MG1655
W3110
Search for
Japanese | English
Deletion Report : 4
General information
Deletion 4  
Location (BP) 4,277,073 - 4,359,445   Go Linear View
Length (BP) 82,373
Related strains
     Strains ME5082    ME5083    ME5113    ME5114    ME5115    ME5116    ME5117    ME5118    ME5119    ME5120    ME5121    ME5122    ME5123    ME5124    ME5125     
Primer
Deleted Region 5' Primer R_4276628_C_04E_L  
Sequence GTTTTTTTTCCTGTTGTCGTTAGGTATGACCTACCAGTGACATAATCACCGG  
3' Primer L_4359001_U_04E_R  
Sequence CCGGTGATTATGTCACTGGTAGGTCATACCTAACGACAACAGGAAAAAAAAC  

 Linear View (Whole Mode)
View Location
   4302.073  –  4386.519 (KBP)

Sequences
Nucleotide
Fasta Format

View sequence out neighbor 100bp
-00100                                             GCTAACGGTG TCGGTCTGGT GATTAAAAAC 
-00070 CCGCTTGATG GTCTGCCCGT TGCGCTGGGT GATTTCGCGA CCTTCCCGGT GATTATGTCA CTGGTAGGTC 
000001 TGGCGGTGAT CATCGGCCTG GAAAAACTGA AAGTCCCTGG TGGCATTCTG CTGACCATTA TCGGTATCTC 
000071 AATTGTCGGT TTGATCTTCG ATCCTAACGT CCATTTCTCC GGCGTTTTCG CCATGCCTTC ATTGAGCGAT 
000141 GAAAACGGCA ATTCACTGAT TGGCAGCCTG GACATTATGG GCGCGCTGAA TCCTGTAGTC CTGCCAAGCG 
000211 TTCTGGCGCT GGTGATGACG GCAGTATTTG ATGCCACCGG AACTATCCGT GCCGTCGCCG GCCAGGCGAA 
000281 CCTGCTGGAT AAAGATGGGC AGATCATCGA CGGTGGGAAA GCACTGACCA CTGACTCCAT GAGCAGCGTT 
000351 TTCTCTGGCC TGGTGGGTGC GGCTCCGGCA GCGGTATACA TCGAGTCTGC GGCGGGTACG GCGGCGGGCG 
000421 GTAAAACCGG TTTGACGGCT ATCACCGTTG GCGTGCTGTT CCTCCTGATT CTGTTCCTCT CTCCGCTCTC 
000491 TTACCTCGTT CCGGGGTATG CAACGGCTCC GGCGCTGATG TACGTTGGCC TGCTGATGCT GAGCAACGTG 
000561 GCGAAAATCG ACTTTGCTGA TTTTGTTGAT GCGATGGCGG GTCTGGTTAC GGCTGTATTC ATCGTGCTGA 
000631 CCTGTAACAT CGTAACAGGC ATCATGATCG GCTTCGCGAC TCTGGTGATT GGTCGTCTGG TTTCCGGCGA 
000701 ATGGCGCAAG TTGAACATCG GTACGGTCGT TATCGCCGTG GCGCTGGTGA CCTTCTATGC GGGTGGCTGG 
000771 GCTATCTAAT CTTTCATCGG ATTCTGAAAA CGGGTGGCAA TGGCTGCCCG TTTTTATTTT CTCCGCACAT 
000841 TGTGTGAGCT TTTGCGATAT TCTGAAAAAA ATGAGAATTC AGGCATAACG TCTTTCTCAG ATCATAAAAA 
000911 ACATCGCAAA CAGGGAACGC ATGGAAATCT TCTTCACCAT ACTGATAATG ACCCTCGTGG TCTCGCTGTC 
000981 CGGGGTGGTC ACTCGTGTCA TGCCCTTTCA GATCCCGCTT CCGCTTATGC AAATCGCCAT CGGTGCGCTA 
001051 CTGGCGTGGC CGACGTTTGG TTTGCATGTG GAGTTTGATC CTGAACTCTT TTTAGTCTTG TTTATCCCGC 
001121 CGTTGCTGTT CGCTGATGGC TGGAAAACGC CGACCCGTGA ATTTCTCGAA CATGGTCGAG AGATTTTCGG 
001191 CCTCGCGCTG GCGCTGGTGG TGGTCACCGT GGTCGGCATT GGCTTCCTTA TTTACTGGGT GGTGCCGGGC 
001261 ATTCCGCTGA TCCCTGCCTT TGCGCTGGCG GCGGTGCTTT CTCCGACCGA TGCTGTGGCG CTCTCCGGGA 
001331 TTGTTGGCGA AGGGCGCATC CCGAAAAAAA TCATGGGCAT TTTGCAGGGC GAAGCGTTGA TGAATGACGC 
001401 CTCCGGTCTG GTGTCGTTGA AGTTTGCCGT AGCAGTGGCG ATGGGGACGA TGATCTTCAC CGTCGGCGGT 
001471 GCGACGGTCG AATTTATGAA AGTAGCCATT GGCGGTATTC TCGCCGGTTT TGTGGTGAGC TGGCTGTACG 
001541 GTCGCTCGCT GCGATTCCTC AGCCGCTGGG GCGGTGATGA ACCCGCGACG CAGATCGTCC TGCTGTTCCT 
001611 GCTGCCATTC GCTTCTTATC TGATTGCCGA ACATATTGGC GTTTCCGGCA TCCTCGCTGC GGTTGCCGCC 
001681 GGGATGACCA TCACCCGCTC CGGTGTGATG CGCCGTGCGC CGCTGGCAAT GCGCCTGCGT GCAAACAGCA 
001751 CCTGGGCGAT GCTGGAATTT GTCTTTAACG GCATGGTGTT CCTGCTGTTA GGTCTGCAGC TGCCGGGTAT 
001821 TCTGGAGACG TCGCTGATGG CAGCAGAAAT CGACCCTAAC GTCGAAATCT GGATGCTGTT TACCAATATT 
001891 ATTCTGATAT ATGCGGCGCT GATGCTGGTC CGTTTCGGCT GGCTGTGGAC GATGAAAAAG TTCAGCAACC 
001961 GCTTCCTGAA GAAGAAGCCG ATGGAGTTTG GTTCGTGGAC CACACGAGAA ATCCTGATCG CGTCTTTCGC 
002031 CGGGGTGCGT GGGGCGATCA CTCTGGCCGG TGTGCTCTCT ATCCCGCTGC TCTTGCCGGA TGGTAACGTC 
002101 TTCCCGGCGC GCTATGAGCT GGTGTTCCTG GCGGCTGGCG TCATTCTCTT CTCGCTGTTT GTCGGCGTGG 
002171 TGATGTTGCC TATTCTGCTA CAACACATTG AAGTCGCGGA TCATTCGCAA CAATTGAAAG AGGAACGTAT 
002241 TGCGCGAGCG GCAACGGCAG AAGTGGCGAT TGTGGCGATC CAGAAAATGG AGGAGCGTCT GGCGGCGGAT 
002311 ACCGAAGAGA ATATCGATAA CCAGCTGCTT ACGGAGGTCA GTTCTCGCGT CATTGGTAAC CTGCGTCGTC 
002381 GCGCCGATGG ACGTAACGAC GTTGAAAGTT CCGTGCAGGA AGAGAACCTT GAGCGTCGCT TCCGTCTGGC 
002451 GGCATTGCGT TCTGAACGTG CTGAACTTTA CCACCTGCGC GCCACACGGG AGATCAGCAA CGAAACGCTG 
002521 CAAAAATTAC TGCACGATCT CGATTTGCTT GAAGCGTTGC TAATTGAGGA AAATCAGTAA GCCGAAAGCG 
002591 ACGTAACCAG GCCCGAGGTA ATCTGAAAAA GGTGCAATCT TTTGCACCTT TAACAGGTTA GCTCGGGCTA 
002661 ACATTCATGA TTCTAAAACA AATAAATTAT CTCTCTTTTA AAGTCAATTC ATTGGCTGTT CTTCGACTTA 
002731 ACCTCAATCT GCATCTTGCA TAATATCTGC AGTAATCTTC ATAGCGACTG CATGAAGATT ATCCTCAGTT 
002801 TGTGACATGC CAGTATGAGT GGCACAATCT TCTTCAAAGA ATTTCTGTAG TGTTACCAGG ATATCACTAT 
002871 TAATGGAGAT ATTTTCCTCA CCACGGAGAA TGGTAATACC CATTCCCTGG ACGCTAGCCT CATCGAAATT 
002941 AACACGATAG AGACGGATAT TAAACATCCA GGCTTTTGTT AAAACAGAAC AGTTGAAATG GCAATTGCTT 
003011 AAATTGGCAT TATTAAAATT AACATTAGCC ATATTAGAGT CGGTACATAT AACCATTTCG AGGAACGTAT 
003081 TTGTTAACCG CGTAAAAAAG AGTTTGCTAT CAATTAAGTT TATATTCTGG AGGGTTGCTT TATTCAGGTT 
003151 GACACGAGAC AGATCAGCAT GTTCAAAGTT AATTAAATCA AGTTTAGAGA AGCTAAGGTC GGCTCTAAAT 
003221 AAATTAATAT ATGGCGCTAT TACTTTATAA AGATTTACCT CAGCCATGTA TGCCATATAA AAATTTGAAT 
003291 AATCAAGGAA GGTATTTTTA ATATTGGCTC TATTCATTGT TGCATTGTAG AATTGAACAT GCATAGCGGA 
003361 ACATGAATTT AGAGTTCCGT CAGTCATTTT TATCTGAGCG AAATTTGAGT CATCGAGAAT ACAATTATCA 
003431 AAAAGTATTT TTTCCATTAT GGCGAAATTA AAATTCGTTT TATACATATT ACAGTCCTGA AAAATAGCGT 
003501 TTTGTAGTCT GCAACCTGCA AAATTCGAAT TGGATAAATC TTCATCTTTA ATCACGATAC CTTTCAGGCT 
003571 AAGGTGTGAA AAATCGTAAC CACCATTTAC TGTCTGTGGG ATTTCGATAG TATTATTATG GACGGTGACA 
