MG1655
W3110
Search for
Japanese | English
Deletion Report : 16-2
General information
Deletion 16-2  
Location (BP) 2,194,448 - 2,240,964   Go Linear View
Length (BP) 46,517
Related strains
     Strains ME5095    ME5096    ME5097    ME5116    ME5117    ME5118    ME5119    ME5120    ME5121     
Primer
Deleted Region 5' Primer 2194443_C_16_2_Lar  
Sequence ATGGAGCGCAACGTCACGCTCGATTATGCGGGTTAGAGAGAGACAAAATC  
3' Primer 2240963_U_16_2_Rar  
Sequence GATTTTGTCTCTCTCTAACCCGCATAATCGAGCGTGACGTTGCGCTCCAT  

 Linear View (Whole Mode)
View Location
   2219.448  –  2270.413 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             TGAAATAATC CCCCTTCAAG GCGCTGCATC 
-00070 GACAGCGCCT TTTCTTTATA AATTCCTAAA GTTGTTTTCT TGCGATTTTG TCTCTCTCTA ACCCGCATAA 
000001 ATACTGGTAG CATCTGCATT CAACTGGATA AAATTACAGG GATGCAGAAT GAGACACTTT ATCTATCAGG 
000071 ACGAAAAATC ACATAAATTC AGGGCAGTTG AGCAACAGGG AAACGAGTTG CATATCAGTT GGGGAAAAGT 
000141 TGGCACCAAA GGGCAAAGCC AGATAAAAAG TTTTTCAGAT GCTGCGGCAG CGGCAAAAGC GGAGCTTAAG 
000211 CTGATTGCGG AGAAGGTGAA GAAGGGGTAT GTGGAGCAAG CGAAGGATAA TTCTTTGCAA CCTTCCCAAA 
000281 CGGTAACGGG CTCTCTCAAG GTAGCGGACT TATCCACCAT TATTCAGGAA CAACCCTCTT TCGTAGCAGA 
000351 AACCCGTGCG CCTGACAAAA ATACAGATGC TGTTTTACCG TGGCTGGCGA AAGATATTGC TGTCGTTTTT 
000421 CCGCCCGAAG TTGTACACAC CACGTTAAGT CATCGCCGCT TTCCCGGAGT TCCTGTTCAG CAAGCAGACA 
000491 AATTGCCCCA ATTACGTCGC TTAGCCTGTA GTGTGTCGCA ACGGGATAAT AAAACAGCCA CATTTGACTT 
000561 CAGCGCCTGT TCTTTAGAAT GGCAAAACAC CGTCGCCCAG GCGATCAGTC AGATCGACGG CCTGAAAACA 
000631 ACACAGTTAC CATCACCAGT AATGGCTGTA CTCACGGCAC TTGAAATGAA ATGCACAAGA TATAAAGTGC 
000701 GTGAGGATGT TATGGATCAG ATCGTCCAGG AAGGCGGTCT GGAATATGCT ACTGATGTAA TAATACACCT 
000771 TCAACAGATT GATATTGAAT GGGATTATGC GAATAATGTC ATTATTATTC TGCCGTCTGG CATTGCACCT 
000841 AGCTACTTGG AGCAATATTC CAGATTTGAA TGACGCCTAC GTAAACATTT ATCACTGACG GAAGAGTCTC 
000911 TCTGGCAAAA ATGTGCACAA AAACTTATTG CCGCAATTCC ACATATTCCA GAATGGCGGC AACCATTAAT 
000981 TGCTTTGTTA TTACCCGAAA AACCAGAAAT TGCACATGAA ATTGCCCAGC GTCTACTGGG GCAAAAAAAA 
001051 TTACCCTCGC TTGAGTGGTT AAAAATAGTG GCGACTGATG AGCACATTCT TGCCTCATTA GAAAAATATC 
001121 ACGAACCATA TGCCATTTTT GATGATTACT ATTGTGGTGC GATATGGTCA GCCACCGTAT TACAGGAGCA 
001191 AGGTGTTGCA GCCCTGCCCC GATTTGCTCC CTATGCCGCA AGTGACTACT GCGCCGATGT GTTGCGTCAT 
001261 ATCAATCATC CGTTCGCATT GACACTGCTT ATACGTGTAG CCGGGCAAAC TAAACGCTGT CACGATCGGA 
001331 TGACGAAAGC CATTGCTGCG TTCCCACATG CAGCAATGGC GGCACTGACG GAACTTCTTG GGCAAAAAGA 
001401 AGAGAACAGT TGGCGCATTA TGCTAATGAC AATGCTTATC TCACAACCAG CACTGGCAGA ACAGGTCATT 
001471 CCCTGGCTCT CGACACCCGC AGTTGCCGTA CTGAAATCAT GCCAGCAACA ACTGACACAG CCCTCAAACC 
001541 ATGCCAGCGC CGATCTACTG CCAGCCGTAG TAGTCTCCCC TCCCTGGCTT TCGAAAAAGA AAAAATCGCC 
001611 GATTCCGGTG CTGGATTTAG CGCCATTAGG CATTGAGCCA ATCTGTTATC TGACAGAAGA AATCAGTAAT 
001681 CAACTTTTGG CGAAATATAT CTGGTATTCA AAACACATCA CGGTTAGCCA TGAAGAAAGT ACTACCAACC 
001751 TGTTGGCAAG GATGGGTTTT CAACGACGGA TCGCTGGTAC ATATATTAAA GCTCCCGAAG CGGTAGTTGA 
001821 GGCATGGCTA AATGAAGATT ATTCAACCTT ACTAAGTGAA TTTAAGGTGT TTCATTCACC TACCGGGCAT 
001891 TATTGGCAGT TGGGGATTTT GACAACATTG CCGCTGGAGA AAGCAGTAAA AGCATGGAAT GCCCTTACCC 
001961 TATCTCCACA TACCGATACC GAATACTCCA TGTTACATTT TGGACTCAAA GGGTTACCTG GGTTAGTAAA 
002031 CTCACTTGCA CGCTATCCAC AAGAAGCCTT GCCCATCACG AATTACTTCG CAGCGAGTGA GCTGGCTCCT 
002101 GCCGTCGCCC GTGCCTTCAA CAAACTGAAA ACGCTACGCG AAAACGCCCG TAGCTGGCTG TTGAAATACC 
002171 CGGAACATGC CCTTACCGGC CTGCTGCCTG CGGCGCTCGG CAAAGCCGGT GAAGCACAGG ATAACGCCCG 
002241 CGCTGCCTTG CGTATGCTTA CCGAAAACGG TCATCAGCCA TTACTGCAAG AAATCGCCCG ACGTTATAAC 
002311 CAGCCGGAAG TAACCGATGC GGTGAACGCT CTGCTTGCGC TCGATCCCTT AGATAATCAC CCGACAAAAA 
002381 TCCCCACTCT TCCGGCCTTT TATCAGCCAT CGCTCTGGAC GCGCCCGGTA TTAAAAGCAA ATGCCCAATC 
002451 ACTGCCAGAT AGCGCCCTCC TCCACCTCGG TGAAATGCTC CGCTTCCCTC AGGAAGAGGC TCTGTATCCG 
002521 GGATTATTGC AGGTGAAAGA CGTCTGTTCC GCCGACTCAC TGGCGGGATT TGCCTGGGAT CTGTTTACCG 
002591 CCTGGCAGAC CGCTGGCGCG CCGTCGAAAG AGAGTTGGGC GTTCACTGCG TTAGGCGTTC TCGGTAACGA 
002661 TGACACCGCC CGCAAACTGA CGCCATTAAT ACGCGCCTGG CCTGGTGAAT CCCAGCATAA ACGCGCCACC 
002731 GTTGGGTTGG ATATTCTCGC TGCTATCGGT AGTGATATCG CCCTTATGCA GCTTAACGGC ATCGCCCAGA 
002801 AACTGAAATT CAAAGCATTA CAGGAGCGGG CAAAAGAAAA AATTGCCGAC ATTGCCGAGA GCCGCGAACT 
002871 CACGGTGGCG GAGCTTGAAG ATCGGGTTAG CACCGGATCT CGGTCTGGAT GATAACGGTT CGCTGCTGCT 
002941 GGATTTTGGC CCACGGCAGT TCACCGTCAG CTTTGATGAA ACCTTAAAAC CGTTTGTGCG TGATGTTTCC 
003011 GGCAGCCGCC TGAAAGACCT GCCCAAACCG AACAAAAGCG ATGATGAAAC GCGGGCGAAC GATGCGGTTA 
003081 ACCGCTACAA ATTGCTGAAA AAAGATGCGC GTACCATCGC CGCCCAGCAG GTAGCAAGGC TGGAATCCGC 
003151 CATGTGCCTG CGCCGCCGCT GGTCGCTGGA AAACTTCCAG CTCTTCCTGG TTGAGCATCC GCTGGTTCGT 
003221 CACTTAACCC GCCGTCTGAT TTGGGGCGTT TATAGCGCCG AAAACCAGCT ACTGGCTTGC TTTCGCGTAG 
003291 CAGAAGATAA CAGCTCCAGC ACCGCTGACG ATGATCTTTT CACCCTGCCG GAAGGCGATA TCTCTATCGG 
003361 CACTCCTCAC GTTCTGGAAA TATCACCAAC GGATGCTGCC GCCTTTGGTC AGCTTTTTGC CGACTACGAA 
003431 CTGCTACCAC CGTTCCGCCA GCTCGACCGT AACAGCTACG CCCTGACAGA AGCCGAGCGC AATGCCAGTG 
003501 AACTGACCCG CTGGGCAGGC AGAAAATGCC CGAGTGGTCG GGTCATGGGG CTGGCGAATA AAGGCTGGAT 
003571 AAAGGGCGAA CCACAGGATG GAGGCTGGAT CGGATGGATG ATCAAACCTT TGGGTCGCTG GTCGTTAATC 
003641 ATGGAAATCG ATGAAGGCTT TGCGGTAGGC ATGTCGCCAG CCGAACTCAG CGCTGAGCAG CTCTTAAGCA 
003711 AGCTGTGGCT ATGGGAAGGC AAAGCAGAAA GATATGGCTG GGGGAGTAAT TCAACACAGG AAGCGCAGTT 
003781 CTCCGTAATC GATGCCATCA CCGCCAGCGA GCTAATTAAC GATATTGAAG CCCTGTTTGA ATAAGGAAAG 
003851 AGCATGGACA AGGAATTACC GTGGCTGGCG GATAACGCCC AACTGGAACT GAAATATAAA AAAGGCAAAA 
003921 CGCCGCTCAG TCATCGTCGC TGGCCGGGCG AACCAGTGTC CGTTATCACT GGAAGTCTCA TCCAGACATT 
003991 GGGTGATGAA TTGCTACAAA AAGCTGAGAA GAAAAAAAAC ATTGTCTGGC GTTATGAGAA TTTTTCACTG 
004061 GAGTGGCAGT CCGCCATCAC GCAGGCCATC AACTTGATCG GCGAACACAA ACCCTCAATC CCGGCCCGGA 
004131 CAATGGCGGC GCTAGCCTGT ATCGCGCAAA ATGACAGCCA ACAGTTGCTC GACGAAATCG TCCAACAAGA 
004201 GGGGCTGGAA TATGCGACTG AGGTGGTGAT TGCACGCCAG TTTATTGCGC GGTGTTATGA GAGTGATCCT 
004271 CTGGTAGTGA CATTGCAGTA TCAGGACGAG GATTATGGCT ATGGTTATCG CTCAGAAACC TATAACGAAT 
004341 TCGATCTCCG ACTGCGTAAG CATCTCTCTC TGGCAGAGGA AAGCTGCTGG CAGCGTTGCG CCGACAAACT 
004411 CATTGCCGCA CTACCAGGAA TAAACAAAGT TCGCCGCCCT TTTATTGCGC TGATCCTCCC GGAAAAACCA 
004481 GAAATAGCCA ATGAGTTGGT AGGCCTTGAA TGCCCGCGAA CTCATTTTCA TTCTAAGGAG TGGTTAAAAG 
004551 TTGTTGCTAA TGACCCCACA GCGGTGAGAA AACTCGAACA CTACTGGAGC CAGGATATAT TTAGCGATCG 
004621 AGAAGCCAGC TACATGTCGC ATGAAAACCA CTTCGGCTAC GCGGCCTGCG CCGCCCTTTT GCGCGAACAA 
004691 GGACTGGCAG CCATTCCGCG CCTCGCGATG TATGCCCATA AAGAAGATTG CGGCAGTCTG CTGGTACAAA 
004761 TTAACCATCC GCAAGTCATC CGCACCTTGC TACTGGTGGC TGATAAAAAC AAACCCAGCC TGCAACGTGT 
004831 AGCTAAATAC CATAAAAACT TCCCCCATGC GACGCTCGCC GCACTGGCAG AACTGCTGGC GTTAACAGAA 
004901 CCACCAGCCC GCCCTGGTTA TCCAATCATC GAAGACAAAA AGCTGCCTGC ACAGCAAAAA GCACGCGATG 
004971 AATACTGGCG TACGCTGTTA CAAACGCTGA TGGCATCGCA GCCACAACTG GCAGCAGAAG TGATGCCGTG 
005041 GTTAAGTACT CAACCCCAGT CAGTGCTGAA GAGTTATTTA TCGGCACCGC CCAAACCGGT TATTGATGGC 
005111 ACCGATAACA GCAATCTGCC AGAAATCCTC GTTTCACCAC CGTGGCGTAG TAAGAAAAAA ATGACAGCTC 
005181 CACGTCTTGA TTTGGCACCG CTCGAATTAA CTCCGCAAGT TTACTGGCAA CCAGGCGAAC AAGAGAGGCT 
