MG1655
W3110
Search for
Japanese | English
Deletion Report : 14
General information
Deletion 14  
Location (BP) 2,284,394 - 2,334,827   Go Linear View
Length (BP) 50,434
Related strains
     Strains ME5089    ME5090    ME5091    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer C_2284391_C_14C_L  
Sequence CGAAGCTGAAAATGAGGAGAGGTAACTGTGATGTGTCACGGTCTGTTTAT  
3' Primer C_2334826_U_14C_R  
Sequence ATCAGTACGTTTGGAGCTGGAGATCGGCTCGTCGTCAACGTCCACTTCCG  
Complemented region 5' Primer 2307361_U_14B_Cp5  
Sequence TTACCTCTCCTCATTTTCAGCTTCG  
Position 2307363  
3' Primer 2310119_C_14B_Cp3  
Sequence GATCTCCAGCTCCAAACGTACTGAT  
Position 2310121  

 Linear View (Whole Mode)
View Location
   2309.394  –  2364.222 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             CCTCTCGTGC CGACCAAAAA TCCCAAGAAA 
-00070 AAACCAACCC TTACGGTTGG TTTTTTTATA TCTGCAATTA ATTCGATAAA CAGACCGTGA CACATCACAG 
000001 CCTGTTTATT TTCTGTTATC AGAACGTCCA GACCACACCC GCCTGAGTAT TCCACGGCGA TTCTACCCCT 
000071 GCGCCATTGC CATAGCTGAC TGACAAATGA CCGCTTAACG TCGGGGTAAA CGATGACCTT ATACCAGCCT 
000141 GATAAACGCC ACTGGTTCCA GCCACATCAT TATTAAATTT GCCATCGTCA TTAACTTTCA CCTGGTTAGA 
000211 ATCGGCGTAT TCCTGACGCA CGGCCGCTTT CAGCCAGGGT TCCAGCGTCG TACCGTTTTG CAGGTCCATG 
000281 TGATAGCTTA CCGCCGTTCC CGCTTCAGCG CGTAATATCC GGGTATTTCC CACATCCGCG CGCATGCCGT 
000351 TTGATAACGT GTAGTCCTGA CCATCTGTGG TAAAGCCGGT AAAGGCCAGA TAGGGTCTAA CACTCCACAA 
000421 TCCGTCAACC CAACGGAACC CGCTCTCAAC ATGAGCACCC GCGCCGTTAC TATTGTAATC GCCAAACGCT 
000491 GTTGCCCCAT TACTCATCTT GCCATGGATG GTGTTGGCAA AACGGTCAAC TTTCACCACC CCATCAACAT 
000561 AGGCACCGTT CTGATGCTCC CAACCGGCAT AAGCCCCCAG GGTATAGCTA TCGATATTAC CTTTGCCGCC 
000631 GCGATCAAAA CCAATATCAG AATGAGAGTA ACCAAAGATC AAGCCGCGAA TTGTACTGCT TTCTTCACGG 
000701 GAGAAACGGC TATCGATACC GAGCGTCAGG CCCGTCAATG TTTGCTCAAA ACCAGCTCCC GCATCAGTGG 
000771 TCACGTTGTT GCGGGTGTTA ATTGCCGAAC TCCACATCGC CGTATCGTAA CTAACGCCTT TTACGCTACC 
000841 AAGACGCTCA CGCACGGTGT CCAGTTCTGC ATCAAATACC AGCGGTTGTG CGGCCGCCAT ATTCAGCACA 
000911 TCAGTGGTTG AAGGGGTAAT TTGCGCGCGA TTCTCTGCCA GACTCCAGCT ATGGTTGCCA TTATCCAGCA 
000981 AGGTATATTC ATACGTACCG ATATCAACAA CGCCTCCGGC ATTGCCCAAC GTAAATGCAG CATCACCGCC 
001051 GCCCGTTGTT ACCAGTGTAA GGCTATCTCC TGCTGCCGGG CTGGCACCGG TGTCCGTCAC GAATATTTTG 
001121 AAATCACCTG TTGCCTGACC GGTGACGTTG AGCTGATCGC TCTGATGATT AGCCATATCG GTACGCATAT 
001191 AAAAATTGCC GTTTCCCGAC AGGGTATTGG TGGTCAACGT AATGAAATTT TCCGCACTTG CCGTCACTGA 
001261 TGAACGAGTC ACTGGCTCAT CCATCATAAT CACATTTGCG TCAGACATCG CAAGGTTGGC TAAGTTGAGG 
001331 AGGGTGTTTT GGTTCGTCGT AGTGATATCG GCAATGATGG TCCATACGCT ATTTTCGAGC GAAACGTCCG 
001401 CTTTGCTGGT ATCCACGGCA CCATGCGTTC TAAAAGAAGC GCCCTCAGAA ACCACTACCT TACCCACCAA 
001471 CATTGCGGGT GCATAATTTA TTTGCGGCTT CATGACCTCA AGAATGCCAT CATTCCCTCT GACTGAAACG 
001541 TTAACCATTG TGCCAGCCCA GACGTTAGCG CGGCCATTGT TGATAACCAT ATTTTCAGAG ATGGCTTTTG 
001611 AGGAATACGT GATACTTCCA TTCTGATATG ATCGACCGAG ATCATATACC GCATTTGCCT GCACTTTCGT 
001681 ACCAGTATCC TTTCCCAGCG ATTGCATAGT GGCATGCTTA TCAAGGATAG TATCAATGGC CTGCGTGTCC 
001751 TCCATAACAA TGAGCCCGGA ACCATCATCC AGTTCATAAT TTTTTGACAC ACCATCTTTT ATACTAAATT 
001821 GGCCTTTACT GTTTGGACCA CTCACTTCCA GCGCATTCGT TGAGACAATT AATTTTCCGC CTGCTTTTTT 
001891 ATCAACGCCA GTTACAGTCC CGCCATCCAT AACCTCCAGT AAGCCGCCAC TATCTACAGT GGTATTATAA 
001961 GCGAAGTCAT TTTCTTCAAC TCGCAAACTT CCGCCGTTTT CCAACAACAT ATTATTAGCA ATACCATTCT 
002031 TGATATCGAA CTGACCGAGA CGGTTTGTTC CGAATACCTC CATGGCCCGC GTGGTTGTTT TAATAGCACC 
002101 GCCTGCTTTC TGATCTACCG CAAATGCAAA TCCCCCCTCT TTAACCTCCA GTAGTCCTCC CTTTTCGATA 
002171 GCGACAAAGA CGGCCCCCCC ATCTTTTTCA ACGATTAAGC GCCCGCCTTT AATCGTGGTA TCATTCGCTG 
002241 CGCCATAAAC CTGTAGCACA CCATTATTGA GCGTAGTCTG GTTTGCCGCG CCACCCATTT GAACAATTTG 
002311 ATAACCGTCA TTTAATACTG AGTATTCTGC GGCGCCATTC ATTTCAATGT ACTGATACCC TCCGTTAATT 
002381 TCAGTATTAT TACTTACACC AAATTCTTTT ATATGCTGTT CTCCGCCAGG ATTGATTTTC GTATTATTGG 
002451 CGGTCCCATA AACCAGCTGG ATATCTTTTT CCAGGACAAC ACCATCAACT GTCTCACCAT ACTCAACAGT 
002521 TGATGCCAAT GCTATGGGTG AATATAAGGA AGGTGCGAAT AAGCGGGGAA ATTCTTCTCG GCTGACTCAG 
002591 TCATTTCATT TCTTCATGTT TGAGCCGATT TTTTCTCCCG TAAATGCCTT GAATCAGCCT ATTTAGACCG 
002661 TTTCTTCGCC ATTTAAGGCG TTATCCCCAG TTTTTAGTGA GATCTCTCCC ACTGACGTAT CATTTGGTCC 
002731 GCCCGAAACA GGTTGGCCAG CGTGAATAAC ATCGCCAGTT GGTTATCGTT TTTCAGCAAC CCCTTGTATC 
002801 TGGCTTTCAC GAAGCCGAAC TGTCGCTTGA TGATGCGAAA TGGGTGCTCC ACCCTGGCCC GGATGCTGGC 
002871 TTTCATGTAT TCGATGTTGA TGGCCGTTTT GTTCTTGCGT GGATGCTGTT TCAAGGTTCT TACCTTGCCG 
002941 GGGCGCTCGG CGATCAGCCA GTCCACATCC ACCTCGGCCA GCTCCTCGCG CTGTGGCGCC CCTTGGTAGC 
003011 CGGCATCGGC TGAGACAAAT TGCTCCTCTC CATGCAGCAG ATTACCCAGC TGATTGAGGT CATGCTCGTT 
003081 GGCCGCGGTG GTGACCAGGC TGTGGGTCAG GCCACTCTTG GCATCGACAC CAATGTGGGC CTTCATGCCA 
003151 AAGTGCCACT GATTGCCTTT CTTGGTCTGA TGCATCTCCG GATCGCGTTG CTGCTCTTTG TTCTTGGTCG 
003221 AGCTGGGTGC CTCAATGATG GTGGCATCGA CCAAGGTGCC TTGAGTCATC ATGACGCCTG CTTCGGCCAG 
003291 CCAGCGATTG ATGGTCTTGA ACAATTGGCG GGCCAGTTGA TGCTGCTCCA GCAGGTGGCG GAAATTCATG 
003361 ATGGTGGTGC GGTCCGGCAA GGCGCTATCC AGGGATAACC GGGCAAACAG ACGCATGGAG GCGATTTCGT 
003431 ACAGAGCATC TTCCATCGCG CCATCGCTCA GGTTGTACCA ATGCTGCATG CAGTGAATGC GTAGCATGGT 
003501 TTCCAGCGGA TAAGGTCGCC GGCCATTACC AGCCTTGGGG TAAAACGGCT CGATGACTTC CACCATGTTT 
003571 TGCCATGGCA GAATCTGCTC CATGCGGGAC AAGAAAATCT CTTTTCTGGT CTGACGGCGC TTACTGCTGA 
003641 ATTCACTGTC GGCGAAGGTA AGTTGATGAC TCATGATGAA CCCTGTTCTA TGGCTCCAGA TGACAAACAT 
003711 GATCTCATAT CAGGGACTTG TTCGCACCTT CCATAACGCT GTAGCCACCA GAACAGATAT TGCGGAACGA 
003781 CAAAGAGAAA CAGAACCAGA TTGATGCATT GAGCTTTCAT CCTATGAAAT TAATTGCTGT TAAAAGCATT 
003851 GGGTACAGAA AATACCCATA GCTCCATACC CGGAGTCAGT TTTTAAAAAC TGTTTAAAGA AATGCACAAG 
003921 TATTGTGATT GATTTTTTAG TTGTTTTTCT TGATGAGAAG CTGATGCAAA ATTCCGTCTT TATAATGAAA 
003991 ATGATGCCAA AGCGAACGAC AAGGTTGTAG TTTTCACTAC ATGTCCATAC ATAAAATGGG GTAACATTCA 
004061 CGCGCCTGGT AGCGTTACCA ACGCTACGCT CAAACATAAT GATTCTAATA AAACCTCAGG AGACTACTAT 
004131 GCCTGAAGCA ACACCTTTTC AGGTGATGAT TGTGGATGAT CATCCACTTA TGCGACGCGG TGTTCGTCAG 
004201 TTACTGGAGC TTGATCCTGG CTCTGAAGTG GTCGCCGAAG CGGGCGACGG CGCGAGCGCT ATCGATCTGG 
004271 CGAATAGACT GGATATCGAC GTGATCTTGC TGGATCTCAA TATGAAAGGT ATGAGTGGCC TGGATACTCT 
004341 CAATGCCTTG CGCAGGGATG GCGTTACCGC GCAAATTATT ATCCTGACCG TATCCGATGC CTCCAGCGAT 
004411 GTCTTTGCGC TGATAGACGC AGGCGCAGAC GGTTATCTGT TGAAAGACAG CGACCCGGAA GTATTGCTGG 
004481 AAGCGATTCG TGCCGGAGCG AAAGGCAGCA AAGTCTTTAG CGAACGCGTC AATCAGTACT TACGTGAACG 
004551 TGAAATGTTT GGCGCGGAAG AAGATCCCTT CAGCGTGCTG ACGGAGCGCG AGCTGGATGT TCTGCACGAG 
004621 CTGGCACAGG GGCTGTCAAA TAAACAGATT GCCTCGGTGT TGAATATTTC CGAGCAGACA GTAAAAGTAC 
004691 ATATTCGCAA TCTGCTGCGT AAACTCAATG TCCGCTCACG CGTGGCGGCC ACCATTCTGT TCCTGCAACA 
004761 ACGCGGGGCA CAATAAAAAT AGCCCGATGG ATTTATCATC GGGCTGAGAT TTATGACAAA CGCAAAACTG 
004831 CCTGATGCGC TACGCTTATC AGGCCTACGT GGATCGATCA ATTTATTGAA TTTACACAAT TTTGTAGGCC 
004901 GGATAAGGCG TTCACGCCGC ATCCGGCATA AACTAAGCGC ACTTTGTCAA CAGTCTAGCC CGATGGCATC 
004971 ACCATCGGGC CTCTTTTTAT TTACTCTCCT GCGGCGACAA ATGTTGCATC GCCTGCGCGA TACTACGTTC 
005041 AATCACCGCA CGGCGAGTAT CGTTGGCAGG TAAGAGTTTC AACATCATCT CCCACGCGGC AACGGCTTCG 
005111 CCAAATCGCT GCTGCTCAAA GGCATTAAAC GCATACATGC TTAGCACACG GATATTGCTA TGGTCCGTTC 
005181 TCACCAGCTG ACGTAGCAGT TCACCGCCGA GGCGGTTGTC GTTGGGATCA GATGAACGAG TCAACGCTTC 
005251 AGCGTATCCC AGTGCAGCAT CACTGTTTTT CGGATCGAGG CGATACGCAG TGGCGTATGC ATCGGTGGCG 
005321 ATACTGGCGT TACCCAGCGC CATGCCAACG CGGCCCAACA TAATCCAGCC TTCTATATCT CCCGGATTTT 
005391 TTTGCAGTTG AGTACGCATC CCCAGCGCAA GACGCGACAT CTCTTCTTCG TTGAGCGGAT CGGCTTTCGG 
005461 ATCCAGCGCC CTGTCCAGCA ACGCCGGAGC CTGTGCCGTG GCCTGCTGCC AGATTTTCAC CTGCTGATAA 
005531 TTGCCAGTCT GGTAGTAGCT GACGCCAGCC ACAATTAACG CCACCACAAT ACCCGGCAGA TAAACAACAT 
005601 ATCCGGCACG CTTACCTTCC GGCACGCTTT GTTCAGGAAA CGCTTCCGGC ACCACGCGTA CCCGACGCCG 