003641 TTATTTATAA AATATACCAC CTTAATTGAC ACTTCCTTAT CTTTATTAAG GTAAACTCTT CTCGTAATTC 
003711 TATCGTCACA TTTATTATTT GCATGTGAAG CTATATCTAT AAAATATTTA TGTATTTTCC TGTCCGTTTC 
003781 TTTCGTGATT TTTCCTGATG GTAAACTATC ATAAATTCTT TTCATTTTCT GAATCAAGCC TATCACTTTT 
003851 TCATGATCAT CCATTTTGAA AAGAGAGAGG GCTTTATTGT CAATTAACGT GTTTTTATGA TGTTTGCTGT 
003921 AATTATCTGA TTTTGTTTTC TTTGTATGTG ATGGACTTGT GACAGAGTGG TTATCGTTAA TCAGGCAAAG 
003991 AGGGAAAAAC ATATTATTTA AACCATTATA GCGCATAAAA TATCCTTATA ATTAACAAGA AAGAAAAGGC 
004061 ATATTCTCTG CATTATCATT TTCTACGACT GTCAAAAATC GCTCATTTTT TAATGAGTTT ATTTGTTTAA 
004131 TATTATGGGA AAAGGTGATG CATTTGGGAG AGGAAGAGTA TTCCCCGGTC AGACGACCGG GGAAGGGGAG 
004201 AGATTAATGC GCGCGGCCTT GCTCAACGCC AAAGCCGGTC TGGGAGCGGA TAAACTGCGC GCGGAACAGT 
004271 TCACGCTCAC GCGCGCCTTC CGCTGAGTTA TCGGTTGCCG AGAAGAACCA GATGCCGAGG AATGCCACGG 
004341 TGATAGAGAA CAGCGCCGGG TATTCATACG GGAAGATGGC TTTTTCGTGA CCAAGGATCT GTACCCAAAT 
004411 CGTCGGGCCG AGGATCATCA GTACTACTGC GGTAATCAGC CCCAGCCAGC CACCCATCAT CGCGCCACGC 
004481 GTGGTCAGTT TCGACCAGTA CATAGAAAGC AGAATGATCG GGAAGTTACA GCTCGCCGCG ATGGCAAACG 
004551 CCAGCCCCAC CATAAAGGCG ATGTTCTGAT TCTCAAACAG CACGCCGAGG ATAATCGCAA TCACGCCGAG 
004621 GATCAGTACG GTGATTTTTG ATACCCGCAG CTCTTCACGT TCGGTCGCGC CTTTTTTGAA GACGTTAGCG 
004691 TACAAGTCAT GCGAAACCGC GGATGCGCCC GCCAGCGTCA GACCCGCAAC CACCGCGAGG ATAGTGGCGA 
004761 AAGCAACCGC TGAAATAAAA CCGAGGAACA GGTTGCCGCC CACTGCATTC GCCAGGTGAA CGGCCGCCAT 
004831 GTTGTTACCA CCAATCAGAT GGCCCGCCGC GTCTTTATAT TCCGGATTCG CACCAACCAG CATGATCGCG 
004901 CCGAAGCCGA TAATAAAGGT CAGAATATAG AAGTAGCCCA TAAACCCGGT GGCGTAGAAC ACGCTCTTAC 
004971 GTGCTTCGCG GGCATCGCTG ACTGTAAAGA AGCGCATCAG AATGTGCGGC AAGCCCGCCG TACCAAACAT 
005041 CAGTCCCAGA CCCAGAGAGA GCGCGGAGAT CGGATCTTTC ACCAGCCCGC CCGGCTTCAT GATGTCGACA 
005111 CCTTTCGGGT GTACCGCCAT CGCTTCACTG AACAGATTGT TGAAGCTAAA GCCGACGTGT TTCATCACCA 
005181 TAAAGGCCAT AAAGCTGGCA CCGAACAGCA ACAGCACGGC TTTGATAATT TGCACCCAGG TGGTCGCCAG 
005251 CATGCCGCCG AACAGGACGT ACATCATCAT CAGCACGCCG ACCAGCACCA CCGCAATGTG ATAGTTAAGG 
005321 CCAAACAGCA GCTCGATCAG TTTACCTGCG CCCACCATCT GGGCGATAAG GTAAAGCGCC ACCACCACCA 
005391 GAGAACCACA GGCCGAAAGA ATACGAATCG GCCCTTGTTT CAGACGGTAA GAGGCCACAT CGGCAAAGGT 
005461 GTAGCGCCCC AGGTTACGCA GACGTTCGGC AATCAGGAAC AAAATGATCG GCCAGCCCAC CAGGAAGCCC 
005531 AGCGAGTAAA TTAAGCCGTC ATAGCCGGAG GTAAACACCA GCGCGGAGAT CCCCAAGAAT GAGGCGGCGG 
005601 ACATATAGTC CCCGGCAATC GCCAGCCCGT TCTGGAAGCC AGTGATATTG CCGCCTGCGG TGTAGTAGTC 
005671 GCTACGAGAA CGTACGCGTT TTGATGCCCA GTAGGTAATG CCGAGCGTAA ACACGACGAA AATCAGGAAC 
005741 ATAATAATCG CCTGCCAGTT CGTTGGCTGG CGCTCTACGG CCCCGCTAAT AGCATCCGCG GCGTTAGCTG 
005811 CGAAAGGGAG TGTGGCGGCA AGCGCCGTCA GAACTCTTTT CATGATGCTT GTACCTCATG CAGGACTTCA 
005881 TTATTAAGAC GGTCGAATTC GCCGTTCGCC CGCCAGATGT AGATACCGGT GAGAACAAAG GAGATCACAA 
005951 TCACTCCAAC ACCAATTGGA ATACCGCGTG TGACGCTGGT GTTCGGATTC AGCGGCGTGC CCAGCCAGCC 
006021 GGGCGCGAAG GCGATCAGTA AAATAAAGCC GATATAAACT GCCAGCATAA TAATCGACAG GATGGTGGCA 
006091 AACCGTTGCC GTTTTTCGAC TAACTCCCTG AAATGCGCAT TGTCTTCTAT CCGCTGATAA ATAGTGCCAT 
006161 TCATCACAGA TTCTCCAGAG GTAATGTAGG GATTGTTTTA ATTCCCGCTC CCTTATGGGA GAAGGTTAAC 
006231 GCTCGGGTAA CCCTTGCCGA ATGTAGGCCG GATAAGGCGT TTACGCCGCA TCCGGCAATC AATGCCTGAT 
006301 GCGACGCTGT CGCGTCTTAT CAGGCCTACA AACCGTTACC GACTCGCATC GGGCAATTGT GGGTTACGAT 
006371 GGCATCGCGA TAGCCTGCTT CTCTTCAAGC AGCTTCTCGA CTACGCCAGG ATCGGCAAGC GTCGAGGTAT 
006441 CGCCCAGGTT GCTGGTATCG CCCGCCGCAA TTTTGCGCAG AATACGGCGC ATAATTTTGC CGGAGCGGGT 
006511 TTTAGGCAGG GAGTCGGTCC AGTGCAGCAC GTCTGGCGTC GCCAGCGGGC CAATCTCTTT ACGCACCCAG 
006581 TTGCGGACTT CTGCGTACAG TTCTGGTGAC GGTTCCTCCC CGTGATTAAG CGTGACGTAG GCGTAGATCG 
006651 CCTGACCTTT AATATTGTGC GGAATACCTA CTACGGCGGC TTCGGCAATC TTCGGATGCG CCACCAGCGC 
006721 CGACTCAATC TCTGCCGTCC CCAGACGGTG ACCGGAGACG TTCAGCACGT CGTCCACACG CCCGGTTATC 
006791 CAGTAATAGC CATCTTCATC GCGACGCGCG CCGTCGCCGC TGAAATACAT ATTTTTGAAG GTGGAGAAGT 
006861 AGGTCTGTTC AAAACGTTCG TGATCGCCAA ACAGCGTACG CGCCTGACCC GGCCAGGAGT CGGTGATTAC 
006931 CAGGCTACCT TCGGTGGCCC CCTCCAGCGG GTTACCTTCG TTATCGACCA GCGCCGGTTG CACGCCGAAG 
007001 AACGGACGTG TTGCCGAACC GGCTTTCAGC TCGGTAGCGC CAGGCAGCGG GGTGATCATG AAACCGCCGG 
007071 TTTCGGTCTG CCACCAGGTA TCGACCACCG GACATTTCTC GTTGCCGATT TTTTTCCAGT ACCACTCCCA 
007141 CGCTTCCGGG TTAATTGGCT CGCCCACGGA ACCGAGAATG CGCAGCGACG AACGGTCGGT GCCTTCGATC 
007211 GCTTTATCGC CTTCCGCCAT CAGCGCGCGG ATCGCCGTGG GTGCGGTATA GAGAATATTG ACCTGATGCT 
007281 TGTCCACCAC CTGCGCCATA CGGGCAGGCG TCGGCCAGTT GGGTACGCCT TCAAACATCA GCGTGGTCGC 
007351 ACCGCAGGCC AGCGGGCCGT ACAGCAAGTA ACTGTGTCCG GTCACCCAGC CCACATCGGC GGTGCACCAG 
007421 TAGATATCAC CCGGATGATA ATCAAAGACA TATTTAAAGG TCAGCGCCGC GTACACCAGA TAACCGCCGG 
007491 TAGTATGCAG CACACCTTTT GGCTTACCGG TAGAACCGGA GGTGTAGAGA ATAAACAGCG GATCTTCGGC 
007561 GTTCATCTCT TCCGCCTGGT GCTGATCGCT CGCTTGCTCA ACCAGGTCGT GCCACCACAG GTCGCGCCCT 
007631 TCCTGCCAGT CAATTTTCCC GCCAGTACGC TTCAGTACCA CCACATGCTC TACGCTGGTG ACGTTCGGGT 
007701 TTTTCAGCGC GTCATCAACG TTTTTCTTCA GCGGAATACT GCGCCCGGCA CGCACACCTT CGTCGGAAGT 
007771 GATCACCAGT CGTGAGTTGG AATCAATAAT GCGCCCGGCA ACGGCTTCCG GCGAGAAGCC GCCGAAAATC 
007841 ACCGAATGCA CCGCGCCAAT GCGGGCGCAG GCCAGCATCG CAACCGCGGC TTCCGGCACC ATCGGCATAT 
007911 AAATCGCCAC CACATCACCT TTTTTAATGC CCAGCTCGAG CAGGGTATTG GCGAAGCGGC AGACGTCGCG 
007981 GTGCAGCTCT TTATAGCTGA TATGTTTGCT CTGGCTGGCG TCGTCGCCTT CCCAGATGAT GGCGGTACGA 