005251 TGCCGCCACT GAGCCTGCCC GTTATTTCAG CACGGAATCT CTTGCGCAAC GCATGGAACA AAAAAGTGGA 
005321 CGAGTTGTAT TACAGGAACT GGGTTTTGGG GATGATGTAT GGCTGTTTCT GAATTATATA CTCCCCGGAA 
005391 AACTGGATGC TGCACGCAAT TCACTCTTTG TTCAGTGGCA TTACTACCAG GGGCGGGTTG AAGAGATCCT 
005461 GAATGGCTGG AACTCCCCGG AAGCACAATT AGCAGAACAG GCGCTCCGCA GCGGTCACAT AGAAGCGTTA 
005531 ATTAACATAT GGGAAAATGA CAACTACTCA CATTATCGTC CGGAAAAGAG TGTCTGGAAC CTGTATTTAT 
005601 TGGCACAGTT GCCGCGTGAG ATGGCTTTGA CCTTCTGGCT GCGTATCAAT GAGAAAAAGC ATCTGTTCGC 
005671 GGGTGAGGAC TATTTTCTCA GTATCCTCGG ATTGGATGCG CTACCAGGTC TGCTGTTGGC TTTTTCACAT 
005741 CGTCCAAAAG AAACATTTCC GTTAATTTTA AATTTTGGCG CAACAGAACT GGCGCTGCCT GTTGCCCACG 
005811 TCTGGCGACG TTTCGCGGCG CAGCGTGATC TGGCTCGCCA GTGGATTTTA CAATGGCCGG AACATACGGC 
005881 TAGTGCACTT ATCCCTCTTG TCTTTACCAA ACCCAGCGAT AATAGCGAAG CCGCATTACT TGCCCTGCGT 
005951 TTACTGTACG AACAGGGACA TGGCGAATTG CTACAAACCG TGGCAAACCG CTGGCAGCGT ACAGATGTAT 
006021 GGTCTGCCCT GGAGCAGTTG CTTAAACAGG GTCCAATGGA CATTTACCCG GCACGCATTC CAAAAGCCCC 
006091 TGATTTCTGG CATCCGCAAA TGTGGTCCAG GCCGCGCCTT ATCACTAATA ATCAAACTGT TACCAATGAC 
006161 GCTCTGGAAA TTATCGGCGA AATGCTGCGC TTTACCCAGG GGGGACGTTT TTATAGCGGG CTGGAACAAC 
006231 TGAAAACGTT CTGCCAGCCA CAAACGCTGG CAGCTTTTGC CTGGGATCTC TTCACTGCGT GGCAACAAGC 
006301 TGGTGCCCCC GCAAAAGACA ACTGGGCATT TCTGGCGTTA AGTCTCTTTG GTGACGAAAG CACGGCACGG 
006371 GATCTGACGA CACAGATCCT CGCCTGGCCA CAAGAAGGCA AATCTGCCCG TGCTGTCAGC GGCCTGAACA 
006441 TCCTTACCCT GATGAATAAT GATATGGCGC TGATACAGCT GCATCATATA TCGCAACGGG CTAAATCCCG 
006511 CCCCTTACGT GATAACGCGG CGGAATTTCT TCAGGTGGTC GCAGAAAATC GCGGGCTAAG CCAGGAAGAG 
006581 CTAGCGGACA GATTAGTCCC AACCCTGGGC CTTGATGATC CGCAGGCGTT GAGTTTTGAT TTTGGTCCCC 
006651 GGCAGTTTAC CGTTCGCTTC GATGAAAATC TCAACCCGGT TATCTTTGAT CAGCAAAACG TTCGCCAGAA 
006721 AAGCGTTCCC CGTTTGCGCG CCGATGACGA TCAACTGAAA GCGCCCGAGG CACTGGCCCG ACTAAAAGGG 
006791 CTAAAAAAAG ATGCTACTCA GGTGAGCAAA AACCTGCTCC CGCGTCTTGA AACGGCCCTA CGTACCACCC 
006861 GACGCTGGTC GCTGGCAGAT TTTCATTCTC TGTTTGTTAA TCATCCCTTT ACCCGTCTGG TTACCCAGCG 
006931 ATTAATATGG GGGGTTTATC CGGCAAATGA ACCGCGTTGT TTACTCAAAG CCTTTCGTGT GGCCGCAGAG 
007001 GGGGAGTTCT GCAATGCGCA AGATGAGCCA ATTGACCTGC CTGCGGACGC TCTGATTGGC ATTGCCCACC 
007071 CGTTAGAAAT GACAGCAGAA ATGCGCAGTG AATTTGCACA GCTTTTTGCC GATTACGAAA TTATGCCGCC 
007141 TTTTCGCCAG TTGTCGCGCC GCACGGTGCT GCTCACACCT GACGAGTCAA CCAGTAACAG CCTGACTCGC 
007211 TGGGAAGGTA AATCCGCTAC CGTTGGGCAA CTTATGGGAA TGCGATACAA AGGCTGGGAG TCAGGCTATG 
007281 AGGACGCATT TGTCTATAAC CTGGGTGAGT ACCGGCTGGT CCTTAAGTTT TCACCCGGTT TTAACCACTA 
007351 CAATGTTGAT AGCAAAGCGC TAATGAGCTT CCGTTCTCTT CGAGTGTACC GTGACAATAA ATCCGTCACT 
007421 TTTGCCGAAC TTGATGTGTT TGATTTGAGT GAGGCGTTAA GCGCACCTGA CGTCATTTTC CATTAAAACA 
007491 CAGCGGGCAG TGATGCAACT GCCCGTTATC AACACGACTT ACCAGCGGGG AAAGCGATGA TCGTGCAAAA 
007561 AGAGCTGGTT GCTATTTACG ATTATGAGGT CCCTGTACCT GAAGATCCGT TTTCCTTCAG ACTTGAGATC 
007631 CATAAATGCT CTGAATTATT TACAGGTTCC GTCTATCGAC TGGAGCGATT CCGGCTACGT CCAACATTTC 
007701 ATCAACGTGA TCGAGAAGAT GCTGACCCGC TAATAAATGA TGCGTTGATT TATATAAGAG ATGAGTGTAT 
007771 TGATGAGCGG AAATTACGAG GTGAATCACC TGAAACTGTA ATAGCAATTT TTAATCGTGA ACTACAGAAT 
007841 ATATTCAACC AAGAAATAGA ATAATATACT CTAAATAATT CAAATTGGTC CGATCCGGCG CAACGTCCCA 
007911 ATGGCCTGGA TTATAAATCT CATTATCTTA ATTGCAACGG GGTCCAGCCG TGGTTATAAT TCGTTCGTTG 
007981 GAACACGATG TTGCACAGGC TGTGGTGTTA GGCCTGAAAA TAGTAAATAA AAGAACCTGC CTCACCAGCA 
008051 GGTTTTTTTA TTTACTGTGA TCTGCTTTCC AGATATTTTT CGCTCAAACA ACTAATGCGC CAAACATTTA 
008121 TTGCGCGTAA AATATCGTTT ATTTCATTAA TACATTTCAG GGATGAATAT ATGTCACCGC AGAATAATCA 
008191 TCTGCAGCGT CCGCCTGCTG CTGTGTTATA CGCCGATGAA CTGGCAAAAT TAAAACAAAA TGATAACGCA 
008261 CCTTGCCCGC CCGGTTGGCA GTTAAGTTTG CCTGCGGCCC GTGCTTTTAT CCTTGGCGAC GAAGCGCAAA 
008331 ATATCAGCCG TAAAGTGGTG ATTAGCCCCT CCGCTGTCGA ACGTATGTTA GTCACTCTTG CTACCGGCCG 
008401 CGGTTTGATG TTGGTGGGGG AACCGGGTAC CGCAAAATCT CTTCTTTCTG AATTACTGGC AACCGCTATT 
008471 AGCGGCGATG CCGGGTTAAC CATCCAGGGC GGGGCATCTA CCACCGAAGA TCAAATCAAG TATGGCTGGA 
008541 ACTACGCCCT GCTTATCAAT CATGGTCCGT CAACGGAAGC GCTGGTCCCT GCCCCGCTTT ATCAGGGAAT 
008611 GCGCGACGGC AAAATCGTCC GTTTCGAAGA GATAACGCGT ACACCGCTGG AAGTGCAGGA CTGTCTGTTA 
008681 GGTATGCTTT CTGACAGGGT GATGACGGGG CCGGAACTCA CTGGTGAAGC CAGTCAGCTC TATGCGCGAG 
008751 AAGGCTTTAA TATTATTGCC ACTGCCAATA CCCGCGATCG CGGCGTCAAT GAAATGAGTG CTGCGCTAAA 
008821 GCGTCGCTTC GATTTTGAAA CGGTTTTTCC GATTATGGAT TTCGCCCAGG AGTTGGAACT GGTCGCCAGT 
008891 GCTTCGGCGC GTTTGCTGGC CCATAGCGGT ATTCCGCATA AAGTGCCTGA CGCGGTACTG GAATTACTGG 
008961 TCCGCACCTT CCGCGATCTG CGTGCCAACG GCGAAAAGAA AACGTCAATG GATACACTGA CAGCGATTAT 
009031 GTCCACCGCT GAAGCCGTGA ACGTGGCCCA TGCTGTGGGC GTCCGCGCCT GGTTTTTAGC GAATCGCGCG 
009101 GGGGAGCCTG CCGACCTGGT GGAATGTATT GCCGGAACCA TCGTCAAAGA TAACGAAGAA GATCGCGCGC 
009171 GTCTGCGCCG TTACTTCGAA CAGCGTGTCG CCACACATAA AGAAGCTCAC TGGCAGGCTT ATTATCAAGC 
009241 CCGCCACCGC CTGCCGTGAG GAAAGATGCA TGAGCGAGCC GTTAATTGTC GGCATCCGGC ATCATAGTCC 
009311 GGCCTGCGCC CGGCTGGTGA AATCGTTAAT CGAAAGCCAG CGGCCACGAT ACGTGTTGAT TGAAGGCCCG 
009381 GCTGATTTTA ATGACCGGGT AGACGAACTG TTTTTAGCCC ACCAGCTTCC GGTAGCTATT TACAGTTATT 
009451 GCCAGTATCA GGACGGTGCA GCCCCCGGGC GTGGTGCCTG GACGCCATTT GCTGAATTTT CGCCGGAGTG 
009521 GCAGGCGCTA CAAGCCGCAC GTCGCATTCA GGCACAAACT TACTTCATCG ATTTGCCTTG CTGGGCGCAG 
009591 AGTGAAGAAG AGGACGATTC GCCTGATACG CAAGATGAAA GCCAGGCCTT ACTGCTGCGT GCCACCCGCA 
009661 TGGATAACAG CGATACCCTG TGGGATCACT TGTTCGAAGA TGAAAGCCAG CAAACTGCAT TACCCTCTGC 
009731 GCTGGCGCAC TATTTTGCCC AACTGCGGGG CGACGCCTCC GGCGATGCGC TCAATCGTCA GCGCGAAGCC 
009801 TTTATGGCCC GCTGGATTGG ATGGGCGATG CAGCAAAATA ATGGCGACGT GTTAGTTGTC TGCGGTGGCT 
009871 GGCACGCTCC GGCACTGGCA AAGATGTGGC GCGAATGCCC TCAGAAAATT AACAAGCCAG AATTGCCCTC 
009941 GCTGGCAGAT GCCGTTACAG GTTGTTATCT CACACCCTAC AGTGAAAAGC GCCTTGATGT GCTGGCAGGA 
010011 TACCTTTCAG GAATGCCTGC CCCGGTATGG CAAAACTGGT GCTGGCAGTG GGGCTTGCAG AAGGCCGGTG 
010081 AACAACTGCT AAAAACTATC CTTACCCGTT TGCGCCAGCA CAAATTGCCC GCTTCTACCG CGGATATGGC 
010151 TGCCGCTCAT CTGCATGCGA TGGCGCTGGC ACAGTTGCGC GGTCATACAC TACCGTTACG CACTGACTGG 
010221 CTGGATGCCA TAGCAGGCTC GCTGATTAAA GAAGCCCTGA ACGCGCCGTT GCCGTGGAGC TATCGCGGCG 
010291 TTATTCATCC CGATACCGAT CCGATTCTGC TAACGTTGAT AGACACATTA GCGGGTGACG GATTCGGTAA 
010361 ACTTGCCCCT TCTACGCCAC AACCGCCTCT GCCAAAAGAT GTCACCTGCG AACTGGAACG TACCGCAATC 
010431 TCCCTTCCGG CGGAGCTTAC CTTAAATCGC TTTACCCCCG ATGGGCTGGC GCAAAGTCAG GTGTTACATC 
010501 GGCTGGCAAT ACTGGAGATC CCTGGGATTG TACGCCAGCA GGGAAGTACA CTGACACTTG CAGGCAACGG 
010571 TGAAGAACGC TGGAAATTAA CCCGCCCGCT TAGCCAGCAT GCGGCATTGA TTGAGGCCGC CTGTTTTGGT 
010641 GCCACACTCC AGGAAGCCGC ACGCAATAAA TTAGAAGCCG ATATGCTGGA CGCGGGCGGA ATCGGCAGTA 
010711 TCACCACATG TCTTAGCCAG GCGGCGTTAG CGGGTCTGGC GTCCTTCAGT CAACAATTAC TGGAGCAACT 
010781 CACACTATTA ATCGCCCAGG AAAATCAATT TGCCGAAATG GGCCAGGCGC TGGAAGTGCT TTATGCCTTA 
010851 TGGCGGCTGG ATGAAATTAG CGGTATGCAA GGCGCGCAGA TATTACAAAC GACGTTATGC GCGACTATCG 
010921 ATCGCACGCT GTGGCTGTGT GAATCTAACG GCAGACCGGA TGAAAAGGAG TTTCACGCTC ACCTGCATAG 
010991 CTGGCAAGCG CTTTGCCATA TTCTGCGCGA TCTACATAGC GGCGTTAATT TACCCGGCGT TTCTCTTTCT 
011061 GCGGCGGTAG CCTTACTGGA GCGACGCAGT CAGGCAATTC ATGCCCCGGC GCTGGATCGC GGCGCGGCTC 
011131 TTGGCGCACT AATGCGTCTG GAACATCCCA ACGCCAGTGC CGAAGCGGCG CTGACGATGC TGGCGCAGTT 