005671 CGAGCGGGCG TATATGACCC AACCGCCAAT GCCAATAGCC ACTACTGGCA GCACCCACAG CAGCACGGTC 
005741 AGCGGCGTTA ACGGCGGATC GTAAGTGACG AAGTTGCCGT AACGCGCCAC CATATAATCG ACAATCTCTT 
005811 TTTTACTTTT ACCTTCCTGC ATCAGTTCAT ACACTTTCTG ACGCAGGTCG GTGGCAATCA TCGAGTTGGA 
005881 ATCGGCAATG CTGTTGTTCT GGCATTTCGG GCAGCGCAGT TCTTCAGTGA GCTGACGGAA CTGTTGTTCC 
005951 TGTGCTTCAT CTTTAAACTG CAACACATCG ATGGTCGCCA GCGCTGAGCC GGAGATCATC AGCATCAGCA 
006021 CGCCCAATAA AAACCTCATT GTGCGGCCTC CTTACTGTAT TTCTCCCACA GCGGCTTGAT CTCTTCTTCC 
006091 CAGACGCGAG GATTCAGATC GCCCGCATGG CGATAGCGAA TGATGCCGTT GCCGTCAATA AGAAACGTTT 
006161 CTGGCGCGCC ATAGACACCG AGATCCAGCC CTAACATGCC ATCGCCATCA AACAGGCTTA GCGCGTAAGG 
006231 ATTGCCCAGC TCTTTCAGCC AGCTGATTGC CTTCTGGCGA TCGTCTTTAT AGTTCATGCC GACCACGCGG 
006301 ATGCCCTGCG CAGAAAGCTG ATTCAGATAT TGATGTTCCG CACGGCAGGT CGGACACCAG GTCGCCCAGA 
006371 CGTTAAGCAG TACTGGTTTG CCCTGAGTCA GCACATCCGC CTGATAAAAC TGCCCCGGAT TGTCCAGTGA 
006441 TTCGAGACGA AACTTCGGCA CAGGCTTGCC AATGAGCGCC GATTCCAGAT TGGTCGGATC ATCCCCTTCG 
006511 GCATTACGCG CCAGCTGCCA CAGCAGCGCC GCGGCAATCG CCAGGAAGAT AATCAACGGA ATTAACAATA 
006581 CTTTGCGCTT CATACGGCCT CCGGCGCAGT TTTTTGCGGA CTCACGCGCT TACGATAGCG AGGATCAAAC 
006651 AGACACAGCA GTCCGCCCAA CGCCATCATC AGCCCGCCCG CCCAAATCCA GCGAACAAAT GGTTTGTAGT 
006721 AAAGACGCAC GGCCCACGCG CCGTTTTCCA GCTCTTCACC GAGGGCCGCG TACAGGTCAC GCGTGATGCC 
006791 GCCGTCAATT GCCGCTTCGG TCATCATCGA CCCGGCAGTG TTGTAATAAC GTTTTTCCGC ATACAGCACC 
006861 GTTTCCGGCT TGCCATCGCG CGTTACGCCG ATAGTCGCCA CACCGCCACG CCAGTTCGGG CCAGTCACCT 
006931 CTTTGACATC ACGGAAGGTG AAGCGATATT CATGAATATC GACGCTATCG CCGGACTTCA TGCGCACATC 
007001 ACGCTCAACG CTATAGTTCT GGCTAAAGGC AATGCCAACA ATTGTCACTG CCAGCCCAAG GTGAGCCGCC 
007071 ACCATCCCCC AATAACTGAA GGTGGTTTTC GTGCCGCGTG AAATACGTAG CGCAGCTTCC GCAATTGCCA 
007141 GCACCGCAAT CCAGCAGGCC ATTGCCAGGC CGAGCACCGT CATCGCCACA ACTTTGCTTT CGAACAGCCA 
007211 CGGCAACAGC AGCGACAGCA CCAGCGTAGA GATGAAGGCG ATAATCAATA AATTGCGGAT CTTACGCGGG 
007281 CGATCCCGCC CCCAGCGCAC CAGAGGACCG ACACCAAGCA GTAGCGCAAA CGGCACCATC AGCCAGGTAA 
007351 ACATGGTGTT GAAGAACGGT TCGCCAATCG AAATACTGCC CAGTCCCAGT TGCTTATGCA CCAACGGCAG 
007421 CAGCGTCCCC AGCAACACCA CCAGCATCGC AGCGACCAGC AAAACATTGT TCGCTAACAG CAAAGATTCC 
007491 CGCGACCACA GCGCATTGTT TACGCGTGAG CGAACTTTGT GTCCACGCGC GGCAAACAGC AGCAGCGAAC 
007561 CGCCAATCAC CAGCACCATA AAGGCGAGGA TAAACATACC GCGCGCCGGA TCAGACGCAA ACGCGTGTAC 
007631 CGATACCAGC ACGCCGGAAC GCACGAGGAA AGTCCCCAAC AGACACAACG AGAAGGCACT GATTGCCAGC 
007701 AGTAATGTCC ACGCTTTGAA GCTGGCGCGT TGTTCAGTGA CCGCCAGTGA GTGCATCAGC GCAGTCCCCA 
007771 CCAGCCACGG CATAAACGAG GCGTTTTCTA CCGGATCCCA GAACCACCAG CCACCCCAGC CGAGTTCGTA 
007841 ATAGGCCCAT GCGGAACCGA GCACGATGCC GAGCGTCAGG AAGATCCACG CTGCCAGCGT CCACGGACGA 
007911 GTAAAACGCG CATAAGTGCT GTCCAGACGC CCGCTCAGCA AAGAAGCAAT GGCAAAAGCA AACGCCACCG 
007981 AGAAACCCAC GTACCCCATA TAAAGCAGAG GCGGATGGAA GATCAGCCCC GGATCCTGCA ATAGCGGGTT 
008051 AAGATCGCGA CCTTCAATCG GGAAGTTCGG CAACGTGCGA GAGAACGGGT TAGAGGTAAA GAGAATGAAC 
008121 AGCAAAAAGC CGACACTGAC CATCCCCATT ATCGCCAGTA CACGGGCCAC AATATCCAGC GGAATACGCT 
008191 GACTAAAAAT CGCCACCGCA AAGGTCCAGC CGCTCATCAG CAGCACCCAC AGCAGTAGCG AGCCTTCATG 
008261 CGCGCCCCAG GTAGCCGCCA CGCGATACCA CACCGGAAGC TGGGTATTGG AGTTGCTGGC AACATAGGTG 
008331 ACGGTGAAGT CGTTGACCAC GAAAGCATTG ACCAGCACCA GAAATGCGCC AGCCACAGAC ATAAACAGCA 
008401 GCCAGGCAAA CAAGCGGGAA GACGCCATCA TGCGCGCATC TCCGCGCGCC ACGCCCCATA GCGGATACAC 
008471 GGACAGCAGC AGCGCAATTC CCAGCGCCAG GCACAGCAGT CCGTTACCAA TTTCTGGCAT CATGATGCTG 
008541 GGTCCTTATA AACACTCGCC GGGCGACGGT GGTTAGCTTC CATCGCTTTC TCAACTTCTG GCGGCGTATA 
008611 GTTTTCATCG TGTTTCGCCA GCACTTCTTT CGCGAGGATA TGATTGCCTT TTTCCAGTTC GCCCTGCACC 
008681 ACAACGCCCT GCCCTTCACG GAACAGATCC GGCAAAATGC CTTCGTAAGA GACATCCACT GAGCCTTCAG 
008751 CATCGTAAAT GGTGAAGGTC ACTTTCAGCG AATTGGGATC GCGCTGCACA CTACCCGGCA TCACCATCCC 
008821 GCCAACGCGC AGACGCTGAC CGACTTCCGG CATTTGCTGA GTTTCACGCT TGCCGTAGAG AATTTCCCCC 
008891 GGCGTATAAA AGAGATCGAT ATTCGAGCGC AGCGCATATA GCACCAGACC GATAGTCAGC GCCAGCCCTG 
008961 CCAACACGGC ACAGGCAATC CACAAGCGGT TTTTACGGCG AATATTCATG CAGCCTCCTG CTGTTGCGCA 
009031 GCACGTAAAC GCGCCTCACG CGCCCGCTGT TGCGCCACGC CACGCAGAAT TGCGCGATGT TGCATCACCG 
009101 AGTGCACGAC CAAAACCACC AGCGGAATAA CGGTCATCAC CACCGCCAGC CAGACAAAAA AGGCGTAACC 
009171 GCCCATTGCG AAAAATTCAT TCCAGGAAGC AAATGCAGGG GTCATTTACG GCCTCTTTTC AGTATCAGTT 
009241 CACTCACCCA CGGACGGCGT TTTTCCATCA GCAAAATCAA ATTACGCATC CGCATCAGCG TCAGCGTGGC 
009311 AGACAGGAGC AGGAAGCCAA AAATCGACCA GCGCAGCGGC GAACGCATCG CCGGATCGAT ACTTTGCTGC 
009381 ATCCGCGTTG ATCCCTGATG CAGGGTGTTC CACCACTCCA CGGAGTAATG AATAATCGGC AGATTCACCA 
009451 CGCCAATCAG CACCAGGATA CCTGCCGCAC GGCCCGCCAG ACGGCGGTCG TCGAAGGCGT GCCACAGGGC 
009521 AATCACACCC ACATACAAAA ACAGCAGCAC CAGTTCAGAA GTCAGACGTG CATCCCATAC CCACCAGGTG 
009591 CCCCACATCG GTTTTCCCCA TGCAGAGCCG GTAACCAGGG CAATAAAGGT AAACACGGCA CCAATGGGGG 
009661 CCATCGCCGC CACCGCCAGG TTGGCCATTT TCATCTGCCA GACAAGGCCA ATAAACGCTG CCACTGCCAT 
009731 TGATGCATAA ATGCCCATCG ACCAGATCGC CGCAGGCACA TGCAGGTAGA TAATGCGGTA GCTATTTCCC 
009801 TGCTGATAAT CAGCCGGAGC AAAGCCGAAT CCCCAGATCC AGCCGACGGT AAGCACGACC ACACTGGCAA 
009871 TTGCCAGCCA CGGTATAAAC CAGCCACAGA TTTGATACAG CCGTGGTGGG ATCGCCAGTT GATGCAGTGT 
009941 TTTCCACATA GTTTCGATAC CAGACTCGAA CAAAAATCAG TAATCCAGCG TTATTGAATG CTGATTCGTA 
010011 ACGCTGCCGC CGTCGCAAAA GGACTTAATG TCGCGGTGCC TGCCAGCAAC GCGCCTAAAA TTGCCAGATA 
010081 CCCGTCAACG GGCAAATGCA TAGAAGCCGC GTCCATCGCG GCGGTGGCAA AGATGAGTAA TGGGATAGTC 
010151 AGCGGTAACA CCAGTATGCT GAGCAGCACA CCACCGCGCT TAAGTCCCAC TGTCAGCGCC ACGCCCGGTG 
010221 CACCGAGAAA GCCAAGCGTA GGCGTTCCCA GCAGCAGCGT CAGCGCCATC ACTTGCCAGC CATAAACATC 
010291 CATTCCCAGT AGCATTGCTA CCAGTGGCGA AAGGATGAGT AACGGCAGAC CGGTTACCAT CCAGTGCGCC 
010361 ATCACCTTCG CCAGCACAAC GGCGGGCAAG GGTAACGGCA ACAACATCAA TTGTTCAAGA CTGCCGTCCT 
010431 GCAAATCGTC ACGGAACAGT CGTTCCAGCG CCAGCAAGGA TGAAAGCAGC GCAGCAACCC AGATAATGCC 
010501 CGGTGCAATA CGCGCCAGCA GTTGCGGCTC CGGACCGATA CTGAGCGGAA AAAGGGTAAT TACAATCAGG 
010571 AAGAACCACA GCGGGTTGGC GATTTCGGCG CTATGGCGAA ACGCTACACG CAGCTCAAGA CGGAAAATGC 
010641 GCCAGAACAT CATGCGGCCC TCGTTTGCGT CAGTGAAATG CGGCGAATTT TACTTTCAGC AACGTTGAGC 
010711 GGCTGGTGGG TAGTCAGAAT CACAATCCCC CCCTGCTCCG TATGCTGCGC CATACGCTGG GTCAGACGAT 
010781 CGACACCGTT AACGTCAATC GCGGTAAAAG GCTCGTCGAG GATCCATAAC GTGGCACGGG TCAGCCACAG 
010851 ACGCGCTAAA GCGACGCGGC GTTGTTGCCC GGCCGAGAGC TGATTTACAG GAATATCTTC GAATCCGGCA 
010921 AGCCCGGCCT GCGCCAGGGC TTCCAGACAT TGTGCGGTAT CGCCATCGCG ATGATAAAAG TGCAGATTTT 
010991 CTAACGCCGT CAGCCGGGTT TTGATCCCCG GCTGATGGCC TATCCATAAC AGGTTTTGAT GGTAGCTGTC 
011061 GCGTACCTGA TGCAAGGGCT GCCCTTGCCA GAGAACCTCG CCTGCGTCAG GGCGAGACAA CCCCGTCAGC 
011131 AAACGGAGAA GCGTTGTCTT CCCCGCGCCG TTGCTACCGG TGATTTGTAC CCACTCTCCT GCGTTCAGCG 
011201 TAAATGACAA GCCACTAAAT AAGGTTCGTT CATCCCGCTC ACAAAGTAAC TCTCTGGCTT CAAGCATACC 
011271 CACGCAATAA CCCTGTTAAA AACCTGGCTC GACTTCACGC ATATCGGGCA GCTTGTGCGC TATCCCTTTA 
011341 TGGCAATCAA TACAGGTTTG CCCATCTTTC ACCGCCTGGT CATGCATCTT CGCGGCAACC GATTTCTGGG 
011411 CGGTTGTATC CATATACTCG AAGTTGTGAC AGTTACGGCA CTCCTGCGAG TTATTGTCCT TCATGCGCCG 
011481 CCACTCATTC TGTGCCATCG TCAGACGATG AGCTTCAAAT TTCTGCGGCG TGTCAATAAC GCCAAAAATT 
011551 TTACCATACA GCTCTTTACT TGCTTTGAGC TTGCGTATCA TCTTCGGCAC AAACTCGTGC GGAACGTGAC 
011621 AATCCGGACA GGTCGCACGG ACGCCGCTAC GGTTGTTGTA GTGCACGGAA TCCATGTATT CCTGATACAC 
011691 CGTGTTGCGC ATTTCGTGGC AGCTAATGCA GAACTCTTCG GTATTGGCTT TTTCCATCCC GGTGTTAAAG 
011761 CCACCCCAGA AGACGATGCC GCCAACAAAA CCGATCAACA GCAGCGTCCC CAGCGCCAGA CGGCTGGGGG 
011831 TACGCCACCA TTTCCACAGG CGCTTAATCA GACCAGGCTT ACGGTCAGAA TTTCCCATAA TAACCTCTTA 
011901 TTTCCCGTAA CCTTTTGATG GGGTAAAGGT ATTCCCCACG ATTGGCGCGG TATCGGCCTG CGGTACGTGA 
011971 CATTGCAGAC AGAAATAACG ACGCGGAGCC ACTTCCGCGC CCACTTTGCC GTCGCTGTCC ATAAAGTGAG 
012041 TAGGACTGAT ACGCGGCGCG CCAGTGGTGC GATAGCTTTC GACACCGTGG CACTGCAAGC AGCGATTGGT 