008051 TCGCCGTTTT CTTGCAGATG GCGGTCAAGG CAGTTTGCCG CCAGATTCAG CGTGCCGTCC TCGTACCATT 
008121 TAATGGACAC ATTACCGGGG GCAAAGGAGG TGTTTTTCAC CTTCTGGTAA GGTTTGATCC AGTCAAGAAT 
008191 TTTTCCCTGT TCGCCCCAGA AGGTATCAGG TACGTTAATA GATTGTTGAT ACATCGCCTC GTACTGCTGA 
008261 GGGTTTATCA GGCAACGGTC TGCGATGTTG GCAGGAATGG TGTGTTTGTG AATTTGGCTC ATGCTTTTGT 
008331 TCTCCTTGTA GGATGTTAAT AATATGTGGC ATAAGCGTTA AATGTAGGGG TATTGGCAGT TTTGTTTAGT 
008401 ATTTGGGCGA CAGATCACGC AAAAGTAGAA TTGTGCAAAT AAACGGCAGG GTAATTTTTG AAGGTCAGCA 
008471 ACAAAAGTTG ATTAATTCTT TGAGGAACAT GCAGTTATGC ATGCTGTTGA AAAAGAGGAA GATACTGACT 
008541 AACTCTAAAG TGGTATTTTA CATGCACTTA CAATTGATTA AAGACAACAT TCACAGTGTG GTTATTTGTT 
008611 ACACATAGGG GCGAGCAATG TCATGACAGT GTAGGTGCGG TTACTGTCGT GAAAAACAAT AAAAACCGCC 
008681 ATTGCAACAA TGGCGCAATT CGGATGAAGC CCCTATGACA AGGATAAAAA TAAACGCACG CCGTATCTTC 
008751 AGCTTATTGA TTCCTTTTTT CTTTTTCACT TCTGTTCACG CTGAACAAAC GGCTGCTCCC GCAAAACCTG 
008821 TAACTGTGGA AGCGAAGAAT GAAACCTTTG CCCCGCAGCA TCCCGATCAA TATCTCTCCT GGAAAGCCAC 
008891 CTCGGAACAG TCAGAGCGTG TTGACGCCCT GGCGGAAGAT CCACGGCTGG TGATCCTGTG GGCGGGGTAT 
008961 CCCTTCTCGC GCGATTACAA CAAGCCGCGT GGACATGCTT TTGCTGTGAC CGATGTGCGT GAAACCCTGC 
009031 GTACCGGTGC GCCGAAAAAC GCTGAAGATG GTCCGCTACC GATGGCATGC TGGAGTTGTA AAAGCCCGGA 
009101 TGTGGCGCGT CTGATCCAGA AAGACGGCGA AGATGGCTAC TTCCACGGTA AATGGGCGCG CGGCGGTCCG 
009171 GAAATCGTCA ACAACTTAGG TTGTGCCGAT TGCCATAACA CCGCCTCTCC AGAGTTCGCC AAAGGCAAAC 
009241 CGGAGTTAAC CCTTTCCCGT CCGTATGCGG CTCGCGCGAT GGAAGCCATT GGTAAACCTT TTGAGAAAGC 
009311 CGGACGTTTC GACCAGCAAT CGATGGTTTG CGGTCAGTGC CATGTGGAGT ATTACTTCGA CGGCAAAAAC 
009381 AAAGCGGTTA AATTCCCGTG GGATGACGGC ATGAAAGTCG AAAATATGGA GCAGTATTAC GACAAAATTG 
009451 CCTTCTCTGA CTGGACTAAC TCCCTGTCGA AAACGCCAAT GCTGAAAGCG CAGCACCCGG AATATGAAAC 
009521 CTGGACAGCG GGCATTCACG GTAAAAACAA CGTGACCTGT ATCGACTGCC ATATGCCAAA AGTGCAGAAC 
009591 GCCGAAGGCA AACTCTACAC CGACCATAAA ATTGGTAATC CGTTTGATAA CTTCGCCCAG ACTTGTGCGA 
009661 ACTGCCATAC CCAGGACAAA GCTGCCTTGC AAAAAGTGGT CGCGGAACGT AAGCAGTCGA TTAACGACCT 
009731 GAAAATCAAG GTTGAAGATC AACTGGTTCA CGCTCACTTC GAAGCGAAAG CAGCGCTGGA TGCAGGCGCG 
009801 ACGGAAGCTG AAATGAAGCC AATTCAGGAC GATATCCGTC ATGCCCAGTG GCGCTGGGAT CTGGCGATCG 
009871 CTTCCCACGG CATTCATATG CACGCACCGG AAGAAGGTTT ACGGATGCTC GGTACGGCGA TGGATAAAGC 
009941 GGCGGATGCA CGCACCAAAC TGGCGCGCCT GCTGGCGACC AAAGGCATCA CCCATGAAAT CCAGATCCCG 
010011 GATATCTCAA CCAAAGAGAA AGCCCAGCAG GCCATTGGCC TGAACATGGA ACAAATCAAG GCCGAGAAGC 
010081 AGGACTTCAT CAAAACGGTG ATCCCGCAGT GGGAAGAACA GGCACGTAAA AACGGTCTGT TAAGCCAATA 
010151 ACCCCGTTCC GCCTCGCAAG GGGCGGAAAA CACAATGGAG TGAATATGAG CGTATTACGT TCGTTATTAA 
010221 CTGCCGGGGT GCTGGCGTCG GGCCTGTTGT GGAGCCTGAA CGGAATTACC GCTACCCCTG CGGCGCAGGC 
010291 ATCTGATGAT CGCTACGAAG TTACCCAGCA GCGTAACCCG GATGCCGCCT GTCTGGACTG TCATAAACCA 
010361 GATACCGAAG GTATGCATGG AAAACATGCT TCCGTTATCA ACCCGAATAA CAAACTGCCG GTCACCTGCA 
010431 CCAACTGTCA CGGCCAGCCA TCACCGCAAC ACCGCGAAGG GGTGAAAGAT GTGATGCGCT TTAACGAGCC 
010501 GATGTACAAG GTTGGAGAGC AGAACAGCGT CTGTATGTCC TGTCATCTGC CGGAACAGTT GCAAAAAGCG 
010571 TTCTGGCCGC ACGATGTCCA CGTAACCAAA GTGGCGTGCG CCAGCTGCCA TTCCCTGCAT CCACAGCAAG 
010641 ATACGATGCA GACGTTAAGT GACAAAGGAC GGATTAAGAT TTGCGTCGAT TGCCACAGCG ATCAGCGCAC 
010711 CAATCCGAAC TTTAACCCGG CGTCTGTTCC GTTGCTTAAG GAGCAGCCAT GACCTGGTCT CGTCGCCAGT 
010781 TTCTCACCGG CGTCGGCGTG CTGGCAGCCG TCAGCGGCAC CGCAGGGCGC GTGGTGGCGA AAACGTTGAA 
010851 TATCAATGGG GTGCGTTACG GCATGGTGCA TGACGAGTCG TTATGCATCG GCTGTACCGC CTGTATGGAT 
010921 GCTTGTCGGG AAGTGAACAA GGTGCCGGAA GGCGTCTCGC GCCTGACGAT TATTCGTAGC GAGCCGCAGG 
010991 GCGAATTTCC TGATGTGAAA TATCGCTTCT TCCGTAAGTC TTGCCAGCAC TGCGATCATG CGCCGTGCGT 
011061 TGACGTCTGC CCGACCGGTG CGTCTTTTCG CGATGCTGCC AGTGGGATTG TCGATGTTAA TCCGGATCTC 
011131 TGCGTCGGTT GTCAGTACTG CATCGCCGCC TGTCCGTACC GCGTGCGCTT TATCCATCCG GTCACGAAGA 
011201 CGGCGGACAA ATGCGATTTC TGCCGTAAGA CCAATTTGCA GGCCGGTAAG TTGCCCGCGT GCGTTGAAGC 
011271 TTGCCCGACC AAGGCGCTGA CGTTTGGCAA TCTGGACGAT CCCAACAGTG AGATTTCGCA ACTGCTGCGC 
011341 CAGAAGCCCA CTTACCGCTA CAAGCTGGCG CTGGGAACCA AACCGAAGCT GTACCGCGTA CCGTTTAAAT 
011411 ACGGGGAGGT GAGCCAATGA CGCAGACTTC CGCATTTCAT TTTGAATCGC TGGTGTGGGA CTGGCCGATT 
011481 GCCATCTACC TGTTTTTGAT TGGTATTTCT GCTGGTCTGG TGACGCTGGC CGTGCTGTTA CGTCGCTTCT 
011551 ACCCGCAGGC GGGCGGTGCA GACAGTACGT TGCTGCGCAC CACGCTGATT GTCGGGCCGG GCGCGGTGAT 
011621 CCTCGGTCTG TTGATCCTCG TCTTCCACCT GACAAGACCG TGGACCTTCT GGAAGCTGAT GTTCCACTAC 
011691 AGTTTTACCT CGGTGATGTC GATGGGGGTG ATGCTGTTTC AGCTCTACAT GGTGGTGCTG GTGCTGTGGC 
011761 TGGCGAAAAT CTTTGAACAT GATTTGCTTG CCCTGCAACA ACGCTGGTTG CCGAAGCTGG GGATCGTGCA 
011831 AAAGGTTCTG AGCCTGCTGA CGCCCGTTCA TCGCGGACTG GAAACATTGA TGCTGGTGCT GGCGGTGTTG 
011901 TTGGGGGCTT ATACCGGCTT TCTGCTGTCG GCGCTGAAAT CGTATCCGTT CCTCAATAAC CCGATCCTGC 
011971 CGGTGCTGTT CCTCTTCTCC GGCATCTCGT CCGGTGCGGC GGTGGCGCTG ATCGCCATGG CGATACGCCA 
012041 ACGCAGTAAC CCGCATTCCA CGGAAGCGCA GTTTGTACAC CGTATGGAAA TCCCTGTGGT ATGGGGTGAA 
012111 ATCTTCCTGC TGGTGGCGTT TTTTGTCGGT CTGGCGCTGG GCGATGACGG TAAAGTTCGT GCGCTGGTGG 
012181 CGGCATTAGG TGGCGGTTTC TGGACGTGGT GGTTCTGGCT TGGTGTCGCC GGGCTGGGGC TGATTGTGCC 
012251 AATGCTGCTC AAACCGTGGG TCAATCGCAG TTCCGGCATT CCTGCCGTGC TGGCGGCGTG TGGGGCCAGT 
012321 CTGGTCGGCG TGTTGATGCT GCGCTTTTTC ATTCTCTACG CCGGACAGTT GACGGTGGCG TAAGCCAGAA 
012391 AAGAGGTGGT TTCTGGACGT ATTCCTTCCT GAAGTCGGTT TTCTGGCGTT GTTGTTAAGT CTCGGGGTCA 