011201 ATCCCCGGCA CAATCTGGTG AGGCGCTGCA CGGTTTGCTG GCGCTGGCCC GCCATCAACT GGCCTGTCAG 
011271 CCGGCATTTA TCGCCGGTTT CAGCAGTCAT TTAAATCAAC TGAGTGAAGC CGATTTTATT AACGCCCTGC 
011341 CCGATTTACG CGCGGCGATG GCCTGGCTAC CACCACGAGA ACGCGGGACG CTGGCGCATC AGGTGCTTGA 
011411 GCATTATCAA CTGGCGCAAC TTCCCGTTTC GGCGCTGCAA ATGCCGTTGC ATTGTCCACC ACAGGCCATT 
011481 GCACATCATC AACAACTCGA ACAGCAGGCA CTGGCATCGC TGCAAAACTG GGGAGTTTTC CATGTCTGAA 
011551 CTGAACGATC TTCTGACCAC CCGTGAGCTA CAACGCTGGC GATTAATTCT TGGCGAAGCG GCAGAAACGA 
011621 CGCTTTGTGG GCTGGATGAC AACGCCCGGC AGATAGACCA CGCGCTGGAG TGGCTGTATG GGCGCGATCC 
011691 TGAACGGCTC CAGCGTGGTG AACGTTCCGG TGGATTAGGT GGCTCAAATC TCACCACCCC TGAGTGGATC 
011761 AACAGTATTC ACACGCTGTT TCCGCAGCAG GTGATTGAGC GGCTGGAAAG CGATGCCGTG CTGCGCTACG 
011831 GCATTGAAGA TGTGGTGACG AATCTCGACG TGCTGGAACG TATGCAGCCT TCTGAAAGCC TGCTACGCGC 
011901 TGTTTTGCAC ACCAAACATC TGATGAACCC CGAAGTACTG GCTGCCGCCC GCCGGATAGT GTGCCAGGTT 
011971 GTTGAAGAAA TTATGGCTCG ACTGGCAAAG GAAGTTCGTC AGGCTTTTTC TGGTGTCCGC GATCGCCGTC 
012041 GCCGTTCATT TATTCCACTG GCGCGAAACT TTGATTTCAA AAGTACTCTG CGCGCCAACC TGCAACACTG 
012111 GCACCCGCAA CACGGCAAGT TGTATATCGA ATCCCCCCGC TTTAACAGCC GCATTAAACG CCAAAGCGAA 
012181 CAATGGCAAC TGGTCTTACT GGTTGATCAA AGCGGATCGA TGGTCGATTC GGTGATCCAC TCTGCGGTGA 
012251 TGGCGGCCTG TTTGTGGCAG TTACCCGGCA TTCGTACCCA TCTGGTGGCG TTTGACACAA GCGTCGTTGA 
012321 TCTCACGGCA GACGTTGCCG ATCCGGTAGA GTTATTAATG AAAGTACAGT TGGGCGGCGG GACCAATATC 
012391 GCCAGTGCCG TGGAGTATGG TCGGCAACTT ATTGAACAAC CAGCGAAAAG CGTCATTATC CTCGTGAGCG 
012461 ATTTTTACGA AGGGGGTTCA TCATCATTAC TGACGCATCA GGTGAAAAAG TGTGTCCAGA GCGGCATCAA 
012531 AGTGCTGGGA CTGGCAGCGC TCGATAGCAC CGCAACACCT TGCTATGACC GCGATACGGC CCAGGCGCTG 
012601 GTTAATGTCG GCGCACAAAT AGCCGCCATG ACGCCGGGCG AGCTGGCATC ATGGCTTGCG GAGAATCTTC 
012671 AGTCATGAAT TCACTACGTC CGGAATTATT AGAACTGACA CCGCAGGCCC TGACGGCGTT AAGCAATGCC 
012741 GGTTTTGTTA AGCGCAGTCT TAAGGAACTG GAAAATGGCA ACGTCCCGGA GATCAGCCAT GAGAACGACG 
012811 CTTTAATCGC CACCTTCAGT GACGGTGTCC GTACCCAGCT GGCGAACGGC CAGGCACTGA AAGAGGCTCA 
012881 GTGCAGTTGC GGGGCCAACG GTATGTGCCG TCATCGCGTG ATGCTGGTGT TAAGTTATCA ACGACTTTGT 
012951 GCCACCACTC AGTCTACGGA AAAAGAAGAA GAGTGGGATC CGGCAATCTG GCTGGAAGAA CTGGCTACCC 
013021 TTCCCGATGC TACCCGCAAA CGCGCACAGG CGCTGGTCGC TAAAGGCATC ACCATTGAGT TGTTCTGTGC 
013091 GCCGGGTGAA ATTCCCTCTG CCCGCTTACC GATGAGCGAT GTGCGTTTTT ATTCCCGCAG CAGTATTCGT 
013161 TTCGCCCGTT GTGATTGTAT TGAAGGCACA CTTTGCGAAC ATGTCGTACT GGCGGTACAG GCCTTCGTCG 
013231 AGGCCAAAGC GCAGCAAGCA GAATTTAACC ATTTAATCTG GCAGATGCGC AGCGAACACG TCACATCATC 
013301 TGACGATCCG TTTGCCAGCG AAGAAGGCAA CGCGTGTCGT CAATATGTTC AGCAATTAAG CCAGACATTA 
013371 TGGCTTGGCG GCATCAGCCA GCCGCTCATC CATTACGAGG CAGCATTCAA CCGCGCATTG CAGGCGGCAG 
013441 AGACCTGCAA CTGGCGCTGG GTGAGTGAAT CGCTACGGCA ACTGCGCGCC AGCGTTGATG CCTTCCACGC 
013511 CCGCGCCAGC CACTATAATG CCGGAGAATG CTTACATCAG CTTGCGGCAT TAAACAGTCG ATTAAATTGC 
013581 GCACAAGAGA TGGCCCGGCG CGACAGTATT GGTGAAGTTC CTCCTGTGCC GTGGCGCACG GTCGTTGGCT 
013651 CTGGCATTGC CGGAGAAGCA AAGCTTGATC ATCTGCGGCT GGTGTCTTTA GGTATGCGTT GCTGGCAGGA 
013721 TATTGAGCAT TATGGTTTAC GCATCTGGTT TACCGATCCC GACACCGGCA GTATTTTGCA CCTTTCGCGC 
013791 AGTTGGCCGC GAAGTGAACA GGAAAACTCA CCGGCAGCTA CGCGTCGGCT GTTTAGTTTT CAGGCTGGCG 
013861 CACTGGCGGG CGGGCAAATT GTTTCACAAG CAGCAAAACG CAGTGCCGAT GGCGAGCTGC TGTTAGCTAC 
013931 CCGCAACCGC TTAAGCAGCG TTGTGCCGCT GTCGCCTGAT GCCTGGCAAA TGTTGAGCGC GCCGTTACGC 
014001 CAGCCGGGCA TTGTGGCTTT GCGGGAATAT TTACGCCAGC GTCCCCCCGC CTGCATACGG CCTCTTAATC 
014071 AGGTCGATAA CTTATTTATT CTGCCGGTCG CTGAGTGTAT TTCGCTCGGT TGGGACAGCA GCCGCCAGAC 
014141 GCTGGATGCG CAGGTCATTA GCGGCGAAGG GGAAGATAAT GTGCTGACGT TATCATTACC AGCCTCAGCC 
014211 AGCGCACCTT ATGCCGTTGA ACGCATGGCG GCGCTTTTGC AACAAACAGA CGACCCCGTG TGTCTGGTTT 
014281 CTGGCTTTGT CAGTTTTGTT GAAGGGCAAT TGACACTGGA ACCACGGGTG ATGATGACAA AAACCCGTGC 
014351 CTGGGCGCTG GACGCAGAAA CTACGCCTGT GGCACCGCTA CCTTCTGCCA GCGTTTTGCC TGTGCCGTCT 
014421 ACTGCTCATC AGTTGCTGAT ACGCTGCCAG GCGTTACTTA TTCAACTGCT CCATAACGGC TGGCGCTATC 
014491 AGGAACAGAG TGCTATTGGT CAGGCATAGT TGCTGGCGAA TGACCTCACC GCGGTGGGTT TTTATCGGCT 
014561 GGCACATGTG TTGGGACAAT TTCGTAATAC AGAAAGCGAG GCACGGGTAG AAGCAATGAA TAACGGTGTT 
014631 TTGCTTTGCG AACAATTATT CCCCATGCTT CAGCAACAAG GATGAAATAG TGCTTTTTAC TAAGAGTTCT 
014701 ACTCCAGTTC CGGACTGCTC ACGCCACGGT ATTAGGCATA TCCTATATAG CCCCTGGTGA GAGTCACCAG 
014771 TTCCTTGATT AAATAAAATG GAGTTTTACA TGAAGGCTTT CAATAAGCTG TTTTCCCTCG TTGTTGCATC 
014841 TGTTCTGGTT TTCTCTCTTG CTGGCTGCGG TGACAAAGAA GAATCGAAGA AATTCAGCGC CAATCTGAAC 
014911 GGCACTGAAA TTGCCATTAC CTATGTCTAC AAAGGTGACA AGGTGCTTAA GCAATCTTCT GAAACCAAAA 
014981 TTCAATTTGC CTCCATTGGT GCAACCACCA AAGAAGATGC TGCCAAGACA CTTGAGCCGT TAAGCGCCAA 
015051 ATACAAAAAC ATCGCGGGTG TTGAAGAAAA ATTAACCTAT ACCGATACCT ACGCGCAGGA AAACGTGACT 
015121 ATCGATATGG AAAAAGTGGA TTTTAAAGCC CTGCAGGGTA TTTCAGGAAT CAACGTTTCT GCTGAAGATG 
015191 CCAAAAAAGG TATCACTATG GCGCAAATGG AACTGGTGAT GAAAGCCGCT GGTTTTAAAG AAGTGAAATA 
015261 ATCGGTTGGC GGTCATGCTC TAAACATGAC CGCCAATTTT TTAGCCTTTT TTCACATGCT GGCGCGCTGC 
015331 CAGTCCACGC AGAAAATAAC GTAAAAATTG ATCGCCGCAT TCGCGGAAGT TTTTATGATC CGGTGCGCGC 
015401 ATCATCGCTG TAATTTCCGG CATCGAAACG CGGAACTGCT GTTCGGTGAG GATAGCCAGA ATGTCATCGG 
015471 TTTTCAGCGA AAACGCGATG CGTAATTTTT TCAGCACGAT GTTGTTATTA ATGCGACGTT CCGGCTCCAG 
015541 TGCCGGAGCA GACTCATCCT TGCCGCGTTT TTCATAAATC AGGCCATTGA GGAATGACGA CAAAACAATG 
015611 TCCGGACAAC GCTGAAAACC CTCTTCGTCT TCTTTACGTA GCCAGACGGC GATCTGTTCC GCGGTGGCTT 
015681 CGACATTACC CAGCGCCAGA ATACGCACCA GGTCATTATT ATTGGCTTTC AAAATGTAGC GCACGCTGCG 
015751 CAGAATATCG TTACTTAGCA TGAGGCCTTC AGGTGTTGAT GAGGCAAAAA GCCATTTTAG CAGTCTTTTA 
015821 CAGGCCAATC GCCTCTTTTA AGCTTTTCAG ATAACGGCGG CTGACCGGCA CGGTTAAGCC ATTACGCAAA 
015891 ATCAACTCGG CCTGGCCGTT ATCTTCCAGA CGAATCTCCT GTAAATGCGC GAGGTTAACC AGATACTGAC 
015961 GATGGCAGCG CAGTAGTGGT GTACGACTTT CCAGGGTACG TAATGTCAAT TCGGTAAAGC CCTCTTTCCC 
016031 TTCGTGGCTG GTAACGTAGA CACCGCTCAT CCGACTGCTG ACAAATGCCA CATCTTTCAT TTGCAGCAAA 
016101 TAAATCCGAC TATGCCCCGT ACAAGGGATA AATTTCAGCG CCTGTTGATT TTCCGGTAAC AGCGAAACAT 
016171 CCTGCTTGCT GCGCTCCTGA CGCAATCGCG CCAGCGTTTT CTCCAGTCGC GCTTCATCAA TTGGCTTCAG 
016241 CAGATAATCA AAGGCATGTT CTTCAAAGGC TTTAATTGCG TATTCGTCAA ACGCAGTGAG AAAAACAATA 
016311 TACGGGCGAT GTTCCGGGTC AAGCATCCCC ACCATTTCCA GACCACTGAT GCGCGGCATC TGGATATCGA 
016381 GAAACAGCAC ATCCGGGCGC AGTTTATGCA CCGCGCCGAT CCCTTCCACG GCGTTTGAAC ACTCTCCAAC 
016451 GATTTCAATA TCGCTCTGCT CCTGCAAAAA TACACGCAGG TTCTCCCGTG CTAACGGTTC ATCATCGACA 
016521 ATTAAGACTT TAATCATGCC TCGTCCCTCC ATGGTAGTCG TAACGTTATT CGGGTGTAAC TATCAGGCTC 
016591 ACAGGCGACG CTTATTCCAT AGTCATCGCC AAACCGTTCA CGTAAACGCT TATCCACCAG ATTCATCCCC 
016661 AGCCCACTGG CATTGGTTAC CGGTTGATAC AAACCGGCAT TGTCTTCGAT CTCCAGCATC AAATGTTGCC 
016731 CCTCACGTCG GGCGCTGATT GCCACTCGCC CTGTATCCAG CAGTTGTGAT GTCCCATGTT TAATGGCGTT 
016801 TTCCACTATC GGTTGCAGGG TAAACGCGGG CAATTGCTGC TGGGATAATT CTTGCGGAAT AGCAATGTTG 
016871 ACCTGCAACC GCGACTGGAA GCGCGCCTTT TCAATTTGCA GATAAGCATT CACATGTTCA ATTTCGTCGG 
016941 CGAGAGTAAC AAACTCCGAA GGCCGCTTTA AGTTTTTGCG GAAAAAAGTG GAAAGATACT GCACCAGCTG 
017011 GCTGGCCTGT TCGCTGTCGC GGCGGATCAC CGCTTTAATG GTGTTAAGCG CATTAAACAA AAAATGGGGA 