012111 ATTGGTCGTT ACCTGATAAC CTTCAACGCT ATGCGGGATC ATTGGCGGCT GATTCACATA GTTCAGCGGC 
012181 ATCCGATCCT GCTCTTTTGG CATCCGAATG GCCCCTTCCT GTGTCCCGGA TACTTCCGGC GACTGGCTAA 
012251 AATCGACGCC ATTAGCCGCC CAAACCGCGC CGCTTACCAC CAGGGCCAGC ATCGCCGTCC ATTGACACAG 
012321 CGCTTTCTTC AGGTCATGGC TTTTCATGAT TTCGCTCCCG AACTCCATCG TGTAGTTATT GTAAATACAT 
012391 CCTCAGAACA GACATCCACG CAGCGACCGC ACGTCATGCA ATCGCGGCTG GTGACCTGCA CCGGGCTTTG 
012461 TTCATCCAGC ACCGGGGCAC GTAGCACATG CGGTTCCGGG CAAACATGAA AACAATCCAT ACAGCGGTTA 
012531 CATTTCTGCC GATCGGTGGC CGCAACGGTA ATCACACCTT TGCTACCCAG CACGCCATAC AGCGCGCCAA 
012601 CCGGACAAAT GTGCCCGCAC CAGCCGTGTT CAACGACCAG TAGATCAAAT AAAAACAGCG CGAGAATAAG 
012671 CAGCGCGCCG CTGCCGAAGC CCATTACCAG GCTACGCCCC ATCAGAGAAA CGGGGTTGAT CCATTCCCAA 
012741 ATGAGCGTGC CAGTTAAGGC TGATCCCACC AGAATGACCA CCAACAGCAC GTAGCGAATG TGGCGAGGGA 
012811 TCGTCGCAGA CTGATTGAGG TCAAAGCGCC TGCGTAACCA GTTCGCTAAG TCGGTAATCG GGTTCAGCGG 
012881 GCAGACCCAG CTGCAAAATA ATCGCTTTCC CGCCAGGGCG TAGAGCACGG TGATAATCAC CGCACCGGTC 
012951 AACGCCACCG TGGCAGGCAG ATGACCACTG GCAAGACTTT GCAGCGTCAT CAGCGGATCG GTCAGCGGAA 
013021 CGGTGTCGAA TAACAGGCTA CTGCTGTAGT TGCCGTGCAA GATCCACACA CCAAACCATG GACCGCTCAA 
013091 AAACATCCCC AGCACGAAGA ACTGACAAAG GCGACGTAAC ACCAGCCAAC GGTGACTGCG CCACCAGCCT 
013161 TTTTTCTCCA GCGCCTCGCG CCCGGCGTCA CGTTTACGAT TTGCCATTGT TCCCCTCCAG CCAGCCGAAG 
013231 CGGTAATGGT GACCTAACTC CCCTTTCGCC AGTGACAGCG GTAACACCTT GATTGCCGGT TGTTCCAGCA 
013301 CGCATACTTT TTCGCACTTA CCGCAACCGG TACAGGCGTC GCTGTGAACC GTCGGCAGAA AGCGGGCGTG 
013371 CTTACCGGTA CGCGTGTTGC GCTCCAGCTC CAGGGTGATG GCCTCATCAA TTTTCGGGCA TTCGCGATAA 
013441 CAAACATCGC AGCGCAGCCC CTGAAAGTTG AGACAGTTTT CCTGGTCCAC CAGTACCGCC AGCCCCATCC 
013511 GCGCGTCGTC GATCGATTCA ATCTCACGAT CCAGCGCACC GCTTGGGCAC ACTTTGGCGC ACGGAATGTC 
013581 CTCACACATT TCGCAAGGAA TATCCCGTGC GACAAAATAT GGCGTGCCCG CCGACAGACC AGAGGCCAGC 
013651 GTCGCCAGTT TTAAGGTGTC GTAAGGGCAA GCCTGAACAC ACTGACCGCA ACGCACACAG GCACTGGCAA 
013721 AGGCGTTCTC GTTTATGGCT CCGGGCGGGC GCAACCGCAC GCCAGATGCG CGTGCGGTTT GCTGTTGTAA 
013791 CCCCAGCGCC ACACCCACGG CAGCCAGCCC GCCTGCTGTG CGAACGACAT CGCGCAGAAA GCGGCGGCGA 
013861 CCATTTTGAG GTTTCGCTGA CCGGGACATA ATGGCTTACA CCTTCTCCAG TTTGACCGCG CACTTCTTGA 
013931 AGTCCGTCTC TTTCGAGAGC GGATCGGTCG CATCCAGCGT CAGTTTGTTA ACCAACTGTG CGGCGTCGAA 
014001 GAACGGCATG TACACCAGGC CCTGTGGCGG ACGGTTACGA CCGCGCGTTT CAACAATCGA GATCACTTCG 
014071 CCACGGCGAG AAACCACTTT CACTTTGTCG CCACGGCGCA GATCGCGCGC TTTCGCATCC AGCGGGTGAA 
014141 TAAACAGGAC CGCTTCCGGG AAGGCGCGGT GCAGTTCTGG TACACGGCGA GTCATACTGC CGGTGTGCCA 
014211 GTGCTCCAGA ACGCGTCCGG TAGAGAGCCA CAGGTCGTAC TCTTCATCCG GTGCTTCCGC CGCCGGTTCG 
014281 AATGGCAGTG CGAAGATCAC CGCTTTGCCA TCCGGTTTAC CGTAGAACTT ATAGCCTTCG CCCGCTTTCA 
014351 CGTACGGGTC GTTACCTTCG CTGTAACGCC ACTGCGTTTC TTTACCGTTC ACCACCGGCC AGCGCAGACC 
014421 GCGCGCTTTG TGGTAGTCAT CGAACGGTGC CAGATCGTGA CCGTGACCGC GACCAAACCA TGCGTACTCT 
014491 TCGAACAGCC CTTTTTGCAG ATAGAAGCCC AGCTCGCGGG ATTCATCGTT CAGCTGATCT TCCGCCAGTT 
014561 CGGATACCGG GAATTTGCTC ACTTCCGGTG TGGCATACAG CACTTCGTAC AGCGTTTTGC CACGCAGTTC 
014631 CGGTTTCTTC GCCAGCAGAT CTTCCGGCCA TACTTCTTCA GTTTTGAAGC GGCGGGAGAA CTGGACTAAC 
014701 TGCCAGAGAT CCGATTTCGC TTCGCCCGGT GCCTGTACCT GTTGACGCCA GAACTGAGTA CGGCGTTCGG 
014771 CGTTACCGTA AGCGCCCTCT TTCTCTACCC ACATTGCGGT CGGCAGGATC AAGTCGGCGG CCAGCGCACT 
014841 GACTGTCGGA TACGGATCGG AGACGATGAT GAAGTTGCGC GGATCGCGCC AGCCCGGCAT ACGCTCTTCA 
014911 TTGATGTTCG GCCCGGCCTG CATGTTGTTG GTACACATGG TCCAGTAAAC ATTCAGTTTG CCGTCTTTCA 
014981 GCGCACGGTC TTGTGCCACC GCGTGCAGAC CGATTTTCGC CGGAATGGTG CCGCTCGGGA TATTCCACTT 
015051 CTTCTCGCAG ATATCACGGT GTTTCTCGTT GGTCACCACC ATGTCCGCAG GCAGACGGTG AGCAAAGGTG 
015121 CCCACTTCAC GCGCAGTACC ACACGCAGAA GGTTGCCCGG TCAGGGAGAA CGGACCGCAA CCCGGCTGGG 
015191 AAATTTTGCC GGTCAGCAGG TGCAGGTTGT AGACCAGGTT GTTAGCCCAC ACGCCACGAG TATGCTGGTT 
015261 GAAGCCCATC GTCCAGTAGG AGATGACTTT CTTGTTCGGA TCGGCATACA GCTGCGCCAG TTGTTCTAAC 
015331 TGGTCTTTCG GCACGCCGGT CATTTCGGCA GTTTTTTCCA GCGTATACTC GGCAACGAAG GCTTTGTAAT 
015401 CTTCAAAGCT CATCGGTTCG GAGGCGTCAG AACCCGGATT CTTCGCTGCT TTTTCCAGCG GATGGGTCGG 
015471 ACGTAAACCG TAGCCGATGT CCGTCGCCCC TTTGCGCAGG TTAACGTGCT TGCTGAAGAA GTCCTGATTT 
015541 ATCGCATTGT TTTGAATGAT ATAGTTGGCG ATGTAGTTCA GGATCACCAG GTCAGATTGC GGCGTAAAGA 
015611 TGATGCCGTT ATCCGCCAGC TCGAAGCTAC GATGCTGGTA GGTAGAAAGC ACCGCCACGG TGACGTTCTG 
015681 GTTAGAGAGA CGACGGTTAG TGATGCGCGA CCAGAGGATC GGGTGCATTT CCGCCATGTT TGCGCCCCAC 
015751 AGCACAAACG CGTCAGCCTG CTCGATGTCG TCATAGCAGC CCATCGGCTC ATCCATACCA AAGGTACGCA 
015821 TAAAGCCAAC TACTGCCGAC GCCATACAGT GACGCGCGTT CGGGTCGATG TTGTTCGAAC GGAAGCCCGC 
015891 TTTAAACAGC TTGGACGCGG CATAACCTTC CCAGATAGTC CACTGACCAG AACCGAACAT ACCGATCGAT 
015961 TCCGGCCCTT TTTCTTTCAG GGCGGTTTTG AATTTCTCTT CCATCACATC GAAGGCCTGA TCCCAGGTGA 
016031 TTGGGGTAAA TTCGCCTTCT TTGTCATATT TACCGTTTTT CATACGCAGC AGCGGCTGCG TCAAACGGTC 
016101 TTTACCGTAC ATGATTTTGG GCAGGAAATA GCCCTTAATG CAGTTCAGGC CACGGTTAAC CGGTGCGTCC 
016171 GGGTCGCCCT GACAGGCCAC CACACGTCCC TGCTGCGTTC CGACCAGAAC GCCGCAACCA GTACCGCAGA 
016241 AACGGCACGG CGCTTTATCC CATTTGATGG CTTCCTGCTG ACCAACAACG GCGCGGGCAA CGCCCGGCAC 
016311 GCTGAGACCG GCAGCCGCCG CAGCGGCCGC AACGGCGTTA GCTTTCATAA AGCTACGACG ACTGAGTTTC 
016381 ATGGTGTTTC CTCACCTTGC TCTTCCTGCT GGTGATAAAC CAGCGACACC GCCAGCACGC CCTCTACGTT 
016451 GCGTACTGAC TCAATGGTTT GGATCAGCGT TTCGCTGTCT TCTGCTTCCA CCACCACAAT CAACTGACCG 
016521 CTCGGCGCGT CGCTGACAGC AACTTCACAG CCGGGAAAGG CGTTCAGTTG GGTGCTGATG TCTGAAATTC 
016591 GTTCGCTTTT GGCCTGCACG ACCAGGCTGC AAACTTGCCA GTTAGTGTGC ATGGAGATAC TCCGCAGTTA 
016661 TGGCTGATAC CGGACAGCTG GCTGCACATG CTCCACATCC GTTGCAAAGT TGGCTATTAA GTTGCGGCTG 
016731 GTAGATCCCG GAGAGCGTCG GGCGAAAGAT AATTGCCATT GGCTCACAGC TATCCTGACA GCGGCGGCAT 
016801 TCAACTGACT GATACGCCAG GCACGCGTCC CCGATGGTGA ACTGCAAATC CCAGGCCCTG GTGTGGCGCG 
016871 GAGAAAATAG CGATTCGGGG CAAGCCTGCG CGCAGGCGTA ACAGAAGCTG CACTCGTTAT TTTTGAAATT 
016941 AACGCTCGGA TAGCCGCCCG CGCCGCGTTG CAGAATGTTG TTTTCACAAG CATTAATACA GGCGTCGCAG 
017011 CGGGTGCAAT GGGTCAGAAA ATGAGATTCA TCACCGGACC AGGGCGGACG GATACCGTTA CTGGCTTTGC 
017081 GCCAGCGACC AGTGAGTATG CCCCGACGGG ATGCATCAAT CTTCACATTG ACCTTCCATC ATTAACGCGC 
017151 TCTGAAAATT GAGAGCGACC AAATAAACCG CATAATTAAT AAGCCATTTT TATAGCCGCT AAGATATTAA 
017221 AGGATGTGTC AAAGATGCAT ACCCCGATCG GGGTAAAACC TGTAGCAGGA TCAAAAGAGT GGCGGGAAGC 
017291 GTGGCAAAAA CGGGCTTTTG CTCACATTTC AAATGGTTAT AAATATATTT ATATAGCGAT TGATTCACCA 
017361 GAGATATTTC TGCTGGTTTG CTCTCTCATT AGAATTTAAC ACTAAAAGAG CAGGTAAAAT TGTCTGAATG 
017431 TTCTTTAAGT TATTCATAAA GCAAATTAAT AAATCTGATG AATATGTTAA CCTTCAGCGA CATCATCGGT 
017501 GAAAACCTAT AAATGAAGAA GGAAAGCAAA AAAATGAAGA CCATTCTACC TGCAGTATTG TTTGCCGCTT 
017571 TCGCTACCAC TTCCGCCTGG GCGGCAGAAA GCGTCCAGCC ACTGGAAAAA ATCGCGCCTT ATCCACAAGC 
017641 TGAAAAAGGG ATGAAGCGTC AGGTGATTCA GTTAACCCCG CAAGAAGATG AATCTACCCT GAAAGTAGAA 
017711 CTGTTAATCG GTCAGACGCT GGAAGTCGAT TGCAATTTGC ATCGTCTCGG CGGGAAGCTG GAAAACAAAA 
017781 CGCTGGAAGG CTGGGGCTAT GATTATTATG TCTTTGATAA AGTCAGTTCC CCGGTTTCAA CGATGATGGC 
017851 CTGCCCGGAT GGCAAGAAAG AGAAGAAATT TGTCACCGCG TATCTGGGCG ATGCTGGAAT GCTGCGTTAC 
017921 AACAGCAAGC TGCCGATCGT GGTGTATACG CCAGACAATG TAGATGTGAA GTACCGCGTC TGGAAGGCGG 
017991 AAGAGAAAAT TGACAACGCG GTAGTTCGCT AAACTGCCGT GAAGTGCGGC ACCCCGTAGG TCAGACAAGG 
018061 CGGTCACGCC GCATCCGACA TCCAACGCCC GAGCCGGTTG CCTGATGCGA CGCTGGCGCG TCTTATCAGG 
018131 CCTACACCGC TGTGAAGTGC GGCACCCCGT AGGTCAGACA AGGCGGTCAC GCCGCATCCG ACATCCAACG 
018201 CCCGAGCCGG TTGCCTGATG CGACGCTGGC GCGTCTTATC AGGCCTACAC CGCTGTGAAG TGCTCCACCC 
018271 CGTAGGTCGG ATAAGGCGGT TACGCCGCAT CCGACATCTA ACGCCCAAGC CGGTTGCCTG ATGCGACGCT 
018341 GGCGCGTCTT ATCAGGCCTA CACCGCTGTG AAGTGCTCCA CCCCGTAGGT TGGATAAGGC GGTTACGCCG 
018411 CATCCGACAT CCAACGTCCG AGCCGGTTGC CTGATGCGAC GCTGGCGCGT CTTATCAGGC CTACACCGCT 