012461 ACGTGTTGAC CCCGTTGACG GCCTTCGCGG GAGTGCGGTT GCGCTGGCCT GCCATGATGC GACTCACTTG 
012531 CATCGGCATT CTGGCGCAGT TCGCGCTCCT GCTGCTCGCC TTTGGCGTAC TGACGTATTG TTTTCTCATC 
012601 AGCGATTTCT CGGTCATTTA TGTCGCGCAA CATAGCTATA GCCTGCTGTC GTGGGAACTC AAGCTGGCAG 
012671 CGGTGTGGGG CGGCCATGAA GGTTCGCTGC TGCTTTGGGT GCTGCTGCTT TCCGCCTGGA GCGCGCTGTT 
012741 TGCCTGGCAT TATCGGCAGC AAACCGATCC GCTATTTCCG CTGACGTTAG CCGTTTTATC TCTCATGCTC 
012811 GCCGCACTGC TACTGTTTGT GGTGCTGTGG TCCGATCCCT TCGTGCGGAT ATTTCCACCA GCAATCGAAG 
012881 GCCGCGATCT CAATCCGATG CTGCAACATC CCGGTCTTAT CTTTCATCCA CCGCTGCTTT ACCTTGGCTA 
012951 TGGCGGTTTG ATGGTAGCGG CGAGCGTGGC GCTGGCGAGT CTACTGCGCG GCGAGTTTGA TGGTGCCTGC 
013021 GCCCGAATTT GCTGGCGCTG GGCGTTACCT GGCTGGAGTG CATTAACGGC GGGGATCATC CTCGGTTCCT 
013091 GGTGGGCCTA CTGCGAACTC GGCTGGGGCG GCTGGTGGTT CTGGGATCCG GTGGAAAACG CCTCTTTATT 
013161 ACCCTGGCTT TCTGCCACTG CGCTGCTGCA CAGTTTGTCC CTGACACGCC AGCGGGGGAT TTTTTGCCAC 
013231 TGGTCGCTGT TGCTGGCGAT AGTTACTCTG ATGCTGTCGC TGCTGGGCAC CTTAATTGTC CGTTCTGGCA 
013301 TTCTGGTTTC GGTTCATGCG TTCGCGCTGG ATAACGTCCG CGCCGTGCCG TTGTTCAGCC TGTTTGCACT 
013371 GATTAGCCTT GCGTCTCTGG CTCTGTATGG CTGGCGAGCG CGGGACGGTG GCCCGGCGGT GCATTTTTCG 
013441 GGGTTATCGC GGGAAATGTT AATCCTCGCT ACGCTGTTGC TGTTTTGCGC AGTGCTACTG ATCGTGCTGG 
013511 TGGGAACGCT TTATCCGATG ATTTACGGCC TGCTGGGCTG GGGACGCCTC TCCGTTGGCG CGCCGTATTT 
013581 TAACCGCGCG ACGTTACCGT TTGGTCTGTT GATGCTGGTG GTGATTGTGC TGGCGACGTT TGTCTCTGGC 
013651 AAACGCGTGC AGCTTCCGGC GCTGGTAGCT CATGCGGGCG TGCTGTTATT TGCCGCTGGG GTCGTGGTCT 
013721 CCAGCGTCAG CCGTCAGGAG ATCAGCCTGA ATTTACAGCC GGGTCAGCAG GTGACGCTGG CAGGATACAC 
013791 CTTCCGTTTT GAGTGCCTCG ATCTACAAGC CAAAGGCAAT TACACCAGCG AAAAAGCGAT AGTGGCACTG 
013861 TTTGACCATC AGCAACGCAT TGGTGAACTG ACGCCGGAGC GGCGTTTTTA TGAAGCACGC CGTCAACAAA 
013931 TGATGGAACC GTCAATTCGC TGGAACGGCA TCCATGACTG GTATGCGGTC ATGGGGGAGA AAACTGGGCC 
014001 GGATCGTTAC GCTTTTCGTT TGTATGTACA AAGCGGTGTG CGCTGGATCT GGGGGGGAGG ATTGTTGATG 
014071 ATTGCGGGCG CATTGTTAAG CGGATGGCGG GGGAAGAAGC GCGATGAATA AAGGGCTTCT CACGCTACTG 
014141 CTGTTATTTA CCTGTTTTGC GCACGCTCAG GTCGTAGACA CCTGGCAATT CGCCAATCCG CAACAACAGC 
014211 AACAGGCGTT AAATATTGCC AGCCAGTTAC GTTGTCCGCA GTGCCAGAAT CAAAACTTAC TGGAATCCAA 
014281 CGCGCCGGTG GCTGTCAGTA TGCGCCATCA GGTTTACAGC ATGGTGGCGG AGGGGAAGAA CGAAGTCGAA 
014351 ATCATTGGCT GGATGACCGA ACGCTACGGA GATTTTGTTC GCTATAACCC ACCGTTAACG GGTCAGACGC 
014421 TGGTGTTATG GGCGCTGCCA GTGGTGTTGT TACTGCTGAT GGCACTGATC CTCTGGCGAG TGAGGGCGAA 
014491 GCGATGAAAC AGCCCAAAAT ACCGGTGAAA ATGCTGACAA CACTCACGAT ATTGATGGTA TTTCTCTGTG 
014561 TCGGCAGTTA TCTGTTAAGC CCAAAATGGC AGGCGGTACG TGCGGAGTAT CAGCGTCAGC GCGATCCGCT 
014631 ACATCAGTTT GCCAGCCAGC AAACCCCGGA AGCGCAGCTT CAGGCATTGC AGGATAAAAT CCGCGCTAAT 
014701 CCACAAAACA GCGAACAGTG GGCGTTACTG GGCGAGTACT ATCTGTGGCA AAACGATTAC AGCAATTCGT 
014771 TGCTGGCGTA CCGTCAGGCG TTGCAACTAC GTGGTGAGAA CGCTGAACTG TATGCGGCGC TGGCGACGGT 
014841 GCTTTATTAC CAGGCCAGCC AGCATATGAC CGCCCAGACT CGCGCAATGA TCGACAAAGC CCTCGCGCTG 
014911 GACAGTAATG AAATCACCGC CCTGATGCTG CTGGCTTCCG ATGCGTTTAT GCAGGCGAAC TACGCGCAAG 
014981 CCATCGAACT ATGGCAAAAA GTGATGGATC TCAACTCACC GCGAGTTAAC CGAACACAGC TGGTTGAGTC 
015051 GATTAATATG GCGAAATTGT TGCAGCGGAG ATTGGATTAA TCATCTGGTG ATGAAGATTA TGTCATTGAG 
015121 CTGCATAAAA AATAATCGAA TGAACATATG CCAAAAATAA TCACTAATCA GTATTATTGC AGATTAAACA 
015191 AATAAAAATC TTTCCATAAC AAATGGTTAT TCATTAATCC TGCCATAAAC TCGCGTTATT ATGCATTAAT 
015261 GCAGCGAAAA GCTCTGTTGT TAAAGGGTTG CGCAACATAC CGCGCAAATG ATACTGATCA TAAGCGTTAA 
015331 AAAAATCTAC AAACCAACGC AACACAATTC ATGCCCTGGC AGTATGTCAC GTTCTCGCGT TTCTGAACGG 
015401 GGAACGGCGC TCCATTGAGG AAGTCATTCA TATGAAAAAT ATAAAATTCA GCCTGGCCTG GCAGATTCTG 
015471 TTTGCTATGG TGCTGGGCAT TCTCCTGGGA AGCTACCTGC ACTACCATAG CGACAGCCGC GACTGGCTGG 
015541 TCGTCAATTT GCTCTCTCCG GCGGGTGATA TCTTCATCCA TCTGATTAAA ATGATTGTTG TGCCGATTGT 
015611 GATCTCCACG CTGGTGGTGG GTATCGCGGG TGTTGGTGAT GCCAAACAGC TCGGGCGTAT TGGCGCGAAA 
015681 ACCATTATCT ACTTCGAGGT GATCACCACC GTCGCCATCA TTTTGGGGAT CACTCTGGCG AACGTCTTCC 
015751 AGCCCGGTGC CGGGGTGGAT ATGTCGCAGT TGGCGACCGT CGATATCTCG AAATATCAGA GCACTACGGA 
015821 AGCGGTACAA AGCAGTTCCC ACGGCATTAT GGGCACGATT TTGTCGCTGG TGCCGACGAA CATTGTGGCG 
015891 TCGATGGCGA AAGGCGAAAT GCTGCCGATC ATCTTTTTCT CGGTGCTGTT TGGTCTGGGG CTTTCTTCCC 
015961 TGCCCGCGAC GCATCGTGAA CCGCTGGTGA CCGTGTTCCG CTCCATCTCT GAAACCATGT TTAAAGTGAC 
016031 TCACATGGTG ATGCGTTATG CACCGGTGGG TGTGTTTGCG CTGATTGCGG TGACGGTGGC TAACTTTGGT 
016101 TTCTCGTCTC TGTGGCCACT GGCGAAACTG GTGCTGCTGG TGCATTTCGC CATTCTGTTC TTCGCGCTGG 
016171 TAGTGCTGGG AATTGTGGCG CGCCTGTGCG GGTTAAGCGT CTGGATCCTG ATTCGTATTC TGAAAGATGA 
016241 GCTGATTCTG GCGTACTCCA CTGCCAGCTC TGAAAGCGTG CTGCCGCGAA TTATTGAGAA GATGGAAGCC 
016311 TACGGAGCAC CGGTGTCGAT CACCAGTTTC GTGGTGCCGA CCGGTTACTC TTTTAACCTT GATGGTTCGA 
016381 CGCTGTATCA AAGTATTGCC GCTATCTTCA TCGCGCAGTT GTATGGCATT GACCTGTCCA TCTGGCAGGA 
016451 AATCATTCTG GTGCTGACGC TGATGGTGAC CTCGAAAGGG ATTGCTGGCG TGCCTGGCGT GTCGTTTGTG 
016521 GTGTTGCTGG CAACGCTGGG TAGCGTAGGT ATTCCGCTGG AAGGTCTGGC GTTTATTGCT GGTGTTGACC 
016591 GTATCCTCGA CATGGCGCGT ACTGCGCTGA ACGTGGTGGG TAATGCGCTG GCGGTGCTGG TGATTGCCAA 
016661 GTGGGAACAC AAATTTGACC GTAAGAAAGC GCTGGCTTAT GAGCGTGAAG TGCTGGGCAA ATTTGATAAA 
016731 ACTGCGGATC AATAATTGAA GATTGCCGGG GATATCCACC CGGCAATGTG TGAATGCCTG ATGCGACGCT 