017081 TTCACCTGGG CGTGAAGCAG TTTGATCTCT GACTGGGTGA GCATCGCTTT TTGCCGCTCA TATTGCCCGG 
017151 CAAGGATCTG CGCCGAAAGC AATTGCGCAA TCCCCTCACC CAACGTGCGG TTGATTGAAC TGAATAAACG 
017221 GTTTTTGGCT TCATACAATT TGATGGTGCC CATCACCCGC TGATTTTCAC CACGCAACGG AATTACCAGC 
017291 GTCGACCCCA GTTTGCATTG CGGATGCAAA GAGCAACGGT AAGGTACTTC GTTGCCATCA GCGTAGACCA 
017361 CTTCACCGGT TTCAATCGCT TTTAAAGTAT AAGTTGAAGA AATCGGTTTG CCGGGTAAAT GGTGGTCGTC 
017431 ACCAATTCCG GTAAAGGCCA GCAATTTCTC TCGATCGGTA ATCGCGACTG CACCAATATC CAGTTCCTGA 
017501 TACAGCACCT GAGCCACTTT CATGCTGTTC ACTTCGTTAA ACCCCTGGCG CAAAATGCCT TCCGTCGAGG 
017571 CTGCCACTTT CAGCGCAGTG GCAGAAAAAG CCGAAGTGTA TTTTTCAAAC ATCGCGCGTT TATCGAGCAA 
017641 TATACGCATA AACAGCGCCG CGCCGACGGT ATTGGTGACC ATCATTGGCG CAGCAATATT ACTCACCAGA 
017711 CGCACCGCAT CTTCATAAGG TCGGGCGATC GCAAGGATGA TCAGCATTTG CACCATTTCA GCGACGAACG 
017781 TGACGGCACC GGCGGTAATG GGGTTAAAGA CTTTATCAGT GCGCCCGCGG CGGATCAGGA TGCTGTGTAC 
017851 CAGGCCACCG AGTAATCCTT CAACGATGGT CGAGATCATG CAACTTAACG CGGTCATGCC CCCCATCGAA 
017921 TATCGATGTA AGCCGCCGGT CAGCCCAACC AGCCCACCGA CGACCGGACC GCCGAGTAAG CCGCCCATTA 
017991 CCGCGCCTAT CGCACGGGTA TTGGCAATAG AATCGTCAAT GTGCAACCCA AACCAGGTGC CCATGATGCA 
018061 GAAGATGGAA AAGACGATGT AGCAGAGAAA TTTATGCGGC AGACGAACCG TGACCTGCAT TAACGGTATG 
018131 AATAATGGCG TTTTACTCAT TAACCATGCA ATGACTAAAA AAACGCACAT CTGCTGAAGC AGCAGCAACA 
018201 CCAGATTAAA ATCGTACATA CCCGCAAACC ACACTTCCCT TTAAAACGCG TAACATACAT TGCCTGCGTT 
018271 TAACTTTCTT TGAACTCTTG CAGAAAAATG AGAATTCGTG AGTACGATCA CTCAAAATCG CCTGGCAAAA 
018341 ATAAAATCAC CCTATAGATG CACAAAAAAC GGGCAAAACT ACCTGGTTCG CAAAACTGCG TCTAAAGTTA 
018411 AACCGGGACC TCGCGAGCAA GGGTGAGACG ATGGCGCTTT ACACAATTGG TGAAGTGGCG TTGCTTTGTG 
018481 ATATTAATCC TGTCACGTTA CGCGCGTGGC AGAGGCGTTA CGGATTGCTG AAACCGCAAC GGACAGACGG 
018551 CGGTCATCGG CTGTTCAACG ATGCCGATAT TGACCGGATC CGCGAGATCA AACGCTGGAT CGACAACGGC 
018621 GTGCAGGTCA GCAAAGTTAA AATGCTGCTC AGTAATGAAA ATGTTGATGT GCAGAACGGC TGGCGCGATC 
018691 AGCAAGAAAC ATTACTGACT TACCTGCAAA GCGGCAATCT ACATAGCCTG CGAACGTGGA TCAAAGAGCG 
018761 CGGTCAGGAT TACCCCGCCC AGACACTCAC CACACATCTG TTTATTCCTC TGCGCCGACG GCTTCAGTGC 
018831 CAACAACCGA CTCTCCAGGC GCTGCTGGCG ATCCTCGACG GCGTACTGAT CAACTACATC GCCATTTGTC 
018901 TGGCTTCGGC ACGTAAAAAA CAGGGTAAAG ATGCGCTGGT GGTTGGCTGG AATATTCAGG ATACCACCCG 
018971 TCTGTGGCTG GAGGGCTGGA TTGCCAGTCA ACAAGGATGG CGCATTGATG TCCTCGCCCA CTCGCTCAAT 
019041 CAACTACGCC CTGAACTATT CGAAGGCCGT ACATTGCTGG TGTGGTGCGG TGAAAATCGA ACCTCCGCCC 
019111 AACAGCAGCA ACTCACCAGT TGGCAAGAAC AAGGCCATGA TATTTTCCCA CTCGGCATTT AATGATTCGT 
019181 TAACAAATGC GCTTTACTGT ACAATCCTTT CGTTAACATA AGGAGTGCAT TATGCGCATA GCTAAAATTG 
019251 GGGTCATCGC CCTGTTCCTG TTTATGGCGT TAGGCGGAAT TGGTGGCGTC ATGCTCGCAG GTTATACCTT 
019321 TATTTTGCGT GCTGGCTAAG CGCCTGCACC AGCCTTTCAA ACAGGCGGTC TGCGATGATC GCCGCCAGTG 
019391 CCACCAGTAA CGCCCCCTGG ATCACATACG CGGTATTAAA TCCGCTAAGC CCGATGATGA TGGGCGTACC 
019461 CAGCGTGCTG GCCCCTACCG TTGAGGCGAT CGTCGCCGTA CCAATGTTGA TAATCACCGA AGTTCGCACG 
019531 CCCGCCAGAA TCACCGGAGC CGCCAGCGGT AGCTCGACCT TACGCACTCG CTGACCACGA CTCATTCCCA 
019601 TACCTTTCGC AACTTCTGTC ACGCTGGCAT CAATCGCTCC CAGCCCGGCA AGTGTCGCCT GCAGGACGGG 
019671 CAGCACACCG TAAAGGATCA AGGCGATAAT CGCTGGTTGC AGACCAAAGC CGATCACCGG AACGGCGATC 
019741 GCCAGCACTG CGACGGGCGG AAAAGTCTGT CCAACGGCGG CAATAGTTTC CACCAGTGGG CGAAATTCCG 
019811 CGCCCCACGG GCGAGTGACA GCAATTCCGG CACCAGTGCC AATGATCACC GCAAACAAAC TCGAAATTCC 
019881 CACCAGCCAG AAATGAGCCA GTGCCAGAGC TGCAAAACTT TCTTGCTGAT AAACGGGTCG TGGCAGTTGT 
019951 GGGAACAAGG CAGCAAACAG CGGCTGGCTG TAAGGCAGCC AGAAAATCAG CGCCACAAAC AGAGCAATGA 
020021 GCCAGAACAG CGGATCGCGC AACATCTTCA TACGCTTACG CCTCCACCAG CAGATCCTGA AAATGCAGCG 
020091 TGCCGCAAGG CTGGCCCTGC ATGTTCACCA CCGGCAGCAC CTCGCATCCC CGCGCAACAA ACAGAGAGAG 
020161 CGCATCGCGT AGCGTCATCT CTTCTGCCAG TGCCTCACCA TCTGCTCGTT CTTCGCGACG CACGTAATCC 
020231 GCCACACTAC GTAACGAAAG CAGGCGCACA CCCAGTTCAC TACGTCCAAA AAACTGGCGG ACAAAATCAT 
020301 TCGCCGGACG AGTCAGCATC GTCAGCGGAT TGCCCTGCTG CACTACTTCA CCGTGATCCA TCAATACCAG 
020371 ATGTTCTGCC AGCCGTAGCG CCTCATCAAT ATCATGAGTG ACCAGCACAA TGGTACGCCC CAGCAAACGG 
020441 TGAATGCGCG TCATCTCTTG TTGCAACGCG CCGCGCGTTA CCGGGTCCAG TGCGCCAAAA GGTTCATCCA 
020511 TTAGTAAGAC TTGCGGATCG GCAGCCAGTG CACGCGCCAC TCCCACACGT TGCTGCTGAC CACCGGAAAG 
020581 CTGATGCGGA TAACGCTCAC GCAAATTTGA CTCCAGCCCC AGTAGCGCCA TTAATTCGTC GATACGATCG 
020651 TCAATCCGCG CCCGCGACCA TTTTTGTAAT TGCGGCACGG TAGCGATGTT TTGCGCCACG CTCCAGTGGG 
020721 GGAACAGGCC AATAGATTGA ATGGCATAGC CCATCCGGCG GCGCAACTCC AGTACTGGCA GCGAGCGAAT 
020791 TTCTTCTCCG GCAAAGCGGA TCTCTCCGCT GTCATGCTCC ACCAGGCGGT TAATCATTTT CAGGGTGGTG 
020861 GATTTGCCGG AGCCAGATGT GCCAATCAGC ACCGAAAAAC TCCCTTCCTG AAAATTGAGA TTGAGATCGT 
020931 TAACGGCTTT TTGTGCGCCG AACAGTTTGC TGACATGGCT AAATTCAATC ATTACGTTTC ACCTTCAGCA 
021001 GTGCGATAAG CAAATCGAAC AGCGCGTCGG TAAGCACCGC CAGAACAATT ACCGGGATCA CCCCCAGCAA 
021071 CACTAAATCA ATGGCGCTGC TTAGCAGCCC CTGGAAAACC AGCGCACCAA AACCGCCTGC GCCGATTAAC 
021141 GCCGCAATCA CCGCCATACC TACAGTTTGC ACCATCACCA CCCGCAGGCT GCGCAGAAAT ACCGGTAACG 
021211 CCAGCGGTAA CTGAACATGC AGGAAACGCT GCGCCCCGCT CATCCCCATC GCTCTGGCGC TTTCCAGCAC 
021281 ATCGCGCGGG ATCTGGTTCA AACCGACTAC CACGCCGCGC ACCAGCGGCA GCAAGGCATA GAGCACCAGC 
021351 GCAATCAGTG CGGGTGTCAT TCCGGTTCCT GCTATGCCGA GCGTCCCCAG CCACGGAAAG GCCGTAACCA 
021421 GCGCGGCAAG CGGCGCAATC AACAGGCCAA AGAGCGCCAC CGAAGGCACG GTCTGAATCA CATTGAGCAG 
021491 AGAAAAAATT GCCCCCTGCC GAGCAGTGGA AAAGTAGCAC CAGATGCCCA ACGGCACACC AATCACTAAC 
021561 GCAGGCAGCA CCGCACCAAA CAGCAACGTC AGATGTTGTG CCAGCGCGTC GTCAAACACA TCCTGACGGT 
021631 TGGCGTATTC TTTCATTAGT GAGAGATCGT TAAGCGTGCC GGAGTACAGC AACCACAGCG GAATAATGGC 
021701 AATCTGCATA TGCAACAACC AGCGCCACAG CGGATGCGTG GAGATTCGGC GGATGGCATC GCTACAGGCC 
021771 AGCAATGCCA GCGCCGCAGC CAGCCAGAAA CCACTGCCGA GGCTGGTACG CGCCAGCGCA CTGCCATTTT 
021841 GCGCCAGTTG GGTCGCCGCC TTTCCAGCTC CCCACACCAG CAATACGAAG ACGAATTGCG CCAGAATGAG 
021911 TGCACAAATG CTGCCTTTTT TACCGGGAAT AAAACAGGCC GTCAGCCAGG CGCAACCAAC GCCCACCAGC 
021981 ATCCAGATCG TTTGCGGCCA CAGCTGCCAG AGATGACGCC CCTCACCCGA AACTAAACGA TTAGGCGCGT 
022051 AACTGATAAA CGGCAGCGCC GCTGCGATTG CCGTCAGCAA CAGCAGCAGC GCCAGAACAG GATTAATACG 
022121 GAAATAAGTC ACGGGAAATT ACTTCGTCCA CCCTTTTTGT TTCAGGTAGT CGGCAGCCAC TTTTTTGGCA 
022191 TCCAGTCCTT CCACAGCAAT GCTGGCATTC AGTTGCTGCA ATGTTTTTGC ATCGAGGCTG GCGAAGACTG 
022261 GCTGTAGCCA CTGTGCCATT TGCGGATACT CCCTCAACAC CGACTCACGC ACCACTGGTG CAGGCGCGTA 
022331 GATAGGTTGC ACACCTTGCG GATCGCTTAA GGTTTGCAGC CCCAGCGCCG CTACCGGGCC GTCAGTGCCG 
022401 TAAGCCATTG CAGCATTAAC GCCAGAGGTT TGCTGGGCAG CGGCTTTGAT CGTCACCGCC GTGTCGCCAC 
022471 CAGCCAGTGA CAGCAACTGA TCCTGACCGA GCTTAAAGCC ATAGGCTTTT TCAAACGCGG GTAACGCATC 
022541 GGCGCGTTCG ATAAACTCTG CCGAGGCTGC CAGTTTGAAG GTGCCGCCCT CTTGCAGATA ACGACTCAGG 
022611 TCGGCAAGCG AAGTGAGTTT ATTTTTCTCT GCCACATCCT GACGCACGGC GATAGTCCAG GTGTTATTTG 
022681 CAGGCGCGGG CGTCAGCCAG ATTAACTTGT TGTGCTCCGA ATCGAGCTTT TTGACTTTCT CGTAACCTTG 
022751 CTGCGCGTTT TTCCACGCTG CATCGTTTTC ATCTTTAAAG AAGAAAGCGC CATTGCCGGT ATATTCCGGA 
022821 TAGATATCCA GTTCACCGGA AGTAATCGCC CCGCGCACCA CAGGAGTCGT TCCGAGTTGC ACTTTATTCA 
022891 CCGTCGGTAC GCCGTGGCTT TCCAGCACCT GCAAAATGAT ATTGCCGAGT AGCGCACCTT CGGTATCGAT 
022961 TTTTGAACCG ACTTTAACGG GGGAAGCCGC CTGTAGCGGC AGGCTCACGG CTGCCAACAT AACCAGTGAA 