018481 GTGAAGTGCT CCACCCCGTA GGTCGGATAA GGCGGTTACG CCGCATCCGA CATCTAACGC CCAAGCCGGT 
018551 TGCCTGATGC GACGCTGGCG CGTCTTATCA GGCCTACACC GCTGTGAAGT GCTCCACCCC GTAGGTTGGA 
018621 TAAGGCGGTT ACGCCGCATC CAACATCTAA CGCCCGAGCC GGTTGCCTGA TGCGACGCTG GCGCGTCTTA 
018691 TCAGCATACG CCACATCCGG CATACCATGC CGGATGTGGC GTATCATTAC AACGCAATAT CCGCCACTTC 
018761 TTTTTGAACG GGTTGCGGTT TCAACTGCGG TTTCGGCGTA CTATCTGCTG CCTGCGGCTT GTCGTAGTTC 
018831 AACCCCAGCA CTTCGCTGGT GTACTGCAAC TCGCGTTCTG TTGCCGCTAC ATCACCGTTC AGCTTGCGTC 
018901 CATAAGACGG AACGATCGCT TTCAACGTAG CCTGCCATTG CGGGCTGGAA ACACGATCGC CAAATACTTT 
018971 TTCCAGCAGA TTCAACATAA TCGGCGCGGC GGTTGACGCC CCTGGCGATG CCCCCAGGAG CGCGGCAATG 
019041 GTTCCTTGCT GGTCACTGAC GACTTCAGTA CCCAGACGCA GTACGCCACC TTTCTCGGCA TCACGCTTGA 
019111 TAATCTGCAC GCGCTGCCCC GCTTGCCACA AACGCCAGTC CTCTTTTTTC GCCTGCGGAT AGTACTCTTT 
019181 CAACGCTTCA AAACGATCCT CTTCACTCAA CATCACCTGA CTCACCAGAT ATTTCACCAG ATCGAAATTA 
019251 TCCAGCCCGA CGTGCATCAT CGGCATCACG TTAGAGGTGG TGGTGGAACT CATTAGATCC CACAATGAAC 
019321 CGTTTTTGAG GAATTTGGTT GAGAAGGTGG CAAATGGCCC AAACAGCACT ACGCGTTTAC CGTCCAGAAC 
019391 GCGGGTATCG ATATGCGGAA CCGACATCGG TGGTGCGCCA ACGGATGCTT TACCGTAAAC CTTCGCCAGA 
019461 TGGTGATTAA CCACGTCCGG GTTTTCCGAA ACAAGGAACT GTCCGCCCAC CGGGAAACCG GCGTAGTCTT 
019531 TCGCTTCCGG AATCCCCGAT TCCTGTAACA GCTTCAGCGC CGCACCGCCC GCGCCGATAA AGACAAATTT 
019601 GGCACGAATG TTCTGTGCAG TGCCATTTTT CAGATCGGCA ACGGTAACGG TCCAGGTGTT ATCGTCATTA 
019671 CGCTTTAGGG CGCGGACTTC GCTGCTGAGT TGCAGCGAGA AGTTAGATTT CTTCTGCAAG GAAGCAATTA 
019741 ACTGGCGGGT GATCTCGCCG TAGTTCACAT CGGTACCAAT TTCCGTACGC GTGGCTGCCA CTTTCTGTTG 
019811 CGGATCGCGC CCTTCCATCA CTAACGGTGC CCACTCTTTG ATCTGCGCGT GATCTTCAGA GTAACGCATA 
019881 CCGCGAAACA GCGAGCTTTG TTGCAACGCG GCGTAACGGG CGCGCAGGAA ATTGACGTTA TCCTCGCCCC 
019951 AGACAAAGCT CATATGCGGA ACGGTATTGA TAAATGAACG CGGAGTACGC AGCACGCCGC GCTCAACCTG 
020021 GTGCGCCCAG AACTGGCGGG AAATCTGAAA TGCTTCGTTA ATGGCGACTG CTTTTTCAAT ACTGATGCTG 
020091 CCATCGGCGT TTTGCGGGGT GTAGTTCAGT TCCATCAGTG CAGAATGCCC GGTTCCGGCG TTATTCCAGC 
020161 CGTTCGAACT CTCCTGCGCG ACACCCTCCA GGCGCTCCAC CATGGTCATC GACCATTCAG GCTCCAGCTC 
020231 GCGTAAATAG GTCCCCAACG TGGCGCTCAT AATGCCGCCG CCAATCAACA GTACATCAGT TTCCTGCTCC 
020301 TCGGACGCTT TCGCTTTTGC CGCCATCGAA ACGGCATTAA GCCCCACGGC CATCGAGAAG AGCATGGCAG 
020371 TCACTTTTTT CATCTTGTTA ATGCCTTACT TTTAGTCGCT TTATTGCAGG TGAGATTTGC GCGGCATCAA 
020441 CGGTAACACT TAAGTAACAA CATTTAAATA ATGTTTATAA ATTATATTCT AATTTTAGAA ACATTATAAT 
020511 TTCGTTGATT AATTATAGGG TTATTAGAAA TGAAGGGATT TTTAGCATAT TGACCTGACG GCAGCAGTCC 
020581 GCCAGGTCAG CGTCGTAATA TTATGCCGTC CGGGCAACGG CATCACGCGA AGCGGCATCG CGCTCTTCGC 
020651 CCGTCAGCTC GCTAAGTTGC CCATTGCGCA TTTCCAGCAG GCGGTCGGCG TGGATAAAGT AATGATCATC 
020721 ATGACTGATA GCGAAAATAG TTTTACCCAT CTCCTGCATC AGCGGCAGCA ACACCTGATA AAACTCACGA 
020791 CGGAAGTGTG GATCCTGATC CGCCGCCCAT TCATCCAGCA GGATAATATC GCGTTCTTCT GCCAGCGCCA 
020861 GCAACAGCGC CACGCGTTTT TTCTGCCCTT TTGATAACTT CAGGTTAACA ATACGCCCGT TGCTTAACTC 
020931 AAGCTTATGA GCCATTTTCA GCTGCGCCAG CCACTTCTCA ACCAGTTGCG GGTTAGCGGG TTTACCCTCC 
021001 GGCCCCAGCA GTTGATCAAA CAGCCAGACA TCGGTAAACA CTGCCGAAAA CAGTTTGCGA TAATCTTCCG 
021071 GTTGTTCGCC GCTGACAGGT TTGCCATCCA GCAAGATTTC GCCGCTTTGT GGCTGATACA AGCCCGTCAA 
021141 CAACATCGCC AGCGTCGATT TTCCGCTACC GTTGCCGCCA ATCAGAAACA GCAGCTCGCC ACGTTTGATG 
021211 GTGAGATTAA TCGGACCAAC GGAAAACGCG TTATCCTGAT AAGCAAACGT CACGTTACGC AGCTCCAGCG 
021281 TTTGCCAGTT GGGAAACGCC TGCGGGCGCG GAAACTCTGC TTTGAAAGGC GCGAGCGCGA ATTTGTTCAG 
021351 CTTGTTAAAC GCCACCTGCG CCGTCAGCAG CGTCGGCAAT GCGCCAACCG CCGAAAGCAG CGGCGTACGC 
021421 AGGAATAAAA GCGTCAACGA ATAGGTCGCG GCAACGTTGG TATCAGCCCA ACCGAGGCTG TTCGCCATCC 
021491 AGAACACCAG GCCGATTGCG CCCAGCATCA TGATGTTTGA CCAGTTCACG GCACTAAGAT GGAAGGTGTC 
021561 TGCGCGAATA ATATGGTGGC GATACTCTTG CGCATCAGGA ATGTAGAGGT TGTTAAACAC ATACTCGGCG 
021631 CGTTCCCGGT TCAGAGTCAG CTCTTTGCGC CCTTCAAGTA CAGTTTGAAA ATCCGTGTAC AGCTTGTCTT 
021701 CGGTTTCACG CAGGGTCGCC ATATGTTTGT ACACCCGCGC CACCAGCACA AAACCGCCCC AGATGGTGAT 
021771 CGCCATCCAG ATAGCCGTTA CCAGCAACAT TTTGCCCGAC AGCATCCACA GATACGCCGC TGAACCGATA 
021841 GTGAGAATGA TCCCCTGCAC CAGTTCCGGC AGACGCACAA AAGCAATGGT GATATTGCGC ACATCGCTGG 
021911 TTAACCCCGC CAGCAACGAG GCGCTACCGA GTTGTTCAAT GCGCTCGACG TGAGTATCCA GAATCCGCTT 
021981 GATAAATTCA CTACGCAGTC GGTAAACGAA GTGATGCCCC AAAGTGGTGA GCGCCAGTTG CGATCCGAGA 
022051 GTGACTGCCA TCAACAGCAG CAATAATCCC AGAAACTCCG GCAACACCAG CAGACTGGTA TCCGCCGTTT 
022121 CGATAAGGCG CTGATTGATA AAAGCAATTA AGCCAATGCC TAATGCCGCA CTGGCGAGGC TTAGCGCCAT 
022191 CACACTGATA AATGGCCAGC GATACTGCCG CCAGACAAGT ACAAGAAGTT CCATGCAGAA AACCCGGACA 
022261 ATGAATTACA GCCCGCAGTT TAAACATCTT CGCGCGCACA GCAATAATAA TTCTTATTTT TATTCTTTTT 
022331 TACCTGCCTG ACGGAATGTC AGGTTGTAGC GGCAGTCGAT GGTGAGTGGA TGAAACCCCG CTTTCAACGG 
022401 TTGAATACCG TGATAAAACA GCCGCGATTC ACCGCCCCAT ACCACCACAT CGCCATGTTC CAACAACAAA 
022471 CGTTTGAGCG GATCATTTCG TTTCAGGCCG CCAAATTGAA AAATCGCGGG TAAGCCCAGA GAAACAGAAA 
022541 CAATTGGCGC GCGCAGATCC GGTTCGTCTT TATCCTGATG CAGCGACAGT TTCGCGCCAG GAGCGTAGCG 
022611 GTTGATAAGA CAAGCATCTG GCTGGAAATC TGGATAGCCC GCCGCCGTAG CCGCACGTTG ACATAAATTA 
022681 TGAAAACTCT GTGGCATGGC GGGCCACGGT TTATTTGTTT GCGGATCAAT GGGCGAATAG AGATAACCTT 
022751 GCCGATGGGT CGTCCAGCCC AGATGCCCAC AGTTGGTCAT CGCCACCGAC ATGGTATATC CCCCGGGGGT 
022821 GACCATCTGG CGAAACGGCG ACTGGCTGGC AACGTCATTA ATATCGCGGA TCAGTTGCTC CGCAGCGTTA 
022891 AAAGCAAAAC GCCGTAAAAT TACCGCACCA GCCGCCAGTG GCTCTTGCCA CGGTTCAGCA TCGGCAAACA 
022961 GATCCAACAT TACCTCTCCT CATTTTCAGC TTCGCGGCGC AGCAGTTGCG CTTTACGCGA CACGCCCCAG 
023031 CGGTAACCGG AAAGTGTGCC ATCACCACGG ACCACCCGAT GACAGGGTAT TATGATAGCC AGCTTGTTGG 
023101 CGGCACAGGC GCTGGCAACG GCCCGTACCG CTTTCGGTTT GCCGATGGCG TTAGCCAGTT GCTGATAACT 
023171 GACGGTTTCA CCGCAAGGTA TCGTGCGCAG TGCCTGCCAG ACTTGTTGCT GAAAAGCAGT GCCGCGAATG 
023241 TCCAGCGGTA ACGTCAGCGG CGTATCGCGT TGATTGAGGC TGGCGATCAC TTCACGCACA TGTTGCTGAA 
023311 ACATCAGATC GGCAGGCGCG TTGTCGGCAG CGGGAAACAT CTGCTGCAAC TCGCTGATTA GTGTCGCGTC 
023381 ATCATCGCCC AGCAATATCG CGCAAATCCC CCGCTCGCTT TCTGCCACCA GGCAACGACC CAGCTCACAA 
023451 TCAGCCAGCG CGTAACGCAC CGCCAGATTT TCGCCACCGT GACGGAATTG TTTAGCCGTC ATGCCCAGCG 
023521 TTTCGTCAGC TTTGCGATAG TAACTGCTGC TGTCGGGGAA TCCGGCGTTA AGAATAGACG TCGTCACGCT 
023591 CTCCCCTTTC GCCAGCGATT CGCGCAAACG GCGAGCGCGC CAGGCCTGTT GCCAGGCTTT AGGCGTCATT 
023661 CCGGTAGTCG CTTTAAACAA CCGATGTAGA TGAAATGGAC TCATCGCCAC CTGGTCGGCT AAGGCTTCCA 
023731 GCGTTACAGG CGTTTCCTGT TCCAGCAGTC GACACGCGTG GGTGATTTTA TCCAACCGAT GTTGCTGGGC 
023801 ATTGGCTTTT TCTGGCTGAC AACGTTTGCA GGGGCGAAAG CCAGCGGCGA GTGCCTCGCT GGCATTTGCG 
023871 TAGAAGGAGA CGTTTTCCCG CAAAGCATGT CTGGCGCGGC AAGACGGACG GCAAAAGATG CCTGTGGTAC 
023941 GCACGGCGAA AACGAATTCG CCGTCGGCAT TCGGGTCGCG GGCTAAGACA GATTGCCAGC GTTGATCGTC 
024011 AGTTAAGCAT GTGGCTTTTT TCATAATCAG CTCCCTGGTT AAGGATAGCC TTTAGGCTGC CCGGTCACCA 
024081 TCACGCAAAA ACCAACAATC TTGCGCTTTA ATTTTTTTCG CTGACAAGGA AGCTTTTAAA CTGTGGTGAC 
024151 ATCCAGGTTT TAAAGCTATC GCCTTCTTTG GTGATCATAT AAACCGCCAG CCCTTCCCGG CGAACAACCT 
024221 CTTTAGCTTT CTCCGGCCCG AGTACCATCA AGCCAGTATC CCAGGCATCG GCTTCCAGCG CCGTCGGAGC 
024291 AATCACCGTC ACGGATACCA GATTGTGTTC GATGGGACGC CCGGTTTGCG GATCGATAAC ATGGGAAAGA 
024361 CGTTTGCCGT CCAGTTCGTA ATAGTTACGG TAGCTGCCAG AGGTGCTAAT CCCATGACCG TTGATATCCA 
024431 CCACAGCCTG AACCGCGTTT TCTTTATCGG TTGGTTTTTG AATCGCTACC CGCCACGGCA GGCCTTCACC 
024501 GTTCATACCA CGGCTGTTCA GCGCGCCGCC CACCGACACC AGATAGCGGG AAATCCCTTC CTGCTCCATC 
024571 AAGCGTGCCA AATGATCGGC CGCATAGCCT TCGCCGACGG TGGAGAGATC GACATATAAA TCCGGCAGGT 
024641 CTTTTTGCAG ATATTGCTGA TGCGACTGAT TGATGACCGT CAGGTGCTGT AAGCCGGTTT TGGCTTTCAT 
024711 CGCATCGATC TGTTCCTGGC TCGGAATTTG AACCGGCTGT TGTTCCGGGC CAAAGCCCCA CAGATTCACC 
024781 AGCGGCCCGA CGGTTATATC CATCGCGCCA TCGGTCTTCG CGCCAATGCG CAGCGAGGTG GTGACGATAT 
024851 CGGCCATCGC TTCACTTACC GGCCACGGCG ATAAACTTTG CGAGTCGTTA AAGCGCATCA GCGCGGAATC 
