGGCA GTGTGCTGGA GCAGTCGACG CCGAATAAAT GGCCAGAATG 
022821 GGACGTCCCC GGTGGGCAAC TCACCACCAA AGGTGGCGTG CTCGAAGTGT ATATGGGCCA TTACATGCGT 
022891 GAATGGCTGG CAGAGCAGGG GATGGTGAAA TCGGGGGAAT GCCCGCCGCC GTACACCGTT TATGCCTATG 
022961 CCAATAGTCT GCAACGTACC GTTGCGACCG CACAGTTCTT TATTACCGGC GCATTCCCGG GGTGTGATAT 
023031 TCCTGTGCAT CACCAGGAAA AAATGGGCAC TATGGACCCA ACCTTTAACC CGGTGATCAC CGATGATTCC 
023101 GCCGCATTCA GTGAACAGGC GGTGGCGGCA ATGGAGAAAG AGCTCAGCAA ACTCCAGCTT ACCGACAGCT 
023171 ACCAGCTACT GGAAAAAATC GTTAACTATA AAGATTCCCC TGCCTGTAAA GAGAAACAAC AGTGTTCGCT 
023241 GGTGGATGGC AAAAATACCT TTAGCGCCAA GTATCAACAA GAACCAGGTG TTTCCGGGCC GCTGAAAGTC 
023311 GGCAACTCGC TGGTAGATGC GTTTACTTTG CAATATTACG AAGGTTTTCC GATGGATCAG GTGGCCTGGG 
023381 GAGAAATCAA ATCTGACCAG CAGTGGAAGG TGTTGTCGAA GCTTAAAAAC GGCTACCAGG ACAGCCTGTT 
023451 TACCTCACCG GAAGTGGCGC GCAATGTTGC GAAACCGCTG GTCAGTTATA TCGACAAAGC TCTGGTCACC 
023521 GATCGCACCA GCGCACCGAA AATTACAGTG TTGGTTGGGC ACGACTCCAA CATTGCCTCT CTGTTAACGG 
023591 CGCTGGATTT CAAACCGTAT CAGTTGCATG ACCAGAACGA ACGCACGCCG ATTGGCGGCA AAATCGTTTT 
023661 CCAGCGTTGG CATGACAGCA AAGCCAATCG CGATTTGATG AAAATTGAAT ATGTGTATCA GAGTGCGGAA 
023731 CAGTTACGTA ATGCCGATGC GTTAACCCTG CAGGCACCTG CGCAGCGTGT GACGCTGGAA TTAAGCGGTT 
023801 GCCCGATAGA CGCTGATGGT TTCTGCCCGA TGGATAAGTT TGATAGCGTG TTGAATGAAG CGGTGAAATA 
023871 ACAGAAAACT CCCCCGCGAG AAGCGGGGGA GTCGCTGGTT AAACGTTTTT ACGTTCGATG GTCTGTTCGC 
023941 CCCAAAAAAG CGAATCTTTA TCGGTCTTAG CAAAGGCTTT GACTAACACT TCATCACTAC CTTCTTCCCA 
024011 AATCTTTTCC GCCATTTTTT CGTCGTACCC GGCGACTTCG AAAATGGCCT CGGCTATTTC CGGCGACGTA 
024081 TTGCGCAGAG ATGCCCATTC ACCGACGTGA TGAGCTTTCG CTTCTTGAGT TGGCATGCGT ATCCTCCTGT 
024151 TGAAGATTAG CCGTTAAGTT TAACTGCCAG ACCTGCGACA TATTCCCCTT GATAACGAGC AATAGACAGT 
024221 TCTTCCTGGC TGGGCTGGCG TGAACCGTCA CCGCCTGCGA TGGTGGTTGC GCCGTACGGC GTACCGCCGC 
024291 GAACCTGTGA AACGTCAAAT AATTCCTGCG CTGCGTAGCC AATAGGGACA ATTACCATGC CGTGATGCGC 
024361 AAGGGTCGTC CAGGTGGATG TGATGGTTTG TTCCTGACCG CCGCCAGTAC CGGTGGAACT AAAGACGCTC 
024431 GCCAGTTTTC CGTATAGTGC GCCGGAAGCC CACAGGCCGC CCGTCTGGTC GAGGAAGGTA CGCATTTGAC 
024501 CGGACATGTT GCCAAAGCGG GTAGGTGTAC CAAAAATAAT GGCGTCGTAA TCGGCCAGTT CTTGCGGGGT 
024571 TGCAACCGGT GCAGTTTGCG TTTTACCGCC TGCTTTTTCA AATAATTGCG GCGGCATGGT TTCCGGTACA 
024641 CGCTTAACGA CAACTTCAGC GCCATCCACT TTGCTTGCAC CCTCAGCGAC TGCGCGTGCC ATCGTTTCAA 
024711 TATGTCCGTA CATGGAATAA TAAAGCACCA GAACTTTAGC CATTTCTAAC CACTCCTCGT GTTATCTCTA 
024781 TTCCGTAGCG ATTCGCTACC ACTTATTTAA AGATAAGACG TCCTTTTCAG AGTGCAAATT TCACAACCAC 
024851 TTATTTGATT TATAACAACT TTCACAAGCA CGTAATTTTG TCGCAAAATG ACACATTTTT ATCTCATCGC 
024921 GTTTTTTTAA TCATAAGAGC GGCTTATGGA TAATTATTGG AGATGATATC TATTCTCGCT AAGAAGCTGT 
024991 TGCAGGATAT TACCAAACGC GGGTCTGCCC GCGTCAGTTC ACTAAGCTTA GTCCCACGTA GCGAAAATAT 
025061 GGCAGCCGCC ATACGCCGCG TTAATTCTAT GCAATATGAT GTCTATACCC AGACGGAGGT CAGTAATGGC 
025131 AAACCATCGA GGCGGTTCCG GCAATTTTGC AGAAGACCGC GAAAGAGCAT CAGAAGCAGG TAAAAAAGGT 
025201 GGACAGCACA GCGGGGGTAA TTTCAAGAAT GACCCGCAGC GCGCATCTGA AGCAGGTAAA AAAGGTGGTA 
025271 AGAGCAGTCA CGGCAAAAGC GACAACTAGC CGGGCTAATC AATGACGAAT GCATTTTTGT CTGTAGCTCG 
025341 TCAAAAAGCC ATCACCGCCG GTTACCCGGT GGTTGATACT GATGACAAAT GTAAGCTTGC CTGATGCGCG 
025411 ATGCTTATCA GGCCTACCAG AAGATTGCAA TATATTGAAT TTGCACTGTT TTGTAGGCCG GATAAGGCGT 
025481 TTACGCCGCA TCCGGCATGA ACAATGCGTA CGTTGTCAAC AATCTGCACC GCCGGTAACC CCGGCGGTTT 
025551 TCTGTTTATG GCTCCTGATG AACAACTTCT GGCGGTGGAA CGTCAACCAA CTTTCTGCTT AACAACGCAT 
025621 TGAGTAAAAT CGCGCCAAAG GTTGCTGTAC CAATCCCTCC CAACGTAAAA CCGCCCAGCG TGAGAGCAAA 
025691 ATCACCCGCG CCCAGCACTA AGGTTACTGC GACCATAATC AAATTACCGT TCTGGCTTAA ATCGACACGG 
025761 TTTTGTACCC ATATCCTTGC GCCTGCGACG GCAATCAGCC CGAACACAAC AATTGATGCA CCACCAATAA 
025831 CCGCGGCCGG AATGGTATGA ATCAGCGCAC CAAATTTCGG TGAAAAGCCC AACAGCATGG CGATGACGGC 
025901 AGCAGCAACA AACACCAGCG TCGAGTAGAC TTTGGTCACG GCCATCACAC CGATATTTTC AGCATAGGTG 
025971 GTCACGCCGC TACCGCCGAC AGAGCCGGAA AGCATCGTTG CCAGACCATC GCCTACGAAT GCCCGCCCCA 
026041 TATACGGGTC CATATTGCGT CCGGTCATCC CGGCGACTGC CTTGAGATGA CCTAAGTTTT CCGCCACCAG 
026111 AATCACCGCC ACGGGCGCAA TCAGCATCAT TGCCTGACCA TTAAAAGCAG GAGTGGAAAA ATGTGGCAGA 
026181 CCGAACCAGG CAGCATGGCT GACGAGAGTA AAATCGACGG CTTTTCCCAG CCCTAAAACG TTGGTCATCA 
026251 CGCCATACAG CAGACAGGCG ACAATTAATC CTACGAGAAT CAATAACCGC TGGATCATGC CACGGGTAAA 
026321 CACCGCCACC AGCCCAATAC ACAGCACCGT CATTACCGCC ATCCAGCTAT CAAAGGCCGA AGCCGATACA 
026391 CTTTTCACTG CGATAGGCGC TAAGTTCAGG CCAATCGCCA TCACCACCGC ACCCGTCACC ACCGGCGGCA 
026461 TCAGTCGTTC AATCCAGCGC GTACCGATTT TCATCACCAC CAGGCCAATG ACGGTATAAA CCAGCCCACA 
026531 GGCGATAATC CCGCCCAGCG CAATGCTGAT ATTCGGGTTA ATGCCCTGAC CGTTAAAGCC CGTCGCGGCG 
026601 ATCACCACGC CGACAAAAGC CGCGCTGGAG CCGAGATAAC TGGGGACGCG CCCGCCGGTA ATAAAGAAAA 
026671 ACAGTAACGT GCCGATCCCC GACATTAAAA TGGAAAGATT GGGATCCAGC CCCATCAGAA TCGGCATTAA 
026741 CACCGTCGCG CCAAACATCG CCACCGCGTG TTGAACGCCC ATTACTGCCG TCTGAGCAAA CGGCAATCGT 
026811 TCATCCGGCG CGACCACGCC GCTCTCTGTA GAGGTCGATT TTAACTGCCA GTGAGGAAAA CCGAACATTG 
026881 CCATCAGCTG TCTCCTTAAG GAGGTTAACA AGCAGGGCGC ATCAGCGCGT GATAACTGCG ATCGAACCAC 
026951 ACCAGCCCGT AGGGTGTGGT GTGACGATGA ATCGCTTCGA TGGCGCAAAA CAGAATGTCG TGGGTGCCGA 
027021 CGCTCACCAC CTGGCTGATA CGGCAGTCAA ACGAAACCAG AGCCTCTTCC AGTTGCGGGC ATCCGGTCAC 
027091 CCCCGTCTGC CAGCGGGCGG CGGCAAAGCG GTGTTCCATG GGCGTTTTGC CGCCAAAAAG GTTTGAAAGC 
027161 GGCTCCTGCC CGGCGCTAAG TGTATTTACA CACAGCGTTC GATTTTCATT GAATGCCGGC CAGACGGACG 
027231 CCCCACGATT CAGGCACACC AGTAATGTGG GCGGCGTATC GGTCACACTG CAGACGGCGC TGGCGGTGAA 
027301 CCCGGCGCGC CCGGCTGGAC CGTCCGTGGT GATAATATTG ACCGCCGCGC CCATGCAGGA CATCGCATCG 
027371 CGAAAAGTTT GTTGATCGAC AATGTTCATA GTTTGCTCCT TACAACAGCC CGCAGGCTTC TTCAAAGGAC 
027441 AGACGTGGCA GGCGCGCATA AAGCTTGCTG CTATCGCCAT AGCCGATATT AATCAGCAGA TTGCTCTTCA 
027511 GCGTGCTGCC CGTAAAAAAG GCGTCGTCCA CGTGTTGACG GTCAAAGCCC GACATCGGGC CGGTATCCAG 
027581 TCCCAGCGCC CGGCAGGCGA CGATCAGATA GGCCGCCTGC ATGGAACTGT TGCGAAACGC TGTTTCTTCG 
027651 GCAAGTTGTG GGCTGGAGGT AAACCAACTG CGGGCATCAC CGTGGGGAAA CAGTAGTGGT AACCGTTCAT 
027721 AAAATTCACT GTCCCAGGCG ACGATAGCGG TGACGGGCGC GGTCAGGGTT TTTTGCAGAT TGCCGCTGGA 
027791 AAGTGCCGGG CGCAGACGTT CTTTTCCTTC TGCCGTGCGG GTAAACACGA TCCGTGCCGG AGAACAGTTA 
027861 GCTGATGTCG GCCCCCATTT CATCAGGGCA TAAATCTCCC GTAACGTCTC ATCGCTGACG GGTGTCTCCC 
027931 GCCAGCCGTT GTGAGTGCGG GCATCGGTGA ACAGGGTGCT AAGCGCACCT GGGCTAACGG CTTCGTTCAT 
028001 AGCAATTCCT TACAGGGCGG CTTCACGGTG ATGTAACAGG CTGGCAAGCC CGTTGAGTAA CAGAGCATTA 
028071 AACGTTTCGG GATCGGTCAC GTTGCAGGCG TGTCCGCCAT AGGGCATCAC CATTTTCTGG CTATCGGGCA 
028141 GGGCGGCATG AAGTTCACTG GAACATGCTG TTGGCACCAG CAGATCATCA CTGGCGCAGA TGATTTGCAC 
028211 CGGGCAGCGG ATGCGATCCG CATGGTGACT AAAGTCAGCG CGTTTGAGGG CGTTAAGTCG ACGCAGTAAA 
028281 TTATTTTTGC CCTGAAAATG CGCCAGTGCC AGCGCGTCTT CTGCCTCCAG GCGAGGTGCG CGGGCCGCCA 
028351 TCCAGTCGGC GGGATAGAGG AACAACGGCT GCGCTTCCAC CCATGCCTGC GCGCCGCCGC TATACAGTAA 
028421 TCGTTCGCGA ACCTGAAAAC AGCGGCGCGT ATGGGCGTTT ATTCGTAGCC AGCCGTTAAC GCTGATCAGC 
028491 ACAGTTACCG ACGCGGGATA ATCCAGCGCC AGCTGCATTC CCACCAGCGC ACCGAGCGCA TGGCCGACCA 
028561 CTGCGTAATG CTCAATCCCT GCGGCTACCA GCGCCTGATG CAGTTCCGCT GCCATCTGGG CGATACTGTA 
028631 ATCTTCTGCC AGCGTGTCGG GATTATTGCC GGTGCCGCGC TGGTCGTAAC AGACTACCTG ATACTCCTGC 
028701 TCCAGCACCG CCAGTTGCGG TAACCAGTAA CTGCCGCTAC CCCCAAGACC CGAAATCAAC ACCACTACGG 
028771 GCGCATCAGC ATAAGGGGGA GGTGAGAGTG AAAGTTTCAT CGCGGCCTCA CTTGGCGATA TGCGCAATTG 
028841 TGGCGATTTC CACCAGCGCG TCAGGTTTTA CCAGTCCGCA CTGAATGCAG AATCGCGCCG GTTTATCACC 
028911 CGGAAAAAAC TCGGCGTAGA TTTCGTTAAT CGCGGCGTAA TTTTTCCAGT CGGTAATAAA GATGCTGTTG 