023031 CCTGCCCAGA GCTTTAAGAG TGGCATGATG CTTTCCTCAT TCTTTTACTG TTGTTTTCAG CGAATTAAGA 
023101 GAAAAGCATA GTTGATAATG GCGGGGTTAG CTTGAGCGGA AGGATTCAGT TGCAGAATCA GATAAATACT 
023171 TAAGAGGCAT ATTCGGTCCG GCGTTTCCTG CCGGATGCGG CGCGAGCGCC TTATCCGGCC TACAAAGGGC 
023241 GCAAACGTCG CGCCCTTACT AAAGCATTAC AGCAACTCAA ACTCGCCTTT CTTAACGCGT GCGGAATCAG 
023311 TGCCGATAAA GACATTGAAC TTGCCAGGCT CGGCGTCATA TTTCATCTGT TGATTCCAGA ACTTCAGCGC 
023381 CTCAATATCG ATCGGGAAGC TGACAGTCTG AGTTTCGCCC GGTTTCAGGG TGATTTTCTC AAAGCCTTTC 
023451 AGCTGTTTCA CAGGGCGACT CATGGAAGCC GTCACATCCT GCAAGTACAT CTGCACTACC GTGGCACCCT 
023521 CGCGCTTACC GGTGTTCGTC ACCTGCACGC TGGCAGTCAC TTTGCCGTCA CGCTTCATGG TCGGCGCAGA 
023591 AAGTTTCACA TCAGAGACGG TGAAAGTGGT GTAGCTCAGC CCATAGCCGA ACGGATACAA CGCCCCGTTA 
023661 GCTTCATCAA AATAACGCGA AGTGTATTTG TTCGGCTTGT CGGCATTATA CGGGCGACCG GTATTCAGAT 
023731 GGCTGTAGTA CACCGGGATC TGCCCGACAG AACGCGGGAA GGACATTGGC AGCTTGCCGG ACGGGTTGTA 
023801 ATCGCCAAAC AATACATCGG CAATTGCATT ACCGCCTTCA GTCCCCGCAA ACCAGGTTTC CAGAATCGCA 
023871 TCAGCCTGCT GATCTTCTTT CACCAGCGCC AGCGGACGCC CGTTCATCAG CACCAGCACC AGCGGTTTAC 
023941 CGGTGGCTTT CAGCGCCGCA ATCAAGTCAC GTTGGCTTTG CGGAATAGTG ATATCGGTCC GGCTGGAGGC 
024011 TTCGTGCGCC ATCCCCTGTG CTTCACCGAC TACAGCCACC ACCACATCAG ATTGTTTCGC CGTCTGCACC 
024081 GCTTCATCAA TCATCTCTTG CGGCGAACGC GGATCGACTT TGACCGCTTC TTCATACTGA TTCAGGAAAT 
024151 CGATAATGCC TTTGTCACTG GTAACGTTCG CCCCTTTGGC ATACAGCACT TTACCGTTTT CACCGACGGC 
024221 ATTTTTAATC CCGGTCAGTA CGGTCACGGA TTGATCGGCA ACACCGGCTG CGGACCAGCT GCCCATCACG 
024291 TCACGTTTAC TGTCCGCCAG TGGCCCAACC ACCGCAATGG TGGCCGATTT TTTCAGCGGT AACGTTTCGA 
024361 GACGGTTTTT CAGCAACACC AAGCTTTCGC GCGCCACTTC ACGCGCTTCT TTACGGTGCA GGCGGCTTTC 
024431 GGCATTGGTA TCCACCGGGT CAGACTCTTT CGGCCCCAAA TGGCTGTATG GGTCGTTAAA CAACCCCATA 
024501 TCATATTTAA CGTTCAGTAC ATGGCGGGCA GCATCGTCCA GCTCTGCCAT CGTCACTTTG CCGGATTTAA 
024571 TCAACCCAGG CAGATACTTC GAGTAGTACT CGTCGCTCAT GCTCATGTTG ATTCCGGATT TCAGCGCCAC 
024641 GCGCACCGCA TCTTCCGGGT CTGCCGCCGT GCCATGTTTA ATCAGCTCTT TGATTGCACC GTGATCGGAA 
024711 ACGGTGATGC CTTTAAAGCC CCACTGGTCG CGCAGAACAT CTTTCAGCAG CCAGGAATCG GAGGTGGCTG 
024781 GCGTGCCGTT CAGCGAGTTC AGCGCCACCA TCACCGCGCC GCTGCCTGCG TCCAGCCCCG CTTTGTACGG 
024851 CGGCATATAA TCATTAAACA GGCGCTGCGG ACTCATATCG ACGGTGTTGT ACTCTTTACC GCCTTCTACC 
024921 GCGCCGTATG CGGCAAAGTG TTTGACGCTG GTCATCACCG AGTAGCGATC TGCCGGGCTT TTACCCTGCA 
024991 TCGCTTCCAC CATGGTTTTA CCCATTGTTG AGGTGAGATA CGTATCTTCG CCAAAACCTT CGGAAGCACG 
025061 TCCCCAGCGC GGATCGCGCG AGACATCGAC CATCGGTGCC CAGGTCATAT TCAGGCCATC ATCTGCCGCT 
025131 TCATAAGCAG AGACACGTCC GACCGTTTTC ACTGCATCGA GGTTAAAAGA CGAGGCCAGA CCGAGGCTAA 
025201 TCGGGAACAC CGTGCGCTGA CCGTGCAGCA CGTCGTAAGC AAAGAAAAGA GGAATTTTCA GGCGGCTTAA 
025271 TTCCATCACC TGATCCTGCA TGGCGCGGAT ATCCTGACGG GTTACGGTGT TGAAAATCGC CCCAACCTGA 
025341 CCGTCTTTGA TCATCTCGCG GATCGCCTCT TTCGGGTTAT CCGGGCCGAC GCTGATTAAG CGCAGCTGAC 
025411 CAATTTTCTC ATCAACTGTC ATTTTCTTAA GCAGTTCGGT GACGAACGCA TCCCGCGCTT CGGGCGTTAA 
025481 TGGATGGTTG CCGAATAAAT CATCCGCCAG TGCTGGCTGC AGGGCCAGAC TCACCGCGAT TCCTACTGAA 
025551 CATAGCCATT TCATATGGAT TTTTCTTCCT TTGTTGCCCG ACGTGGCAGC GAAAATGGTG CAAAAACCGT 
025621 AGTTTGCCAT AAGCATGATG GAGAGAGAAA AAGAATGCTC AGTTTATTGT CTGAATTTTC AAAATATTCA 
025691 CTCGCTGAAT TGTTATACAA GGCGCTATTC TAGTTTGTGA TATTTTTTCG CCACCACAAG GAGTGGAAAA 
025761 TGTCTTCCAT GACAACAACT GATAATAAAG CCTTTTTGAA TGAACTTGCT CGTCTGGTGG GTTCTTCACA 
025831 CCTGCTCACC GATCCCGCAA AAACGGCCCG CTATCGCAAG GGCTTCCGTT CTGGTCAGGG CGACGCGCTG 
025901 GCTGTCGTTT TCCCTGGCTC ACTACTAGAA TTGTGGCGGG TGCTGAAAGC CTGCGTCACC GCCGACAAAA 
025971 TTATTCTGAT GCAGGCCGCC AATACAGGCC TGACCGAAGG ATCGACGCCA AACGGTAACG ATTATGATCG 
026041 CGATGTCGTT ATCATCAGCA CCCTGCGTCT CGACAAGCTG CACGTTCTTG GCAAGGGCGA ACAGGTGCTG 
026111 GCCTATCCGG GCACCACGCT CTATTCGCTG GAAAAAGCCC TCAAACCGCT GGGACGCGAA CCGCACTCAG 
026181 TGATTGGATC ATCGTGTATA GGCGCATCGG TCATCGGCGG TATTTGTAAC AACTCCGGCG GCTCGCTGGT 
026251 GCAACGTGGC CCGGCGTATA CCGAAATGTC GTTATTCGCG CGTATAAATG AAGACGGCAA ACTGACGCTG 
026321 GTGAACCATC TGGGGATTGA TCTGGGCGAA ACGCCGGAGC AGATCCTTAG CAAGCTGGAT GATGATCGCA 
026391 TCAAAGATGA CGATGTGCGT CACGATGGTC GTCACGCCCA CGATTATGAC TATGTCCACC GCGTTCGTGA 
026461 TATTGAAGCC GACACGCCCG CACGTTATAA CGCCGATCCT GATCGGTTAT TTGAATCTTC TGGTTGCGCC 
026531 GGGAAGCTGG CGGTCTTTGC AGTACGTCTT GATACCTTCG AAGCGGAAAA AAATCAGCAG GTGTTTTATA 
026601 TCGGCACCAA CCAGCCGGAA GTGCTGACCG AAATCCGCCG TCATATTCTG GCTAACTTCG AAAATCTGCC 
026671 GGTTGCCGGG GAATATATGC ACCGGGATAT CTACGATATT GCGGAAAAAT ACGGCAAAGA CACCTTCCTG 
026741 ATGATTGATA AGTTAGGCAC CGACAAGATG CCGTTCTTCT TTAATCTCAA GGGACGCACC GATGCGATGC 
026811 TGGAGAAAGT GAAATTCTTC CGTCCGCATT TTACTGACCG TGCGATGCAA AAATTCGGTC ACCTGTTCCC 
026881 CAGCCATTTA CCGCCGCGCA TGAAAAACTG GCGCGATAAA TACGAGCATC ATCTGCTGTT AAAAATGGCG 
026951 GGCGATGGCG TGGGCGAAGC CAAATCGTGG CTGGTGGATT ATTTCAAACA GGCCGAAGGC GATTTCTTTG 
027021 TCTGTACGCC GGAGGAAGGC AGCAAAGCGT TTTTACACCG TTTCGCCGCT GCGGGCGCAG CAATTCGTTA 
027091 TCAGGCGGTG CATTCCGATG AAGTCGAAGA CATTCTGGCG TTGGATATCG CTCTGCGGCG TAACGACACC 
027161 GAGTGGTATG AGCATTTACC GCCGGAGATC GACAGCCAGC TGGTGCACAA GCTCTATTAC GGCCATTTTA 
027231 TGTGCTATGT CTTCCATCAG GATTACATAG TGAAAAAAGG CGTGGATGTG CATGCGTTAA AAGAACAGAT 
027301 GCTGGAACTG CTACAGCAGC GCGGCGCGCA GTACCCTGCC GAGCATAACG TCGGTCATTT GTATAAAGCA 
027371 CCGGAGACGT TGCAGAAGTT CTATCGCGAG AACGATCCGA CCAACAGCAT GAATCCGGGG ATCGGTAAAA 
027441 CCAGTAAACG GAAAAACTGG CAGGAAGTGG AGTAAAAATT ACGGATGGCA GAGTATCGCC ATCCGAATTC 
027511 ACTTAATCGT TCTGTGCCGT CTGCCCCGCC GCCGCCATTT GGGCGGCTTT TTGTTTTTTA TAGCTCAACG 
027581 CTGCTGCCGG CACAGGCATC ACTTTACCGG TTTCAATCCA GGTACGCAGG CGGCTGGCAT CGGCAAAATG 
027651 GGTATATTTG CCAAACGCGT CCATCACTAC CAGCGCCACC GGTTTATTAT TGATAACCGT ACGCATCACC 
027721 AGACAATGGC CCGCCGCATT GGTAAAGCCG GTTTTGGTTA ACTGAATATT CCAGTTATCG CGATACACCA 
027791 GATGATTAGT ATTGCGGAAC GGCAGCGTAT ACGTCGGATT AGAGAAGGTT GCCATATCTT CCCGGGTAGT 
027861 ACTTAACTGC CCGATCAACG GATATTGTTT GCTGGCAATG AGCAGTTTGG TTAAGTCACG GGCAGTTGAA 
027931 ACGTTATGCA CCGACAATCC GGTAGGTTCA ACAAAGCGCG TGTTGTTCAT TCCGAGCGAT TTCGCTTTCG 
028001 CATTCATTGC CTTAATAAAG GCTTTGTAAC CACCGGGATA ATGGTGCGCA AGGCTTGCCG CCGCGCGGTT 
028071 TTCTGAAGAC ATCAGCGCCA GCAACAGCAT ATCTTTACGG CTGATTTCGC TATTCAGTCG TACGCGCGAA 
028141 TAGACCCCTT TCATCTCCGG CGTCTGGCTG ATATCCACTT TTAGTTTTTC ATCCAGCGGC AGTCGTGCAT 
028211 CCAGCACAAC CATCGCGGTC ATTAATTTGC TGATAGACGC AATCGGACGC ACCAGATCCG GGTGGTTCGA 
028281 ATAGATCACT TTGTTGGTAT TCAGATCAAC AATCATCGCG CTACCGGAGG CAATTTCCGG TTGTGAAGCG 
028351 GTGGTAGCGG CTGCCGTTTT CGCAACGGCC TGCGGTGCAA AAGGCACAGC CAGCATCAGG GCCAGGCTAA 
028421 ATAAAGAAAC TCGAAATTTC GGCATGATGA GCATTCAGAT AGTGGTTCAC GCGCACGGGT TGCGCACCGC 
028491 CGGAGTAAGG ATTTACTGAG GCTAGCGACG CCATCATAAC GAGCAAAAAG TGCGATCGTC AAAGGAGAAT 
028561 CGTGAGGAAA TGCTGCATTG CTGACATTTA CGCCAGCAAT GCAACGTCAA AGAACTTTCT AGAACAAACG 
028631 ATAACCGTAG CCCCATAGTA TAACGGTTAG GGCGAGCAGC ACTTCCAGTA CCAGCACGCC AATCGCCAGC 
028701 GTCGAACTAG AGAAGCTAAG GCCTTCCTCT TTGTTGATAT TCAGGAAGCT CGGAATACCA AGGTAAAGCA 
028771 GGTAGCCGGT GTAAAACAGC GCCACCGTGC CGACCAGCGC ACACAACCAG ACCAGTGGAT AAAGCGCCAC 
028841 CAGACCGCTT AAAAACAGCG GAGTTGCAAC GTAGCCCGCG AAGACCATGC AGTGCGCAAG TGACGGACGC 