024921 TTTTTTATAG GTCGAAAGCA GCTGATCGTC GGCGTCCAGT TGGGTCTGAA TCTTTTCTTT AAGTTCGGCG 
024991 CTGCGTTTGG CGTCAATGCC CGGGATGCTG GCACGCCAGA AGGTACCCAT AGTTTTGCCT TCAAGAACGG 
025061 TAACTTCAGT AGCGTGGGTT TTGGCGGGTT GTGGTTTTTG ATCGCAACCA ACAAAGAAGA GCGCGGCAGC 
025131 CAGCAGTGCC ACGCGGGTAA AGCTTATTTC CATACGTGAT TATCCTCATG CGAACGGTCG CAAGAGTACA 
025201 CCAAAAAACT GAGTTTGTAC GCTGAAAACA ATGAAAAAAG GGCCCGCAGG CCCTTTGTTC GATATCAATC 
025271 GAGATTAGAA CTGGTAAACC AGACCCAGAG CTACGATGTT ATCAGTGTTG ATGCCAGCGT CACGAGTGAA 
025341 CTGGTTGTCG TCCAGCAGGT TGATTTTGTA GTCAACGTAG GTGGACATGT TTTTGTTGAA GTAGTAGGTA 
025411 GCACCAACAT CAACATATTT CAGGATATCT TCGTCGTCGT AGCCACGACC CAGGTTTTTA CCTTTAGACT 
025481 GCAGGTAAGC CAGGGACGGA CGCAGACCGA AGTCGAACTG GTACTGAGCA ACAGCTTCGA AGTTCTGTGC 
025551 TTTGTTCGCC CAACCCAGGG AACCTACGCG AGTTGCGTTG TAGGTCTGGG TGTACTGAGC AGCCAGGTAG 
025621 ATGTTGTTAG CGTCGTATTT CAGACCACCA GTGTAGGTTT CAGCACGGTC GCCGTTACCG ATGTAAGCAG 
025691 CGGTGTTCTG AGCATCAGTA CGTTTGGAGC TGGAGATCGC ACCACCGATA CCGAAACCTT CGTAATCATA 
025761 AGTGATAGAA CCGCCGACGC CGTCGCCGTT TTGACGCAGT GCGTCACGAC CGTTGTTAGT TACGCCACTA 
025831 GTAAAGCCTT CACCAGATGG GTTGCCGTTT TTACCCTGGT ACTGAACAGC AAAGTTCAGG CCGTCAACCA 
025901 GACCGAAGAA GTCAGTGTTA CGGTAGGTCG CGAAGCCGTT ACCACGCTGC TGCATGAAGT TGTCAGAACC 
025971 GTAGGTGTCA CCACCGAATT CTGGCAGTAC GTCGGTCCAG GAAGTTACGT CATAAACAAC GCCGTAGTTA 
026041 CGACCGTAGT CGAAAGAACC CACATCCTGG AATTTCAGAC CTGCGAATGC CACACGGGTC CAGGAGTTGT 
026111 TTTCGTTTTC AGCGCTGTTG CCCTGGATCT GATATTCCCA CTGGCCGTAA CCGGTCAGCT GGTCAGTAAC 
026181 CTGAGTTTCA CCTTTGAAGC CAAGACGCAT GTAGGTCTGG TCGCCATCTA CATCTTTGTT GTCAGAGAAA 
026251 TAGTGCAGGC CGTCTACTTT ACCGTACAGA TCTAATTTGT TGCCGTCTTT GTTGTAAACT TCAGCAGCGT 
026321 TTGCTGCGCC TGCTACCAGC AGAGCTGGGA CCAGGAGGGA CAGTACTTTA ACTTTCATGT TATTAACCCT 
026391 CTGTTATATG CCTTTATTTG CTTTTTTATG CCACTGCATA CTGATTAACC CTCATTAATC AGTCGGCAAG 
026461 TCCATTCTCC CCAAAAATGC AGAATAATCC AACACGAATA TGATACTAAA ACTTTTAAGA TGTTTCATTT 
026531 ATCGCTATAG ATGTTTCAAA ATGTAAATGC AAGGGAACTT TTTAAGATTA TTGCGGAATG GCGAAATAAG 
026601 CACCTAACAT CAAGCAATAA TAATTCAAGG TTAAAATCAA TAACTTATTC TTAAGTATTT GACAGCACTG 
026671 AATGTCAAAA CAAAACCTTC ACTCGCAACT AGAATAACTC CCGCTATCAT CATTAACTTT ATTTATTACC 
026741 GTCATTCATT TCTGAATGTC TGTTTACCCC TATTTCAACC GGATGCCTCG CATTCGGTTT TTTTTACCCT 
026811 TCTTTACACA CTTTTCATTA TTCTGTGCTA CCACAGAAAA ACTATAACGC TTGTTAACTA TTTCACAAAT 
026881 AATTAACATC CGCATAATTT CCAGCAATCT TTGTTTATTT GCAATTATTT TTGTTGGGCT TTTTGTAGGT 
026951 TATTTGTACA GCAAAATGGC GCTTGTACAT CTATTTCCCC CAATGCAGGA TGATAAATAT CACGGGAGAA 
027021 TAGAGAATCA TCAATCAGGT AAGAGTCTGG AATTTCACAC TGTACCCTTT ATACTGCCCT ATCACTTCGC 
027091 GAAGTTTTAA CAGGTCATAA ACACGAATGC GTCAGAAAGA GACAACGGCC ACGACCCGCT TTTCACTCCT 
027161 ACCGGGGAGC ATTACCCGCT TCTTTTTACT GTTGATCATT GTGTTACTGG TGACGATGGG TGTAATGGTA 
027231 CAAAGCGCCG TTAACGCCTG GCTGAAAGAT AAAAGTTACC AGATTGTCGA CATTACCCAT GCTATCCAAA 
027301 AGCGCGTCGA TAACTGGCGT TACGTGACCT GGCAGATCTA CGACAACATT GCCGCGACGA CCTCCCCCTC 
027371 CTCCGGCGAA GGTTTACAAG AGACGCGCCT GAAACAGGAT GTCTACTATC TGGAGAAACC ACGCCGCAAA 
027441 ACGGAAGCGT TAATCTTTGG CTCTCACGAC AACTCAACGC TTGAGATGAC TCAGCGGATG TCCACTTATC 
027511 TGGATACATT GTGGGGCGCA GAAAATGTAC CGTGGTCGAT GTATTACCTG AATGGTCAGG ATAACAGTCT 
027581 GGTGCTGATC TCAACCCTAC CCCTTAAAGA TCTCACCTCC GGATTTAAAG AATCGACCGT CAGCGACATT 
027651 GTTGATTCAC GTCGTGCAGA GATGTTGCAA CAGGCCAACG CCCTCGATGA ACGCGAAAGC TTTTCTAACA 
027721 TGCGCCGCCT GGCCTGGCAG AACGGTCATT ACTTTACATT GCGTACTACC TTTAACCAGC CAGGACATCT 
027791 GGCAACGGTC GTGGCTTTTG ATCTGCCGAT TAATGATTTG ATCCCACCGG GTATGCCGCT GGACAGTTTC 
027861 CGCCTTGAGC CAGACGCGAC GGCAACGGGA AACAATGATA ATGAGAAAGA AGGGACGGAT AGCGTCAGTA 
027931 TCCACTTTAA CAGTACGAAG ATTGAAATCT CCTCGGCACT CAACTCTACC GATATGCGCC TGGTCTGGCA 
028001 GGTTCCTTAT GGCACCTTAT TGCTGGATAC GTTGCAAAAC ATTCTGCTGC CACTGCTGCT GAACATCGGT 
028071 TTGCTGGCGC TGGCGTTATT TGGCTATACC ACATTCCGCC ATTTCTCCAG CCGCAGTACA GAAAACGTCC 
028141 CCAGCACGGC GGTCAATAAC GAATTGCGCA TTTTACGGGC AATCAATGAA GAGATAGTCT CACTGCTGCC 
028211 GCTCGGCCTG CTGGTTCACG ATCAGGAATC GAACCGCACT GTCATAAGTA ACAAAATTGC CGATCATTTG 
028281 CTGCCGCATT TGAATCTGCA AAACATCACC ACCATGGCGG AACAGCATCA GGGGATTATT CAGGCGACGA 
028351 TCAATAACGA GCTGTATGAG ATCCGCATGT TCCGCAGCCA GGTCGCGCCG CGCACACAAA TTTTCATTAT 
028421 TCGCGATCAG GATCGCGAAG TGCTGGTAAA CAAGAAACTC AAGCAGGCGC AGCGTCTGTA TGAGAAAAAC 
028491 CAGCAGGGGC GGATGATCTT TATGAAAAAC ATTGGCGATG CGCTGAAAGA ACCCGCACAG TCCCTGGCGG 
028561 AGAGCGCGGC TAAACTCAAC GCCCCGGAAA GCAAACAACT GGCGAATCAG GCAGATGTGC TGGTGCGGCT 
028631 GGTTGATGAA ATACAGTTAG CGAACATGCT TGCGGATGAT AGCTGGAAAA GTGAGACGGT GCTGTTCTCC 
028701 GTGCAGGATT TAATTGATGA AGTTGTGCCT TCAGTGTTGC CTGCCATCAA GCGTAAAGGT CTGCAACTGC 
028771 TGATTAACAA TCATCTGAAA GCACACGATA TGCGCCGCGG CGATCGCGAT GCCTTACGAC GTATTTTGCT 
028841 GCTACTGATG CAATATGCCG TGACCTCAAC GCAATTGGGA AAAATCACCC TTGAGGTTGA TCAGGATGAG 
028911 TCCTCCGAAG ACCGCCTGAC GTTCCGCATT CTGGACACGG GAGAAGGCGT AAGTATTCAT GAAATGGATA 
028981 ATTTGCACTT CCCGTTTATC AACCAGACCC AAAACGATCG CTATGGCAAG GCGGACCCGC TGGCATTCTG 
029051 GCTGAGCGAT CAACTGGCAC GTAAACTGGG CGGTCATTTA AACATCAAAA CGCGGGATGG GCTTGGTACA 
029121 CGCTACTCTG TGCATATCAA AATGCTCGCA GCTGACCCGG AAGTTGAAGA GGAAGAAGAG CGTTTACTGG 
029191 ATGATGTCTG CGTAATGGTG GATGTTACTT CGGCAGAAAT TCGGAATATT GTCACTCGCC AGTTAGAAAA 
029261 TTGGGGTGCA ACCTGTATCA CACCCGATGA AAGATTAATT AGTCAAGATT ATGATATCTT TTTAACGGAT 
029331 AATCCGTCTA ATCTTACTGC CTCTGGCTTG CTTTTAAGCG ATGATGAGTC TGGCGTACGG GAAATTGGGC 
029401 CTGGTCAATT GTGCGTCAAC TTCAATATGA GCAACGCTAT GCAGGAAGCG GTCTTACAAT TAATTGAAGT 
029471 GCAACTGGCG CAGGAAGAGG TGACAGAATC GCCTCTGGGC GGAGATGAAA ATGCGCAACT CCATGCCAGC 
029541 GGCTATTATG CGCTCTTTGT AGACACAGTA CCGGATGATG TTAAGAGGCT GTATACTGAA GCAGCAACCA 
029611 GTGACTTTGC TGCGTTAGCC CAAACGGCTC ATCGTCTTAA AGGCGTATTT GCCATGCTAA ATCTGGTACC 
029681 CGGCAAGCAG TTATGTGAAA CGCTGGAACA TCTGATTCGT GAGAAGGATG TTCCAGGAAT AGAAAAATAC 
029751 ATCAGCGACA TTGACAGTTA TGTCAAGAGC TTGCTGTAGC AAGGTAGCCT ATTACATGAA CAATATGAAC 
029821 GTAATTATTG CCGATGACCA TCCGATAGTC TTGTTCGGTA TTCGCAAATC ACTTGAGCAA ATTGAGTGGG 
029891 TGAATGTTGT CGGCGAATTT GAAGACTCTA CAGCACTGAT CAACAACCTG CCGAAACTGG ATGCGCATGT 
029961 GTTGATTACC GATCTCTCCA TGCCTGGCGA TAAGTACGGC GATGGCATTA CCTTAATCAA GTACATCAAG 
030031 CGCCATTTCC CAAGCCTGTC GATCATTGTT CTGACTATGA ACAACAACCC GGCGATTCTT AGTGCGGTAT 
030101 TGGATCTGGA TATCGAAGGG ATCGTGCTGA AACAAGGTGC ACCGACCGAT CTGCCGAAAG CTCTCGCCGC 
030171 GCTGCAGAAA GGGAAGAAAT TTACCCCGGA AAGCGTTTCT CGCCTGTTGG AAAAAATCAG TGCTGGTGGT 
030241 TACGGTGACA AGCGTCTCTC GCCAAAAGAG AGTGAAGTTC TGCGCCTGTT TGCGGAAGGC TTCCTGGTGA 
030311 CCGAGATCGC TAAAAAGCTG AACCGCAGTA TTAAAACCAT CAGTAGCCAG AAGAAATCTG CGATGATGAA 
030381 GCTGGGTGTC GAGAACGATA TCGCCCTGCT GAATTATCTC TCTTCAGTGA CCTTAAGTCC GGCAGATAAA 
030451 GACTAATCAC CTGTAGGCCA GATAAGACGC GTTAGTGTCT TATCTGGCAT TTGCACCGAT TGCCGGATGC 
030521 GGCGTAAACG CCTTATCCGG CCTACGATTC CCATTATTTC AACAAATTAC ATTAAAGTAG GCCAGATAAG 
030591 ACGCGTCAGC GTCGCATCTG GCATTTGCAC TGAATGCCGG ATGCGGCGTA AACGCCTTAT CCGTCCTACG 
030661 AATCCCGCGA TTTCCTGACC CTCTCGGCAT ATAACGTCAG CGTCTGTTTT ATCACATCCA GCGTTACCGG 
030731 CTTCGACAGG CAGCTGTCCA TACCGGACTC CAGACACCGC TGCTTCTCTT CAGCCAACGC ATTAGCAGTT 
030801 ACTCCGATTA CCGGCAACGT CAGTCCCAAC TGACGAATGC GTTGCGTCAA GCGGTAACCA TCCATATTTG 
030871 GCATGTTGAC GTCGCTAAGC ACGATATCAA TATGATTCTT GCTAAGTACA TTAAGCGCAT CGACGCCATC 
030941 ATTCGCGGTT TTACATTGAT AGCCCAACGA TCCCAACTGA TCTGCCAGCA AACGCCGGTT AATCGGATGA 
031011 TCATCCACGA CCAGAATCAT CATATCGTCA TTATCGCTGA CCGCTTTGTC CGTTGACGGC AGAGCGTTAG 
031081 CAGGATCGTC GCTCTCCATC TCGATCAAAT AAATACGCGC CAACAATGCC GGTAGCTCAT GCGGAGCAGC 
031151 CACACTGTGT ACCCACTCCC CTGGCGCTTT CTCCAGCGGA ATACCAATAT GGCGACGACA GAAGGTCACT 
031221 ACCGCTCTGC CCTGCCATTT TTTACTCACT ACCTCGTCAG TGATCAACAC ATCTTCGGGA GTCGGTTCCT 