028981 AAGGTCACAT CCGCCATCGT GCCACCCGCC GTCTCGATCA CCTTGCGGAT AGTTTCCAGA ACGTGGCGGG 
029051 TTTGCGCCTT TGGGTCATCG GCAAACAGCA CGTTATTATG TTGATCAAAA GCCAGCGTAC CGGAGACATA 
029121 CACCACGCCA TCAGCCAGCG TGCCGGGAAC GAAGGGGGCC AGCGGTGCGC TGCTGCCAGC GGGAATAATT 
029191 ACGGATTTTG GCATCGTTAA ACTCCTTAAG CGATATGAGC AAAGGACGTG GGAGAAAGCG CGTCGCAGAA 
029261 TGTTTCGACG TCGCTGACCC AGCCAAAAAA GGTTTCGATA TTGAACAACG CGGCTTTCTG CGCAAATTTC 
029331 GGCCCCGCCT GGTGAGTTGC GTCTTCAAGC ACCACGCCGA AATACTCCAG AAAAAAGCCG TCGCGTAGCG 
029401 TCGATTCGAC GCAGACGTTG GTAGCGATGC CGGTGAAAAC CAGATGGCGT ATTCCGCGGC TGCGCAAAAT 
029471 GCTGTCCAGC GGCGTATTGA AGAAACCGCT GTAGCGCGGC TTCGGCAGCA CAATATCGCC AGGCTGCGGC 
029541 ACCAGTTCAT CCACCAGTTG ATAATCCCAG GAGCCTTTCG CCAGCAATTT CCCCTGCAGC TGCGGCTGCT 
029611 TACGCATGGT TTTCAGGGCG TTCGATTTAT GAAAATTCGG TGAGCCGGGT CCGCCAGCCT CGACATACTG 
029681 TTCATCCCAG CCATTTTGAA ACCAGATGAT CAGCATCCCT GCCGCTCGCG CTGCGGTCAC GGCGGTTTGA 
029751 ATGTTGGCAA TGACCGGGCG AGTGGTTGAG ACATCAAACC CGGCGAGATC TAAGTAGCCG CCTGGCGTGG 
029821 CATAAGCGTT TTGCATATCC ACCACGATCA GCGCACTTTG CTGCGGATCG AAGGTAATGG CTTCCGGTCG 
029891 AGCGGTTAAG GTCGTCATCA TGCCACCTCC TGAGTCAGCG CAGGTAGATG GGCGCGGCAT TGCATCAGTG 
029961 GTTGAATGCG CTCGCCGAAG GTTTCGATTC CCGACAGAAA ATCGTCGAAG GTTAACAGCA CGCCTTCGGC 
030031 ACCAGGCACG CTTGCGACTT CATCTAACAT GCGCGCGACA CTGGCGTAAG AACCGACTAA CGTCCCCATA 
030101 TTGATGTTTA CCGCCGAAGT GGGATCGGCC ATCTGACGAA CGTTGGTGTC AGTACCGGAG CGGGTATCTT 
030171 TCTGACTTTG TTCGGTTAGC CAGCTTAACG CCTCTTCATC CGCGCCCGCT TTGTAGTGTT CCCATTTGGC 
030241 GCGAGCGGCA TCGTCGGTTT CATCGGCAAT CACCATAAAC AACACATAAG AGCCAACGTC GCGTCCGGTT 
030311 TGCTCTGCGG CCTGTTTCAT CCGCGCAGCG GTCGGGGCGA AAGCCGTGGG TGTATTTACG CCTTTGCCGA 
030381 AACAGAAGTT GAAATCGGCA TACCGGGCGG AGAACGCCAT GCCAGCGTCG CTTTGCCCGG CGCAGATCAC 
030451 TTTCATGGGG ACACTCGGTT GCGGACTCAC GCGACAATCA TTCATGGTGA AAAAATCGCC TTTAAAATCG 
030521 CTTTTCCCCG TGCCCCACAG GTCGCGCAGC ACCTGAACAT ATTCGGTGAG ATAGTCGTAA CGACGGGAGA 
030591 AATAGTCATC GCCAGGCCAG ATACCCATCT GCTCATACTC GGGCTTTTGC CAGCCAGTCA CGAGGTTGAC 
030661 GCCAAAACGC CCGCCAGAGA TGGAGTCGAT GGTTGCGGCC ATACGGGCGA CGATTGCCGG AGGTAACGTT 
030731 AAGGTGGCAG CAGTGGCGTA AATCTGAATG CGCGAGGTCA CGGCCGCCAG CCCCGCCATC AAGGTGAACG 
030801 ACTCAAGGTT GTGATCCCAG AACTCAGTTT TGCCGCCAAA GCCACGCAGT TTGATCATCG ACAGGGCGAA 
030871 ATCGAAATGG TAGTGCTCCG CTTTTTGCAC AATGGCTTTA TTCAGTTCAA AGGTCGGCAT GTACTGCGGC 
030941 GCGTGGGTCG AAATGAGCCA GCCGTTGTTG CCAATAGGTA CGAATACGCC AATTTTCATC ATCAACCTCT 
031011 CTTCGTCTCG TAAAGTGAAA GTCAGACGGG GCGCTGCATC CTGCATATCC TTTTCAGCCG CGTATTGGCT 
031081 TGTTTGCAAA GCGGATGCCA GTTTTTAAAA AGTTAATGTT ATTAATCTGT TAACATTACG TTATCTAAAA 
031151 TATCTGGTAA AAAGTGGACT AAACGGTCAA AACAGTTGCA CATAAAACAT GCATCTGTGC GCGATGAGAG 
031221 TGCAGAAGGT CGAGGCCGGG CGGGGGTTTT GCTATCCTGT TGCCAATCTA CAAGAGGGGA GAGCGCATGA 
031291 CGCAAGGCGC AGTGAAAACA ACGGGTAAAC GTTCGCGCGC AGTAAGCGCG AAGAAAAAAG CGATTCTTAG 
031361 CGCAGCACTG GACACTTTTT CACAATTCGG TTTTCACGGC ACAAGGCTGG AGCAGATCGC AGAGTTGGCG 
031431 GGTGTTTCAA AAACCAATCT GCTGTATTAC TTTCCGTCAA AAGAGGCGCT GTATATTGCC GTGCTGCGGC 
031501 AGATTCTCGA TATCTGGCTG GCACCGTTAA AAGCGTTTCG TGAAGATTTC GCCCCGCTGG CGGCGATCAA 
031571 AGAGTACATC CGTCTGAAGC TGGAAGTCTC ACGCGATTAT CCGCAGGCTT CGCGCCTGTT CTGTATGGAG 
031641 ATGCTGGCAG GCGCGCCGCT GTTAATGGAT GAACTGACGG GCGATTTGAA GGCATTAATT GATGAGAAAT 
031711 CGGCGCTGAT TGCCGGTTGG GTCAAAAGCG GCAAACTCGC GCCGATTGAT CCGCAGCATT TGATTTTTAT 
031781 GATTTGGGCT TCCACTCAAC ATTACGCCGA TTTCGCCCCT CAGGTGGAGG CGGTGACAGG CGCGACGTTG 
031851 CGCGATGAGG TATTTTTCAA TCAAACGGTT GAAAACGTGC AGCGGATTAT TATTGAGGGG ATTCGACCAC 
031921 GTTAAAGATG CCGGAGGAGG TTGTAACATC CTCCGGCTAC CTGTTTAACC TATAGTCATT AAGCTGGCGT 
031991 TACCGCCAGC GGCAGCGGTA TTCACACTCA GCGAACGCTC GATATACAGC CGTTCCAGAA GGATATTGCT 
032061 TTCGCCACGG GCAAAACCCT GCACCGAAAC AATTGTGCCA TCCCGCGCGG CAACTGCTTC ACACAATGCG 
032131 CGAAGCTGAT CCGAATCACC GTGGAAGATC ACCGCATCAA ACGGTTGAGC GGTTATATTT TCCGCTTTCG 
032201 CCAGTTGAAT ACGTTCGCTG ACTGCCGATG GCAATGCCTT CACTAACTGA CGATGCAGCG CGTCATCCGG 
032271 CCACAGTACC TGGCTGCCCA CCGCCAGCAC GGCGGCGAGC TGAGTCAGCG CATCCTGCTC ATCATCGGCA 
032341 ATACACAACA CGCGCTCACG CGGCAGCAGC GTCCAGGTGT TGCGTTCACC CGTCGGCCCC GGCAGCAATC 
032411 GTTGTGTTCC TGCCTGCGCC AGCTCGCCAT ATTGCGTACA TAACGCCTGC AATTCTGGAC GATTTGCTGC 
032481 CCATTCCCGC AGTGCATTTA GCGGCTGAGT CAATGCGGCT TTCAACTGCG CATCGACCGG ATACTTTGCA 
032551 TCCTGACGCG CGAGCGTCAC TGCCAGCGCA CTTTCCGGGC GATTCGCCAG CAGACGGTAG AGATAGAGCG 
032621 GACCGCCTGC TTTCGGCCCG GTACCGGACA ACCCTTCGCC GCCGAACGGC TGCACACCAA CCACTGCGCC 
032691 CACCATATTA CGGTTAACAT ACAGGTTACC AACATGGGCC GAGCCAGTGA CCTGGGCGAT GGTTTCATCA 
032761 ATGCGCGTAT GGACGCCAAG CGTCAGACCA TAACCGGAAG CGTTAATCTG CTCGATCAGC TCTGGTAGCT 
032831 GGTTACGGTT GTAACGCACC ACATGCAGCA CCGGACCAAA GACCTCTTTT TGCAATTCGG CAAAGTCATC 
032901 CAGTTCGATC AGCGTCGGGG CGACAAAGGT GCCGCTTTGC CATTCACGGG CATCTTCGCT GTTTTCCCGC 
032971 ACCGCCTGGA ACACCGGACG GCCTTTGCTA CGCATGGTCT GAATATGGCG CTCAATATTG GCTTTCGCTT 
033041 CGCTATCAAT CACTGGACCG ATATCGGTGG TCAGGCGACC CGGATTACCC ATCCGGCATT CGGCCATTGC 
033111 GCCGCGCAGC ATTTTCAACG TGTGGTCGGC AATCTCATCT TGCAGGCACA GCACGCGCAG CGCCGAACAA 
033181 CGCTGACCCG CACTGTCGAA CGCCGAGGCC AGTACATCCA CGACGACCTG TTCGGTCAGT GCTGAAGAAT 
033251 CGACAATCAT CGCGTTCATG CCGCCGGTTT CAGCGATGAG CGGAATAGGG CGACCCTGAG CGTCCAGGCG 
033321 GCTGGCGATA TTGCGCTGCA GTAACGTAGC GACTTCGGTT GAACCGGTAA ACATCACCCC GCGCACGCGA 
033391 TCATCACCCG TCAGTTGCGC GCCCACGGTT TCACCCCGAC CTGGCAGCAA TTGCACCACG CCTGGCGGTA 
033461 CACCCGCTTC CAGCAAAATG GCGATCCCTT GCGCGGCAAT CAGCGGCGTT TGTTCTGCCG GTTTTGCCAG 
033531 CACGCTGTTA CCTGCCGCCA GTGCGGCGGC GATCTGCCCG GTGAAAATAG CCAGCGGGAA GTTCCACGGA 
033601 CTGATACACA CCACAGGCCC TAATGGACGG TGGGTTTCGT TAGCGAAATC ATCCCGCACC TGTCCGGCGT 
033671 AGTAGTGGAG AAAATCGACC GCTTCGCGCA CTTCGGCAAT GGCGTTACTG AAGGTTTTTC CGGCCTCACG 
033741 CACCAGAATA CCAATCAGTT GCTGCATCTG GCTTTCCATC AGCACGGCAG CGCGGTGCAA AATCGCTGCG 
033811 CGTTCAGCCG GAGGCGTGGC AAACCAGATT GGCGCGTTAT TAACCGCACT TTCCAGCGCC TGTTCTACTT 
033881 CACGCGGCGT GGCTTCACGC ACATAGCCCA CAATATCTTT CGGTTCCGCA GGGTTAATAA CGGGCGACAT 
033951 CTCACCTGCC GCTACCGGTT GTTCCAGCAT TGGCAAGGCC TGCCATTTTT GCAGTGCACT ATTGAGCAGG 
034021 GCAGAGGAGA GCGAGGCCAG GCGGTGTTCG TTAGCGAGAT CCAGCCCTGC CGAGTTGTCG CGCCCGTGAC 
034091 CGTAAAGATC GCGCGGCAGG GGAATTTTCG GATGCGGTAA TCCAGTTTGC CCTTCCTGTT GCGCCAGTTT 
034161 TTCTACAGCA GTGACCGGAT CGGCGACCAG TTCATCCAGT GGCAAAGAGG TGTCGGCAAT ACGGTTAACA 
034231 AACGAGGTGT TAGCACCGTT TTCCAGCAGG CGACGCACCA GATACGCCAA CAGCGTTTCA TGTGTGCCAA 
034301 CCGGAGCATA AATACGACAC GGACGGTTAA GTTTGCCGTC GGCAACTTTC CCGGTGACCT GCTCATACAG 
034371 TGGCTCGCCC ATACCATGCA GGCACTGGAA CTCGTACTGA CCCGGGTAGT AGTTCTGCCC CGCCAGTTGA 
034441 TAAATCGCCG CCAGCGTATG GGCGTTGTGC GTCGCGAACT GCGGGTAGAT TAGATTCGGC ACCGCCAGCA 
034511 GCTTTTTCGC ACAGGCGAGA TAAGAAACGT CGGTATACAC CTTGCGGGTA TAAACCGGAT AACCTTCAAG 
034581 GCCGTCCATC TGCGCACGCT TAATTTCACT ATCCCAGTAC GCGCCTTTCA CCAGGCGAAT CATCAGACGG 
034651 CGACGGCTGC GGGTGGCGAG ATCAATCAGG TAATCGATCA CCAACGGGCA GCGTTTTTGA TAAGCCTGAA 
034721 TAACAAAACC GATGCCGTTC CAGCCTGCCA GTTCCGGCTC GAAACAGAGT TTTTCCAGCA GATCGAGGGA 
034791 GATCTCCAGG CGATCGGACT CTTCGGCGTC AATGTTGATA CCAATATCGT ACTGACGCGC CAGCAGGGTG 
034861 AGTGATTTCA GACGCGGGTA AAGCTCTTCC ATTACCCGGT CATACTGGGC GCGGCTATAA CGCGGATGCA 
034931 GCGCCGACAG TTTGATTGAA ATGCCCGGCC CTTCATAGAT GCCACGACCG TTAGACGCTT TACCGATGGC 
035001 GTGAATCGCC TGCTGATAGG AAACCATATA CGCCTGTGCA TCTGCGGCGG TCAGCGCGGC TTCGCCCAGC 
035071 ATATCGTAAG AGTAACGGAA ACCTTTCTCT TCCAGCTTGC GGGCATTGGC TAACGCTTCC GCGATGGTTT 
035141 CGCCAGTGAC GAACTGCTCA CCCATCAGGC GCATCGCCAT ATCCACACCT TTGCGGATCA GCGGTTCACC 
035211 GCTTTTACCG ATAATGCGGT TCAGCGAGCG GGAGAGGCTG GCTTCGTTAT GGGTGGAAAC CAGTTTGCCA 