028911 TGCGGATAAT TACGCGCCAT CCACCAGATG ACCCGCCCCA TCACCGCGAC CCCAGCCAGC ATAACGCCGT 
028981 AAAACAAGAC AGCCAGCGCC AGTCCGGTAA ACCAGGATAA CTTCAGGATA GTGCCATCGC CAAAATTCCA 
029051 GCCAATCTGT GTAGTGCCAA TGAAGGCGCA AATCACCGGA ATCGCCGCCA TCAGCAAAAC GTGGTGGGTG 
029121 TAATGGTGAG AAATCGTTTC GTTTTCGCGA TTAATCACCT GCATTTCACG ATCGGGATGG GAAAACAGTC 
029191 CCCAGACATG GCTCATACCG CCCCCTTGTT GTGAGTTCAT GAACCTGACA GTTCAAGTAT AAGTCAGCTT 
029261 GTGATTATTT TTTGTTCGCC CATGTAATTT TCACTGTCTG ATGAACGTCC TTTTTCAGCG TGAATGATTC 
029331 ACAGGGTGTA TGCTTACTGG CAACCAAAGG GAGACAGACT GGCCTATGGA TCTCAATACA CTTATCTCAC 
029401 AATATGGTTA TGCCGCGCTG GTGATCGGTA GCCTGGCGGA AGGTGAAACC GTGACTTTGC TGGGAGGCGT 
029471 TGCGGCGCAT CAGGGGCTAT TAAAGTTCCC GCTGGTGGTA CTTTCTGTGG CGCTTGGCGG CATGATTGGC 
029541 GACCAGGTGC TCTATCTGTG CGGGCGGCGG TTTGGCGGCA AGCTGTTACG CCGTTTCTCG AAACATCAGG 
029611 ATAAAATTGA GCGGGCGCAG AAACTTATCC AACGCCATCC GTATCTGTTT GTCATTGGTA CGCGCTTTAT 
029681 GTATGGCTTT CGGGTGATTG GCCCGACGCT GATTGGTGCC AGCCAGCTGC CGCCGAAAAT CTTTCTGCCG 
029751 CTGAATATTC TCGGCGCATT TGCCTGGGCG TTGATTTTTA CCACTATTGG TTACGCTGGT GGTCAGGTGA 
029821 TTGCGCCGTG GTTGCACAAT CTCGACCAGC ATTTGAAGCA CTGGGTCTGG TTGATTCTGG TCGTGGTTCT 
029891 GGTGGTGGGC GTGCGCTGGT GGCTGAAACG ACGCGGGAAG AAAAAGCCGG ATCATCAGGC GTAAAACCAT 
029961 TGCCCTGGAT AAGGCGTTCG CGCCGCATCC GACATCCGGA GTACCATGCC TGATACGACG CTTGTGCGTC 
030031 TTTTCATGCC GACCAAAATA TTACCCAATG AAATATCCAC GCACCTCACT GCGCTATTCT GGGTTGAACT 
030101 GTGGATTCGC CAACATAAAG CCGCCATCCA CTATCAACGA CTGCCCGGTG GTGTAATTTG CGCCCTCCGA 
030171 ACAAAGCCAC ACCACCAGGC TGGCAATCTC ATGCGTTGCG CCAAAACGCC GCAAGGGAAT CGAAGGCTCC 
030241 GCGTCGGGCT TCACGTCGCT GTCATCCATG CCATTCATTG GCGTGGCGAT CGCCCCAGGC GCGACTGCGT 
030311 TCACCAAAAT CTTATGCCTG ACCAGCTCCA GCGCCATCGC TTTGGTTAAC CCACCGAGCG CATGTTTAGC 
030381 GGCTGTGTAG GCGCTGGCAT CCGGCAGCGG CGTATGTTCA TGTACCGACG TAATGTTGAT GATGCGACCG 
030451 CCCTGCCCTT GTTTCACCAT CTGACGAGCC GCAATTTGCG AGCATAAGAA TGCACCATCG ACATCAACGG 
030521 TAAAAATCTT GCGCCACTCA TCAAAAGCCA TATCAAGAAA CGGCGCTTTG GTCATTGCAC CCGCATTATT 
030591 CACCAGCACA TCAATGCGCC CCAGCCGTTG AATGAGTTTC TCCAGCGCCA GTGCCCCTTC TGGTAGATTG 
030661 CCGAGATCCA GCTGCACGAT CTCCGCACGT ACGCCGTGGC TAACTACCTC ACGCGCGGTA TCTTTTGCCC 
030731 CTTCTTCATC TGAGTGCCAG GTAATACCAA TATCAAACCC CTGCTGCGCC AGTAATAACG CGCACTCTTT 
030801 GCCGATCCCC GAATCGGAGG CGGTAATAAT CGCAACCTGT GCCATCGAGT TCTCCACTTA ACGCTGAATA 
030871 AACGTTAAGT ATAGAAGGCG CATATCATCA GCGTTTGTAC CCCCCGCCCA ACGCACCAGT GAGTTGAATG 
030941 GAGGCATCCA GCCACTGCCC TTGCAATAAC AGGCCATTGG CCCGCTCACG CAGCGCGGGG ATTCTGGCTT 
031011 CGCTGACGCG GGAACCAGCA ATGATGCCCG CGTTAAAGCG CGCCTGCGCA AGACCTACCA CACGCAAGGC 
031081 ATCGCGCTCA ATTTGCGCCT GATGCTGGTT TTTCTCCGCC AGTGTCTGAA CCTGACTGGC TGCCCGCGCC 
031151 ACGTCATTCA CCGCTTCAAC CACCGCTTTG TTGTAGCTGG CGATAGACAA GTTGCTTTCG GCTTTTGCGA 
031221 TATCGAGATT GGCGTTAAGA CGACCACTAT CGAAAATGGG TAGCGTCAGG CCTGCCGTAA CGCCCATTTG 
031291 CTGCGCGGAA TGACGGAACA GATCGCTTAA GTGCAACGCA TCCTGTTGCA GGAAGGCCAT CAGGTTGATG 
031361 TCAGGATAAA ATGCCGCTTT TGCCGCATCA ATGGTGCTTA GCGATGACTC AACGTACCAG TGCGCCGCCT 
031431 GCAAATCTGC CCGCCGGGCC AGTAAGGAGT ACCCCAGTTC ATCAGGAAGC TGGCTTGCCA CTTTCGGCAA 
031501 CGCGACCGGT TTAAGCTTCA ATGACTTTGT CTGGTTATTT GTAAGTGCGC TTAACCGTGC CTCAATAATT 
031571 TTCATTTTCC CCGCGACATC GTTGAGCTGC TGCCGGGTTT TGCTGGCATT AATATCGGTT TCCACACCTT 
031641 CAACTGAAGA AGTAATCCCG TTCTGATATA GCTGGCGATC GGTCGCGATA ATGGTGTTCT GCTCTTTTTC 
031711 TATTTGCTGC AAGACCGTGT TTAACGCCGC CTGGGTTTGC CACTCCCAGT ACAGGCGGGC TACGCTGCCA 
031781 GCCAGCAATT GGCGGGTTTG CTCGCGTTCC GCCGCCCGTG CTTTAACCGT ACCCAGGCGG GCAGTAACCT 
031851 CCGCCCGATT CTTTCCCCAG ATATCGAGAT GCCAGCCCGC CGTTAAGCCA AAAGTACCGT TGGTGTACCA 
031921 CGGGCCGGTC GTACCTGCGG CCGGATCGTT CAGAGCAAAC GGCCCCATTA AGCCTTCTGC CGACATTTTT 
031991 TGCCGCTCCA TATCCGCCGA AAAGTCGATC TGCGGACCAT CCTGAGTGGC AACTGCCTTC GCCTGGGCTT 
032061 CAGCTAGCTG AATGCGCTGT TCAGCCACCT GCATATCCGG TGCGTTCTGT AGTGCATTGT TAATTAAGGA 
032131 AGTGAGTTGA TTATCGTGAT ACTCCAGCCA CCATTGGCTG TCTGGCCAAC CATTTTCAGC GCCGTGGGTA 
032201 ATGCGGTGTC AACTTGTGCA GCGGGCGTTT GCTGGCTTAA CGCCTGGCGG GTTTCATGCA TAGGCGCACA 
032271 CCCGGCCAGC ATCAGTAACA GCGGAAAACA GGCGATGGCT GGATAAAAGG AATCACGATT CATGGGGGAA 
032341 TAATCAGGTA AGAAAAGGTG CGCGGAGATT ACCGTGTGTT GCGATATATT TTTTAGTTTC GCGTGGCAAT 
032411 ACATCAGTGG CAATAAAACG ACATATCCAG AAAAATATAC ACTAAGTGAA TGATATCTTC CGATTTATCT 
032481 TAATCGTTTA TGGATAACGG CAAAGGGCTT CGTTTTTTCC TATACTTATT CAGCACTCAC AAATAAAGGA 
032551 ACGCCAATGA AAATTATACT CTGGGCTGTA TTGATTATTT TCCTGATTGG GCTACTGGTG GTGACTGGCG 
032621 TATTTAAGAT GATATTTTAA AATTAATTAA TGTCATCAGG TCCGAAAATA ACGAGAATAT TTCAGTCTCT 
032691 CATCCTGTTG CGCTCCTGTC ATGTGCATTG CTTCATATAA TCACTGGCGC AAGGAGCGCG CAGGGGGCGG 
032761 CCAATCGCCG CCGCCCCCTG CACCCCCGGG CTCTGGCGAA CAAAATCGCC GCTGCGCGGT GCCCTCGGCT 
032831 TATCCCTTAC GGCTACCGGG TCGGGCGCGA GGTAACATCC CTGTAAAACG CGCCCTCAGC CCACATCCAT 
032901 GTGGGCTGCC CCGGCCTTCA GGGAACGCCT CGGCAATTTT GACGCCACCA AACAACCGTG CGGCCTATTG 
032971 ATAAAGAGCT AACACATTGT CAAAAAACAT CACTATGGTT TTTTAGAGTT TCTCGATATC AATTGCCTGA 
033041 ATAGCCCTTG CAATATCAGG GGAATTATTC AACACCCGAA CATGCTGAAA TAATTCCGTT GCTTCATCGT 
033111 ATTCTTTACG CAAATAACTC AACCACTGTT TAATCCGCGC AACGTGATAT AACCCGGTAT CGCCCTGCTT 
033181 TTCCAGACGG GTATATTTTT GCAGCAAAGC AACCACCTCC GGCCACGGCA TTCGCGGTTC GTTATATTTT 
033251 ACCACCCGGC TCAGGTTGGG AATATTGAGC GCCCCGCGAC CAATCATCAC TGCGTCGCAG CCGCTGATCG 
033321 CCATGCATTG TTGCGCGCTC TGCCAGTCCC AGATTTCACC GTTGGCAATC ACCGGAATAT TCAGCCGCTG 
033391 GCGAATATCG CCAATCGCCT GCCAGTCAAT ATGCTCCGCG CGGTAACCCT GCTCTTTCGT CCGCCCATGC 
033461 ACCACCAGCT CCGTAGCGCC AGCCTGTTGA ACCGCATCGG CGATTTCAAA TTTCTTCTCA CCGCTGTCCC 
033531 AGCCCAGACG CACTTTCACG CTGACGGGCA AATGCGCCGG TACAGCTTCA CGCATCGCTT TTGCACCCTG 
033601 GTAGATGAGT TCAGGATCTT TGAGTAACGT CGCCCCGCCG CCGCTACCGT TAACCGTTTT CGACGGGCAG 
033671 CCGCAATTGA GATCCACGCC CCAGGAACCT AACTCCACCG CACGGGCGGC GTTCTCTGCC AGCCATTGTG 
033741 GGAACTGACC TAACAACTGC ACGCGCACCA GCGTACCAGA TGGTGTCCGG CTGGCGTTTT GTAGCTCAGG 
033811 GCAAATGCGA TGAAAGACTT TTACCGGCAG CAGTTGATCC ACCACGCGGA CAAACTCGGT GATGCACAGA 
033881 TCGTAGTCGT TAACTTCGGT CAGCAATTCA CGCACCAGAG AGTCAAGCAC TCCCTCCATC GGTGCCAGTA 
033951 ACACACGCAT ATCATCACCC GCAAAAAAAT GAGGCGCTAT GTTAGCGCCT ATGGTCAGCG GATTAAAGGT 
034021 CTGCAAAGAG GGATTGCTGC AAACTGCAAT CCCTCTCTAT GCTTGATGTA TGCCTGAGTT CGCTGCGCAT 
034091 TGCGTAATGC CGGGGAGCGA AAAAATAAGC GCTGATTTCT TAATGTGATC GGTAGCACGT TTTACGAATT 
034161 AATTGTATGA TGAATCCATC TCATCTGGGG TGTTGATTAT GAGTAAGACA CTGAACATTA TCTGGCAATA 
034231 TTTACGCGCT TTCGTCCTGA TTTATGCCTG CCTGTATGCA GGCATTTTCA TTGCTTCCCT GCTACCGGTA 
034301 ACCATTCCGG GCAGCATCAT CGGGATGCTG ATCCTGTTTG TCCTGCTGGC CTTGCAAATT CTTCCGGCAA 
034371 AATGGGTCAA TCCGGGGTGC TACGTACTGA TTCGCTATAT GGCGCTATTG TTTGTGCCGA TTGGCGTAGG 
034441 CGTCATGCAA TATTTTGATT TGCTCCGCGC ACAGTTTGGC CCGGTAGTGG TTTCCTGTGC AGTCAGTACG 
034511 CTGGTGGTTT TTCTGGTGGT GAGCTGGAGT TCGCAACTGG TACACGGTGA ACGTAAAGTC GTAGGTCAGA 
034581 AAGGATCAGA AGAATGATGG CGAATATCTG GTGGTCATTA CCGCTGACAT TGATTGTCTT TTTTGCCGCC 
034651 CGCAAACTGG CGGCACGGTA TAAGTTTCCC TTGCTTAACC CGTTGCTGGT AGCAATGGTG GTGATCATTC 
034721 CTTTTTTAAT GCTGACTGGC ATCTCTTACG ACAGCTACTT TAAAGGTAGC GAAGTGCTAA ACGATCTGCT 