031291 GCCCTTCGTA TGTTGTAACG ACGATGCCGC TGCGCTGCAA ACTGGTTTCC AGGAACTGAC AGAGCGACGC 
031361 ATTGCGGACC GCCAGCCAGC AGCGTTTACC ACTCAACCCT TCCACGCCTT TTTTCTGCGG GTACTGAGCG 
031431 CCGTACAACG GAATACGCAC GGTAAACTGG CTGCCCATTC CCGGTTCTGA ATCTACCGAG ATATCGCCGT 
031501 CCATCATGCT GATCAGTTTT TCACAAATCG CCAGACCCAG ACCGGTCCCC TGGAAATTAC GCTGTACGCC 
031571 CGTTCCGACC TGGAAGAAGG GATCAAACAA GCGCACCACT TCTTTCGCCG GTATCCCCAC GCCGGTATCG 
031641 CGAACACGGA TAGAGAGATA ATCGCCATCC GCGCGAACAT GCAAAACTAT ACAGCCGGTA TCGGTGAATT 
031711 TTATGGCGTT ACTCAACAGG TTGGAGATGA CCTGCTGTAA ACGCATCGGG TCGCCATTTA AGGCCACTGG 
031781 CACATCCGGT TCAATAAAGC AGTACAAGCC TAACTGCTTG CGTACCACCA GCGGTAAATA GTTGGCGGTG 
031851 ATGTGGTTCA TCACTTCACG CGGTGAAAAC TCACGCGGTT CGATCTTCAA CTGTTCCGAT TCAATCTTCG 
031921 AGAAATCGAG AATATCGCTG ATAATTTTCA ACAACAGGCT GGAAGAGTTG TTCATTGCCG TCACCAGCCG 
031991 ATCGACGCCT TTCGGTAACT CTTTGGTTTG CAACAGATCC AGGTTACCGA TAATGCCATA CAGCGGCGTT 
032061 CGCAGCTCAT GACTGACGGT GGCAAGGAAC ATCGATTTTG ACTGGCTCGC CTGTTCCGCT GCTTGTGCCA 
032131 TCTCCTGCAA CGACTCTTCC ATCTTCACGC GCGAAGAAAC ATCCACCAGC ACACAAATGG CCACGTTTTC 
032201 ATTACGATAG CGCGAATGGA CGAAGCTGAT TTGCAGATTG GTATTGTTGC TGGTCAGGAC ATCAACAAAA 
032271 TTGACCTGCT GCCCACAGAT AATTTGCGTC AGTCGTTGGC GGTCCTCATG CGTAAGCATA TTGAGATAGG 
032341 TATGCGCCAG TTCGTTACTT AAAATATTGA CGCCATCAGC GGTACGCAAA ATGCAGATAC CCACTGGCGC 
032411 GGAGGCGACA ATCTTGCGAT TGAACTGCTC ATGTTCTTCC AGTCGCAGGG CGTCGCTTTC CGCCGGAATG 
032481 AAAATACGTC GCTCGTACAT CCGTGCGAGA GTAAACAATG CAGCTCCGGC AAGCACATTC AGCAAAATTG 
032551 CGTTAAGGAT CAACATGCGA ATGCGTTCCA GCACCTTATC AACCGGCACC GAATACACGA TGCTTAGCGA 
032621 TGAGGGTGGC AGATTTTTCT TCAGCACCAG CTCCCGGAAC CCTTCCGTAT AGCCAAACCA GGAGCGTTCC 
032691 TGCATCCAGC GAGGATCGCC CTTAATTTTA CTTTCTGGTC CGGTAAGCGA AATCAGGGTA TGACCATTTT 
032761 CATCAAGAAT GGTAACCCCC ATCGGCAACG TACCCGGTAA GAAAAAGTTC TCCATCCGGA TGGTCTGCTC 
032831 GACACCCAAA AGCGCCTGCA ACCGGTTCGC CAGATAAACT GGCGTCAACG CGTAAAAATA CCCGACGCCA 
032901 GGGCGCGGAC CTTCGCTGAT CCAGTAGAGG TTACTGCCGC TATCATCTTG TGGTGCATTT CGATATTTAT 
032971 TGATGCGTTC ATGCAAAGCT TTCAACGCGG TATCGCGTTC CACTGGCATA TCACGCAGAC CGAAATTGGC 
033041 CATGCAGAGG TTATCGCTGC CGATTAAAAA TACCCGGTTT AGATCGTAAG CCGCAGAAAA ATTATCGCGC 
033111 CAGTAGCGCA TAAACCACGC CAATGACTCC AGAGAACCTC GCCAGGTGTT ACTCATTGCG GAACAATCGG 
033181 AGTCGGCAAA CAGCGGTTCA AACGCAGGCA CATCCGCCTG CGTTTCTCGT CCACGCGGGG AAAGCACACC 
033251 GTTTTCTGCC GATAAGCGAT TTTCGGCGAT GTACTTCAGC TCTTTCATCA CATCAGAGGT GCGTTGAATA 
033321 AAGCGCTGAG CCTGATCGGA ACTCAGATTA AATTCCTGAC GAATTTCCGA TTCTCGCTGA TGTAACGCAT 
033391 TAACGATGTA AAAAACGGAT GAAAAAGCAA TCAACAGCCA GAGCACTAAC GCCAATGCTC TGAACATGTA 
033461 GCGCGAGGCT TTCAGGGTTG TACGAAAAGA AGCAAGGTAT TTCAAAGGGG CGAAGCTCCG CCTCAGGTGA 
033531 CCGATGGAGT GTGGTTAAGG TAGCGGTAAA AGCGTGTTAC CGCAATGTTC TCTCTTCTCT GGAATATGAT 
033601 ACACCGCCGA GAAATCATCA CCTTAACCTC TGATAATCGT CATATACCGG ACAAGACTAG TGGATTTCAG 
033671 CATGCATTAT ATGAAGTGGA TTTATCCACG CCGCTTACGC AATCAAATGA TCCTGATGGC AATCCTGATG 
033741 GTCATTGTCC CAACGCTTAC TATTGGTTAT ATCGTAGAAA CGGAAGGACG TTCAGCAGTC TTATCTGAAA 
033811 AAGAGAAAAA ACTTTCTGCC GTGGTCAACC TGCTTAATCA GGCACTAGGC GATCGCTATG ATCTCTACAT 
033881 CGACTTACCA CGTGAGGAGC GTATCCGCGC ATTAAATGCA GAACTTGCCC CCATTACCGA AAATATCACT 
033951 CACGCCTTCC CTGGCATCGG TGCTGGTTAT TACAACAAAA TGCTGGATGC GATAATCACC TACGCGCCTT 
034021 CAGCGCTATA TCAGAATAAT GTCGGCGTTA CCATTGCCGC AGATCACCCT GGTCGCGAAG TGATGCGTAC 
034091 AAATACCCCT TTAGTTTATT CAGGCAGGCA GGTGCGCGGC GATATTTTGA ATTCAATGCT CCCCATTGAG 
034161 CGTAATGGTG AAATCCTCGG CTATATCTGG GCCAATGAAT TAACCGAAGA TATTCGCCGC CAGGCCTGGA 
034231 AAATGGATGT GAGGATTATC ATTGTGCTCA CCGCTGGTTT GCTGATAAGC CTGCTGTTGA TTGTCCTTTT 
034301 CTCCCGTCGC CTGAGCGCCA ATATTGATAT CATCACCGAT GGCCTCTCGA CTCTGGCACA AAATATTCCC 
034371 ACTCGATTAC CACAATTGCC CGGTGAAATG GGGCAAATCA GTCAGAGTGT TAATAACCTC GCCCAGGCAC 
034441 TGCGTGAAAC GCGGACACTT AACGATCTGA TTATTGAAAA CGCTGCCGAT GGCGTCATTG CCATTGACCG 
034511 CCAGGGTGAT GTAACCACCA TGAACCCAGC AGCAGAAGTT ATCACTGGCT ATCAACGCCA TGAACTGGTA 
034581 GGGCAGCCTT ACTCCATGTT GTTCGACAAT ACTCAGTTCT ACAGTCCAGT ACTGGATACG CTGGAACATG 
034651 GCACCGAACA TGTGGCGCTG GAGATCAGTT TTCCAGGTCG TGACCGCACC ATTGAACTCA GTGTCACTAC 
034721 CAGTCGTATT CATAACACGC ACGGTGAAAT GATAGGTGCT TTGGTGATTT TCTCTGATTT AACTGCCCGC 
034791 AAAGAAACCC AGCGCCGCAT GGCGCAAGCA GAACGCCTCG CCACACTGGG TGAGCTGATG GCTGGCGTCG 
034861 CGCATGAAGT ACGTAATCCG TTAACGGCTA TTCGTGGTTA TGTACAGATC TTGCGCCAAC AAACCAGTGA 
034931 CCCAATACAT CAGGAATATC TGTCCGTAGT ACTCAAAGAA ATCGATTCAA TTAACAAAGT TATTCAGCAA 
035001 TTGCTCGAAT TTTCACGTCC ACGCCACAGT CAATGGCAAC AAGTCAGCCT CAATGCATTG GTTGAAGAAA 
035071 CTCTGGTACT GGTACAAACC GCCGGCGTAC AAGCGCGGGT CGACTTCATA AGCGAACTGG ATAATGAATT 
035141 AAGCCCGATT AACGCCGATC GTGAACTGCT CAAACAGGTA CTACTGAATA TCCTGATCAA TGCCGTCCAG 
035211 GCTATCAGCG CACGAGGGAA AATTCGCATT CAAACCTGGC AATACAGCGA CTCACAACAG GCCATTTCGA 
035281 TAGAGGACAA CGGCTGTGGC ATTGATCTCT CGCTGCAAAA AAAGATCTTC GATCCCTTTT TCACCACCAA 
035351 AGCCTCAGGA ACCGGGCTTG GTCTGGCGTT AAGTCAACGC ATCATTAATG CCCATCAGGG TGATATTCGC 
035421 GTCGCCAGTT TGCCGGGCTA CGGCGCAACC TTCACGCTTA TTTTACCGAT CAACCCGCAG GGAAATCAGA 
035491 CTGTATGACT GCTATTAATC GCATCCTTAT TGTGGATGAT GAAGATAATG TTCGCCGTAT GCTGAGCACC 
035561 GCTTTTGCAC TACAAGGATT CGAAACACAT TGTGCGAACA ACGGACGCAC AGCATTACAC CTGTTTGCCG 
035631 ATATTCACCC TGATGTGGTG TTGATGGATA TCCGCATGCC AGAGATGGAC GGCATCAAGG CACTAAAGGA 
035701 GATGCGCAGC CATGAGACCC GGACACCCGT TATTCTGATG ACGGCCTATG CGGAAGTGGA AACCGCCGTC 
035771 GAAGCGCTAC GCTGCGGAGC CTTCGACTAT GTTATTAAAC CGTTTGATCT CGATGAGTTG AATTTAATCG 
035841 TTCAGCGCGC TTTACAACTC CAGTCAATGA AAAAAGAGAT CCGTCATCTG CACCAGGCAC TGAGCACCAG 
035911 CTGGCAATGG GGGCACATTC TCACCAACAG CCCGGCGATG ATGGACATCT GCAAAGACAC CGCCAAAATT 
035981 GCCCTTTCTC AGGCCAGCGT CTTGATTAGC GGTGAAAGCG GCACCGGGAA AGAGTTGATT GCCAGAGCGA 
036051 TTCACTACAA TTCGCGGCGG GCAAAGGGGC CGTTCATTAA AGTCAACTGC GCGGCGCTGC CGGAATCGTT 
036121 GCTCGAAAGT GAACTGTTTG GTCATGAAAA AGGTGCATTT ACTGGTGCAC AAACCTTGCG TCAGGGATTA 
036191 TTTGAACGAG CCAACGAAGG TACTCTGCTC CTCGACGAAA TTGGCGAAAT GCCGCTGGTA CTACAAGCCA 
036261 AATTACTACG CATTCTACAG GAACGGGAAT TTGAACGGAT TGGCGGCCAT CAGACCATAA AAGTTGATAT 
036331 CCGCATCATT GCTGCCACCA ACCGCGACTT GCAGGCAATG GTAAAAGAAG GCACCTTCCG TGAAGATCTC 
036401 TTTTATCGCC TTAACGTTAT TCATTTAATA CTGCCGCCTC TGCGCGATCG CCGGGAAGAT ATTTCCCTGT 
036471 TAGCTAATCA CTTTTTGCAA AAATTCAGTA GTGAGAATCA GCGCGATATT ATCGACATCG ATCCGATGGC 
036541 AATGTCACTG CTTACCGCCT GGTCATGGCC GGGAAATATT CGAGAGCTTT CCAACGTTAT TGAACGCGCC 
036611 GTCGTGATGA ATTCAGGCCC GATCATTTTT TCTGAGGATC TTCCGCCACA GATTCGTCAG CCAGTCTGTA 
036681 ATGCTGGCGA GGTAAAAACA GCCCCTGTCG GTGAGCGTAA TTTAAAAGAG GAAATTAAAC GCGTCGAAAA 
036751 ACGCATCATT ATGGAAGTGC TGGAACAACA AGAAGGAAAC CGAACCCGCA CTGCTTTAAT GCTGGGCATC 
036821 AGTCGCCGTG CATTGATGTA TAAACTCCAG GAATACGGTA TCGATCCGGC GGATGTATAA CACCAAAACT 
036891 TGCTATGCAG AAATTTGCAC AGTGCGCAAT TTTCTGCATA GCCGCTCATT CTCCTTATAA ATCCCCATCC 
036961 AATTTATCCC TTCATATTCA ATTAGTTAAA TAACTAAATC CAATAATCTC ATTCTGGCAC TCCCCTTGCT 
037031 ATTGCCTGAC TGTACCCACA ACGGTGTATG CAAGAGGGAT AAAAAATGAA AACAAAATTG ATGACATTAC 
037101 AAGACGCCAC CGGCTTCTTT CGTGACGGCA TGACCATCAT GGTGGGCGGA TTTATGGGGA TTGGCACTCC 
037171 ATCCCGCCTG GTTGAAGCAT TACTGGAATC TGGTGTTCGC GACCTGACAT TGATAGCCAA TGATACCGCG 
037241 TTTGTTGATA CCGGCATCGG TCCGCTCATC GTCAATGGTC GAGTCCGCAA AGTGATTGCT TCACATATCG 
037311 GCACCAACCC GGAAACAGGT CGGCGCATGA TATCTGGTGA GATGGACGTC GTTCTGGTGC CGCAAGGTAC 
037381 GCTAATCGAG CAAATTCGCT GTGGTGGAGC TGGACTTGGT GGTTTTCTCA CCCCAACGGG TGTCGGCACC 
037451 GTCGTAGAGG AAGGCAAACA GACACTGACA CTCGACGGTA AAACCTGGCT GCTCGAACGC CCACTGCGCG 
037521 CCGACCTGGC GCTAATTCGC GCTCATCGTT GCGACACACT TGGCAACCTG ACCTATCAAC TTAGCGCCCG 
037591 CAACTTTAAC CCCCTGATAG CCCTTGCGGC TGATATCACG CTGGTAGAGC CAGATGAACT GGTCGAAACC 
037661 GGCGAGCTGC AACCTGACCA TATTGTCACC CCTGGTGCCG TTATCGACCA CATCATCGTT TCACAGGAGA 