035281 GTAAACAGCA GCCCCCAGGT GGCGGCATTA ACAAACAGTG ACGGGCTACG ACCAATGTGT GACTGCCAGT 
035351 TACCGTTGCT GATTTTGTCG CGAATTAACG CGTCGCGGGT GGCTTTGTCG GGAATACGCA ACAACGCTTC 
035421 CGCCAGACAC ATCAGCGCCA CGCCTTCCTG CGATGACAGC GAAAACTCCT GCAATAACCC CTGGACCATA 
035491 CCTGCGCGAC CACTGGCATT TTTTTGATTA CGCAGTTTAT CGGCCAGCTG ATACGCCAGT TTGTGCGCCT 
035561 GTTCAGCAAC TGGCTGCGGC AGGCGGGCTT GTTCCAGCAG CATAGAAACC GCTTCGGTTT CCGGGCGGCG 
035631 ATAGGCCGCG GTGATCGCGG CGCGGGAAAC CGACTGGGGC AATATTTGCT CGGCAAAGTC GAGGAATGGC 
035701 TGGTGTGGTT CCTCTGCCGG AGTCGGTGCT TCATCGCTCT CATTGGCCGC GCCAGAAAGC AGCGCAGGTA 
035771 GCTCCGGCAG AGTATCGCTG TTTTCCAGTT GTTCGAGATA AGAAAAAATC GCCTGCTTAA TTAACCAGTG 
035841 TGGTGTGCGA TCGATACGTG TCGCGGCAGA CTTAATACGC TCACGCGTCG CGTCGTCCAG CTTAACCCCC 
035911 ATGGTGGTGG TTCCCATGCC ATTACTCCTG TTGTTCAGAA AGGTGCAACT TAACGTTATC GTGAAATATC 
035981 CATGATGTTG CAACTTTGTG CAACCATGTT AAATGTGACA TGCGTAGCAA GCTTAAAAAT GAATGAAATG 
036051 TTAATAAAAG AAATCGATAT GACAGGGATT AAAAAAATAA CTCAGACTTT TTCTCTGCGG CAGTTAACAT 
036121 TTTTGAAAGG TGCAACCGCA AAAAATGTGA GAGAGTGCAA CCTGATGAAA AATAGTGTCG CTGAGCACTA 
036191 AAATTTAATG TAAATGGTGT GTTAAATCGA TTGTGAATAA CCAGCGCTTC CGGCAGGATA CGGTCGCCCT 
036261 GGTAAAACAT AAACTCTGTT ACCCCGTTCC GGTGGCAGAT ATAACGGCAA GTTTCGACAT TGCCGATAAT 
036331 AATTTTTTGG AGACTTTAGA TGGCTATTAG CACACCGATG TTGGTGACAT TTTGTGTCTA TATCTTTGGC 
036401 ATGATATTGA TTGGGTTTAT CGCCTGGCGA TCAACGAAAA ACTTTGACGA CTATATTCTG GGCGGTCGTA 
036471 GTCTTGGGCC ATTCGTGACG GCATTATCGG CGGGTGCGTC GGATATGAGC GGCTGGCTGT TAATGGGGTT 
036541 GCCGGGCGCT GTTTTTCTTT CCGGGATTTC CGAAAGCTGG ATCGCCATTG GCCTGACATT AGGCGCGTGG 
036611 ATTAACTGGA AGCTGGTGGC CGGGCGGTTG CGTGTGCATA CCGAATACAA CAATAACGCC TTAACACTGC 
036681 CGGATTATTT CACCGGGCGC TTTGAAGATA AAAGCCGCAT TTTGCGCATT ATCTCTGCGC TGGTTATTTT 
036751 GCTGTTCTTC ACCATTTATT GCGCTTCGGG CATTGTGGCA GGCGCGCGTC TGTTTGAAAG TACCTTTGGC 
036821 ATGAGCTACG AAACGGCTCT GTGGGCGGGC GCTGCGGCGA CGATCCTTTA CACCTTTATT GGCGGTTTCC 
036891 TCGCGGTGAG CTGGACTGAC ACTGTACAGG CCAGCCTGAT GATTTTTGCC CTGATCCTGA CGCCGGTTAT 
036961 CGTCATTATC AGTGTCGGTG GCTTTGGTGA CTCGCTGGAA GTGATCAAAC AAAAGAGCAT CGAAAACGTT 
037031 GATATGCTCA AAGGTCTGAA CTTTGTTGCC ATTATCTCAC TGATGGGTTG GGGGCTGGGT TACTTCGGGC 
037101 AGCCGCACAT TCTGGCGCGT TTTATGGCGG CGGATTCTCA CCACAGCATT GTCCATGCGC GTCGTATTAG 
037171 TATGACCTGG ATGATCCTCT GCCTGGCAGG GGCGGTGGCT GTCGGCTTCT TTGGGATTGC TTACTTTAAC 
037241 GATCATCCGG CGTTGGCTGG TGCGGTAAAT CAGAACGCCG AGCGTGTGTT TATCGAACTG GCGCAAATTC 
037311 TGTTTAACCC GTGGATTGCC GGGATTCTGC TGTCGGCAAT TCTGGCGGCG GTAATGTCAA CCTTAAGTTG 
037381 CCAGCTGCTG GTGTGCTCCA GTGCGATTAC CGAAGATTTG TACAAAGCGT TTCTGCGTAA ACATGCCAGC 
037451 CAGAAAGAGC TGGTGTGGGT AGGGCGTGTG ATGGTGCTGG TGGTGGCGCT GGTGGCGATT GCGCTGGCGG 
037521 CAAACCCGGA AAACCGCGTG CTGGGCTTAG TGAGCTACGC GTGGGCAGGC TTTGGCGCGG CGTTTGGTCC 
037591 AGTGGTGCTG TTCTCGGTGA TGTGGTCACG CATGACGCGT AACGGTGCGC TGGCGGGGAT GATCATCGGT 
037661 GCGCTGACGG TTATCGTCTG GAAACAGTTC GGCTGGCTGG GACTGTACGA AATTATTCCG GGCTTTATCT 
037731 TCGGCAGTAT TGGGATTGTA GTGTTTAGTT TGCTGGGTAA AGCGCCGTCA GCGGCGATGC AAAAACGCTT 
037801 TGCCGAGGCC GATGCGCACT ATCATTCGGC TCCGCCGTCA CGGTTGCAGG AAAGCTAAGG GACTTAGCCT 
037871 GCGGCGGTTT TGTTTGGCTT CAGCAGCGGG TTGCGCTCCC TTAATGTGCC TCGCCATATA AATTGAATGG 
037941 TGCAGGGAGC GCGCAGGGGG CGGCCAATCG CCGCCGCCCC CTGCTGTCCC GGCCTTCGGG GAACGCTTCA 
038011 GCGATTTTGA CGCCACCAAC ACCCGAGCTG TTATTATGTT CCGGGCAAAA AGTTAGATTT GATAATCGCG 
038081 GATGGACGAA ATTGCTTGAT ACACCCGCTT ATCAGTTTTA CATGGAAGCT CTGATGCATT GAGTCTGGAC 
038151 AGTTTTGTCG GCTGGATACG GCGTTTACGC GGCATCCGGC AAGAACACAT GGTTCTTTGC AAACAATCCC 
038221 ATCTTTCTAC CCTGGAATAA TCGTTTATAT CCCTTGGCAT TACCTCTCTT TGTTTACATT CCAACATCAT 
038291 TTTATAAACA TTCCGCTTGT GTTTTTCTTT GCCGTAATGA TAATCGCTAT CACTGCGATT TACTTTTCTT 
038361 TGCATAGATT GACTCAGAAA AACGTTTAAG GGTGGGTGGC ATGTTTGTTC CGTTTCTCAT TATGTTGCGC 
038431 GAAGGACTTG AAGCCGCGCT GATTGTCAGT TTGATTGCCA GCTATCTTAA GCGTACCCAG CGAGGCCGAT 
038501 GGATTGTGTG ATGTGGATTG GCGTGTTGCT TGCCGCTGCG TTGTGCCTGG GCTTGGGTAT CTTCATTAAC 
038571 GAAACCACCG GCGAATTTCC GCAAAAAGAA CAGGAACTGT TTGAAGGTAT CGTGGCGGTG ATCGCCGTGG 
038641 TGATCCTTAC CTGGATGGTT TTCTGGATGC GCAAAGTGTC GCGCAACGTC AAAGTGCAAC TGGAACAGGC 
038711 AGTCGATAGC GCATTGCAGC GTGGAAATCA TCATGGCTGG GCGCTGGTGA TGATGGTCTT TTTTGCCGTT 
038781 GCAAGGGAAG GGCTGGAGTC GGTCTTTTTC CTGCTGGCGG CATTTCAACA AGATGTCGGG ATCTGGCCGC 
038851 CGCTGGGTGC AATGCTCGGT CTTGCTACTG CCGTGGTGCT AGGCTTCCTG CTCTACTGGG GCGGTATTCG 
038921 CCTCAATCTT GGTGCATTTT TTAAATGGAC CAGCCTGTTT ATTCTCTTCG TCGCCGCAGG GCTGGCAGCT 
038991 GGTGCCATTC GCGCATTTCA TGAAGCCGGA TTGTGGAACC ACTTTCAGGA AATCGCCTTC GATATGAGTG 
039061 CGGTGCTCTC AACTCACTCG CTGTTTGGCA CGCTGATGGA AGGGATTTTT GGCTATCAGG AAGCGCCGAG 
039131 CGTCAGCGAA GTCGCCGTCT GGTTTATTTA TCTCATCCCG GCGCTGGTGG CATTTGCTCT GCCACCACGC 
039201 GCAGGGGCGA CAGCGTCTCG CTCCGCGTAA CAAATACGAC GCAAACTCTT GCTTAGTTAC AACATACTTT 
039271 AAAGGGATAG TCTCGTCATG ACCATTAACT TCCGCCGTAA CGCATTGCAG TTGAGCGTGG CTGCGCTGTT 
039341 TTCTTCTGCT TTTATGGCTA ACGCCGCTGA TGTGCCGCAG GTCAAAGTGA CCGTGACGGA TAAGCAGTGC 
039411 GAACCGATGA CCATTACGGT TAACGCCGGG AAAACACAGT TCATTATTCA GAACCACAGC CAGAAGGCGC 
039481 TGGAGTGGGA GATCCTCAAA GGCGTGATGG TGGTGGAAGA GCGGGAAAAT ATCGCCCCTG GCTTTAGCCA 
039551 GAAAATGACG GCGAATTTAC AGCCTGGCGA ATACGATATG ACCTGCGGTC TGCTGACTAA CCCGAAAGGG 
039621 AAGTTGATCG TCAAAGGTGA GGCAACGGCG GATGCGGCGC AAAGTGATGC GCTGTTAAGT CTTGGTGGTG 
039691 CAATTACTGC ATATAAAGCG TATGTCATGG CGGAAACCAC GCAGCTGGTG ACCGACACCA AAGCCTTTAC 
039761 CGACGCGATT AAAGCAGGCG ATATCGAAAA AGCGAAAGCA CTGTATGCAC CGACGCGCCA GCACTATGAG 
039831 CGTATTGAAC CGATTGCTGA ACTGTTCTCC GATCTGGATG GCAGCATTGA CGCCCGTGAA GATGATTACG 
039901 AGCAAAAAGC CGCCGACCCA AAATTCACTG GTTTCCACCG TCTGGAAAAA GCATTGTTTG GCGACAACAC 
039971 CACCAAAGGG ATGGATCAGT ACGCTGAGCA GCTTTATACC GATGTGGTCG ATTTGCAAAA ACGCATCAGT 
040041 GAACTGGCTT TCCCACCTTC AAAAGTGGTC GGCGGCGCAG CCGGACTGAT TGAGGAAGTG GCAGCCAGCA 
040111 AAATTAGCGG TGAAGAAGAT CGCTACAGCC ACACCGATCT GTGGGATTTC CAGGCTAACG TTGAAGGCTC 
040181 GCAGAAAATT GTCGATTTGC TGCGTCCACA ACTGCAAAAA GCCAACCCGG AACTGCTGGC AAAAGTCGAT 
040251 GCCAACTTTA AAAAGGTCGA TACCATTCTG GCGAAATACC GTACTAAAGA CGGTTTTGAA ACCTACGACA 
040321 AATTGACCGA TGCCGACCGG AATGCACTGA AAGGACCGAT TACTGCGCTG GCGGAAGATC TGGCGCAACT 
040391 TCGCGGTGTG CTGGGACTGG ATTAAGCGTT ATGCAGTATA AAGATGAAAA CGGCGTGAAT GAACCGTCAC 
040461 GCCGACGTTT ACTGAAAGTG ATAGGTGCAC TGGCGCTGGC GGGAAGTTGT CCGGTCGCTC ATGCACAAAA 
040531 AACGCAAAGT GCGCCGGGTA CGCTTTCACC GGATGCTCGC AATGAGAAAC AGCCGTTTTA TGGTGAGCAT 
040601 CAGGCAGGGA TCCTGACGCC ACAACAGGCC GCAATGATGC TGGTGGCGTT TGATGTGCTT GCCAGCGATA 
040671 AAGCCGATCT TGAGCGGTTG TTTCGCTTGT TGACTCAGCG TTTTGCTTTT CTGACTCAGG GCGGAGCAGC 
040741 ACCAGAAACG CCAAATCCGC GCCTGCCACC ACTCGATTCC GGCATTCTTG GCGGCTACAT TGCGCCCGAT 
040811 AATCTCACCA TCACGTTATC GGTGGGTCAC TCATTGTTTG ATGAGCGCTT TGGCCTTGCG CCACAGATGC 
040881 CAAAAAAGCT GCAGAAGATG ACGCGTTTCC CCAACGACTC GCTGGATGCG GCGTTATGTC ATGGTGATGT 
040951 GTTGCTACAG ATTTGCGCCA ACACCCAGGA CACGGTTATC CATGCGCTGC GCGATATCAT CAAACACACG 
041021 CCGGATTTGC TCAGTGTGCG CTGGAAGCGG GAAGGGTTTA TTTCCGATCA CGCGGCGCGT AGTAAAGGCA 
041091 AAGAGACGCC GATTAATTTG CTGGGTTTCA AAGACGGCAC TGCCAATCCC GATAGCCAGA ATGATAAGTT 
041161 GATGCAAAAA GTGGTGTGGG TAACGGCAGA TCAGCAGGAG CCTGCGTGGA CAATCGGTGG CAGCTATCAG 
041231 GCAGTACGCT TGATTCAGTT TCGAGTGGAA TTTTGGGACA GAACGCCGCT GAAAGAACAG CAGACGATTT 
041301 TTGGCCGTGA TAAGCAAACC GGTGCGCCGC TGGGAATGCA GCATGAGCAT GATGTGCCTG ATTACGCCAG 
041371 CGACCCGGAA GGGAAGGTGA TCGCGCTGGA CAGCCATATC CGGCTGGCGA ATCCCCGCAC GGCGGAGAGT 
041441 GAGTCCAGCC TGATGCTGCG TCGTGGCTAC AGTTATTCAC TGGGCGTCAC CAACTCCGGG CAACTGGATA 