016801 TGCCGCGTCT TATCAGGCCT ACGCCAGACA GCGCAATAGC CTGATTTAGC GTGATTTTGT AGGTCGGATA 
016871 AGGCGTTTAT GCCGCATCCG ACATCAACGC CTGATGCGAC GCTTAACGCG TCTTATCAGG CCTACGCCAG 
016941 ACAGCGCAAT AGCCTGATTT AGCGTGATTT TGTAGGTCGG ATAAGGCGTT TACGCCGCAT CCGACATCAA 
017011 CGCCTGATGC GACGCTTGCC GCGTCTTATC AGGCCTACGC CAGACAGCGC AATAGCCTGA TTTAGCGTGA 
017081 TTTTGTAGGT CGGATAAGGC GTTTATGCCG CATCCGACAT CAACGCCTGA TGCGACGCTT AACGCGTCTT 
017151 ATCAGGCCTA CGCCAGACAG CGCAATAGCC TGATTTAGCG TGATTTTGTA GGTCGGATAA GGCGTTTATG 
017221 CCGCATCCGA CATCAACGCC TGATGCGACG CTTAACGCGT CTTATCAGGC CTACGCCAGA CAGCGCAATA 
017291 GCCTGATTTA GCGTGATTTT GTAGGTCGGA TAAGGCGTTT ACCGCATCCG ACATCAATGC CTGATGCGAC 
017361 GCTTGCCGCG TCTTATCAGG CCTATCTTAA CCGTTGGTTA ATTTTTCAAA CTCTTCACAC CCGGTATCAA 
017431 ACCCTTCCAT ACAGCTCAGG TTCAACCAGT GCAGCGCCTT TTGCTTGTTC TTCTCGATAA AACCTTCTTC 
017501 ACCGTTTAAG AACATCATTC CCGCCCAGTA CTCGGAATAA CCGGTTCGGG AAATTGCAGA GCTGCGTTTG 
017571 AAATACCAGG TTGCCTTGTC ATCGTCGGCC TTAATGCCCA CGCCGTTGGC GTAAATCAAA CCAAGCAGCA 
017641 TTTGGGCATC GACGGCAGAG TCGTTCTCCA GATCTTCCGA GGCGTTTTCT AACAGCGAAA TTGCCTTTGG 
017711 ATAATCCGGT TTACCCGCTT GAGTATTTAC CAGAATATGC GCCAGCGTTA CTTCACCTTC TTTACTGCCC 
017781 GCTTGCGCCG CTTTCTCTGC AAGAACTTTT GCTTGTGGAT AGTCCAGACT GACCGGATTG GTGATTTTGA 
017851 TCTGCGCCAG CAGCGCGCAG GCATCAGCAT CACCGCTGTC GGCGGCTTTC TGTGCCCAAT ATTCGGCTTT 
017921 GCTCAAATCG CCGGAGCTAA ACCAGCTGTC GGCAAGAAAA TATTGTGCGC GTCGGTCCCC GGCCTCTGCT 
017991 GCCTTTAAAT ACTGGCTGCC AGGCTCGGAG TCGTTGGCGT GGGCAAAGAA TGTCAAAAAC AACATCAATG 
018061 CGATAATTTT TTTCATTTTG ATAATACGAT TGGGTAGGGA GTAACCAGTA TAAAGAGTTC GAATGGATAA 
018131 AAAAACAGCC TCCGAAAGGA GGCTGTAGAA AGGACGGTAT TACGCCAGTG CCGCTTCGCG CAGGCGAGTT 
018201 TTCAACTTGT TGTACTCGTC AATCACGTAC TGCTCGGCGG CGCGCTGATC GGCGATCGGC TCGACGCGAA 
018271 CGGCGCAGTA TTTGTACTCC GGCGTTTTCG TAATCGGGCT TAAGTTTTCG GTAACCAGCT CGTTACAGGC 
018341 ACCAATCCAC CACTGGTAGG TCATGTAAAT CGCCCCTTTG TTCGGACGAT CGCTGACCTG CGCACGGGTG 
018411 ATAATTTTGC CTTTACGCGA GTGCACCCAA ACCAATGCCT CATCTTCAAT ACCCAGACGT TTGGCGTCTT 
018481 CGGTATTGAT TTGTGCGTAG CCAGGTTCAT CAGCCAGCGC CGCCAGTGCC GCACAGTTAC CGGTCATCGA 
018551 ACGGCAAGAG TAGTGACCAA CTTCACGCAC CGTTGACAGT ACCATCGGGT ACTCGTCGGT GAGTTTGTCG 
018621 ATTGGCGCTA CCCAGTCGCA GGTGAAGAAC TGCGCCAGAC CGTTCGGGGT ATCAAACTTC TCTTTAAACA 
018691 GATAAGAAGT CCCCTGATCG GCATCTGAAG TATCGCGGCA AGGCCACTGA ATGAAGCCCA GTTCGCCCAT 
018761 TTTCTCGTAA GTCGCACCGT AGAAATCCGG GCACAGATGA CGCAACTCAT CCCAGATCTC CTGGGTGTTG 
018831 TTGTAGTGCA TCGGATAACC CATACGGGTG GCGATTTCAC TGATGATTTG CCAGTCCGTT TTCAGATCCC 
018901 ATTTCGGTTC AACCGCCTTG AAGAAACGCT GGAAGCCACG GTCAGCCGCA GTAAACACGC CTTCATGCTC 
018971 GCCCCACGAC GTTGACGGTA AAATAACATC CGCCGCCGAC GCGGTTTTGG TCATAAAGAT GTCCTGAACG 
019041 ATAACCAGTT CCAGATCTTC AAAGGCTTTA CGTACTGCCG ACAGCTCCGC GTCAGTTTGT AGCGGATCTT 
019111 CGCCCATAAT GTACGCGGCA CGCACTTCGC CATGCGCTGC GCGGTGCGGC AGCTCGCTGA TGCGATAGCC 
019181 GGTATGCGCT GGCAGGCTTT CCACGCCCCA GGCTTTGGCG AATTTCTCGC GGTTAGCCGG ATCTTTCACG 
019251 TACTGGTATC CCGGATACGT ATCCGGCAGC GCGCCCATAT CGCAGGCACC CTGAACGTTG TTCTGACCAC 
019321 GAACCGGGTT AACACCCGCA TGCGGCTTAC CGAGGTTACC GGTCAGCATC GCGAGGCTGG TCAGAGAACG 
019391 CACGGTTTCC ACGCCCTGGT AGAACTGGGT TACACCCATG CCCCACAGGA TGGCGGCGCT TTTCGCCTGG 
019461 GCATACATCC GTGCCGCCTG ACGAATCTCA CTGGCGCTGA CGCCGGTGAT ATCTTCAACC GACTCCGGCG 
019531 TGTAGCCTTC AACGATTTTA CGATACTCTT CAAAGCCTTC TGTACGTGAA GCGACGAACG CTTTGTCGTA 
019601 CAGATTTTCT TCAATAATGA CATGGCCCAT CGCATTCAAC AGCGCGATGT TCGAGCCGTT TTTCAGTGCA 
019671 ATGTGCATGT CAGCAATGCG CGCGGTTTCA ATTTTGCGCG GATCGCAGAC GATAATTTTC GCCCCGTTAC 
019741 GTTTAGCGTT AATTACGTGA TTCGCCACGA TTGGGTGGGA ATCCGCCGGG TTGTACCCGA AAACGAACAC 
019811 TAAATCGGTA TTATCAATTT CGTTAATAGC ATTGCTCATT GCGCCATTAC CGACCGATTG GTGCAGACCT 
019881 GCAACCGATG GGCCGTGTCA GACACGAGCG CAGCAGTCAA CGTTATTGGT ACCAATAACG GCGCGCGCAA 
019951 ATTTTTGCAT TACATAGTTG GTTTCGTTAC CCGTACCACG CGAGGAGCCG GTCGTCTGGA TGGCATCCGG 
020021 ACCGTACTTC TCTTTGATGG CGCTCAGGCG CTCGGCAACG TAATTCAGTG CCTCATCCCA GGAAACAGGT 
020091 TCGAGTTTGC CGCCACGCTG GCGACGGATC ATGGGGGTTT TCAGGCGCGG GGTCAGGATC TGGGTATCGT 
020161 TAATGAAGTC CCAGCCATAA TAACCCTTCA GACACAGGGT ACCCTGGTTG GTTTTCCCCT GCGCTGCCTC 
020231 CGCCCGGACG ATTTTGCCGT TATCGACGAC CAGGTTGATT TTGCAACCTG ATGCGCAATA GGGGCAAACC 
020301 GTGACGACTT TTTTCATCGG TCTCGCTCCA GTTAATCAAA TCACGCATAC GCGCTCTCGA CTACAGTATG 
020371 CATCTTTTAT GCCACATTTT ATGTGGGGTC ATTCCCTGAT ATTACGGGCA CTATTTATTC AAAACTCTGA 
020441 CGAAAAACAG GCTGTCGTCA GTTTTGACGT GACGAAACGA AATACCGCGT GACAGCCATC ACGCGGCAGA 
020511 CATTTTATTT TTTCTCGACG ACGGGACCTG CCTGATACCC GCCGCCCAGC GATTTCATCA ACTGAATGCT 
020581 TTGGATCACC CGGCGGCTGT CCAGCATCAG TAATGACATC TCTTCGGCAA GCACTGGCAA CCGGGCTTCG 
020651 GTGGCCTGTA AGCGGCTGGT TAAGCCGCGC TGATAGGCGG CCTCGGCAGC GCGCTGGGTA AAGCGCGTGG 
020721 CTTCCACGCG TTCAGCCTGC ATTTCTCGCT CGTCGTTGAG CGTTTGCAGA CGCGTGCCGT TGACGGCAAC 
020791 GTCACGCACC GCGTTCAGTA CTGACTGGTT GTAACGTTCA ATCATCATGT TGCTGGCGGC GCGCGTGCCT 
020861 TCGAGATTGG CATTCAACCG TCCACCGTCA AACAGCGGCA ATTTCAGACC CGGGATGAAG TTGAACTGGC 
020931 GACTGGTTTT TTTGAATAAG GTATGCAGAT GGATGGAGTC CAGACCGAAA AACGCTTTGA TATCAAAGCT 
021001 CGGATAGAAC AACGCCCGCG CGGAATCCAC CTGATCTAAT GACGCCTGAA CATACCAGCG CATGGCTTGC 
021071 AGATCCGGGC GTCTGGCGAG CAACTCATAA GAGAGTGTCG CCGGAATGCC GGTCTGGACT TGCGGTAATG 
021141 CCACCGGTCT GATCTCCGGC ATATCGCTGG CTCCCGCGCC AATCAATGCA CGCAGAGATT CTCGCGTTTC 