037731 GCAAATAATG GATGCGAAAC AACGTATTGC GCGCCGTGTG GCGCAAGAGC TTCGTGATGG TGACATCGTT 
037801 AACTTAGGGA TCGGTTTACC CACAATGGTC GCCAATTATT TACCGGAGGG TATTCATATC ACTCTGCAAT 
037871 CGGAAAACGG CTTCCTCGGT TTAGGCCCGG TCACGACAGC GCATCCAGAT CTGGTGAACG CTGGCGGGCA 
037941 ACCGTGCGGT GTTTTACCCG GTGCAGCCAT GTTTGATAGC GCCATGTCAT TTGCGCTAAT CCGTGGCGGT 
038011 CATATTGATG CCTGCGTGCT CGGCGGTTTG CAAGTAGACG AAGAAGCAAA CCTCGCGAAC TGGGTAGTGC 
038081 CTGGGAAAAT GGTGCCCGGT ATGGGTGGCG CGATGGATCT GGTGACCGGG TCGCGCAAAG TGATCATCGC 
038151 CATGGAACAT TGCGCCAAAG ATGGTTCAGC AAAAATTTTG CGCCGCTGCA CCATGCCACT CACTGCGCAA 
038221 CATGCGGTGC ATATGCTGGT TACTGAACTG GCTGTCTTTC GTTTTATTGA CGGCAAAATG TGGCTCACCG 
038291 AAATTGCCGA CGGGTGTGAT TTAGCCACCG TGCGTGCCAA AACAGAAGCT CGGTTTGAAG TCGCCGCCGA 
038361 TCTGAATACG CAACGGGGTG ATTTATGATT GGTCGCATAT CGCGTTTTAT GACGCGTTTT GTCAGCCGGT 
038431 GGCTTCCCGA TCCACTGATC TTTGCCATGT TGCTGACATT GCTAACATTC GTGATCGCGC TTTGGTTAAC 
038501 ACCACAAACG CCGATCAGCA TGGTGAAAAT GTGGGGTGAC GGTTTCTGGA ACTTGCTGGC GTTTGGTATG 
038571 CAGATGGCGC TTATCATCGT TACCGGTCAT GCCCTTGCCA GCTCTGCTCC GGTGAAAAGT TTGCTGCGTA 
038641 CTGCCGCCTC CGCCGCAAAG ACGCCCGTAC AGGGCGTCAT GCTGGTCACT TTCTTCGGTT CAGTCGCTTG 
038711 TGTCATCAAC TGGGGATTTG GTTTGGTTGT CGGCGCAATG TTTGCCCGTG AAGTCGCCCG GCGAGTCCCC 
038781 GGTTCTGATT ATCCGTTGCT CATTGCCTGC GCCTACATTG GTTTTCTCAC CTGGGGTGGC GGCTTCTCTG 
038851 GATCAATGCC TCTGTTGGCT GCAACACCGG GCAACCCGGT TGAGCATATC GCCGGGCTGA TCCCGGTGGG 
038921 CGATACTCTG TTCAGTGGTT TTAACATTTT CATCACTGTG GCGTTGATTG TGGTGATGCC ATTTATCACC 
038991 CGCATGATGA TGCCAAAACC GTCTGACGTG GTGAGTATCG ATCCAAAACT ACTCATGGAA GAGGCTGATT 
039061 TTCAAAAGCA GCTACCGAAA GATGCCCCAC CATCCGAGCG ACTGGAAGAA AGCCGCATTC TGACGTTGAT 
039131 CATCGGCGCA CTCGGTATCG CTTACCTTGC GATGTACTTC AGCGAACATG GCTTCAACAT CACCATCAAT 
039201 ACCGTCAACC TGATGTTTAT GATTGCGGGT CTGCTGCTAC ATAAAACGCC AATGGCTTAT ATGCGTGCTA 
039271 TCAGCGCGGC AGCACGCAGT ACTGCCGGTA TTCTGGTGCA ATTCCCCTTC TACGCTGGGA TCCAACTGAT 
039341 GATGGAGCAT TCCGGTCTGG GCGGACTCAT TACCGAATTC TTCATCAATG TTGCGAACAA AGACACCTTC 
039411 CCGGTAATGA CCTTTTTTAG TTCTGCACTG ATTAACTTCG CCGTTCCGTC TGGCGGCGGT CACTGGGTTA 
039481 TTCAGGGACC TTTCGTGATA CCCGCAGCCC AGGCGCTGGG CGCTGATCTC GGTAAATCGG TAATGGCGAT 
039551 CGCCTACGGC GAGCAATGGA TGAACATGGC ACAACCATTC TGGGCGCTGC CAGCACTGGC AATCGCCGGA 
039621 CTCGGTGTCC GCGACATCAT GGGCTACTGC ATCACTGCCC TGCTCTTCTC CGGTGTCATT TTCGTCATTG 
039691 GTTTAACGCT GTTCTGACGG CACCCCTACA AACAGAAGGA ATATAAAATG AAAAATTGTG TCATCGTCAG 
039761 TGCGGTACGT ACTGCTATCG GTAGTTTTAA CGGTTCACTC GCTTCCACCA GCGCCATCGA CCTGGGGGCG 
039831 ACAGTAATTA AAGCCGCCAT TGAACGTGCA AAAATCGATT CACAACACGT TGATGAAGTG ATTATGGGTA 
039901 ACGTGTTACA AGCCGGGCTG GGGCAAAATC CGGCGCGTCA GGCACTGTTA AAAAGCGGGC TGGCAGAAAC 
039971 GGTGTGCGGA TTCACGGTCA ATAAAGTATG TGGTTCGGGT CTTAAAAGTG TGGCGCTTGC CGCCCAGGCC 
040041 ATTCAGGCAG GTCAGGCGCA GAGCATTGTG GCGGGGGGTA TGGAAAATAT GAGTTTAGCC CCCTACTTAC 
040111 TCGATGCAAA AGCACGCTCT GGTTATCGTC TTGGAGACGG ACAGGTTTAT GACGTAATCC TGCGCGATGG 
040181 CCTGATGTGC GCCACCCATG GTTATCATAT GGGGATTACC GCCGAAAACG TGGCTAAAGA GTACGGAATT 
040251 ACCCGTGAAA TGCAGGATGA ACTGGCGCTA CATTCACAGC GTAAAGCGGC AGCCGCAATT GAGTCCGGTG 
040321 CTTTTACAGC CGAAATCGTC CCGGTAAATG TTGTCACTCG AAAGAAAACC TTCGTCTTCA GTCAAGACGA 
040391 ATTCCCGAAA GCGAATTCAA CGGCTGAAGC GTTAGGTGCA TTGCGCCCGG CCTTCGATAA AGCAGGAACA 
040461 GTCACCGCTG GGAACGCGTC TGGTATTAAC GACGGTGCTG CCGCTCTGGT GATTATGGAA GAATCTGCGG 
040531 CGCTGGCAGC AGGCCTTACC CCCCTGGCTC GCATTAAAAG TTATGCCAGC GGTGGCGTGC CCCCCGCATT 
040601 GATGGGTATG GGGCCAGTAC CTGCCACGCA AAAAGCGTTA CAACTGGCGG GGCTGCAACT GGCGGATATT 
040671 GATCTCATTG AGGCTAATGA AGCATTTGCT GCACAGTTCC TTGCCGTTGG GAAAAACCTG GGCTTTGATT 
040741 CTGAGAAAGT GAATGTCAAC GGCGGGGCCA TCGCGCTCGG GCATCCTATC GGTGCCAGTG GTGCTCGTAT 
040811 TCTGGTCACA CTATTACATG CCATGCAGGC ACGCGATAAA ACGCTGGGGC TGGCAACACT GTGCATTGGC 
040881 GGCGGTCAGG GAATTGCGAT GGTGATTGAA CGGTTGAATT AATCAATAAA AACACCCGAT AGCGAAAGTT 
040951 ATCGGGTGTT TTCTTGAACA TCGACGGCGA AGGTAACCCC ATTAATCACC AGTCAAAACT TTTCACCAGC 
041021 GTCAGCTCGC CAGCATTACG CATCGGTACA ATAAATGTTT CCTGTTTCTC ATTGACCGAT CCTTCATCGG 
041091 TGATCAGCGT CAGTTGGGCG GTGGTTAATT CCGTTTCGCT GCGCCCACCA TAGTAGTTGA TATACACCTG 
041161 ATAGCGCCCG TGAATTGGCG CGGGCATGGC GAAAATCTCG GGTCCGTACC CCGTCGTGAC ATCCATATCC 
041231 AGTGCACCAC TGTTTTTCAG CACGGTGTTA CCGTACCAGG CGTGTTCGCC ATCGGGCGTA ACAACGTGAA 
041301 GGTCGAGGTC GGTATTGTCC GTATCCCACG AGAGAACCAG CCGTAAACGT GCACGAATCG TTCCTGTACC 
041371 CGGCGTTGAG TAAAACTGCA TTTTTTGTCG GCTTTGCCCA TCCGGGCTGA TGACCTGCAC GCTGTTGCTG 
041441 CCTTCAGTGA AAATATAAGG GCGTGCAAAT GAACCATCGG ATTCAATTCT CTGCGGCATA CTGGCACCGT 
041511 TGACCACCAG CCGGCCCTGC TGAACTTTAC CCGCCGCAGC ATAATTCTTT ATTTTGCCGC GGATCTGCGC 
041581 TGAGATATTT TGATCATCTG CCATGTTGAC GGACGACGCC GGGTAATTGA TCGATTGTGA AAAACTGGCA 
041651 TCTTCGCCCT CTGCCGGATG CCAGCCTGAG AGCGGTGCAT CAATCTCGAC TTCCTGCACA CCTTCACTGT 
041721 GAGCGACAGG CGAAAGCGCC ACCAGTAACA ACGGAAGAAA AATCTTTCGC ATAGCATTAG TCCATTAATA 
041791 ATTGTCGGGT CAGCGTTTCG ATATAGTTCT CATCAAGCCC GGTGGGATAA CCATCAAAGG CCAGGTGCAG 
041861 ATACTCATGG GTTAAATCCA GCCGATCCTG AAGCGTAAAG AAGTTACGAA TAAACAGCCG TTTCTGCTGC 
041931 CGATCGGTAT AGGGGAAACC TGAGACTAAA CGGCAAACCG CAAACACGTC TGGTTCGTTG TACCCCGTCT 
042001 CAGCTTGTAA TATACGCCGC CACTGCGGCA TTTTTTTCGC CAGCCAGGCT TTCGCTTTGG GTAATAACTG 
042071 GCAGGTTGAG CGTGGCGCTC CCCAGCGGCT AAGACTGTTG TCGGGATAAG CAAACGCGAG TATCTGATCG 
042141 TAACGCTCTC CCTGCCCCGC CTGGGCCGTG GCTTGCCGCC AGGAAAGTGT CCCTTCGGTA GCGCGACTGC 
042211 CATGATAATG AACCGGATCG CCTGCATAGA TGAGATCCTG CGTCCAGGCG GTCATCGTTC GCGCCCCCGT 
042281 GGTCGCTGGC GAAGCAGAAA CACGCTGCGT GGCGCTGCTG TCGGGGATGG TCAGGCAATC GCCTTCCCGA 
042351 TTGGCGTTTT GCTGTAAAAA AGTGCGAATC GCCACGGTCA TGGCTTTCGC TGCCTCAGGG GGCGTACTTT 
042421 TCGCCTCGCG ATCCAGAACT CTGGCAACGT ACTCTTCACG ATCGAGATGC GACTGCAATT TCAGTTTGCC 
042491 CTTTTCGCTC AGTAAGGTCG TCTCACCGTG GCTGACAAAC GTAATGTGGT TACCATTAGT AAACGTCACA 
042561 CGATAGCGCC CATTAAGTAC GCCGGGATTT ACTGCCGTCG TACTCTTTTC CGCTGTGATT TTCTTCAGCG 
042631 GATAGCGGGC AAACAGCTCC ACCTCTACAC ATTGCCCACT GGCAACCTGC GTCGGCACTG GCAAAACCCG 
042701 ATTAAGCACC GTCGCATAAC GGGTTAGTAC CGTTTTGCTG GTGCCACTGC CAGTAACCCA CAGCGGTGTA 
042771 CCATCGGTTA ACCAGCCAGC AAAACCACCC TGACGGATTT CCTGTTTATC ATCGGCAAAC CAGCTCCAGG 
042841 TTTTCACCCG TACCCGACTA CCGAGCATGG ATGCGACACC GATTTTCGCC TCGTCCAGCA CCACATCCAG 
042911 TAAGACTTCC TGAGCTTTGT TTTGCGCGGG TAACGTCGCT AATGAATCAA GCAGCGATTT AACCGTTACC 
042981 GAGGTTTCTG GCTTCAGCGT AGTCAGAGAC GCTAACCACG CAGGTGCCTG ACGCTGTTGC CAGTATTGCC 
043051 CCCACACATC TGCGCCAATA TGCAACCGCT GCGGCGCAAA ATAGAGCCCA CAGGAACGTA CCAGCGCGGT 
043121 ATCGCGCGTT ATGCTCTCCC CAGCCTGACA ACAATAAACC TCTTCCGGGG AGTTTCCGCG ACACTGGTAG 
043191 GGCTGCTCCG GTTGATGGGT ATCCTCCAGC CAGGCGTAAA CATACAGTTT CCACAAACTC CCTAACGGCG 
043261 TGGTGAGCGA GTCAGGTAAT GCTGAGACTT TGGTCACGCC TGATGACGAC AGCTGATACA GTTGATCGTG 
043331 CTGCGCACCG CGCAGCACCA GTTGTAACGG CGTCTCCTCC GCAAGTGTTG GCAGAGTAAC CAACGCCAAT 
043401 AGCCAGACGA TTCTGCGCCA GTTCACTTAT TTCACCTGCA TCCCGGTCCA TTCACTCCCT GCCGCAACAC 
043471 TTTGCTGCGC AGGTGCATAG GAACGCACAT AACGAGCAGG AGGCAGAACG AATTGCCCTT TTTGCGAGAA 
043541 GCGCAGCAAA TGGCGGAAAG TGACCGTTCC CGTCAGTTCT TTCACCGGCA CCATATAGGC CAGTTCGCCC 
043611 ATTTCATTTC GCGCTTTTTC CAGCAATTGC CCCTGCTGTT TCGCGGCGTT GGGTTTATTG ACCGAAATGC 
043681 CCCATGTTGT GCGCTCAACG TCGGCTCCCG GTGGCAGCGG TACTTCCACC TGACCGTAGC GCAGAACTGC 
043751 ATCCTGCTCG CTGGTAAGCG TGATTTCATC GAGATACAGC GCATCGCTGT CAATCTCATT GCTGGTCACC 
043821 GGTTGCAGAA TAAAGCTCAT CTCTTCTTCA CCAGGGATAA GCCGATACAA CTGGCGTTCA ACGGTCACCG 
043891 GAATGTTACT TTGTTGAGCC ATTTTTGCCG GCTCACGTCA GCGGACCTGC ACATTTTGCG GCGATAATTC 
043961 GTCACCAAAA GAGAGAATGT CCGGCACGCC CTGACCAACC CAACGCCAGT CTTCGCCCCC TCCAGTTAAC 
044031 TTATGTTTAG CCCATGCGCC CGCAGGCGCA GGCAAAACAA CTGGAGGCAT TGTCGCCATA TATTTCGCCA 