041511 TGGGGTTGCT GTTTGTCTGC TACCAACACG ATCTGGAAAA AGGCTTCCTG ACAGTACAAA AAAGGCTCAA 
041581 TGGCGAAGCG CTGGAGGAAT ACGTTAAACC TATCGGCGGC GGTTATTTTT TTGCGCTGCC GGGGGTGAAG 
041651 GACGCGAACG ATTATTTCGG AAGCGCGTTA TTGCGGGTTT AATGTTTTTA GGCGGATAAG GCATTTGTGC 
041721 GCAGATGCCT GATGCGACGC TTGCGCGTCT TATCATGCCT ACAATCAGTG CGGGTTTGGT AGGCTGGATA 
041791 AGGCGTTCAC GCCGCATCCG GCGATCGTGC ACTGATGCCT GATGCAAATC CTGCTGAAAG CACACAGCTT 
041861 TTTTCATCAC TGTCATCACT CTGTCATCTT TCCAGTAGAA ACTAATGTCA CTGAAATGGT GTTTTATAGT 
041931 TAAATATAAG TAAATATATT GTTGCAATAA ATGCGAGATC TGTTGTACTT ATTAAGTAGC AGCGGAAGTT 
042001 CCCGGCAGTG ATAGTCAGTC ACTATGGAGA TCGCGGATGG TAACGTCCTG TACTGGACAT GTTTTAGATA 
042071 ATCAACGCGC CACCACTCGC GGAGTTTTCT CCTCCGGTAG TCATCTCGTC ACTTTGCATT TTCAACCTCA 
042141 TCCTTTCTTT TCATGTGTTA CCGACGCCGT AAACGGTGCG CGTAGCCGTT TTTCGGCATT TTATCCAAAA 
042211 GCAAACTATG GCTTACAAGG AAGCCAACCC TCTGATGTTC GTGCGCATAA TCGCGCTGCC AACGGCGCGT 
042281 GTGATGAATA CAAACAACTC AAGGTGCTCT CCATGGGAAG ACAAAAAGCA GTGATCAAAG CTCGTCGCGA 
042351 GGCAAAACGT GTGCTGAGAC GGGATTCGCG CAGCCATAAG CAGCGTGAAG AAGAATCGGT CACCTCGCTT 
042421 GTGCAGATGG GCGGCGTAGA AGCCATTGGT ATGGCCCGCG ACAGTCGCGA TACTTCGCCC ATCCTCGCGC 
042491 GAAATGAAGC GCAATTGCAC TATCTGAAGG CTATTGAGAG TAAGCAGCTG ATATTCGCCA CGGGCGAAGC 
042561 CGGGTGCGGA AAAACCTGGA TCAGCGCAGC AAAAGCGGCA GAGGCCCTGA TACATAAGGA TGTCGACAGG 
042631 ATTATCGTCA CCCGTCCAGT TCTGCAAGCC GATGAAGATC TTGGCTTCTT ACCTGGAGAT ATCGCAGAAA 
042701 AGTTTGCTCC CTATTTTCGC CCGGTCTACG ACGTGCTGGT CCGGCGCTTA GGGGCTTCCT TTATGCAGTA 
042771 CTGCCTGCGA CCGGAAATAG GGAAGGTGGA AATTGCGCCG TTCGCCTATA TGCGTGGACG TACCTTTGAA 
042841 AATGCAGTCG TCATTCTTGA CGAGGCGCAG AATGTGACTG CCGCGCAAAT GAAAATGTTT TTAACCCGCC 
042911 TCGGGGAGAA CGTGACGGTT ATCGTCAACG GTGATATCAC GCAATGCGAT TTGCCTCGCG GCGTGTGCTC 
042981 CGGATTAAGT GACGCGCTGG AACGTTTCGA AGAAGATGAA ATGGTTGGGA TCGTCCGGTT CGGTAAAGAG 
043051 GACTGCGTAC GTTCGGCACT TTGCCAACGT ACGCTGCATG CCTACAGTTA AGTGTGTTAT CGGTGCAGAG 
043121 CCCGGGCGAA CCGGGCTTTG TTTTGGGTGT TTATGCCCGG ACTAGCGCTT TTTCTGAAAC AACCATTTTT 
043191 ATTTGCCCCT GGCTGGTGAA GTGTACGCTC ATCCTGTGGC TTTTTTGTAG TTGCTGATAG AGCTCATCAG 
043261 GTATTGCTAA GCTCTCTGCA TATTCTTGCG GCGTATATTG GTAGGCTGCA TGATGCTGCT GTTTTTGAAA 
043331 ACGCAGCTTA TTGTACAGCG CCCAGACAAT TAACACGACG GCATTCGCCA CTGCCAGCAA AAAATAGAAC 
043401 TGAAGTCGGC TTCTGGCCTC GCTTTGCCAG TAATAACCCG TCAGCAGATC CATGGCGAAT AAGAATATGA 
043471 ACAACGCAAA TAATGTCCAC AAGATGGTTG TGGCAACATA ATCAACCAGT AAACGTACTG GTGATTGTCG 
043541 GGTCGTAATA ATTAAATTGT TCATATTAAC CTCTCAGAAT CCCGCGATCG GGACTTACCC AACGGGCGCG 
043611 TTGCTTTTTA GGCATCAACA TGACTCGTGT AAATGATACC AATGTCGTTG CCAGGCTCAG CATCCAGAAA 
043681 ATAACCGGGA ACCAAATAAT CCAGAAAAGC GATGAAGTCA GATTATGCTC ATAGCGATTC TCGATCATCA 
043751 GGCTGACAAT AAATTGCAGT AAACATAACG TACACAATAA TATTCCGGCA GTATGTGTCG CAGCGATATG 
043821 TGTCAATTCA ATATTTAACG GTACACCGGC AAGTTGGACT GCGTAAATAA TGAAACCGAC CAGGCAGGTG 
043891 AAGGCCCATA TTGTCGTCAG GCAGTATTCA AAAAACAGCG GCCACATTCG AAAGTTTTCT TTGCGCCACA 
043961 ACCTTGTCAT ATTTTTGAGG AATACTTCTG CACCGCCCTG AGCCCAGCGC AGGCGCTGTT TCCACAGCCC 
044031 TTTTAACGTT TCAGGCATTA ATATCCAGCA CAGTGCCCGT GGCTCGTAAA AAATCGTCCA CTGATTCAAC 
044101 TGCAGCTTCC AGCTAATATC AATATCTTCG GTGATCATAT CGTCACTCCA GTAACCCACT TCTGCCAGGG 
044171 CGCTGCGACG AAATGCGGCA ATAACACCGG AAACGGTAAA TACGTTTCCA TAGATACGCT GGGTTCGCTT 
044241 GATCAAACCA ATAATTGAGG AATACTCGCC AACCTGAATT TTACCCACCA GGGTAGAACG TGTTCGAATA 
044311 CGAGGATTAC CGGTTACGGC ACCCACACGC GGGTTGTACA ACATCGGTTC CACAATATAT GCCGCCGCAT 
044381 CGCGGTCTAA TAACGCATCG CCATCAATGC ACACCAGATA TTCACTTTTC GCCGCGGCAG CTCCGGTTTT 
044451 AAGCGCAATG GCTTTCCCCT GGTTTTGCGC CAGATGAATG ACCCGCAAAT GGGGAATTTG TGCAGCCATG 
044521 CGATCCAGGA TGGCACGGGT TTTATCTGTT GAACCGTCAT TTACGGCAAT AACTTCAATG TTCTCATAAC 
044591 GCTGTGCTAA AGCGGCGTGT ATGGTTTCCT CAACGTTTTT CTCCTCATTA AAACAGGGAA TGATAATGGA 
044661 GATAGACGGA TTATCTTTCA ACTGGGGAGC TGGTGCGTTT TCTCCCCACG GCCAGTGGCG TTCACGATAG 
044731 ACCCAGAAAT AGACGCCGCC AACAATCCAC ATAATGGACA TAAAAAACGG CCAGAAGAAA ACGAACCTCA 
044801 TCATCAGTTC ACCAGAGTGA AAGTACGCTA CGCATAGGGG TATGCATAAC ACCAGACATA ATATAAAAAA 
044871 CGATACGATG CGATTAATCA TTTTTCGGAT ACCAGGCTGT TGAAAACTCA GGACGAATAA GGTCTATTTC 
044941 AGGTTGGTTA TGCAGAAAAT TGTCGGGATA ATAACCATAG TTTTTCACTC CATTCAGTTG TAATAGGCTC 
045011 ATCCAGTGAG CGAGTTGTTG CGAAGAAATA GCCTGATGCT GACCATTTTT CTGCCAGTTT TGTGCCTGTA 
045081 ATTCTAAAAT AGATTTGTCT TTAGCCTGAG GGATGTTTTT AATTTGATTG GTCAATTGTA TTAACCATTG 
045151 GTCAGCCGAT TTTTCTGCGA CACCTTCCAG ATAAGGCATA GCCATAATAG CGGTCCAGTC ATAGCTTTTT 
045221 AGGAAATCAG CATAATTCTG TGCAAACCAG GCTTCACTTT CAGGTTGTAT TACCGGAAGT GCAAAAATAT 
045291 TTCGTGCAGT TTTAATATGT GGACCGCGAA TGGCTTTTAC GCGCGCACTA AGTTCTAAAG TGAAGTCAGT 
045361 TAACGCACGA CTTTTAAAGC GGGCCCACTG TTTAAATTGC TCCGGGTTTT GTCGAATTTC GCTCAGACTC 
045431 CCGCTAAAGC CTGCTTGCTG ATAAGCCGTG ATAGCCGGTG CACTGGCATC TTCATAATCT GAAAGCAAAG 
045501 CATCATCGTG GAACAATATG CCATCAAAAG CAGCATGTCC GGCAAGATCT TCATATAACA TGCCAACTTG 
045571 TGCTCTGACT CTGTCATCGA AAGGAGAGAG ACGGTGATAT TGTTCAGGAT GAATTTGTGC TTTTTTCTCC 
045641 CCTGTTGGTA AGTATTTTAC TCGCGTTAAT GTGGGATCTA AATCCCAGCT TAATACCGGC ATCCACGCAT 
045711 AGATGTTTAC ACCTGAGCGG GTACGTAATT GCCAGGCAAC CCGACTAAAA ATATCTGCTT TCATTGGTAG 
045781 CAAACGATTT GGAAACCAGA CCTCTTTGAC CAGCCCATCA CCATCGGGAT CAGCAAATGC CTGCAAATAC 
045851 ACGGTTGATA TTTGCATATC TTTCACCCGC TGAATTAGCA CATCAATATT GCGATCCATT TGCTGGAGGT 
045921 TTTCGTCATA AACGTAATCA AGATCGATAT GCATTATCCG TTGTGGTGAT TTTTCCTGTA CGGTAATAAT 
045991 TTGCTGGGCA AACTCTTTTA ATGAGGGATT ATTGGCGATT AATACCCGCG GAATGGAATC CAATTGCGAC 
046061 GCATTTGCCA AACCTGATTC AAGGGTGAAG AACATGTCAT AACCGAGTTT TTTTAATTCC TCTATCGCTA 
046131 TGCCATTCGC TTCGCCATAA GGCCAAACAA AAACGTGTGG ATTTACCTCA ACCTTTGTAC GCAGGTATTC 
046201 CGTCATTTTT ACAGCATCCA GACGAATTCT TTCCCGGTAT TCTGCTGCGG TTTCATACCG TGCGTGGTCA 
046271 GTAAAATATG CACGATTTAC ATATACAGGC AATAAGCTGC CGGTGGCATT AGCCTGAATA CCGTAGTGAG 
046341 AATTCCATGT ATGAGAAGCG AGCTCAACGA GCCGGGAACG CGCAACTTCT CGCACTTGTT GCCACGTGGC 
046411 AAAATATTCT CGATCGACCA ACTCATCGCC AAATTTTACT TGTTTATCCG CTGGCGTATC GACCCAACTG 
046481 CCGACGGGGG CCCATACAGC AGGCCACTGG AAGGCCTGAA GAATTGGGAA GACGCGGGTA TAAAAACTCT 
046551 GGTAGCCGTC ATCAAAAGTC AGCACTACAG CTTTTTCCGG TAGCGGTTTT CCTCCTCGAT GTGCTTCACG 
046621 AATTTGAGCA ATACTGACCG GTTGATAACC GTTCTCGCGC AGCCAGGCAA ATTGTTCACG CAGTGCTGAT 
046691 GTCCGCACTG ACATAAAACG CTGGTCGGCA GCTTCGTCTT CAACGTTATG CCATGAAATC GCTACAAAAC 
046761 CATTATGCGG CCACGGTTGC TCGGCGAGTA AAGATTCGCG ATCCTGTGGC GGTATAAATG ATGTTCTTGA 
046831 CTGGCTAATG CACGCGGTGA GCATAATTAT ACTCACCAGC ATCAGGAGAT ATTTATTTCC ATTACGTAAC 
046901 ATATTTATCC TTAAAATCTG AATGTCATAT CGAATTCAAC GTATAAGTTG TGTTCTCTGT CACCGTCATA 
046971 AGGTCGTTTT TCCCAGCGTA GCGTTGCGCC AGCATCAATC ACGTCATTCC AACTAATGCG TTGCCCGTAG 
047041 CCGAGTTGGG TGACGACATC CGTGCCATAA TGTTTTTGCC AGGAGGCACC AACACCTGCG CTGAATATTT 
047111 GCTCCCAGCT ATTTTCATAG CTTCGCCATA ACAAATGGCT TGCCTCAAAT GCCGGAACAA TATCGAACGT 
047181 TTTTATAGGG TTGTAGTATG GGGTATCGTG TTCTGTATTT TGTTCGTAAT ACAGACTGGG TAGGAAATCG 
047251 ACAATCAAAT ATGGTGAAGA CCAGATGCGT TCCTGACCCT CAAGTGAGAC TTCATGACGC TGGTTACTGT 
047321 CGGAAAAATC AGTGAAAGCC CAGGAGACAC CGTACTTACG CCGCTCATTT TGATACCAGC GAACATAAGC 
047391 CTGAGCACTG TTGCCTGTAA CACCATTTTT CATTGCCCGT AATGGAACGC GGTGAGAGAG GCGTTCCAGT 
047461 TGCGAACCAA TACGCCAGTT ATCATTAAAA TCATACCAGC CAGACAGGCG CGCGCCGGGT TTATGCTCAT 
047531 GATTGAAAAC GCGTTCAGCG TACTCTGCCT CGAGCCAGAT ATTACGTGAC CGCCACTCAA CACCCGCAAG 
047601 CCAGTCGCGA ACAATCCCTT TTCCTTCGCT AAATTGTCCA TCGGCATAAC CGAATCCAGC AAAACCGCGC 
047671 CAGTTATCCT TCAGCGGTGG TGAATAAACG ATGGTGGTTA AGTCGACATC ATGTTTACCA CTATCCGGGC 