034791 GCAACCGGCG GTCGTCGCGC TGGCCTATCC TTTATATGAG CAGCTACACC AGATCCGCGC GCGCTGGAAA 
034861 TCGATCATCA CCATCTGTTT TATCGGCAGC GTGGTTGCGA TGGTGACGGG GACTTCCGTG GCATTGTTGA 
034931 TGGGCGCTTC ACCGGAAATC GCCGCGTCAA TCCTGCCGAA ATCAGTCACC ACGCCTATTG CAATGGCGGT 
035001 TGGCGGCAGT ATTGGCGGTA TTCCGGCAAT CAGCGCAGTT TGCGTGATTT TCGTCGGCAT CCTCGGCGCG 
035071 GTATTTGGCC ATACATTGCT TAATGCGATG CGTATTCGTA CCAAAGCTGC GCGCGGTCTG GCAATGGGGA 
035141 CTGCCTCGCA CGCCCTCGGT ACGGCGCGCT GCGCCGAGCT GGATTATCAG GAAGGTGCAT TTAGTTCGCT 
035211 AGCGCTGGTG TTATGCGGGA TAATTACTTC GCTGATCGCA CCGTTCCTTT TCCCGATTAT TCTGGCAGTA 
035281 ATGGGCTAAA ATTTGCGATG CGTCGCGCAT TTTTGATGTA TGTTTCACGC GTTGCATAAT TAATGAGATT 
035351 CAGATCACAT ATAAAGCCAC AACGGGTTCG TAAACTGTTA TCCCATTACA TGATTATGAG GCAACGCCAT 
035421 GCATCCACGT TTTCAAACCG CTTTTGCCCA ACTTGCGGAT AACTTGCAAT CTGCACTGGA ACCTATTCTG 
035491 GCAGACAAGT ACTTCCCCGC TTTGTTGACC GGGGAGCAAG TCTCATCGCT GAAGAGCGCA ACGGGGCTGG 
035561 ACGAAGACGC GCTGGCATTC GCACTACTTC CGCTGGCGGC GGCCTGTGCG CGTACGCCAT TGTCGAATTT 
035631 TAATGTTGGC GCAATTGCGC GCGGTGTGAG CGGAACCTGG TATTTCGGTG CCAATATGGA ATTTATTGGT 
035701 GCGACAATGC AGCAAACCGT TCATGCCGAA CAAAGCGCGA TCAGCCACGC CTGGTTGAGT GGTGAAAAAG 
035771 CGCTTGCAGC CATCACCGTT AACTACACGC CTTGTGGTCA CTGCCGTCAG TTTATGAATG AACTGAACAG 
035841 CGGTCTGGAT CTGCGTATTC ATCTGCCGGG CCGCGAGGCA CACGCGCTGC GTGACTATCT GCCAGATGCC 
035911 TTTGGGCCGA AAGATCTGGA GATTAAAACG CTGCTGATGG ACGAACAGGA TCACGGCTAT GCGCTGACGG 
035981 GTGATGCGCT TTCTCAGGCA GCGATTGCGG CGGCAAACCG TTCGCACATG CCTTACAGTA AGTCGCCAAG 
036051 CGGTGTCGCG CTGGAATGTA AAGACGGTCG TATTTTCAGT GGCAGCTACG CTGAAAACGC CGCATTCAAC 
036121 CCGACTCTGC CACCGTTGCA GGGAGCGTTA ATTCTGTTGA ATCTCAAGGG TTATGATTAC CCGGATATCC 
036191 AGCGCGCGGT TCTGGCAGAA AAAGCCGATG CGCCGTTGAT TCAGTGGGAT GCCACCTCCG CAACGCTGAA 
036261 AGCTCTCGGC TGTCACAGTA TCGACCGAGT GCTTCTCGCT TAAGCCTGGT GCCGGATGCG GCGTGAACGC 
036331 CTTGTCCGGC TTGCCAGCCC TCTCCTGGTG TCGAAATTCC CGGCAAACAG TTTGCCGTTT CTTGCGCAAA 
036401 ACCAGCGGGT AAAGTAGCCT GATGGAAATT TTCCTTAGAT CGAGTCTCCT GCATGTTAAA GCGCGTGTTC 
036471 CTCAGCCTGT TAGTCCTGAT CGGCTTGCTG CTGTTGACTG TGCTCGGCCT CGATCGCTGG ATGAGCTGGA 
036541 AAACCGCGCC TTATATCTAC GACGAATTGC AGGATCTCCC CTACCGCCAG GTCGGTGTGG TGCTCGGAAC 
036611 AGCAAAATAT TATCGTACTG GCGTAATTAA TCAGTATTAT CGCTACCGCA TTCAAGGAGC GATTAATGCC 
036681 TATAACAGCG GTAAGGTAAA TTATCTATTA CTGAGCGGCG ATAACGCATT GCAAAGTTAT AATGAGCCGA 
036751 TGACCATGCG CAAAGATTTA ATCGCTGCTG GTGTCGACCC ATCAGATATT GTTCTCGATT ACGCAGGCTT 
036821 TCGTACGCTG GATTCCATCG TGCGTACACG CAAAGTTTTC GATACTAATG ATTTCATTAT TATCACCCAA 
036891 CGTTTCCACT GTGAGCGAGC ATTATTTATT GCGCTGCATA TGGGGATTCA GGCTCAGTGT TATGCCGTAC 
036961 CGTCACCGAA AGATATGCTG TCAGTACGTA TTCGTGAATT TGCCGCCCGT TTCGGTGCGC TGGCTGACCT 
037031 TTATATTTTT AAACGTGAAC CGCGTTTTTT AGGGCCGCTG GTCCCTATTC CGGCTATGCA CCAGGTACCG 
037101 GAAGATGCGC AGGGGTATCC CGCCGTCACA CCCGAACAGT TACTTGAATT ACAAAAGAAA CAAGGAAAGT 
037171 AGTTATGGAT GTACAGCAGT TTTTTGTCGT TGCCGTTTTT TTCCTTATCC CGATATTTTG TTTCCGCGAA 
037241 GCATGGAAAG GCTGGCGCGC AGGCGCGATT GATAAACGGG TTAAAAATGC ACCGGAACCG GTGTATGTCT 
037311 GGCGAGCAAA AAATCCCGGA CTCTTTTTCG CTTATATGGT GGCATATATC GGCTTCGGAA TTTTATCTAT 
037381 CGGCATGATT GTTTATCTTA TTTTCTATCG TTAATATTCC CCTCTCCAGT TAATTATTGA GAATAATTAT 
037451 TACTTCACCT GATAAGCTGC GGATATCACA TTCCTAACCG CAGCTATTTG TGAATCTTTT CACAGTTTAA 
037521 ATTCCCCCGC ACGCTTAGCC TTAATATCAG TACATTATTA TTTACTAAAC GCTCGCCTTA ATTACCTATA 
037591 GCATTAAGGA AGATCACATG CCGCAACAAA ATTATCTGGA TGAACTCACT CCGGCTTTTA CGTCTTTACT 
037661 GGCGATTAAA GAAGCCTCTC GCTGTTTATT ATGTCACGAC GCTCCCTGTA GTCAGGCTTG CCCGGCACAG 
037731 ACCGATCCGG GGAAATTTAT TCGCTCAATC TACTTTCGTA ATTTTAAAGG CGCTGCCGAG ACAATTCGCG 
037801 AAAATAATGC CCTCGGTGCC GTTTGTGCCA GAGTGTGCCC GACGGAGAAA TTATGCCAAA GCGGTTGTAC 
037871 CCGTGCCGGT GTTGATGCTC CCATTGATAT CGGCCGCTTA CAGCGTTTTG TTACTGATTT TGAACAACAA 
037941 ACCGGAATGG AAATTTATCA GCCCGGTACT AAAACGCTCG GCAAAGTCGC GATTATTGGC GCAGGTCCTG 
038011 CCGGATTGCA GGCCAGTGTG ACACTGACAA ACCAGGGTTA TGACGTCACG ATTTATGAGA AAGAAGCGCA 
038081 CCCCGGTGGC TGGTTGCGTA ACGGTATTCC GCAATTCCGG TTACCGCAAT CAGTGCTGGA TGCAGAGATC 
038151 GCCCGTATTG AAAAAATGGG CGTGACCATT AAGTGCAACA ACGAAGTCGG TAACACACTC ACCCTTGAGC 
038221 AGCTGAAAGC AGAAAACCGC GCGGTACTGG TCACCGTGGG GTTATCAAGC GGTTCCGGGC TACCGCTGTT 
038291 TGAGCATAGT GACGTTGAGA TTGCCGTCGA CTTCTTGCAA CGTGCACGAC AGGCGCAAGG CGATATCAGC 
038361 ATTCCACAAA GCGCATTAAT TATCGGCGGC GGTGATGTCG CGATGGACGT AGCCAGCACG CTGAAAGTTC 
038431 TCGGCTGTCA GGCGGTAACT TGCGTAGCGC GTGAAGAGTT AGATGAGTTT CCGGCAAGCG AAAAAGAGTT 
038501 TACCAGCGCC CGGGAGCTGG GCGTTTCGAT CATCGATGGA TTCACGCCAG TAGCCGTGGA AGGCAATAAA 
038571 GTCACGTTTA AGCATGTACG GTTATCGGGC GAACTGACGA TGGCGGCAGA TAAAATTATT CTCGCCGTCG 
038641 GTCAGCATGC CAGACTAGAT GCCTTTGCGG AGTTAGAGCC GCAGCGTAAC ACCATCAAAA CACAAAATTA 
038711 CCAGACCCGC GACCCGCAAG TCTTTGCTGC TGGCGATATT GTTGAGGGTG ACAAAACCGT GGTCTATGCC 
038781 GTGAAAACCG GGAAAGAAGC CGCCGAGGCG ATTCATCACT ATTTAGAGGG AGCTTGCTCA TGTTAACGAA 
038851 AGATCTTTCG ATTACTTTTT GCGGCGTGAA GTTTCCCAAC CCGTTCTGCC TCTCTTCTTC GCCGGTAGGC 
038921 AACTGCTATG AGATGTGTGC CAAAGCCTAC GACACAGGTT GGGGCGGTGT GGTGTTTAAA ACGATCGGCT 
038991 TTTTTATCGC CAACGAAGTC TCGCCGCGTT TTGATCATCT GGTGAAAGAA GATACCGGTT TTATCGGCTT 
039061 CAAAAATATG GAGCAGATTG CTGAACATCC GTTGGAAGAG AATCTGGCCG CCCTGCGTCG GCTGAAGGAA 
039131 GATTACCCGG ACAAAGTATT GATCGCTTCG ATCATGGGGG AAAATGAGCA GCAATGGGAG GAGCTGGCGC 
039201 GCCTGGTGCA AGAAGCTGGC GCGGATATGA TCGAGTGTAA CTTCTCCTGT CCGCAAATGA CTTCTCATGC 
039271 GATGGGTAGC GATGTCGGGC AAAGCCCGGA GCTGGTAGAA AAATATTGTC GGGCAGTGAA ACGGGGTTCC 
039341 ACGCTGCCAA TGCTGGCGAA GATGACGCCG AATATCGGTG ATATGTGCGA AGTGGCGCTG GCGGCGAAGC 
039411 GCGGCGGCGC AGATGGCATT GCGGCGATTA ACACCGTTAA ATCCATCACC AATATCGATC TTAATCAGAA 
039481 AATCGGTATG CCGATCGTTA ACGGAAAATC GAGTATTTCC GGATATTCCG GTAAAGCGGT AAAACCGATC 
039551 GCCCTGCGCT TCATTCAGCA AATGCGCACC CATCCAGAAC TGCGCGATTT CCCAATCAGC GGTATCGGCG 
039621 GCATTGAAAC CTGGGAGGAT GCGGCTGAGT TTTTATTGCT CGGCGCAGCA ACGTTACAGG TGACCACCGG 
039691 CATCATGCAG TACGGGTATC GGATAGTGGA AGATATGGCA AGCGGGTTGT CGCATTATCT CGCCGATCAG 
039761 GGATTTGATT CGCTGCAGGA GATGGTAGGT CTGGCGAATA ACAATATTGT CCCGGCGGAA GATTTAGACC 
039831 GCAGTTATAT TGTCTATCCC CGTATCAATC TTGATAAATG TGTTGGCTGT GGACGCTGTT ATATTTCCTG 
039901 TTACGACGGC GGTCACCAGG CGATGGAATG GAGCGAGAAA ACCCGCACAC CGCATTGTAA TACCGAGAAA 
039971 TGTGTGGGTT GTCTGCTTTG TGGTCACGTC TGCCCGGTGG GTTGTATTGA GCTCGGGGAA GTGAAGTTTA 
040041 AGAAAGGCGA GAAAGAACAC CCGGTAACGT TGTAAAACCA GAGACGCATC CGGCATTTGG TTCCTGTCGC 
040111 CGGATGCGGC TTGAACGCCT TATCCGGCCT ACAAAACCAT ACAAATCAGT ATGTTGAGCT TATTGTAGGC 
040181 CGGATAAAAC GCGCCAGCGT TGCATCCGGC ATTTGGCTCC TGTTGCCGGA TGCGGCGTGA ACGCCTTATC 
040251 CGGCCTACAA AACCACACAG ATCATGATGT TATGTGCGTT TATGACCGAA TGCGGACCAC ATTCACATCA 
040321 TTTCTTACGC GCGTATTTCA GTGAATCCAG CGCTACGGCG AAGATAATAA TCGCCCCTTT GATGATGTAC 
040391 TGCCAGTATG GGTTTACGCC GATATACGTC AGGCCATAGT TGATGACGGT AAAAATAATT ACCCCGGTCA 
040461 CCACGCCAAT CACCGTCCCC ACACCGCCGC TGAACGATAC ACCGCCTACC ACGCACGCCG CGATAGCATC 
040531 CAGCTCATAC ATAAAGCCGA GGTTGTTGGT GGCAGAGCCG ATACGTCCGG CTTCTAACAT CCCGCCAAAG 
040601 GCATAGAACA CGCCAGACAA CGCGTAGATC ATCAGCAGGT TCAGGCCGAC GTTGACACCA GATACTTTTG 
040671 CCGCTTCCGG GTTACCGCCA ATGGCAAAAA TGTTCTTACC GAAGCGGGTT TTGTTCCACA ACACCCAGAC 