021211 GGTGATTTGC CCTTTGACGG CAACAATTTG TTTATCGACC GCCAGAATCT GTGCCCGCGC GCCGTGGAAA 
021281 GGCACTTGCG CTTCCAGACC GTGCGCCACT TTACTCTGGT GCGCTTTCAC CGCGTAATCA ATCACATCGT 
021351 GAGTTTGTTC TAACAGATCG AGCATCTGAT AGCTGGCCTG CATACTGTAA TAAAGCTGCG CTACGCCCGT 
021421 GGCCAGCGAT AGCTCTACTG CTGCGGTTTC TGCCAGCGCG GCATTATGCG CGCCAATGGC GGCGGCAACC 
021491 GCTGAGCGAT GCACACCCCA CAAATCAAGA TCCAGTCCGG CAAACAAACC TACTGTGGCT TCCGTATAGT 
021561 ACGGCCCGTC CATACCCAGT GCTGGCGCAT CCATTGAATA AGGGCTTAAA AAGCCGTTCG CCGAGACACG 
021631 TTGGCGGTTG AGCATCCCTA ACGCTGCGAC CTGTAATTGT GAACCGGCAT CTAACAAATC GGCCTGGGAC 
021701 TGCGCTTTTT CTTCCCGCAG TTTCGCTTCG GCGAGGGTGT GTGAACCACT TAGCGTCCGT TGGATCAGCG 
021771 CATCCAGCTG CGGGTCATTG AGTTGTTTCC ACCACTGCGC CTGCGGCCAG CCGGAGCTGG CAAGATGAAT 
021841 ATCGTCGGCC AGTTTGATTT GTTCCGGTTT GAGCTGTTGA TGAGGTGCAG AATCCTTACG TACCAGGGCA 
021911 CAGCCGGAAA TCAGCGTCGT GCTGCCGAGA ATGCTGCACA ACAGCAGACG TGAAAGTTGA CGATTGATCA 
021981 TTGCGTGGCT CCTTGTGCCT GTTCCGTGGC GGGCGTTAAT GCCGGGGCTG TCCAGTCTGG CAAGCGGGCG 
022051 AAAAGCTGGC AGACGTGTTG CTCCTGTTTT AATAAGGTGG GCAGGATGGC CTGAGAGGCG GGTGTCTCTT 
022121 CAAGCGTTAT TTGAGGAGAA CGGCTGAGTG CGGTTGCCAG ACCGGCAGCG TATTTCTCCA GGGCGTCGGC 
022191 AAACTGACCT GCTCTGTCCG GCTGTAGTGC GTTATCCAGC GCCTGCGCCG AGTTCCAGGT GGCATCCCAG 
022261 GCGTGAAGAA GATCGCGGCC CTGACGAATA ACCGTTTGCG AACGTTCAAT CAGTAATGCG CGTTCTTCGC 
022331 TGTCCAGTTG ACGCTCCAGC GCCACGCGTT GGCACATCTC TTCACAGGCA TTAAACGCCG CATGCAGACC 
022401 GATACGAATT TGCAGATAAG TGCGCAGAGC CGTGACTTCC TGCTGGCGTG GGATCCGCAT TACTTTACTT 
022471 AACATACCCA GCGTGCCAGC CAGTTTTTGC GGCAGTGTGC GCGCTTCACT TTCAGGCCAG ACAAAGGTGT 
022541 AAATCACCGC GGACACCACG GTACCAATGA TGATACCCAG GGCGCGATCG CGAATTTCCA CCAGGTCGTA 
022611 CACTGGGCCA AAAACGTTTT CGAGCGTGGC GAGCGCGAAG GTGACCACCA TCTGTGTGCC GATATAAGAA 
022681 GAGCGTTCAG AGCTGGTGGC AATCCATGCG CCCAACAGGA AAATCGGTGC CAGCACAAAC AGCAATTCGA 
022751 CAATATTGTC CAGCCAGGGC ATGACCAGTA GCGTGAATAA CAGCGCCAGA ATCGCGCCGC AAAAGGCCCC 
022821 GCCAAAACGC AGCACCATCT TCTGGTACGA CGAACCGACA TTTGGGTTAG CGACGATCAC GCATGTCAGC 
022891 ATACAGGTGT GAATGCCTTC CCAGTCCACG CCGCTGTAAA AGGTGTAACA GATCAAACAG GCGAGCAGCG 
022961 TTTTTACCGC GTAGCGCATA TAGTCTGGAT TGGTAAAAGC ATCGGCGGCC ATTGATGGCG GTTTGGCTGC 
023031 GGGCGTTGGC GGCGTATTCG GGTCCATCTG ACCCAGTTGT AACAACGTCT GGCAGATATT CTCCAGGTTA 
023101 CATTCCCGTG CCGCCATCGC TTCACTTTCA CTGATCCGCC AGTCGCTTTG CCAGCACTGA CCTTCAGCAA 
023171 CGGCATGCTG CAGCTTGTTG ATTTCTGAAG CTAATTTTTG TCGGAATTCA ATAATTGCCT GAGAATCAGC 
023241 AAAAGAGGTG GGATCGTAGC GATTCAGCGT CGAGTAAATG TAGGTTACCG TTGCCACGCA GCTTTGCCAC 
023311 CATGCGTTTT GAGTTCGCCA GTTGGCATCG TCCGCGAGGC AAAAGACATT GAGTTTTTGT AGCGCCAGCG 
023381 CCTCTCTTTC AATCCGCGTT TCGGGTAGCG GTGCGAGGCT GTCTGTCAGG TGACTAATGG CATCATCAAG 
023451 CCGATCATTA AGCGCCTGAT GCATTTGCGA AATGGCACGA CTGGGAAACC ACAGCACGCC GATTAACGTC 
023521 ATCAGCAAGG TTGGATAGAG GCCAACAACG ATACACCACA GCGTTAAGCG CACGACCACT TCCGGATAGT 
023591 CGAGCATGGC GGGGAAGGTT TGCCCGTAAA TAGCGACAAT GGCGACGGCG AAAAAGACCA GCCCCAAGCG 
023661 ATGGGTGCGC ATCAAAAACA TGCAGCCCAT CAGGATCGGT CCGGCGATGA TCAATCGGAT CAACGGTTCG 
023731 CCGTATGACC ATTTGTAGAT CAAAAACAGG CTGCCGATCT CCAGCACCGT GGCAACCACA AACAAGATCG 
023801 CGACAAATTT GGTGTAAAAC GCGTTCGACT GAATACCGTA AAACAGCACT GCCAGCGATA ACGCCACAAA 
023871 AGGGATCTCA AAGGTCATCG AGATCAGAAT CACCAGCAGG CAGCCTACCC AGAGTTGCAC GGTCTGCGGC 
023941 ACGCGACCTG GTCGCCGCTC GCTTAACTCT TCATGAAAGA ACGCCAGCAG CCTGACCACC GGTAATGGCA 
024011 GGGAGTTGAG CGCGCTCATT ATTGCGGCTC AAGATTAGCG ACTGCCGAAG CGCCGATGCG GAACATTTCC 
024081 GGGTCAGGTT TATCGACCAT GATTTTGACC GGAAAACGCT GGGCAACGCG GACCCAGTTA ATAGAACGAG 
024151 ACACTTTCGG CAGGCCGCCC AGCACCAGGC CGCCGTCATC CGGTAGCACG CCGTAGCCAA TCGAATCCAC 
024221 TTTACCCTCG AAGGTTTTGC CGCTGTCACT CATCAGGCGA ATCGTTGCGG GTGTACCTGA GCGAATATTT 
024291 TTCAGATCGG TTTCGCGGAA GTTGGCGATC ACATACCAGT GACGAGTGTC GATTAGGGTA AAAATAGGGC 
024361 GCATGGCAGA AGCAAATTGC CCGACGGAGG TTTTGAGGGA AATGACCCGG CCATCAAACG GCGCGCGAAC 
024431 GGTCGCCATT TCCAGATGCA GTTTGGTCAG GGCAATATCC GCTTCGACCG CCGCACGCTG GGCAACTAAT 
024501 GCATCCACGC CGCTGACGGC GCTGGCGGCT GACTGCGCCT GTAACAATAC GGCATTAAGA TCCGCTTCTG 
024571 CGGCGCGCTG CGCCGTTCTT GCACGGTCAA CATCTTCCGC TGAGACAAAA CCTTCTTTCA GTAATGGCTC 
024641 GGTGCGGCGT AATGTATCTG TGGCCTGTTT CGCGGCGGCA CGGGCTTTTT CTACCGTGGC ATTAACCGAG 
024711 TCGGCACCAA ACTGTTGCGC GTCAACGCTA CGCTGGGTGA GCATAATTTG CTTATCCAGC GCCGCGAGGG 
024781 AGGCTTCAGC TTTCGCCAGA TTGGCTTCGT ACGGGCGCGG GTCGATGCGG AACAGCAAAT CGCCCTGTTT 
024851 GACTGCCTGG TTGTCGGTGA CCGCCAGTTC TACAATGCGG CCGCTGACTT CCGGTACCAC ATCAATGGTA 
024921 TCTGCTGACG CGTAAGCGTC ATTAGTTGAT GGCGCACTGT CTACGCGCCA GATAACGAAA ACAAGGGCAA 
024991 CCAGCGCCAA CGCAACCACT AACAGAGCAG GGAATTTACT GCGAGGAGCT TTTTTCGGCG TACTTTCCAT 
025061 GAGCGCGTCT CAAATAGATT AGAAAAATGC CAGCCAGAAC AGCATGGCGT AGAGAGCAAA AAGGGCGGTA 
025131 TAAATAATTC CGACAAATGC CAGATTGATA TTTGCCCGCT GAATAACTCG CCTCGTGATG AGCGTCAAAA 
025201 TAAGGCTGGC AATGGCGCAG AAAAACCAGC TGGGATAATA AGCGCCGATC ACCGGGATTG CCGGAGATAA 
025271 TGAGCATCCC GAAACCATGA AGACGGGAAT TATCCAGGCT GTTTTTTTGA GTTGCATCGC CATGCGAGAG 
025341 AGAACTGTTG GCATATTAAA TACATCCTGT CTGCTGCGAA CAATATCTGT AGTGAATATC AATATCCATT 
025411 GAAGGCGTCA GTATGGCTAT TTTCTTGATG AATAAAAATA GCTTTATTCA GCCACCGCAT TCATAACTTA 
025481 TATATTTTAT TTATTAATTG GCTGTATATA TTTTTAAAAT AAATACTTTT GGGGGCTTCA GCGCCCCCAA 
025551 AAGCGAGTGA CATTAATTTG GGGTTACGAT ATTCACCCAC AAATCGAAAT TATCCAGACA GGCGATAATT 