047741 CTTCGGCATC AATTCCTGTT GAGCCAGCGA TACGAAGCTC TGCAAGATTA TGTACATCAA CCGCACGTTT 
047811 TAATCGTACA ACGCCGGGAT CTTGCGGTTC ACGTTCGACA ACATCGTGCG TTAAGACAGC TGCCTGCTGC 
047881 CATTCTTGTA ACGTTAATGC TGTCCAGGCT TGTTCAACCT CCAGATTAAT ATTACGTGGC TCGATCACTT 
047951 CTGCTTTTTT TAATTCATTT TCTGCTGCAC GAGGCCAACC GCGGGCTTGT AACACACTCG CGTAATCAAT 
048021 GCGCAGTCCC TGATTTCCTG GTGCGTTATA AGCAAGCTCT CTGGCTGTCA TTTCAGCCTG AGGAAGATCA 
048091 TTACTATATT TTGCTACGGT TGAGAGAAAC GAATGCCCCT GTAACCAGGT ATCATTCGGG ATGCTCGTAG 
048161 GCGTGCCCAT TAACCGAAGG AAAGGCGGCG AAGTATTAAT GGTATGTTGG GTGACAGTTA GCGCGCCCGG 
048231 ATAATTTTCA CTCTCCAGGT GGCTGTAAAA GAGATCCGCA AGTTCTTCAT CGGATAAATC CGGGGCAATG 
048301 GTCTCCTTGT GATAAAAGAG CTCGGTCATT ATTGACTGTG CTTTTTTCGG CTGATGATCT TTGAGATAAG 
048371 CCGATGCAAC CCAATATTGC CCCCAGGGCG GAATAATTTG CCCCGTCTTT TTTAATCGCT GATAGTGAGA 
048441 AATAACGTCT TTATAACGAT CGCGAGTTAA TAACGCGCCA AGATGATCAA CCTGAATACG CTGGTACTGG 
048511 GCAGTGCGGT CTGGGTTATC GTGCCACAGA ATTTCTAATG CAGCGTATTG GGCGAGGGCG CGATCGGCAA 
048581 TGGCATAACG TTCACTTTCA CTGCGCGTAG GCATAAACGA CAGTCTGACC AGTTCGGCAT GAATATCAGC 
048651 GCGAATATCT GGCGTTAAAT TGGCATCGTC AATCGCGGCA GCAAGTTGAT TATTACGTAA TGCCTGCACG 
048721 TATTCTGTGG GATATTGTTG CGTAGATGCA TTTTCAGGTA ATGACTCTGT CATCGCCCGT AATTCATCCT 
048791 GATGACGCCC CGCCAGTTTA TAGATATAGG CTTCTGCGAG TAAATTGGCT TTGTCCGGTG CTCCAGAGTT 
048861 AAGCTGCTTA AGTTTAACCA GCGCAGTATC ATAGTGACCA GCATCTGCCA GGGTTAAAAT TTGTCCCCGT 
048931 TGATAATCCT TATTTTGCGG CTCCAGAGAG AGCGCCTTTT GCCACAGTGT AAGCGAGTTT TGCCATTGTT 
049001 GCAGGTTACG ATAAGCGACG GCGACAGCTG CATAACCACG CGCTGGTAAT TGCTGATGAC GGTAGCGGTT 
049071 GTAAACGGTA ATAACCTGTT TATCTTGCCC GGCCCATAAG GCAATCTGTA ACCAGTCAGC AATTTGGTTA 
049141 TTGCTGAGTG CTGATTTTAG TGCAAACCAT GACAAAGCTG GCTGAGTATT ACCCTTGCGA GCTTCAATAA 
049211 TCAATGCATC ATAGGCGTTA TTAACAGCAC TCTTCGCCGC GGGACTCGCT GCTAAAAATG CGGCAGTAAG 
049281 AAGTTTCAAA GCCCATTTGG TTTTCGGGCA CCTTTTTCTG CTACTTGAAT ACATCCTGTA TTACTCCATG 
049351 TATTGCCAAA ATCTCTCTCT GTATCTAATT ACAGGTAACT GAAAAGAAAG ATATTTTTGC ACCTCATAAT 
049421 CCGTTATTAA ACGCGGAAGA GAGACGTGAA TTGTTGATGA TGAGAAGAAG AAATGATGAG CAGAGTGTCC 
049491 ATATAAAATC CTTTTCTCGC CCGAAAATCC ATTCCAATGA TGAGGATCTT CAGGAATACG GCATAAATCC 
049561 CAATGCCTTT TTCAAAATAA ATTAGGATTA AAATAATTAA ATCAGTAAAT TCCGATGCAT GATTTCGGAT 
049631 TTTTCGAAAG TCCTGATGAA AGGCTGCGCT ACGGCACTCA CGGATTTAAT TGTTATTCCT AATGTATCTA 
049701 TGAATTAATG TTTTATAAGG ATTTTCTATA ACCATTTATA AGTATTTTCA AGCCTGGCTT GTTGCAAACA 
049771 ATGTATAAAG CACTTAGGCA ATAATAATTA CATTCAGCAA CTATCATCAT CGGTATTGTT TGTGGGCGGA 
049841 ATTTCATATT GACAACAGTA CAGTTCTTAT ATCTATTAAT AATAGAAAGG GATCTACAAC CTACAGATTG 
049911 GTGTAGCTTT ATGGAAAAAG ACTATTTGAG AATTAGTAGT ACTGTATTAG TGAGCTTATT GTTTGGGCTT 
049981 GCTTTGGTTT TGGTGAATAG TTGGTTTAAT CAGCCAGGCG TTGAGGAAGT TGTTCCACGA TCAACCTATC 
050051 TGATGGTAAT GATTGCTTTA TTTTTTATCG ATACTGTTGC ATTTATTTTT ATGCAGTTGT ATTTCATTTA 
050121 TGACCGTAGG CAATTTTCAA ACTGTGTACT TAGTTTGGCT TTTCTGAGTT GTTTGATTTA CTTTGTTATA 
050191 ACCGTCATTA TCATTCAGCA AATTATTGAG GAGCGTTTGA CAAGCAGTGT TGTCCAAAAT GACATTGCAA 
050261 TCTATTATTT GTTTCGTCAG ATGAGTTTGT GCATATTAAT ATTTCTGGCA TTGGTGAATA AAGTTAGTGA 
050331 AAACACAAAA CAGCGCAATT TATTTTCCAA AAAAATGACT TTGTGCATAA GTTTGTTTTT TGTTTTTGGG 
050401 GGGCCGATAG TTGCTCACAT ACTTTCTAGT CATTATGAGA GCTACAATTT ACACATTGCC GAGTTAACCA 
050471 ATGAAAATGG TCAGGTGGTT TGGAAAGCCT CATATGTTAC CATAATGATT TTCATGTGGT TAACCTTGCT 
050541 TTCGGTTAAT CTATACTTTA ATGGTTTACG CTATGATATC TGGAATGGAG TGACGGTGAT TGCTTTTTGT 
050611 GCCGTACTGT ACAATATCTC TCTGTTATTT ATGAGCAGGT ATAGCGTGTC CACTTGGTAT ATTAGTCGCA 
050681 CTATTGAAGT AGTCAGTAAG TTAACCGTTA TGGTAATATT TATGTGCCAT ATATTCAGTG CGCTACGAGT 
050751 AACAAAGAAC ATTGCACATC GCGATCCCTT AACCAATATA TTTAACAGAA ATTATTTTTT TAATGAACTG 
050821 ACAGTTCAAT CAGCATCAGC CCAAAAAACG CCTTATTGCG TCATGATTAT GGATATCGAC CACTTCAAAA 
050891 AAGTCAACGA CACCTGGGGG CATCCGGTTG GCGATCAGGT GATAAAAACA GTGGTGAATA TCATTGGGAA 
050961 AAGCATACGA CCAGATGACC TTTTAGCGCG CGTCGGCGGC GAAGAGTTTG GCGTCTTGCT GACGGACATC 
051031 GATACTGAAC GTGCGAAAGC TTTAGCGGAA AGGATTCGGG AAAATGTTGA GCGTTTAACT GGCGATAATC 
051101 CTGAATACGC TATACCACAA AAAGTGACGA TTAGTATTGG CGCTGTTGTG ACTCAGGAAA ATGCGTTAAA 
051171 CCCAAATGAG ATCTATCGAC TGGCTGATAA CGCACTTTAC GAGGCGAAAG AGACCGGGCG TAATAAGGTG 
051241 GTTGTGAGGG ATGTGGTGAA TTTTTGTGAG TCACCATAAA GCGGCATTTT GATCCTACCC ACGTAATATG 
051311 GACACAGGCC TAAGCGAGGT TCTTGTTTTC AAATTGTTCC GGACTGAGGC CGCCACACCA ACTGTGCCGC 
051381 CGCCACCGAT TGTAATCACA TTCGATATAA TTAAACACCG TTGCCCGCAT TATTTCCCGG CTGATAAAGT 
051451 GTTCTCCATG GATACATTCC ACTTTCAGCG AATGAAAGAA GCTTTCCACG CAGGCATTAT CGTAGCAGCA 
051521 ACCTTTTGCG CTCATACTTC CACGCAGATT ATGCCGCTTC AGTTGCGCCT GATAATCTGC TGAACAGTAC 
051591 TGGCCTCCAC GGTCCGTGTG AACGATAACG TTCCGGGGCC TCTTACGCCG CCACAGCGCC ATCTGCAGGG 
051661 CATCGCAGGC CAGTTGCGCC GTCATGCGTG GCGACATTGA CCAGCCAATA ACGGCACGTG ACCACAGGTC 
051731 AATGACCACT GCCAGATACA GCCAGCCTTC ATCTGTACGT AAGTACGTGA TGTCTCCTGC CCACTTCTGG 
051801 TTCGGGCCAC TGGCGTAAAA ATCCTGCTCC AACAGATTTT CTGACACAGG CAGGCCGTGT GCGCGGTAGC 
051871 TGACCGGGCT GAACTTCCGG GAGGCCTTTG CCCTCAGTCC CTGACGGCGC AGGCTTGCCG CCACGGTTTT 
051941 TACGTTAAAG GGGTAACCCT GAGCACGCAG TTCATCCGTC AGGCGTGGGG CACCGTAACG CTGTTTTGAC 
052011 CGGGTAAAAG CCGCGAGGAC AACGCTGTCG CAGTGTTGGC GGAACTGCTG ACGCGTGCTT ATCCTTGTCC 
052081 GCCGCTGACA CCACGTATAC CAGCCGCTGC GGGCCACCCG GAGCACGCGG CACATTGCTT TGATGCTGAA 
052151 CTCAGCCTGA TGTTTTTCAA TAAAGACATA CTTCATTTCA GGCGCTTCGC GAAGTATGTC GCGGCCTTTT 
052221 GGAGGATAGC CAGCTCTTCA TCCCGTTCTG CCAGCTGGCG TTTGAGACGT GCAATCTCGG TAGACATCTC 
052291 CAGTTCACGT TCAGAAGACG TCTGCTGATT TTGCTGTTTA CTGCGCCAGT TGTAGAGTTG TGATTCATAC 
052361 AGGCTGAGTT CACGGGCTGC GGCAGTAACA CCGATGCGTT CAGCAAGCTT CAGGGCTTCA CTGCGAAATT 
052431 CAGGCGAATG CTGTTTACGG GGTTTTTTAC TGGTTGATAC TGTTTTTGTC ATGTGAGTCA CCTCTGACTG 
052501 AGAGTTTACT CACTTAGCCG CGTGTCCACT ATTGCTGGGT AAGATCAGTG CCTGGCACAC GCGTTTGATG 
052571 GAAGACGGCG TTCAGGCAAT GCGCGATTAT CTTGCCGGAC TGGATATCGC TTCGCCAGAG CATCAGGTTC 
052641 TGATGAACGT AACAGCAAAA AGCGAGGTCG CTCCGTCAAT TATCAAAGAA AATCTCTCAT TACACTTAAC 
052711 TCATACGGTG AAATGGACTG AATCTCTCGA TACATTTCTG AATATGCCAA CCCCGGTAGC TTTCCTTGAA 
052781 ATAAGTAATA AGCCCTATTT GGGGAATATG TTAAATGATT TTGCTGGCGT GGATCAGCAA CGAGTTATGC 
052851 ATTGTCGTAA AGCATTTAGT GATGCAAAGG TATTCAAATG ATTCCTGATT ATTTAACTTT TATTCGCTTT 
052921 CAGGATAAAC GAAATCTGAT ATACATTTAT GCTATTGGAC TTATTCTGAT AGGCTTTTAT TGGAAGAATG 
052991 CAGGGTTTAC TTTTCCATCA GAGGATATTG GTGTAGTTAG TGGGATTCTG GCTCTGGTGC TGTATAATTT 
053061 TATTTTTGAT CTCAAGGCGT ACTGGGCTTA TAAATGCGTC ACGAAGAATA TCGATTTTTC GTGGTTTAAG 
053131 AAAAAGCAGA ACCACAAAAT AGAATTATTT CTTACACAAC CTCTGGTGGC AGGATTTCTG TCGTTAATCA 
053201 TGTTGAGTGC AATGAGTTGG GGGCTATACC AGCTTCTACC CTCGTTATAT GCGCTGTTCC TGATTTCGTT 
053271 ACTTGGGCCG TTGGTCATCT TTCTGCTGTT TCGGATGATC CGCACCAGTT ATGTCAAGCA GGTCGCTATT 
053341 TCAGTAGCGA AAAAAGTAAA ATATAAAAGT CTGACTCGCT ATGTGCTGCT TTCGGTGTGC ATCTCAACGG 
053411 TTGTTAACCT GCTTACTATC AGCCCGTTGC GTAACAGTGA TTCTTTTGTG ACAGAGGGGC AGTGGTTAAC 
053481 GTTTAAATCG ATAATTGCAT TGCTCATTCT TTGTGGCGTA GTGTTGGCGA TTAATCTGTT TTTTCTGCGC 
053551 TTCTCCAAGC GGTACGCTTT TCTGGGCAGG CTTTTTTTGC AGGAAATCGA TCTGTTTTTC TCCAGTGAAA 
053621 ATGCGTTGTC GACCTTTTTT GCCAAGCCGC TTTGGCTTCG GTTATTCATA TTGCTGGTTA TTGAAGTGAT 
053691 GTGGATTACG CTGGTGTCGG TATTGGCAAC GCTTGTAGAA TGGCGGATTT GGTTTGAAGC CTATTTTTTA 
053761 CTCTGCTATG TACCGTGCTT AATTTACTAT TTTTTCTATT GTCGATTCCT CTGGCATAAC GATTTTATGA 
053831 TGGCATGTGA CATGTATTTC CGTTGGGGGC ATTTTAATAA GTGAGGAAGT GATAGGAAGT GACCAGATAA 
053901 TACATATATG TTCTGTACTC TCTTGCGCAT TTTGATTGTT GACTGAGTAA CCAGACAGTT GATGTGCACG 