044101 GCCAGTTCAT GGCCAGCGCG CGCTCAATAG TGGATTGCTC AGCGGTCAAA CCACTTAAAA TAGCGGCCGT 
044171 CTGGGTAGCG TCGCCACCGC TATTAAGCAG CACAACCGTG TGCGCCAGCG GCTGATTGCT GTTTGCCGCT 
044241 TTATCCCACG CATATTGCTG AACCTGTGGC ATCACCGTGG ACTTCAACTG CGCTTTTTTC AGCAACGTCA 
044311 TGGTTAAGAC GTTTGCCACC GCATCTGCCA GTGGAGACTC CGGTGTATCG AGGATCAGGC TATCATTGAT 
044381 ATCGCGGGTG TCTTCCTCAG AGAAATCTTC AGTTTTAGTT CCGCGCCGGG CGATAGCTTC ATCCAACCCT 
044451 TTCAACAACG TTTTGCACGG CAAATTCATC TCCTGCGCCC ATGCCAGCAC CAGCGCCCGA TGCAATAACG 
044521 GCATGTTATC TGCCTGCTCC GCGTAGCTGT CGAGCATATG CTGCCAGTAT TCCGGTTGTT GCGTTACGCC 
044591 GATCGCCTGG CTGGCCTGCC AGTCGGCGTA CCATGCCCAT GCCGTAAGGA AGGCGTCACC ATTGCCATCT 
044661 TCACCCCACC AGGTAAAGCG CGCTCCGGGC CCCGCCAGTT GCATCAGCCG CAGACGGTTA TCCTGAATCA 
044731 TCTGACGAAT GTCGTTAGCG GCGGCACTTT GATGATCGGC AAGCGAACGC CAGGCGAGAC TGAGCGGGAT 
044801 CAGACGGCTA CCGGTGTTGA TTACGCCACC CCACGGTTCA TCGACTAACG CATCAAGATT GTTGCGGAAA 
044871 ATCTCCTGCG GCGTTTCACT ACTTTGTAGC CGGATATTGC TCGCCTGCTC GGGCAACATC AGCGCGTTAT 
044941 CGCCACCACC GAGCATGACA TTTTTCTGCT GTTCAACGGG CCAGCTGTTA TCCACAAAAG ACAGTTTTGT 
045011 GCTAATGCTG TCCTGCACTT GCCCATTTTG TTGCAGTTCT GCACTTAACA AGCCAGATTG CTGAATATTC 
045081 TGCGTCAGCG AAATATAATT CGCCCCTTTG TGCAGCGTCA GCGTCTGGCG CATCTCAGCG CCTGCAAATT 
045151 TAGTCACCAG CGCCACCGGT TCGTTATCCT GCTGACTGAA GATAAACAGT CCTGCCGCCG GTTTGTCGCC 
045221 CACGCGATAC ACCGTTGGCA TACTCCACTT CATGTAGAGA TTTTTTTCCG AACGCAGATA AGCACGCCCC 
045291 TGCCCGACCA GCCCGTCGCC GTTCATCCCA CGCGCGGTGA TACGCCAGCG GGTTAACGAA TCAGGCATCA 
045361 GGAACGTGAA ATACGCTTTG CCTTGTTTAT CGGTTGTGAG TGACGGCATC CATGCCGCGG TATCCACCTC 
045431 TTCACGCCGT GGACGTTCAA GCATTTTTAC TCGCCGCTCG CTGCGGTTAG TTGCGCCAGG CGCAACCGGC 
045501 TCGCTGGAGA GCGCCTGGTC GTAGCTGATA AACGACAGAC TGGAGCTGGT ACGCACATTG TTACGCCCCA 
045571 GCGGATAGAA AAATTTGCCG ATATTCGGCG CGATTTCTGG TTGCAGCGCG TAGATCATTT CATCGACCAC 
045641 GCCTACCGTT AGCTGCGCAG AAACAGGTTT ACCTTTCAGC GACGAGGTTA ATTCGACATT GACCAGTTCA 
045711 CCAGGCTGGT AATGGGTTTT GTCCGTTTTC ACCCGGATAT CCAGCTGGGG AACGGCAACT TTGATCCCGG 
045781 CGTTCTGAAA ACTGTACTGA CCGTTACGGG TATACAGCAC CGAAAAAGTG ATGTTAGGCG CAAAGGAATT 
045851 GCTCACTGGA ACCCGGGCTT CATACTGGGT ATCGTTTAAA CGTTGTAGCG TTAGCCAGTT TGCCGGATGC 
045921 GAAAGCAGCG ACTGCTGTTC CACGCGATCG CGTTCCAGCG TCAATAATGC TTCATCAATT GGCTCCGGAA 
045991 AGGTAATCAG CATCTTCGCG GTTTCGCCTG GCTGGTACAG CGTTTTATCC GCCACGATAT CTACCGTACC 
046061 AGTATGCGCC GTGCTGCCCT TACCGCTGAC GGCATGACTT AACCCAGCGA GAATTAAGCC GTCTTTATCG 
046131 CGTAATGTCA GATTGTAGTT GCCAGGTTTA GCGAAATTGA CGGTAAAGGA TTTGCCGCCT GACGGTAGCT 
046201 CTCCGCTATG GCTCGTGCGG TCTTCGAGAC GCAACCATTC ATACGTAACA GGAACCTGTT TTGAAGATTC 
046271 CAGCGCGGCA TAACGGAACA CAACCGACTC GCCGCTATTA CTGTATTGTG CGGCAGTACT TAATGAGTAA 
046341 TGCGCCAGAC CGCGTTCAAT GAGGATCTCT TTGGTGGTGG TGACGCGATA CGCCGCGCCG TCACTGGCGG 
046411 AGACGGTTAA CAAATAGCGG CTCGGTTTAT CGGCGGCGGG GAGATTTAAC GCCACATGAC CGCTGGCGTC 
046481 GGACACCGTT TCGCTGCCTT CCAGCGACAC GGGGAAACGT CCGGCATAAC GCAAATCGTT ACCGACCATT 
046551 GATAATTGCT GAGCGCGCAA ACTTAACTGC ACGCGGGCAT TTTTTACCGG CTCGCCATCC GGGTAGAGCA 
046621 GTTGCAGTTT GCCGCTGACC GCTTCGCCAG TTTTGAACTC TTTTTTGGCG AGAGCTAAAC CAATCTCGAA 
046691 ATGTGGCTTG ATGTAGTTTG CCACGCGAAA ACTGCTGCTA TAGACCTGAT TGCGGTAAGC AAGACGTAAC 
046761 TCATAACCTC CGGCTACGGC ATTTTCTGGC AGGCGGAAAC TTCCCTGCCC GCCATTGCGC GCATCCAGCG 
046831 TGACATTGAC GGTTTGCAAC AGACTGCCGT TGGCGTCCAG CACCGAAAGC TTCGCCGGGG CGCTGACGAT 
046901 GGGGGATGAA TGCAACGGAT CGTGGAACTC GCGGCCGATC ACTTTAACAT CGACACGATC GCCTGCGCGA 
046971 TATAGCGGGC GATCGGTAAA AATATACAAG CGGGTGTTGT AGATTTCGCT TTCGTAGAAG AAGTTCTCGG 
047041 AGACAAAAAC GCCGCCTTCA GCATCCTTAC CCAGAATGTA TGAACGTTCT GGCGATATAT GTTGTAACTG 
047111 CAAGGTACCG CTGTCATCGG TCACACCGCG GGTCATCACG CCAAGACCGT CAGTCCACAA GATCTCTGAG 
047181 CCGGGCTTCG CTTCACCCTG TTTTTTACCC GCGGTCCACA CCAGAAGCTC TTTGCCTGAC ACTTTGCTAA 
047251 GCGCCACGGT ATCGGAAACA AACACCACCG TCGTCGCCCG ATACCCACCA ACCATCGCCT CGACGAGGTA 
047321 CAGTCCCGGC TCTTGTTGGC CGAGAGGAAT ATAAATGTTA CCCGGCTGCG GCGAGATGAA ATTGCTGGAT 
047391 GCGCCTTCCA GTTTTACCCC TTGCTGCGGC TCGAACGGTT TAGCCTGCCA TAGTGGATAA CGGAACTGTT 
047461 TCACCAGGGG ATATTTTTTC AGCGGGGAAA ACTGGTTGTT CTGTACATAA CGGGAAGGTT TAATAATGGC 
047531 ATTGCCGAGC TGTAATTCGG GTAACGCCTG AGTCACATTC TGCCGTGACT GAGAAGAGAA AGTACGCTGC 
047601 ATCACGCGGC GAGATTTGCC GTACCAGTTA TCCCACAGCC AGGTTAGCGT ATTGTTCAGC CCGTCGCCCA 
047671 GATATTGCGG TTGCACCACA ATGCGATGCA GGTTTTTCTG CTGGCGCAAA AATGCCATCG GGTCAGGAAT 
047741 ACGATACAGG CGAACGTCCA CGCCGCCGTA CTCTTCCATC TGATAGCGCC GATAATCACG CCCCGGCGCT 
047811 TCCAGTCGCA CTTTCGCCTC TTCACTGCTG CTAAAACTGC TGTCAGCAAG CAAAAAGAAT GTTCCCCCGG 
047881 CAGGCGGCGC ATAGTTGCTG GAAGGAAGCG AATCATCAGC ATTAGCAAGC CCTGTTCCCA CAAGAGACAG 
047951 GGACAAGCAC GCTGCTATCG CGCCAGAAAA TTTAAACGAT AAATGCCAAT GAAATTGGGA TTGGAATCGT 
048021 TGGGTATCCA TCGGGTGTCC TTCCATGTCA TAAGTTGTTG CAGACTGACT GCGCGCATTC CGTTGTCAGT 
048091 TTTCGTGGCG CTTCCGGTGT GGTAGATGAC GTAACGCCCC ATCCAGACCA TTAAGTGCTG GGCATCGCCC 
048161 TGATCGAAAA AAATCATATC GCCAGGCAGC GCCTGGTTTA TGTCCTGGCC AATAAACTGG CTGTTGTACT 
048231 GAATCAAATT AATCGCGGTC ACATAGGGGC CGGTTTTCCC GTTCCCCTGA TTCCAGTTTT GCGCCAGTTG 
048301 ACGCTGTTCA GGTGTTAGCG TCATCTCTGG CGGCAAATAC TGGCTAGATA AACCGTTACT TTTTAGCCAT 
048371 TTACTGTCGT GAACTTTCAG CGTCTCGTTC GCCGCAAATC GCACCAGGCC CGCACAATCC TGCTGATACC 
048441 AGCGTGGACT TGGCCCCTGG CGGAGCTGTT CTTGTGCAAT GCGTACAAAC CAGGCGCGAA ACAGCCCGGA 
048511 TTGTTCGACA TTCAGCATTT CGCTATGGGC AACAACACAA CACAGCCAGC AAATCAGCGC CAGCAGCCCG 
048581 TGCCTCATAG CGGCTGCCAG GTTATGGGTA GCCACTGCCA GGCGGCACCG GGTTCCATCT GGGCCAGCTT 
048651 CATGACATAA CGCGGTTGTT GAGATAAAGC GTCCAGCTTC GGCATTAATA AAGTTTGTGC GGCGTTATAA 
048721 AAAACCGGTT CGAGATTCTT CGGCAGACTG GTCAACGTTT CGTTACGCAG CAGTTTCGCT ATTCCTTGTG 
048791 GATTGATATA GAGCGGAACG ATGCCATCAG TGGGTATTAC ATCCACCATT GCCGGGCGGG TTTTATTCAG 
048861 TGTTTGCAGC GCGTTATTAA CCAGCGTGTC ATCGAGGGAG AAAAGCAGCG TTTTGTTTTG CATCGCCAGC 
048931 GACACACGGA AAAAATAATC CGACATTAAT TGATCGGGTT GCGCCGCCTG CGCTTTCGGA TACTGGCCGT 
049001 ATCGGGAACT CACTTCGCGA CGCCAGATTT GCGCTTCGCC CTGCTGAGTC TGGCTTACCG GCAAAACACC 
049071 TTCTGGCGCT TTGCTTTCGT GCGCACCAAT ATTTTGCGTA AACAGTTTCC CTGGCAATTG CGCCTGTTCG 
049141 GCAGTGCCAT CAAACTGACC GACAAACAGC GGGGTTTGCA ATTTTGAGTC TTCATACCAG CACAGCCCCG 
049211 CGGCACCGTC TAACGCCCCA TTCAGCTTGT CGTTTTCCTG GCTGATGTGC GAAAGCATCT CTTCGGCAAT 
049281 ACCGTGTGAA TACGGCACCG CCACACAGAA GCTGGCTCCG GCAGGCATAC TGTTCCATAC CGGCGTAAAA 
049351 TCGAAACTGG CATCTACGCT GGCGGATTCA TCATTTAACG CCACAAAACT GTGCCAGCCG TCGTTACCCA 
049421 TTTCGAAGCG TACGCCAGCA AAAGAAGGCA TTAACCGCTG GTAGCCAAAC CCCAGCCACC TGGCGCTGAC 
049491 TACGATGCGC TGGCGTACTG GCGTTTTTTC GGCAGTACGC TCTTCCAGGC CAAAGCTTGC TTGCCAGCGT 
049561 TTTTTGCCGC TCAACAAATC ACCTGCGATC GCCGTGGCTT CGGTATCCTG CTGATCATCT TTAAACAACA 
049631 TATCCGTGCT GGAAAACACC AGCATCTTGT CCTGATAAGT CGCGAACATC AGGGCGTTAT TGCCGTTATA 
049701 GCGCAACTGA TAAACAGGAA CAGTTTCACT ATTTATCTTG ATGCTACTGA TTTCCGTTTT GCTTAACTGG 
049771 CTGTCGCTGG TAGCGGCAAA CAACAATGGC TCCAGCAGTT TGCTTAAACC ACTGCGCTGG ATCAGCACCA 
049841 TATAATGTGA AAGATGGCCT TGTTTATCGT GCCACAGCGC TGCCTGCGCG GGCTGATCTA AGAGTGACGA 
049911 AAAGAGCTTA TCTTTCAGCG TGAGATCGTG TTCATAGACA ATACGACGAA TGCTGCCTTC AATGCCCAGA 
049981 CGATCGGCAT GATTCTGATA ATAGAAAACG AAATCTTCGC TCAGAACATC GTGGAGAAAC GGAATGGTGA 
050051 GGAGATCTTT GGGAAGCTGG CTCAGAGAGT CGCTGTCGAG AAAGAGGTCC GGCTCATTGA GATCGATTTG 
050121 CAGATTGTTG TGCACCACCA GCGGCGACAA CGTTTTTTCT GGCCCACTGC CAGCATATTG CAACGCCCAG 
050191 ACGCCAGCGG AAAGCAGTGC TATTGCGCCA AAACCTACAA GACCATAGAA CCGCCAGCCT TTCGCCTTTT 
050261 TTTCACCACT CATTGCCACA TTCCTTGTGT ATAGCCAGCC ATTTTTTACG GGCACAGCCA AACTTTACCG 
050331 TGCCCTAATA CGACAAAAGC CCAGACTTTG CAGCCTGGAC TTTTCAATTC AAACAAGGGA GATAGCTCCC 
050401 TTTTGGCATG AAGAAGTAAA ATTATTCTTC TTCTGGCTCG TCGTCAACGT CCACTTCCGG AGCGATTTCA 
050471 TCGTCCCCTT CCGCGGCACT GCCGTCGATG GTATCCAGAT CTTCCTCGTC AACCGGTTCA GCAA