025621 TCTTCCAGTT TCGCGCCATT GCCAATAATT TTGGCTTTCT TCGCTTTTAC CAGATCCGCC ATTTTGGCTT 
025691 GTCCGGTCAG CACGGCGTGC AGATCTTCAC GGCTGATGTA GAAAGAGGCG TCGGCTTGCG GTTGCAGCGT 
025761 TTTCCGGTAG TTAAGCACGC TATCGTTCAG CGTCAGGTTG AGGTTATCGC CGTTGCTCAT ATTGAAGTTC 
025831 AGGCTGATAT TTTTACCCGC AGCTTTCGCG CTATCGAGGC GAACGGCCAT AAAGTCGAAC AGCATTTCGA 
025901 CCGACATCCC GCGAATGGTG TCCGGGGAAC CGGTGGTGCC GTGGCTGAAC TTATGCACCC CTTCGCGCAG 
025971 CTCTTTCGCG CCGGTCAGGT AGAAACCGCG CCATGTGGCG GACTCGGCCT GATAGCCCAG CTGTTCAAAG 
026041 TTATTCGCTT GCAGATTCTT CGCGACCTGG TCACCCGGGT TGGCGGCAAT CACCTGTTTC AGCAGTTCTG 
026111 CCGACCAGCG GTAATCACCT TGCTTGTTCG CTTCTTGCGC CAGGTTGATG ACACGGGCAG AACCGCCCAG 
026181 CGCCTGCACG TAACGTTTAC CCATCTCCAC CTGACCATAC GGATGCAGGT TAGCCGGGTT ACCGTCGTAA 
026251 TAGCCAAGAT AGAAGTTATA CACCGCGCGG GCGTTGTGGC TGACAGAACC GTAATAGCCG CGGCTGGCCC 
026321 AGTTATTGGC AAGTGCAGGC GGCAGCTTAA TCATGTCGCC GATTTCATTC ATGGTGTAGC CCTGGTTCGC 
026391 CAGGTGCAGG GTCTGGTCGT GAATGTACTT GATGGTATCG CGGTATTTAC CAATATAATC ATTGATATGC 
026461 TTATTGCCCC AGACCGGCCA GGTGTGCGGC ATAAACAGCA CTTCCGCGTC GTTACCCCAC ATATCCAGCG 
026531 TTTCGTTCAG ATACTCGGTC CACTTGCTGG TGTCGCGGGT TTTCGCGCCG CGCAGAGTGT AGAAGTTGTG 
026601 CAGGGTATGC GTGGCGTTCT CGGCGGTACA CAGGGCTTTC AGGGCCGGAA TATAGAAGTG CATTTCGGCT 
026671 GGCGCTTCGC TACCTGGGGT CATCAGGAAG TCAAACTCCA GGCCGTCGAT AATCATCTTC TCGCCAGTTC 
026741 TGACGATAGT TTTCGTCGGT GCAATAATGC TCGGGTCGCC CGTTGCCAGC GTCACGCCAA GGCCATTACC 
026811 CACATTGCCT TGCGCGTTGT GCGGCAGTAA CAGACCGTAA GAGTAGAGCG CACGGCGGCT CATGATGTTA 
026881 CCCGCCAGCA CGTTTTCGCT GATGGCTTCG TCCATAAAGC CTGCAGGGGC AATCACCTGA ACTTTGCCGG 
026951 ATTTAACATC GGCTTCAGAG ATAATGCCTT TCACGCCACC ATAGTGGTCG GTGTGGCTGT GAGTGTAGAT 
027021 AACGGCAACA ATCGGTTTTT GCGGACGATG CTGGAAGTAA AGGTCAAGTG CGGCTTTTGC GGCAGGCGGC 
027091 GTCACCAGCG GGTCGATAAC AATAATGCCT TTCTCGCCCT CAACGAACGT AATGTTAGAG ATATCCTGGC 
027161 CGCGCACCTG ATACATTTTA TCGGTGACTT TGAACAGGCC AGAAATACCG TTGATTTGCG ACTGACGCCA 
027231 CAGGCTGGGG TTTACGGTTT CCGGCGCTGC GGCATTAATA TCAAATTTGT AATCGTCCGC GCGGTAGTAA 
027301 ACTTTACCGT TCGCATCACG CAGAATACCT TCATCCAGCA GCGGGGCGAT AAATCCACGC TGGGCATCGT 
027371 CAAAATCCTG ACGATCGCTA AACGGTAATG ATTTGGCGTA ATTCTGATTA ACCTGTTGGG TATATTGAGT 
027441 GGCGGCTTTC GCTTCCTCTT TCGCGTTAGC GGTATTTACC ATCATGCCGC TGGCGGCAGT TAACGCAATA 
027511 ACAATCCTGC TCAAACGGAA TAACCGAGAG TTATTCATAT AAATCTCCAT TTATCATTTA TGTCGTAAAT 
027581 ATGTAATCCA TGCAAAATAC GTCATTTAAA GCTGGCGTTA TCATAATTGG GAAATTGCGA CTTTAATAAG 
027651 TGGAAGTGTG AGCGGAACGC GCCATTTTAT TAGGCATTTG TGCTGAAGAG GGAAAATTAC AGTAAAACTA 
027721 TCATTGCAGA AAATAATATG AGTCGTTTTA TGTGTTTATT ATATATATTG TACCTGTCGT TGGCACAGCG 
027791 GGACATTGCG CTACTGTGCC AACGTTTTAC TCATGGGGCT TTAGCACAGA ACTGTGGCAA AAAACGTTGA 
027861 TGCGCCAATA TTGCTGCACC CTGAGCGCCA TTAAAGTCAG AAGATGAGGC GGCAATAAAG CGCACGACCT 
027931 GATGCGGCAG TGGACGGCGC AGGTACTTTT GGGTCATGGC AACGAGAGTC TCGCGTGGGA AGGCGGGCAT 
028001 ATCCATCACG CCACCGCCCA GGATCACCGC ATCGGGATCG AACAGATTAA TGCTGGTGGC AATGGCCCGT 
028071 GCCGCGTTTT CAAGCAGACT CTGGACGAAA GGGGCGTTTT CCGCATGGAC GAAAAGATCG CGCAATGGGT 
028141 AATTTCGGGG CTGTTGTTCG TACCAGCGTC TTAGCGCCAT TCCAGAGCAA TTGGTTTCCA GGCACCCAGG 
028211 ATTGCCACAC GCGCAGTGTT GGGTCATATC TCCCAGGGGG ATATGACCCA GTTCGCCTGC CACACCGTGT 
028281 GCACCCGTCC ACGGCGCACC GTTCATCCAC ACTGCGAACC CCATCCCCGT ACCGAGATAG GCCGCCAGAA 
028351 CCAGTTGTTG CGTAAGGCGG TTTTCTACTA CGTCCCAGGA GAGTTGCAGG TTAACGTCGC GGGAAAACTC 
028421 AACCGGACAA TTCAGCGTAT TTTCGAGCTT ATCGGCGAGA TCATATAAAT CCGCCGCTGT TAACGGCAGG 
028491 TTAGGCGTAG AAATAATGGT GCGTTTATCT TTACTGACCA GCGCCGGAAA TCCCATCACC AGACCATGAC 
028561 AGCGAGCGTT AAAGCGCCTG AGTTGCTCGT CAATCATTTC GCCGATACCC GACACCAGGC CGGGAGCAAT 
028631 GACTTCTGCG GTCCGCTTTT TTTCGCAGTG TAGCGTTTCA CCTTCTGCTG TCCGCAGACA AAAGCGGATA 
028701 TGCGTTGCCC CCATATCCAC GCCCGCTACG ACGTTATGCT GTTTTTGCAT GAGGCTGTAC CTCGCTTTTT 
028771 GCAGCCAGAA TCTGCGCGGT CATAATTCTC CATGCTTCGT CGATATTTTC CGCATGATTA AACAGGCCGG 
028841 AAGTGCCGAC GATAAAGACA TCCGCCCCTG CCGCCATCAG TTTTTCGTAA GTTGCCTGGT TGCAGGAACC 
028911 GTCCACCTCA ATTTCGTACT CCAGACCTTC TCGTTCACGC CATGCCTTCA GTTCGGCAAG TTTATCCAGC 
028981 ATTTCAGGAA TGAACGGTTG TCCGGCAAAG CCGGGATCGA CAGTCATGAC CGTAATTTTA TCGGCCTTAT 
029051 GGATATAGTA TTTCATGGCC TCAACTGGCG TCTCCGGGTT AAGGATCAGC CCCACTTTCA TGTCATGACG 
029121 GCGGATTTCA TCAATCAGGC GGAACGCCTG GCCGTTGATG GTTTCCGGAT GCAGAGTGAT GAAATCTGCT 
029191 CCCGCACGCG CCAGTTGAGC AATGTAATCC TGCGGCCGCG TCACCATCAG ATGACAGTCG AGCGGTTTAG 
029261 TTGCCAGTTT TTTAACCTGA CTTACGAAGA ACGGTGAGAG TGTCAGATTG GGGACAAAGT GACCGTCCAT 
029331 GATATCGATG TGGAAGTAAT CGGCATGGCT GTCGATAAAT TCGATCTGTT CTTTAAATTT CAGCAGATCC 
029401 ATACACATTA ACGAGGGGGA GATTTTCATG TTCAATTCCT TACTTACTGA TAAGACGGTC AAGGGCGACA 
029471 GCCGCGATAA TTAATCCGCC CATCACCACC AGTTGGTAAT AGGTTTGTAC CTGCAAAATA TTCAGACCGT 
029541 TGTTGATGGT GCCGATGATC AACCCGCCAA TCACCACAGA GAAAATGCGC CCCTTGCCGC CGAAGAAACT 
029611 GGTGCCGCCA ATGATGGCGC TGGCAATGGC ATAGGTTTCA AAACCCATAC CGGCAAGCGG TTCTGCGGCA 
029681 CCGAGTCGTG CAGTTGAGAC GACGCCTGCC AGACCTGCAC AAACACCGGA GATGATAAAC ACCACCAGGA 
029751 TGTGGAATTT CACGTCAATC CCGGAATAGA ACGCCGAATT TTTGTTGCCG CCCAGTGCGT AGATGTTGCG 
029821 CCCGAGCCGC ATACGCGTTG TCAGAAACCA AAGGATGAGC GCGACAATTA GTGAGAAGAT AACGGGGACA 
029891 GGTATCCCAA TTACGCTGGC GGCAAAGAAG TTCACGAAGT CAAATGAGAA GCCGTATACC GAGTTGGCAT 