053971 ATTTCCCCTC GCCCTAACAG ACGTGGGCGG GGGCACCCGG TGTGTGCAAT ATACGAAAAA AAAGCCCGTA 
054041 CTTTCGTACG AGCTCTTCTT TAAATATGGC GGTGAGGGGG GGATTGACTC GCTTCGCTCG CCCTGCGGGC 
054111 AGCCCGCTCA CTGCGTTCAC GGTCTGTCCA ACTGGCTGTC GCCAGTTGTC GACCCCCGGT CGGGGCTTCT 
054181 CATCCCCCCG GTGTGTGCAA TACACGAAAA AAAAGCCCGT ACTTTCGTAC GAGCTCTTCT TTAAATATGG 
054251 CGGTGAGGGG GGGATTGACT CGCTTCGCTC GCCCTGCGGG CAGCCCGCTC ACTGCGTTCA CGGTCTGTCC 
054321 AACTGGCTGT CGCCAGTTGT CGAACCCCGG TCGGGGCTTC TCATCCCCCC GGTGTGTGCA ATATACGAAA 
054391 AAAAAGCCCG TACTTTCGTA CGAGCTCTTC TTTAAATATG GCGGTGAGGG GGGGATTGAC TCGCTTCGCT 
054461 CGCCCTGCGG GCAGCCCGCT CACTGCGTTC ACGGTCTGTC CAACTGGCTG TCGCCAGTTG TCGAACCCCG 
054531 GTCGGGGCTT CTCATCCCCC CGGTGTGTGC AATATACGAA AAAAAAGCCC GTACTTTCGT ACGAGCTCTT 
054601 CTTTAAATAT GGCGGTGAGG GGGGGATTCG AACCCCCGAT ACGTTGCCGT ATACACACTT TCCAGGCGTG 
054671 CTCCTTCAGC CACTCGGACA CCTCACCAAA TTGTCGTTCC TGTCTTGCTG GAACGGGCGC TAATTTAGGG 
054741 AAATCATGAC CTGAGGTCAA CAAACTTTTT GAAAAAATCG CGCGTTTATT CAAACTTCAA TCAATGTGTG 
054811 GTTTTAATAA GCGAAATCTG CTTTTTTTGC CACCGACCAC GGATTTGTTA TGCTGGTGGC CTTTGTAGAT 
054881 CATAACGATA AGTGCGAATA AATTTCGCAC AACGCTTTTC GGGAGTCAGT ATGGATATCA TCTTTTATCA 
054951 CCCAACGTTC GATACCCAAT GGTGGATTGA GGCACTGCGC AAAGCTATTC CTCAGGCAAG AGTCAGAGCA 
055021 TGGAAAAGCG GAGATAATGA CTCTGCTGAT TATGCTTTAG TCTGGCATCC TCCTGTTGAA ATGCTGGCAG 
055091 GGCGCGATCT TAAAGCGGTG TTCGCACTCG GGGCCGGTGT TGATTCTATT TTGAGCAAGC TACAGGCACA 
055161 CCCTGAAATG CTGAACCCTT CTGTTCCACT TTTTCGCCTG GAAGATACCG GTATGGGCGA GCAAATGCAG 
055231 GAATATGCTG TCAGTCAGGT GCTGCATTGG TTTCGACGTT TTGACGATTA TCGCATCCAG CAAAATAGTT 
055301 CGCATTGGCA ACCGCTGCCT GAATATCATC GGGAAGATTT TACCATCGGC ATTTTGGGCG CAGGCGTACT 
055371 GGGCAGTAAA GTTGCTCAGA GTCTGCAAAC CTGGCGCTTT CCGCTGCGTT GCTGGAGTCG AACCCGTAAA 
055441 TCGTGGCCTG GCGTGCAAAG CTTTGCCGGA CGGGAAGAAC TGTCTGCATT TCTGAGCCAA TGTCGGGTAT 
055511 TGATTAATTT GTTACCGAAT ACCCCTGAAA CCGTCGGCAT TATTAATCAA CAATTACTCG AAAAATTACC 
055581 GGATGGCGCG TATCTCCTCA ACCTGGCGCG TGGTGTTCAT GTTGTGGAAG ATGACCTGCT CGCGGCGCTG 
055651 GATAGCGGCA AAGTTAAAGG CGCAATGTTG GATGTTTTTA ATCGTGAACC CTTACCGCCT GAAAGTCCGC 
055721 TCTGGCAACA TCCACGCGTG ACGATAACAC CACATGTCGC CGCGATTACC CGTCCCGCTG AAGCTGTGGA 
055791 GTACATTTCT CGCACCATTG CCCAGCTCGA AAAAGGGGAG AGGGTCTGCG GGCAAGTCGA CCGCGCACGC 
055861 GGCTACTAAT AAAGCATCAG GATTCCTGCT ATCCTTGGCG GGAATTGAAT ACAGGAGAGA GTTATGTATC 
055931 CCGTCGACCT TCATATGCAT ACCGTTGCCA GCACACATGC ATATAGCACA TTAAGTGATT ACATTGCCCA 
056001 GGCCAAACAA AAGGGCATTA AACTTTTTGC GATCACCGAT CATGGCCCGG ATATGGAAGA TGCGCCGCAT 
056071 CACTGGCACT TCATTAACAT GCGTATCTGG CCGCGAGTGG TTGATGGGGT AGGGATCCTG CGCGGCATCG 
056141 AAGCTAACAT TAAAAATGTT GATGGTGAAA TTGACTGCAG CGGTAAAATG TTTGACTCGC TGGATCTAAT 
056211 TATTGCCGGT TTTCATGAGC CGGTTTTTGC GCCACATGAC AAAGCGACCA ATACACAAGC GATGATCGCC 
056281 ACTATCGCCA GCGGCAATGT GCATATAATA AGCCATCCCG GAAATCCCAA ATATGAAATA GATGTGAAAG 
056351 CCGTTGCTGA AGCAGCCGCG AAACATCAGG TGGCGCTGGA AATCAATAAT TCCTCATTTT TACACTCACG 
056421 TAAGGGCAGT GAAGACAACT GTCGTGAGGT AGCCGCAGCG GTACGTGATG CTGGAGGTTG GGTGGCATTA 
056491 GGCTCGGATT CTCACACCGC GTTTACCATG GGGGAATTTG AAGAGTGTCT TAAAATCCTC GACGCGGTAG 
056561 ATTTTCCGCC AGAGCGCATT TTGAATGTTT CTCCGCGCCG CTTACTGAAC TTCCTTGAAT CTCGCGGTAT 
056631 GGCACCGATT GCGGAATTTG CAGACCTTTA ATTACTAGTA ATGGAAATAT ATTAATGAAC GAGTTTTCTA 
056701 TCCTCTGTCG TGTGCTGGGT TCGCTCTATT ACCGCCAACC ACAAGATCCT TTACTGGTGC CGCTGTTTAC 
056771 CCTGATTCGT GAGGGGAAAC TGGCTGCGAA CTGGCCACTG GAGCAGGATG AGTTGCTGAC ACGTTTGCAG 
056841 AAAAGCTGTG ATATGACGCA AGTCTCTGCC GATTACAATG CGTTGTTTAT CGGCGATGAA TGTGCTGTGC 
056911 CGCCATATCG TAGCGCATGG GTTGAGGGCG CGACGGAAGC GGAAGTGCGC GCTTTTCTTT CTGAGCGAGG 
056981 GATGCCATTA GCGGATACGC CAGCCGATCA CATCGGCACA TTGCTGCTCG CAGCTTCCTG GCTGGAAGAT 
057051 CAGTCAACGG AAGATGAGAG CGAAGCACTG GAAACACTGT TCAGTGAGTA TCTGTTACCC TGGTGTGGTG 
057121 CGTTCCTTGG CAAAGTGGAG GCCCATGCAA CCACGCCTTT CTGGCGCACC ATGGCACCGC TAACCCGCGA 
057191 TGCCATTAGT GCAATGTGGG ACGAGCTGGA AGAAGATTCT GAAGAATAAG TGTGATCTAC GTCACTCATA 
057261 ACTGCAACGG ATAATTTGTT GTTGCATAAA ATGTGTGCTC GATCTCATTC ATGGCCGCGT TTTCTGCTAT 
057331 CATGCGCGGC ATGAACATAC TTCTCTCTAT TGCAATCACA ACAGGCATTC TCTCCGGTAT CTGGGGATGG 
057401 GTGGCTGTTT CCCTGGGCTT ACTAAGCTGG GCGGGCTTCC TGGGCTGTAC GGCCTACTTT GCCTGCCCGC 
057471 AAGGTGGGCT GAAAGGGCTG GCGATCTCCG CTGCAACCCT GCTTAGTGGC GTGGTGTGGG CGATGGTCAT 
057541 TATTTACGGT AGTGCACTGG CACCACATCT GGAAATTCTC GGTTATGTCA TAACCGGTAT TGTCGCGTTT 
057611 CTGATGTGTA TTCAGGCCAA ACAGCTGCTG CTTTCATTTG TTCCGGGGAC GTTTATAGGC GCATGCGCGA 
057681 CGTTTGCCGG GCAGGGTGAC TGGAAACTGG TGTTACCTTC GCTGGCGCTT GGGCTGATAT TTGGTTACGC 
057751 AATGAAAAAC AGTGGCCTGT GGCTGGCGGC GCGTAGTGCA AAGACGGCGC ACCGTGAGCA GGAAATCAAA 
057821 AATAAAGCGT GAGGGGCACT CACGCTTTCG CTTAAACAGT AAAATGCCGG ATGATAATTC CGGCTTTTTT 
057891 ATCTGTCAGG ATTCCGGTGG AACCGACATA TGGCGGTATT TCACCAGAAT GTCATTCTGC CGTTCTGCTT 
057961 TATTTTGCAA ATCCCACAGA CCACGGTCGA TACCATCATT AATCAGGAAA ATGACCCCTG TTTCGATAGC 
058031 CGACATCAGG CACAGCATAA CAGGTTCGTT CGAGGTGTAA CCCACTTCCC CTTCAAGCAA GCGCTGGTAG 
058101 TCAATAAAGC GGAAAACCCC GGCCTGAACT TCATAGGAAA GTATCGTCTT ACTGGTGTTC ACCGAAGAAA 
058171 GGATCTCGCC GGTACTCACA TTGACGACGC GCAGGTTCAC GGCAATCTGA TCGAGCTGGT ATTGCGTGTC 
058241 GGCACCGATG CCAAAATATC TTGCCCCAAC CCCGCCAGAT TTGACGTTGC TTTCATAACC GATAATCGAA 
058311 CCTTCAACCA TGATATTTGC CGCCGTTAAA GATTGCAGCG GGATTCGGTT ATTAATGGCA ACCGTGCCGT 
058381 TTTCTTGTGC CGCACGAATA ATCTTGCGCT CGTTAAGCAG GTTTTGTAAG CCCTGGCGCT CCAGCGGTAT 
058451 AAACCAGCGA GAATCTTTCA GTGCCGTGAC CAGCATTGCC GTGGCGCTTT GCGGAACAGC AGTGGAGAAG 
058521 TTACTTGCCG GGTAGGGTTT AAATTGCCCG GTTTCGTCCT GAATGTTGTA TACCGAAACA AAGATTTTAC 
058591 CCGTCGGCGC TGGCAGATGG GTCAAATCTT TGTAGCTCTG AGCACGAGGC ATTAATGTCG GTCTGGCGGC 
058661 TTCTTTAGGC GGGGCGGTTA AGCATCCGCT CAGTAACATG ACGGCAACCA AAAGAAATAA GCGCTGCATG 
058731 ATTATTTTCC TTATGAAGCT GGGGCTTAAA AATCGGTTGA GTTATTTTGT AAACCCGAAA CCTGGATGGT 
058801 CGAGGTTTGT CCGGTTTTAC GATCTGTCAC GTTCAACTGC AATTGACCAT CGCGGTTGGC AATATCGACA 
058871 ATATAATCGT TGGTCACCAT GCGGCCCGGT TTACCGGTAT TAATATTCGA CAGTAGCCCA CCTAAAATTT 
058941 GTGACTGGAT GGCCTGAGTA AAGTTATCTA ACGCTGAGGG TGTTTCAATA CCAAAGTCAT CGTTATAGCT 
059011 CGGATCTTTA TAAGAGTTTT GGGCCTGAGC GCTATTTAAT AAAAAAGCGC CATTATTTGG GTTACCACCA 
059081 AAGTTTGGAT TACGGAACTG GAAAGTCATG GTTCCAGCCC AACTTAATGG CGAAATAAGC ATGAGTAGAA 
059151 CTACTGCATG TTTGACACGC ATTGCAGCCT CCGAACAATT TTTTATTTAG AATTCATCAT GCGCCAAATC 
059221 GCCCGTACTT AATAACGCCT GATTTATCTG GCGACGATTT AGTGCTTCTT CAGTTTGAAT CAGTGCAAAG 
059291 ACGACAGTTT TCTCGAAGTC TCTTTTCAAC GGAAATAAAA AAGTCTGGAA AATAACGTCC TGATTGACCG 
059361 TTATAGTGAT CCAGCTTCCC CATCGTGCAC TGGGCCTTTC ATTAATCGTT AAGTTACCCG TATAGTCACT 
059431 TTCCCATTTA TCACTAAAGG CTCGGTAAAA ATCATGGCCA ATAGATGAAA CAGTATGGTC AGTTAGCAAT 
059501 CCCGGGACTT CTACCTCAAC GGCGTGAAGA TTCCCTGCGG CGAACAGAAA TTCTGCCGCC ACAATCCAGC 
059571 GTAAATAACG TTTCATGGCT TTATCGCCTG AGGTTATCGT TTGCCCAGGA AACCGCTTGT GTCCGGTTTT 
059641 TTACGGCTAT CTTCTTGAAA AGATTATAAA GATGCGTTTT AACCGTATTT TCGCTGATGA ACAACGAACG 
059711 AGCGATCTCG TTATTAGACG CGCCGATACG CAGCTTATTC AGGATCTCTT TTTCCCGATG AGTAAGGAGG 
059781 GCTGATTCCG TGCTGTTATA ACGATAGTTA CCTGAATGCG TAATCAGGTA GCTGGCAAGC TTTTGCGTAA 
059851 AGTAGCATTC GCCGCGCAGG ACGCCTTGCA ACCCATTGAC AACACGTTCT TGATCCTCCA TGGAATAAAA 
059921 AACGCCGTTG ATATGAGGCC AGTTTTCAAT GTCGCGGTAC GGGTAATCTT CAGGCGTATT TAGCAACAAT 
059991 ATTTTGATAT TGTTGTTTTT CCTGCTCAAA GTATCCTGCC AATAATGGAT AAGCTTTTTA TCCGCTTCCA 
060061 TCATATCCAG AAGAATAATA GAGCCTGAAG AGATATCGTC CAGAGAACGT TGAATATTAT GTAATTTTCC 
060131 TGTAATTGCC AGCGATTGTT TAAGGTGCTG CAAGAGAGCT GTCGCCTGCA AAGAAGATTT AGTGATCAAC 