040741 GAACGCCACC GCAATCAACG CGTAGAAGGT GATGTAAGAG AGACGGAAAC TCCCCAGCGC GACAAAGCCC 
040811 TGAGCAAAGG TAGAGAAGCC ACTGTCAAAA CCAGAAATTG GCGACGCCCC GACAAAGTCG TAATAGAGCG 
040881 AGTTGATGCC ATAGACGATG ATCATCGTGC CGAGCGTGGT AATGAACGGC GTCACGTTGA GATAAGCGAT 
040951 AATCAGACCG TTGATCAAAC CGATCACCGC ACCAATGGCA CAGACAATCA GAATAACCAG CGCAATCGGC 
041021 ATCGTCGCCA TTTCCGGGAA CACTTTGTTG GCGTTATCCA TGGACTGCAA TAATGTCGCA GCCACCACTG 
041091 CCGCCAGCCC TACCTGACGA CCAGCAGAAA GATCGGTCCC CTGGGTGACA ATTAACCCTG CCACACCGAG 
041161 CGCGATAATA ATACGCACCG ATGACTGGGT GAGAATATTA CTTAAGTTCA ACAGACTTAA AAATGTTGGG 
041231 TCCTGGAAAA TAATAATCGC CAGCAAAACT AAAAGAACGA CGTAAATACC GCCCTCTTTC AGGTAAGTAA 
041301 GAAAACTTTT CTTATTTAAC GCACTCATGG GAAGCCCCTA ATCTTAAAGG TGCAAAGACG CAAGACGCAG 
041371 AATTTCGTTT TGCGTTGTTG TTTTTGTATC GACAATTCCG GAAACGAGAC CATTGCTCAT GACCAGAATA 
041441 CGGTCTGTTA TCCCTAACAA CTCAGGCATT TCAGAGGAGA TAATAATAAT CCCCTTGCCT TTCTTCGCCA 
041511 GTTCGGCAAT TAACTGATAA ATTTCAAACT TCGCCCCGAC ATCAATACCG CGCGTCGGTT CATCGAGCAT 
041581 TAATATTTCT GGTTGCGTTA GTAGCCAGCG ACCAATAATC ACCTTTTGCT GATTACCACC GGAGAGCGAA 
041651 CCAATTTGCG TCCGATGACC CGGCGTTTTT ACCCGCATCG AATCAATCAC CCACTGGGTA TCGCTTTTCA 
041721 TCCGCGAGTT ATCCAGTAAA CCAACTTTAT TTTTGTAGTT GCGAATATTG GAAATTAACG AGTTAAAACC 
041791 AATATCCAGA TAGGCATAAA TTCCCGTTGA GCGGCGCTCC TCAGTTACCA GTGCAAATCC ATGGTTTATG 
041861 GCTTCGTTGG CATTATGGTT ATTGATCTGT TTGCCGTGCA ACGTTATGGT GCCAGCCGAT TTCTCGCGAA 
041931 TACCAAATAA CGTCTCAACA ATATCGGTAC GTTTCGCCCC CACCAGACCG GCAATACCGA GGATCTCCCC 
042001 TTTATGCAGA TCAAACGAGA CATCGCGAAT CGACGGCTGG CGCAGTGACG TCAGGTTACG TACCTCGAGG 
042071 ATGACTTCGC CCGGTTTGTT TTCTTTGTCA GGGAAACGCT GGTTAAGAGA ACGCCCAACC ATCATGGCGA 
042141 TGATCTTGTC CATCGTCAGT CCTGCCAGCG GTTCGGTGGC GATCCACTGA CCGTCGCGCA ATACGGTAAC 
042211 TTCATCACAT AACTGGAAGA TTTCTTCCAT TTTATGCGAG ATATAAACAA TACCGCAGCC GCGCTCTTTT 
042281 AATTTACGAA TAATAGTGAA CAGATGATTG ACCTCTTTTT CGGTTAACGA AGAAGTCGGT TCATCCATAA 
042351 TCACAATTTT CGCGTTATAG GAAAACGCTT TGGCGATTTC GATCATCTGC ATTTGCGAAA CGGATAATGT 
042421 GCCGACGCGC GCACGCGGAT CGATATCAAT ATCCAGTTCG TCAAAAATCG CTTTGGTTTC GCGGTACATT 
042491 TTGTCCTGAT CGACAAACAT GCCTTTGGTG GGATATCGCC CCAGCCACAT GTTATCCATC ACCGAACGTT 
042561 GTAATACCAG GTTTAACTCC TGGTGTACCA TCGAAATACC ATTTTCCAGG GCTTCTTTTG CAGAATGGAA 
042631 ATCGATCTCT TTACCCTGGA ATAAAATGGT GCCGGAGTCT TTTTGATAAA TACCAAACAG GCATTTTAAT 
042701 AATGTCGATT TTCCTGCACC GTTTTCCCCC ATTAATGCAT GGATAGAATG TGGCCGGACT TTTAAATTAA 
042771 CGTTATCAAG TGCCTTAACA CCAGGAAAGG ACTTGTTGAT ACCGCTCATT TCCAACAAGT ATTCCCCGGA 
042841 GGACGGAGTC GTTGAGCTGA CCATATAATT TTACCTTGTT GGCCATACAA TAAGGGCGCA GTAATAGACT 
042911 GCGCCCAATC AGTCTTATTT CTTGCTGAAT TCAGCCAGGT TGTCTTTATC TACGCCAACA TAAGGTACGC 
042981 GGACCACTTT GTTGTCGATT TTCCAGTTGG TGCCATCAGC CGCACCTTTA CCATCGGCCA GGTTTTTCGC 
043051 CAGATCAAAG GTCGCTTTCG CCTGGTTGTT AGCATCGTTC AGTACGGTGC CCGCCAGTGC ACCGGATTTC 
043121 ACCAGCGCCA GCGCTTCTGG CAGCGCATCG ACGCCAAACA CCGGAATGCT GGACTTGTTG TGTGCTTTCA 
043191 GCGCTTCAAC CGCGCCCATT GCCATCGCAT CGTTGTTGGC GATAACCACT TCGATTTTGT TGGCGTTCGG 
043261 GCCAGACAGC CAGGCGTCCA TCTTATCTTT CGCCTGAGCG GTGTCCCACA TTGCGGTATC TAACTGTAAC 
043331 TGTTCAGTTT TGATGCCTTT ATCGTTCAAT TCTTTAATCA CGTAAGTGGT ACGTGCTTCT GCATCCGGAT 
043401 GGCCCGGTTC ACCTTTCAGC AGTACGAACT GAATCTGACC GTCTTTGTTC AGATCCCAAC CCTGATTCGC 
043471 CGCCCAGTGT TTAGCAATCA AATCGCCTTG AATAATGCCG GACTCTTTGG AGTCAGTGCC AACGTAGTAG 
043541 GCTTTGTCGT AGCTATCCAG CGCCTTACGA GACGGTTCTT TGTTGAAGAA AACCACCGGC ACGTTTTGCC 
043611 CACGCGCTTT CTCAATCACC GTACCCGCAG CTGCCGGGTC AACCAGGTTG ATTGCCAGTG CCTTCACCCC 
043681 TTTCGCCAGC AATACGTCGA TCTGATCGTT CTGCTTGGAC TGGTCATTCT GAGAATCATT CATCAGCAGC 
043751 TGAACATCTG GCGCGGCTTT CGCATCTTGC TCAATAGCCT TGCGCACTAC AGACATAAAG TTATCGTCGT 
043821 ACTTATAGAT TGTTACACCA ATGCGAGTAT CAGCAGCGTG TGCAGCGGCA CCGAATAACA TGCTGGCCAT 
043891 CACAGCAGAC AGGGTTAACA CCTTCTTATT CATGGTATCT CCGGTTTTTC TTATGCAGGG TAGTGCTTGA 
043961 GATAAATGCT CGGCGGGGCA GTAGAGTTAA TGAAGTGTTA CTGAACGCCG AAGCTCACTT TTTAAAATTC 
044031 GTTCTTCCAT GCCCGGTAAC GCTCCAGAAA ACGGCTTTAA TTGTTGTTAT GACGCTGTTA CCTCGGCAAA 
044101 AGTGATTATT CACTGTTACA TACGGGTTAC AACGTTAAAA CGGTGCAATC ATAGCTATCA CATTGTTAAG 
044171 ATACTGTGAA ATCACTCACA GATTGAAAGC GGTTACATCG CCTGATTTGT TGAGTTAGTG ATCGCCGCCG 
044241 CATTCTGGCG TGTTGCGACA GAATGGCGAC GCACTAACGT CGGCATAAAA CAGTGGCTGG CACGAGGATC 
044311 AATATTGCCT GCTGCCCCCT GCAAGGCCAG TTCGGTGGCT AATTTCGCCA TTGAAGCAAT GGGATAACGC 
044381 ACGGTCGTTA ATTGCGGGTC GGTGTAACGG GCGATGGGAA TATCATCGAA ACCGATGATT GAGAGATGTA 
044451 ACGGAATCGC AATGCCATTA TCTTTTAATG CTGTCAGTGC GCCAGCGGCC ATATTGTCGT TATAAGCAAA 
044521 TACAGCGGTA AGTTGTAGAT TGCGCCCCAG CAGTTCAACC ATCGCCGCCT CACCGCCCGG CATGTCCGGC 
044591 GTACCAGCGC CAATCCAGCT TTCCGGCGGA ATAATATCCT GCTCTTTCAA CGCACTCATC CAGCCTGCTT 
044661 TACGCATGGC GTCATCTTCA ATGCCGTGGC TGGAAGAAAG ATAACCAATA CGTTGATGAC CGTTATTCAG 
044731 CAACATGCGC GTCGCCATTC GGGCACCGCT GAGATTATCC AGGCAAACGC AACGATGGGC GTACCCCGGC 
044801 ACAACGCGGT TGATTAACAC CATACCGGGA ATGTTATCCA TAAATTGCGC CAGTTCATCG TCACTCAATG 
044871 CTTTTGAGTG AACAATCAAC GCATTACAAC GCTGGCGAAT TAACACCTCA ATGGCGTGAC GCTCTTTTTC 
044941 CGCTTCATGA TAGCTATTGC CGATTAGCAC GTATTTCTGA TGCTGCTGAG CGACCAGATC CACCGCTTTT 
045011 ACCAGCGCGC CGAAAAACGC ATCAGAAACG TCCATCACCA CCACGCCAAT GGTGTCGCTA ACCTGAGTTG 
045081 CCAGCGCCTG GGCATTGGCG TTTGGCCGAT AATCCAGCTC ACTCACGGCT TTCATTACTG CTTCACGCGT 
045151 GTCGGCACTG ACCAGCGTGC TGTTATTGAG CACCCGGGAA ACCGTTGCCA CAGAGACGCC AGCCTGACGC 
045221 GCTACATCAC GAATGGTGAT CATATTCACT ACCTGTTATG AGATTGCAGT AAATGACTGC TTGCTGGCGG 
045291 CTATTTTGTC AGCACTGAAT ACAGGACTTC GTGAATCGAG TCACAGCAAT GGAAACGGTT ACAGCCGTTT 
045361 TGTTAACGAA TGTGATCCAG ATCGTTATCT TGATGTTTTA GATATTGCCG GTCCGGCAGC ACGCAAAGTT 
045431 AACTGACGCC AGAGCCATTC CACCGGCCCC TGGCGGAAGT AACGCAGCCA GATAACAGAG AAGAGGATAT 
045501 TCGCCAGCCA TACCGGAATA ACAAACGCCA GCAGCTCCAG GCGGTCAAAA TGCATAAACA AACCGAGGTG 
045571 GTAAAAAAGC GTGGTACAAA TCAGCGTTTG CAATAGATAG TTGGTCAGCG CCATCCGTCC GACGCAGGCG 
045641 ATCGCAAGCA CCAGCTTAAA GCGGCTCAAT TGCGGCCAGA AGCCATAAAA CAGCGACGCA TAGCCAATCG 
045711 CCTGAAACGG CGCACTCAGT TCCCGCGGCA TTTGAAGTAA GAAGGCACAC CAGCGATACG CCCAGTCCAG 
045781 CTGCCATTGC AGGGCGATGG CAGGAAGGTT AATGGTCACC CCAATCGCCA CCAGCACAAA ACCAGTACGA 
045851 CGATAGTGAC GTAAGCTGAA CTGCCCTTTC AGCCAGCCGC TGCGCATCAG CGCCGCACCA ATGAGCATCA 
045921 TCCCTGCCAG TTGCCAGCCA TACTGTGCGC CCAGTGCCAG TAAACTGTTG CCAACACCAT CGGCACGATT 
045991 ACTGATCGCT TCAACGCCGC CGTGAAGCTT CCAGTATTTT TCATACAAAA TAGCCGATGC ATCCGGCGTC 
046061 CAGGCGCGGC TGGTCTGGCT GTCGGAAATC AGCCCCAATA ACAGCAAAAC GCCAAGCCCC ACCAGATAAA 
046131 GCATGACGCC TGTATTAAAC AGGCTTTTTA CCGATGGCGC ATCGCGCACC AGCCGCCAGC AGATTAAGCC 
046201 CACCAGCCCG TAAGCCAGCA AAATATCGCC GTCCCAGAAC AATAAACCGT GAATAAAGCC CAACAAGACT 
046271 AACAGCGTTA ACCGCGACTG GATCCAGCGT CTGCCACGGG GCAGCAACAT TTGCAGGCCC GCACCAAACA 
046341 GTAGCGCAAA AAGCGTGAGG AATTTCACCT GGCCGATGAG ATCAAGAAAT GCCCAAGTCC ATGCATCCCG 
046411 CGGCGTAATA GCACCGTACC AGGCGGGATT GAGATAAGCC GCCTTTGGTA GCCCAAAGGC GCTGATGTTT 
046481 AATAGCAGGA TCCCCAGAAT GGCGACGCCG CGAACAAAAT CGAGCGTGAC GTTGCGCTCC ATGGTTCCTG 
046551 CCTTTTAATC AGTTGTGATG ACGCACAGCG CGCAGAAACT CGTGGCGCGT ATTCTGACTG GATTTGA