060201 AATAATGTAT GACCATGAAT ACTATGGACT TCATTAAACA TGATGAAACC CCGCTTTTTT TATTGATCGC 
060271 ACACCTGACA GCTGCCTCTA AAATAGAAGC ACCAGAAGTA CTGACAGATG TTGCACTGCT GTGTGTAGTA 
060341 ATAAATCAGC CCTAAATGGG TAAAATATAA AACTAATGGA TTACATCTGA TTTCAATCTA GCCATTACAA 
060411 ATCTTAAATC AAGTGTTAAA CATGTAACTA AATGTAACTC GTTATATTAA AATGTTAACC TTAAGGTTTT 
060481 ATTAAGTTTA GAAATGATAG AAAAGTTGTA CATTTGGTTT TTATTGCACA ATTTTAAAAA ATCATACAAA 
060551 TGGTGATAAC TTACTAATAA TGCATATAAA AAATATTTCG GTGTAGTCCT TTCGTCATGT AAAACGTTCT 
060621 TGTTTTTTCT CCACACCTCC GTGGACAATT TTTTACTGCA AAAAGACGAG GTTTGTCACG GCTTGTGCGC 
060691 AAGACATATC GCAGCAATCA GCGACGGGCA AGAAGAATGA CTGTCTGGTG CTTTTTGATA GCGGAAAACG 
060761 GAGATTTAAA AGAAAACAAA ATATTTTTTT GCGTAGATAA CAGCGTATTT ACGTGGGTTT TAATACTTTG 
060831 GTATGAACTA AAAAAGAAAA ATACAACGCG CGGGTGAGTT ATTAAAAATA TTTCCGCAGA CATACTTTCC 
060901 ATCGTAACGC AGCGTTAACA AAATACAGGT TGCGTTAACA ACCAAGTTGA AATGATTTAA TTTCTTAAAT 
060971 GTACGACCAG GTCCAGGGTG ACAACATGAA AAACAAATTG TTATTTATGA TGTTAACAAT ACTGGGTGCG 
061041 CCTGGGATTG CAGCCGCAGC AGGTTATGAT TTAGCTAATT CAGAATATAA CTTCGCGGTA AATGAATTGA 
061111 GTAAGTCTTC ATTTAATCAG GCAGCCATAA TTGGTCAAGC TGGGACTAAT AATAGTGCTC AGTTACGGCA 
061181 GGGAGGCTCA AAACTTTTGG CGGTTGTTGC GCAAGAAGGT AGTAGCAACC GGGCAAAGAT TGACCAGACA 
061251 GGAGATTATA ACCTTGCATA TATTGATCAG GCGGGCAGTG CCAACGATGC CAGTATTTCG CAAGGTGCTT 
061321 ATGGTAATAC TGCGATGATT ATCCAGAAAG GTTCTGGTAA TAAAGCAAAT ATTACACAGT ATGGTACTCA 
061391 AAAAACGGCA ATTGTAGTGC AGAGACAGTC GCAAATGGCT ATTCGCGTGA CACAACGTTA ATTTCCATTC 
061461 GACTTTTAAA TCAATCCGAT GGGGGTTTTA CATGAAACTT TTAAAAGTAG CAGCAATTGC AGCAATCGTA 
061531 TTCTCCGGTA GCGCTCTGGC AGGTGTTGTT CCTCAGTACG GCGGCGGCGG TAACCACGGT GGTGGCGGTA 
061601 ATAATAGCGG CCCAAATTCT GAGCTGAACA TTTACCAGTA CGGTGGCGGT AACTCTGCAC TTGCTCTGCA 
061671 AACTGATGCC CGTAACTCTG ACTTGACTAT TACCCAGCAT GGCGGCGGTA ATGGTGCAGA TGTTGGTCAG 
061741 GGCTCAGATG ACAGCTCAAT CGATCTGACC CAACGTGGCT TCGGTAACAG CGCTACTCTT GATCAGTGGA 
061811 ACGGCAAAAA TTCTGAAATG ACGGTTAAAC AGTTCGGTGG TGGCAACGGT GCTGCAGTTG ACCAGACTGC 
061881 ATCTAACTCC TCCGTCAACG TGACTCAGGT TGGCTTTGGT AACAACGCGA CCGCTCATCA GTACTAATAC 
061951 ATCATTTGTA TTACAGAAAC AGGGCGCAAG CCCTGTTTTT TTTCGGGAGA AGAATATGAA TACGTTATTA 
062021 CTCCTTGCGG CACTTTCCAG TCAGATAACC TTTAATACGA CCCAGCAAGG GGATGTGTAT ACCATTATTC 
062091 CTGAAGTCAC TCTTACTCAA TCTTGTCTGT GCAGAGTACA AATATTGTCC CTGCGCGAAG GCAGTTCAGG 
062161 GCAAAGTCAG ACGAAGCAAG AAAAGACCCT TTCATTGCCT GCTAATCAAC CCATTGCTTT GACGAAGTTG 
062231 AGTTTAAATA TTTCCCCGGA CGATCGGGTG AAAATAGTTG TTACTGTTTC TGATGGACAG TCACTTCATT 
062301 TATCACAACA ATGGCCGCCC TCTTCAGAAA AGTCTTAATT TGTTGAAATA TCGAGCATAA GATGAATCTG 
062371 GAGAGAATGG TCTGCTGCGA ATCAGCCAAC CTGAAAGTAT GGATAACACA ACCCTCAAGG ATGACTAATC 
062441 ATTGAGGAAA TAGAATAAAT GTTCAGACCT TTTTTAAACT CTCTTATGCT CGGCAGTTTG TTTTTTCCTT 
062511 TTATTGCCAT TGCTGGAAGC ACCGTGCAAG GGGGCGTGAT CCATTTTTAT GGCCAAATTG TGGAACCGGC 
062581 ATGTGACGTC AGCACCCAGT CATCACCCGT AGAAATGAAC TGCCCACAGA ATGGTTCTAT TCCGGGCAAA 
062651 ACCTACTCCA GCAAAGCGTT AATGAGCGGC AATGTCAAAA ACGCGCAAAT AGCCTCAGTA AAAGTGCAGT 
062721 ATCTTGATAA ACAGAAAAAG CTGGCTGTAA TGAACATCGA ATATAACTAA GTTTCTGAAC AACTCACGTT 
062791 GCTGAGCAGA AAAATGCGAT TTAACCAAAA AGCCTGCTGT ACACTTAAGA AACAAGAAGG TGTAAGGAGG 
062861 CGTTATGAAA ACGCGTATTC ATGTTGTGCA GGGTGATATT ACCAAACTGG CCGTTGATGT GATTGTGAAT 
062931 GCGGCTAATC CGTCATTAAT GGGAGGCGGC GGCGTCGATG GGGCCATTCA TCGCGCAGCG GGTCCGGCCC 
063001 TGCTGGATGC TTGTTTAAAA GTCAGGCAAC AGCAGGGCGA TTGCCCTACG GGGCATGCCG TTATTACGCT 
063071 TGCAGGCGAT CTTCCCGCTA AAGCCGTAGT GCACACCGTC GGGCCAGTCT GGCGTGGTGG TGAACAAAAC 
063141 GAAGACCAGC TTTTGCAGGA TGCCTATCTC AATAGCCTAC GACTGGTGGC GGCAAACAGC TATACGTCAG 
063211 TGGCTTTTCC TGCAATCAGT ACTGGGGTTT ATGGTTACCC TCGTGCGGCA GCGGCTGAAA TCGCAGTAAA 
063281 AACCGTTTCA GAATTTATTA CCCGTCACGC TTTACCCGAA CAGGTATACT TTGTCTGTTA TGATGAAGAA 
063351 AACGCCCACC TCTACGAAAG ACTCCTTACC CAACAAGGAG ATGAATGATT TGCCCCGGCT GGCGAGCGCG 
063421 GTGCTGCCAC TGTGTTCGCA ACATCCCGGT CAGTGTGGCC TTTTTCCTCT GGAGAAAAGT CTGGATGCGT 
063491 TTGCCGCCCG GTATCGTCTG GCCGAAATGG CAGAGCATAC GCTCGATGTT CAGTATTACA TCTGGCAGGA 
063561 CGATATGTCG GGTCGGTTAC TGTTTTCCGC CCTGTTAGCC GCAGCAAAGC GTGGCGTTCG CGTCCGTTTG 
063631 TTGCTGGACG ACAACAATAC GCCCGGACTT GACGACATTT TACGCTTGCT TGACAGTCAT CCACGCATTG 
063701 AAGTCCGGCT TTTTAATCCT TTCTCGTTTC GCTTGCTGCG TCCGCTTGGT TATATCACCG ACTTTTCCCG 
063771 TCTTAATCGC CGTATGCACA ATAAAAGTTT CACTGTCGAT GGCGTGGTGA CCCTGGTGGG AGGACGAAAT 
063841 ATTGGTGATG CCTATTTTGG AGCAGGGGAG GAGCCACTTT TTTCGGATTT AGATGTCATG GCAATAGGAC 
063911 CCGTGGTAGA GGACGTTGCC GATGATTTCG CCCGCTACTG GTATTGCAAA TCGGTTTCAC CCTTACAGCA 
063981 GGTGCTGGAT GTCCCGGAGG GTGAAATGGC GGATCGCATC GAGTTACCCG CCTCCTGGCA TAACGATGCC 
064051 ATGACGCATC GTTATTTACG CAAAATGGAA TCCAGTCCAT TTATAAATCA TCTGGTTGAT GGAACATTGC 
064121 CGCTTATCTG GGCGAAGACA CGTTTATTAA GTGATGATCC GGCGAAAGGG GAGGGCAAGG CAAAACGGCA 
064191 TTCACTGTTA CCGCAGCGCC TGTTCGATAT CATGGGCTCA CCCAGTGAAC GCATCGATAT TATCTCTTCC 
064261 TATTTTGTAC CGACACGCGC AGGTGTGGCG CAACTCTTAC GGATGGTGAG AAAAGGGGTA AAGATTGCGA 
064331 TCCTAACCAA TTCTCTTGCC GCTAACGATG TTGCTGTCGT CCATGCCGGA TACGCGCGCT GGCGCAAAAA 
064401 ATTGCTCCGC TATGGCGTGG AATTATATGA ACTCAAGCCG ACGCGTGAAC AAAGTAGTAC GTTACACGAT 
064471 CGCGGCATAA CCGGTAATTC CGGAGCCAGC CTGCATGCTA AAACCTTTAG CATCGATGGT AAAACGGTGT 
064541 TTATCGGCTC TTTCAATTTC GATCCGCGTT CAACATTGCT CAATACTGAA ATGGGCTTCG TGATAGAGAG 
064611 CGAAACGCTG GCACAGTTAA TTGATAAACG CTTTATTCAG AGCCAGTATG ATGCGGCCTG GCAGCTCCGT 
064681 CTGGACAGGT GGGGACGGAT CAACTGGGTT GATCGTCATG CAAAGAAAGA GATTATTCTC AAAAAAGAAC 
064751 CCGCCACCAG TTTCTGGAAG CGGGTTATGG TCAGACTGGC GTCGATATTG CCCGTGGAAT GGTTATTGTA 
064821 AATGTGGCTT AACGGGCTGG TGCTTTATCG TTCTCACGCT TAACAACCGG TTTACCAGAG AACAAAAACT 
064891 TCAGTAACGG GATGCGCAAA TGAATTTCAT ACAGAATTAT CGCAATCCCT ACTACAAATA TCAGGCCACA 
064961 GAGAAAACCA AGCCAGTTGG AGGTGATGTG CGGTGTAATG TATGCGCCGA AAAACAGCGT TAACGGGTGG 
065031 TGAACCAGAT AGATAAACAG CGATGCGTTA ACAAAATAAG TCACCCGCGC TGACTGGAAG TTAAGCAAAC 
065101 GGTGGCCAAA GGAGAAGACC ACATTCACCA TCCACAGACC GAGGACCATG GTGATCACCG ACTCGGTTTC 
065171 GTACATCCAG GCATCGCCAC TGCCATAGCG CTGGTTGAGT AAATAAGCGA CAAACGCCAA TGCTGCTGCA 
065241 AGGGTACAGC CACGAGACGG CGTGGTAAAC AAGGCTTTAA GATGAGGGAA AATGAAAGCC AGTGCGCCGA 
065311 GGATAAAGAA CGGCAAATAA AACAGCGTTT GCATGACAAT AAAATTGAAC ATGCCATTAC TCAGAATGGG 
065381 CGGATACACA ATAAAAATCG TTCTTCTTAT TACCGCATAA CCGATGCCGA GGCATAAAAA AATCACCGAT 
065451 AGTTTTACCA TCGAGAATTT TTTATTCGTT TTATCAGAAT TTTCTAAATT ATTTCTGATG CGCTTAAATA 
065521 TCCATACGCA CAGCGTCGTC ATGACCACTA ACACCAGTAA AAACCACAGG TGTGATATTA ATTCCCAGGC 
065591 CAACGTATTA TATTTGTCAT ACAATGACAG CCCAGGCCAA CTTTCCGCTT TTCCTTTGAC ATATTGCAGC 
065661 ATAATAAATT GCGGTAATGT CAGTAGGGGG ATGGCTGTTA ACATCGGGAT ACCTACACGT TCGACACGTA 
065731 CTTTCCACCA TTTTTTCAAG GGATAGCGTA AAAAAAGCAT GTAGGAAAAG TAGCCGGATA TAACGAAAAA 
065801 TACCTGCATG CGGAACGAGT GGATGAAGTC ATTAAAAAGG GTCAGCCACA ATGATGATTC GGCGCTATTC 
065871 ACATGCCATG TATGGCTCGA ATAGATTAAA GAAATATGAA AAGGTATCCC TAACAACATC AGCCAGGCGC 
065941 GGATGGAGTC GAGGAAATAT TCACGTTGCG CGGGTACTGG GTTCATATAT GGTTAACTAA TCTCGGATTT 
066011 TTCGTCTTAT CCCTGTCGGG TTATGCCTTT AGGCTTGTTG CCATAGTGAC ACCGACCTGA CCGCGCCAGG 
066081 CGCAGGCTTC AAGGTTTTTA TGCATAGCAT CATCGCTACC ACTAACCAGA ATGGAAGCGT CTGTAAGACG 
066151 GTTGATAAAT AAATTTGCTG GCAAACCCTA CACGAAGTCG ATGCTTCTGT CTTTAGGAGA AGCACGGAAA 
066221 GTGAAAACGG TTGCAATCAG GTGCTTAATC CATGAGCCAG CGTGCTGAAC GATACCGGGA TTCTGTTGTC 
066291 GGAATGGCTG GTTATCCATT AAAATAGATC GGATCGATAT AAGCACACAA AGGGGGAAGT GCTTACTAAT 
066361 TATGAAACAT AAACTACAAA TGATGAAAAT GCGTTGGTTG AGTGCTGCAG TAATGTTAAC CCTGTATACA 
066431 TCTTCAAGCT GGGCTTTCAG TATTGATGAT GTCGCAAAGC AAGCTCAATC TTTAGCCGGG AAAGGCTACG 
066501 AGACGCCCAA AAGCAACTTG CCCTCCGTTT TCCGCGATAT GAAATACGCG GACTATCAGC AGATCCAGTT 
066571 TAATCATGAC AAAGCGTACT GGAACAATCT GAAGACCCCA TTCAAACTCG AGTTCTACCA TCAGGGTATG 
066641 TACTTCGATA CCCCGGTCAA AATAAATGAA GTGACTGCCA CCGCAGTCAA ACGAATCAAA TACAGCCCGG 
066711 ATTATTTCAC TTTCGGCGAT GTTCAGCATG ACAAAGATAC GGTAAAAGAC CTTGGCTTTG CCGGTTTTAA 
066781 AGTGCTTTAC CCGATCAACA GCAAAGATAA AAACGATGAA ATCGTCAGCA TGCTCGGGGC CAGCTATTTC 
066851 CGCGTGATTG GTGCAGGTCA GGTTTATGGC CTTTCTGCCC GCGGCCTGGC AATTGATACC GCCTTGCCAT 
066921 CGGGTGAAGA ATTTCCGCGC TTCAAAGAGT TCTGGATCGA GCGTCCAAAA CCGACTGATA AACGTTTAAC 
066991 CATCTATGCA TTGCTTGACT CGCCGCGTGC GACAGGTGCT TACAAATTCG TGGTTATGCC AGGGCGTGAC 
067061 ACGGTTGTGG ATGTGCAGTC GAAAATCTAT CTGCGCGATA AAGTCGGCAA ACTGGGGGTT GCACCGTTAA 
067131 CCAGTATGTT CCTGTTTGGG CCGAACCAAC CGTCGCCTGC AAATAACTAT CGTCCGGAGT TGCACGACTC 
067201 TAACGGTCTC TCTATCCATG CCGGTAATGG CGAATGGATC TGGCGTCCGT TGAATAACCC GAAACATTTA 
067271 GCGGTCAGCA GCTTCTCCAT GGAAAACCCG CAAGGCTTTG GTCTGTTGCA GCGCGGTCGT GATTTCTCCC 
067341 GCTTTGAAGA TCTCGATGAT CGTTACGATC TCCGTCCAAG CGCATGGGTG ACTCCGAAAG GGGAGTGGGG 
067411 TAAAGGCAGC GTTGAGCTGG TGGAAATTCC AACCAACGAT GAAACCAACG ATAACATCGT CGCTTACTGG 
067481 ACGCCGGATC AGCTGCCGGA GCCGGGTAAA GAGATGAACT TTAAATACAC CATCACCTTC AGCCGTGATG 
067551 AAGACAAACT GCATGCGCCA GATAACGCAT GGGTGCAACA AACGCGTCGT TCAACGGGGG ATGTGAAGCA 
067621 GTCGAACCTG ATTCGCCAGC CTGACGGTAC TATCGCCTTT GTGGTCGATT TTACCGGCGC AGAGATGAAA 
067691 AAACTGCCAG AGGATACCCC GGTCACAGCG CAAACCAGCA TTGGTGATAA TGGTGAGATA GTTGAAAGCA 
067761 CGGTGCGCTA TAACCCGGTT ACCAAAGGCT GGCGTCTGGT GATGCGTGTG AAAGTGAAAG ATGCCAAGAA 
067831 AACCACTGAA ATGCGTGCTG CGCTGGTGAA TGCCGATCAG ACGTTGAGTG AAACCTGGAG CTACCAGTTA 
067901 CCTGCCAATG AATAAGACAA CTGAGTACAT TGACGCAATG CCCATCGCCG CAAGCGAGAA AGCGGCATTG 
067971 CCGAAGACTG ATATCCGCGC CGTTCATCAG GCGCTGGATG CCGAACACCG CACCTGGGCG CGGGAGGATG 
068041 ATTCCCCGCA AGGCTCGGTA AAGGCGCGTC TGGAACAAGC CTGGCCAGAT TCACTTGCTG ATGGACAGTT 
068111 AATTAAAGAC GACGAAGGGC GCGATCAGCT GAAGGCGATG CCAGAAGCAA AACGCTCCTC GATGTTTCCC 
068181 GACCCGTGGC GTACCAACCC GGTAGGCCGT TTCTGGGATC GCCTGCGTGG ACGCGATGTC ACGCCGCGCT 
068251 ATCTGGCTCG TTTGACCAAA GAAGAGCAGG AGAGCGAGCA AAAGTGGCGT ACCGTCGGTA CCATCCGCCG 
068321 TTACATTCTG TTGATCCTGA CGCTCGCGCA AACTGTCGTC GCGACCTGGT ATATGAAGAC CATTCTTCCT 
068391 TATCAGGGTT GGGCGCTGAT TAATCCTATG GATATGGTTG GTCAGGATTT GTGGGTTTCC TTTATGCAGC 
068461 TTCTGCCTTA TATGCTGCAA ACCGGTATCC TGATCCTCTT TGCGGTACTG TTCTGTTGGG TGTCCGCCGG 
068531 ATTCTGGACG GCGTTAATGG GCTTCCTGCA ACTGCTTATT GGTCGCGATA AATACAGTAT ATCTGCGTCA 
068601 ACAGTTGGCG ATGAACCATT AAACCCGGAG CATCGCACGG CGTTGATCAT GCCTATCTGT AACGAAGACG 
068671 TGAACCGTGT TTTTGCTGGC CTGCGTGCAA CGTGGGAATC AGTAAAAGCC ACCGGGAATG CCAAACACTT 
068741 TGATGTCTAC ATTCTTAGTG ACAGTTATAA CCCGGATATC TGCGTCGCAG AGCAAAAAGC CTGGATGGAG 
068811 CTTATCGCTG AAGTCGGTGG CGAAGGTCAG ATTTTCTATC GCCGCCGCCG TCGCCGCGTG AAGCGTAAAA 
068881 GCGGTAATAT CGATGACTTC TGCCGTCGCT GGGGCAGCCA GTACAGCTAC ATGGTGGTGC TGGATGCTGA 
068951 CTCGGTAATG ACCGGTGATT GTTTGTGCGG GCTGGTGCGC CTGATGGAAG CCAACCCGAA CGCCGGGATC 
069021 ATTCAGTCGT CGCCGAAAGC GTCCGGTATG GATACGCTGT ATGCGCGCTG TCAGCAGTTC GCGACCCGCG 
069091 TGTATGGGCC ACTGTTTACA GCCGGTTTGC ACTTCTGGCA ACTTGGCGAG TCGCACTACT GGGGACATAA 
069161 CGCGATTATC CGCGTGAAAC CGTTTATCGA GCACTGCGCA CTGGCTCCGC TGCCGGGCGA AGGTTCCTTT 
069231 GCCGGTTCAA TCCTGTCACA TGACTTCGTG GAAGCGGCGT TGATGCGCCG TGCAGGTTGG GGGGTCTGGA 
069301 TTGCTTACGA TCTCCCGGGT TCTTATGAAG AATTGCCGCC TAACTTGCTT GATGAGCTAA AACGTGACCG 
069371 CCGATGGTGC CACGGTAACC TGATGAACTT CCGTCTGTTC CTGGTGAAGG GTATGCACCC GGTTCACCGT 
069441 GCGGTGTTCC TGACGGGCGT GATGTCTTAT CTCTCCGCTC CGCTGTGGTT TATGTTCCTC GCGCTCTCTA 
069511 CTGCATTGCA GGTAGTGCAT GCGTTGACCG AACCGCAATA CTTCCTGCAA CCACGGCAGT TGTTCCCAGT 
069581 GTGGCCGCAG TGGCGTCCTG AGCTGGCGAT TGCACTTTTT GCTTCGACCA TGGTGCTGTT GTTCCTGCCG 
069651 AAGTTATTGA GCATTTTGCT TATCTGGTGC AAAGGAACGA AAGAATACGG CGGCTTCTGG CGCGTTACAT 
069721 TATCGTTGCT GCTGGAAGTG CTTTTTTCCG TGCTGCTGGC TCCGGTACGC ATGCTGTTCC ATACGGTCTT 
069791 CGTTGTCAGC GCGTTCCTTG GCTGGGAAGT GGTGTGGAAT TCACCGCAGC GTGATGATGA CTCCACTTCC 
069861 TGGGGTGAAG CGTTCAAACG CCACGGCTCA CAGCTGCTGT TAGGGTTAGT GTGGGCTGTT GGGATGGCGT 
069931 GGCTGGATCT GCGTTTCCTG TTCTGGCTGG CACCGATTGT CTTCTCGTTG ATCCTGTCAC CGTTTGTTTC 
070001 GGTGATTTCC AGCCGTGCCA CCGTTGGTCT GCGCACCAAA CGCTGGAAAC TGTTCCTGAT CCCGGAAGAG 
070071 TATTCGCCGC CGCAGGTGCT GGTTGATACC GATCGGTTCC TTGAGATGAA TCGTCAACGC TCCCTTGATG 
070141 ATGGCTTTAT GCACGCAGTG TTTAACCCGT CATTTAACGC TCTGGCAACC GCAATGGCGA CCGCGCGTCA 
070211 CCGCGCCAGT AAGGTGCTGG AAATCGCCCG TGACCGCCAC GTTGAACAGG CGCTGAACGA GACGCCAGAG 
070281 AAGCTGAATC GCGATCGTCG CCTGGTGCTG CTAAGCGATC CGGTGACGAT GGCCCGTCTG CATTTCCGTG 
070351 TCTGGAATTC CCCGGAGAGA TATTCTTCAT GGGTGAGTTA TTACGAAGGG ATAAAGCTCA ATCCACTGGC 
070421 ATTGCGTAAA CCGGATGCGG CTTCGCAATA AAAACGTAGT TGCCTGATGC GCTACGCTTA TCAGGCCTAC 
070491 ATCGTTCCTG CAATTTATTG ATTTTGCAAG ACTTTGTGGG TCGGATAAGG CGTTCACGCC GCATCCGGCA 
070561 AAAACAACGA GCCAATAAAA ATACCGGCGT TATGCCGGTA TTTTTTTACG AAAGAGGTAT CAAATGCGTT 
070631 TAATTGTGGT GAGCATCATG GTGACCTTGC TGAGTGGCTG TGGCAGCATT ATTAGTCGCA CTATACCGGG 
070701 GCAGGGGCAT GGCAACCAAT ATTATCCCGG TGTGCAATGG GATGTGCGTG ACTCCGCCTG GCGTTATGTC 
070771 ACGATCCTTG ATCTGCCATT CTCTCTGGTT TTTGATACTT TACTGCTGCC GATCGACATT CATCATGGCC 
070841 CGTATGAGTG ATTAACGTTC ATCCCACTCA TCAGCTGCTG CGCGTCCTTC CTCGGTATCC AGCGGTGGCT 
070911 CAAGCTGAAA TTCCCCCTCG TCCCATTCAT GTAATGTATT CTCTTCCTGC CACTCCTGGC GTATCTCTAT 
070981 CTCATCATAG TCGCCATCAA AAACACTTTG CGCGGCTTCA CCGCTAAGCA TAGGTAAACA TTCACCTTCT 
071051 TCCCCTTCGT CGGCAAAAAA CTCAACTTGC CACATGATGT CGCCGTCCTG CAAAACGTAT TTTTGGGCAT 
071121 TGAACTGTTG CACATTCGCA TCTTCGGCGT CGATGCCGGG GTTGTCTGCA AGAAATTCTT CGCGTGCAGC 
071191 GTCAATGGCT TCTTCAAGCG TTGCGTACAT GGTCATCACG ATTCTCCCTT TGAGTTGATG AGGTTTCAGG 
071261 GAAAAGGATA GCTGATTCTC CGCTTTTGCA AGTATGAAAG GCGAAAAATC AGTTCGATAC CTGGGGTATT 
071331 CGACGACGAC GTAGACTGTT CCATGAATAG ACTGCGTTGA ATAACACTAC GCCAGCGGTG ACGAGAAATA 
071401 CCGCTCTGAA ACCGTAGTTC GCTGAAATCG CTGCTCCCAT CAATGGTCCG GTAACGTTGC CAATATCACG 
071471 AAACGATTGG TTATAGCTGA AGATACGCCC GGCGATCTGG TTGCTCGAGT TGTAAACCAA CAGTGTCTGT 
071541 ACGGCGGGGA GTAGTGCACC ATCGGCGGCA CCGAGCAAAA AACGTAAAAT CCCAAGTTGC AATGGCGTCT 
071611 GAACGTAAGA CATTGGGATC AACAGCAGTA CAGAAAAGAT CAGCGCTGTA ATCAGGATCT TTTCGGGTCC 
071681 GATTCGATCG CCAAGTTTGC CGAGTCGTGG TGCACTTAGC AGAGCCGCCA CGCCTGGCAC CGAGGCGATC 
071751 ATGCCACTGA TAAAGGCGAC GTTACTGACG TTACCCGCCA GTTCGCGGAC ATACAGCGTC AGAATGGGGG 
071821 CAATTGAGCC CGTCGCCACC TGGATGATTA ACGTAGTGAC AAACAGGCTG AGTACCAGTT TCGGGTTTTT 
071891 AAGTGATGTC ACCACTTCCC GCATGTGCAG CATCTCTTTT TTGCTGACCG GCTGGAATTT TTCTCTGATG 
071961 CAAAACAGGG TGACGAAAAA GCAGAGTATG AGCACACTGG CGGTAATAAA GAATACCGGA CGTAAGCCGT 
072031 AGCTATCGGC GAGCAGGCCG CCAGCCATTG GGCCGAGCAA CGCACCACTA ACGCCGCCTG TGGAGAGCGT 
072101 ACCCAGCGCC CAGCCGCTTT TATTACGCGG TACTTGTGTG GCGATAAGAG CATTAGCGTT GGGGACAAAT 
072171 CCGCCAAGTA ACCCAAGAAG CGCCCGCAGG ATCAAAAACT GCCAGATATT TTGTGCCAGC CCCATCAACA 
072241 CCATCACGAT GCCCATGCCG AGGGCAGAGC GTAATAGCAT GAGTTTTCGG CCTTTACGGT CGGCGAGTCC 
072311 ACCCCAAAAC GGTGAGGCGA TGGCCGAAAA TAAAAATGTA ATGCTGAAGA CAATACCGGA CCACATATTC 
072381 AGGGCGGAGT GACCGGTAAC GCCAAGCTGC TCAACGTAGA GGGGTAAGAA GGGCATTACC AGACTGAAGG 
072451 CGGCACCGGT AAGAAAACAG CCTAGCCAGG CGACGATCAG GTTTCGTTTC CAGTTTATAG GGGTGTCATT 
072521 TTCACAGGGT GACATAGCAA TCCGCTGTTG GTGCGCCAGG CGCGGTGAAC ATAAGAAGAA AAGATAAGCA 
072591 CACTAATTAT GCGCCCGACT TCCAGGGGGC GCAATCCAGA GAGCTTTTAT CGCTAAATCA GGGG