029961 CGGAGATCAC CAGCGTGATC CCACGGAAAA TCGCGTTGGT GCCAAGGGTG ATGATGAACG GGTGTAGCCC 
030031 CGTCCAGTTG ACCAGGCAGC CGTTGATCGC CCCCAGTGCG CCGCCAACCA GTACACCGCC AATCATCGCT 
030101 GCGAGAAACG GGTCAACACC TGCCAACATC AGTTTGGCGG TCACCATACC GGAAAGCGCC AGAATCGCGC 
030171 CAACCGAGAG GTCGATACCA GCGACCAGGA TAGCGAAAAA CTCGCCCATG CCGATCAATA CCGTCACGGA 
030241 GCTTTGAACA AAAATCTGGG TAATATTATT GGTGGTCAGA AAATATTCTG GTGACAGCGA ACCAAAGATG 
030311 GCGACGATGA TCGCCAGGAT AAAAAAGGTG CCGTATTTAT CCCAGAACAG CGCAAAGTTG AACGGTTTCT 
030381 TCTCGCTCGC TTCGCTTTTT ACTCTTGTGG TAAAGCCCAT GCCATAATCT CCTCTTCGCT CATGTCATCG 
030451 CGATTCGTCA GGATTTGCGT CAGTCGTCCT TCGCAGAACA CGGCGATGCG GTCGCAGACG GTGATAATTT 
030521 CAGGTAGTTC AGATGACACC ATCAGGATGA CTTTTCCGTC GTCCGCCAGT TGGCGCATCA CTTTGTAAAT 
030591 TTCGGCTTTC GCGCCAACGT CGATGCCGCG GGTAGGTTCA TCGAAAATAA TCACTTCCGG GCAACAGCAC 
030661 AGCCATTTGG AGATCAGGAC TTTCTGCTGA TTTCCCCCGG AGAGTTCGGT GATATTCTGG TTTACCGAAT 
030731 GACATTTCAG CGCCAGCAGT TCGCGTTGAT TTTCAGCGGT ACGTTGCTCG TCAACTTCAT GAAACAAGCC 
030801 CATCGCGCCT TTATAGCCGC CGTCTTTCAG ACTGCGGCTG ATCGCCATGT TCTGAGCGAT GGAAAAGTTG 
030871 GGGAAAAAAC CGTTATCCCG GCGGCTTTCA GTGATGTAAG CCATCCCTTT TTTCACGGCA TCCAGGGGTG 
030941 AACGTGGAGA GATATCTTTG CCATTAAGAC GGATTTCTCC GCCAGCGCGT TTATCCACGC CAAACAGACA 
031011 ATTCATCAGT TCAGTACGTC CGGAACCGAC CAGTCCGGCA AAGCCTAATA TTTCTCCCCG GCAGACGCTA 
031081 AATGAGATAT CCCGGACCTT TTTTCTGTCA CGACTGGTGA CGTTCCGCAC CTCAAAAACC GTTTCGTGCG 
031151 CAAGGTTGCT GACATTCTCC TTCATCGCGT TAAAACGGTT TTGCAGTTCG CGGCCTACCA TCAGACGGAC 
031221 GATATCGTCA TTTGACACAT CGCTTACTAT GCCGCTGCAA ACGCTGCTGC CGTCTTTCAT CACCGTATAG 
031291 CGGTCGCAAA TACGGCGAAT TTCCGCCAAC TTATGCGAGA TATAGACGAT GGCCGTACCC TCTTTACGCA 
031361 ACTGATTCAT GATCAGAAAC AGATAGTCCA CCTCTTTATT GGTGAGTGAG GAGGTGGGTT CATCCATGAT 
031431 GATGACTTTG GCATCGAGCA TCAGCGTTTT GGCAATTTCT AGCATCTGCT TGTGGCTGAT AGATAAATTC 
031501 GCCACTTTCT CATCTAGATC AACTTTCAAG CCCACGCGTA ATAACATCAT GGCGGCGCGG ACACGCATTT 
031571 CTCGCCAGTC GATAATATTG ACGCCACAGA TTTTTTTCGT CAGATGACGA CCAATATATA AATTTTCCAG 
031641 TACGGTTAAT TCATCAATAA CGCTGAGTTC CTGATAAATA ATCCCGATAC CGAGTTGTGC CGCTAATTTA 
031711 TGATCCAGCT TGTTATAGCT AATGTTATTA ATGGTAATGG TGCCTTTGGT CGGCTCATGT ATTCCGGATA 
031781 AAACTTTCAT TAGCGTGGAT TTACCCGCGC CATTTTCTCC TAGTAATGCA TGTATTTCAC CAGGATAAAC 
031851 CGTTAAATTA ACCGACTTTA ATGCGTGAAC CGGACCAAAG GACTTGCCGA TCCCCGCCAT CGATATATAT 
031921 GGCGTGGCCA TAAATAACCT CTCTGCACGA AATATCGTAT TATTGCCTGA TGGCTACATT TATCAGGTCT 
031991 ACGTTCAGGT TATTTTGTTG GCCGGATAAG ACACTTCATT AGCATCATCA TCCGGCATCA TTCAGTTTTA 
032061 TTGAGTGACC AGGATTGAAT CGACCAGTTT AAATTCCGGT GCTTTATCCA GCGGGATAAC CTTGCCGGAT 
032131 TTCTCAGCGT CAACCATCAG CTTCAGACCC GTTGCGCCGA TATCCGCCGG GTTCTGGGCA ACCGTCGCGG 
032201 TCATTTGTCC GGCTTCCACC ATTTTGCGGG CTTCCGGAAT GCCATCTGTA CCGACGACCA GCACTTTTCC 
032271 CGTTTTTCCG GCGTTTGCGA CTGCCTGAGC AACACCCATT GCCATCGTGT CATTCGCGCA ATAGATCGCT 
032341 TTAATATTCG GATTACGTTG CAACACGTTA GTGGCGACAT CCAGTGCTTT AATGCGGTCC CAGTCGGCAG 
032411 GCTGGCTGGC GACAAGCTTG ATCTGGCTTG CTTTTTTGAA GGCTTCGGTG GCACCATTAC GACGCGCTTC 
032481 ACCGGAGGCG TTACCGGCTT TACCCTCAAT GATTGCGACT TCACCACCTT CAGCGCCCAA TTTGTCAATA 
032551 ATGAACGACG CGCCTTTCGC CCCGACAGCA ACGTTATCGG TGGTGACAAA AGCTTCCACA TTGCCGCCAG 
032621 CTTTTTTCAG ATTATCCATG TCGATTTTTT CATCGAGATT AACCAGATAA ATGCCTTTTT TCCATGCGCG 
032691 GGCGACAGGC ATGACCAGAT TCACTGAGGA TAATGGAGCG AAGGCGATAC CTTTGTAATT TTTATTACTG 
032761 AGATCTTCAA ATAACTGCAA TTGAGATTGA AAATCGCCTT CTGAAGGAGA GGCAAAAATA TCAACGCTGA 
032831 CGCCCAGTGT TTTTGCTTCA TCTTCAATGC CTTTTTTCAT ATCTACCCAA AATGGGTTGG AGAGGGTTTT 
032901 CAATACGACA GCATATTCGG CGGCAGCAAA AGCGCTGGTT GACAACATTA AGCCCACGAG TGTGCCGCTG 
032971 AAATATTTCA GATATTTATT CATAATAATG TTCTCACGGT AAGGGGACAG GTAACTCCGC GATGGCGGAA 
033041 TTACCTTTTT CTTATTTCAG CGCGCCTGGT GAGAAGAAAT CAACAATTGC GCCGGTTTTT TGCATATTAA 
033111 TATTAGCTTG TTCAATGTTG AGCTGGGCGA CAGAGACAAA AAAAGCGTCC AGCAAAGTTA GTTGTAATAT 
033181 TCTTGCCGAG GCATTACGAC CTAATAACGG CGTTTCCGGG GCTGGTGAGC AAATAATATA ATCGGCCAGT 
033251 TTCGCTATCG GTGAATGGTA GCTATGGGTT ATACAAATAA TCTTTGCCCC GTTCTTTTTT GCCAGTTCTA 
033321 CGGCCGCTTT TACATCACTG GTTCGCCCGG AATGGGTCAC TACCAGCACA ACATCTCCTT CCTGTAACAA 
033391 CGAAGCGGAC ATCATCATGA TGTGAGCATC AGGATAGGCC TGACAGCGTA CGCCAATGCG CAAGAACTTG 
033461 TGCTGTACAT CAGCACAGAT AGCATTTGAT CCTCCGGCAC CGTACAAATC CCGCTGTCTG GCCTGATAGA 
033531 AAAAGCGGGC GGCACGGTGG ATCTCATCAA CGTTGACGAT CGACTGACCT TCCATAATGG TGCGTAAAGT 
033601 GATGTTAAAT ACCTTATTCA CCACATCCTG CGGCGCTTCA TCAAAAGCCA ACTCGGAAGG CAATACCTGT 
033671 TCTGACTGAG AAAAATAATC TTCCAGCGCA CTGCGTAAGT TACGAAAGCC GCTAAACCCC AGCAGCTTTG 
033741 ATACCTTAAC TATCATCGCT TCAGATACCG CCAGAGCTTC TGCGACATCT TTAATTGCGG GTGCACAACT 
033811 CAGGTTACCG GGTTTGAGTA ACCACTCCAC GATGCGGCTT TCATTTTCTG TCATTCCTTC CTGCTTCATT 
033881 CGCAGGTAAG GCGCTAACCC TATACCGTTC GGAAGCGCTG AATCAAACTC TGACTGGCTC ATCACGTTCT 
033951 CTTGTCCTTG AATTGAAGAC GCCACTATAT CACCACAGCA AGAACAGAAA AGATGCTGGC GACTTCACAA 
034021 AAAAATAAAA TTTATAAAGT TTATTTTATT GTGAACAATG GCGAGTGGCT TAAAATTTTA TTTCATTTAA 
034091 TTAGTTTAAA AACATGATGT TATTTGTTTT TCTGGTTTTT TAGATGATAG ATGTTGCTGG ATGGTGAGTG 
034161 TCTTTAACGC TATTGCGCTG TCAGATGTAA CTCTGTAAAA CAGATCAGGA AGGCGTAATT CATCGATTTT 
034231 GGGTGTTTTT AATTCATTAA CATCACAAAT GTTTTTTGAT TGTGAAGTTT TGCACGGACG GGGAAGATGA 
034301 ATGAAAAAGA TTGCATTTGG CTGTGATCAT GTCGGTTTCA TTTTAAAACA TGAAATAGTG GCACATTTAG 
034371 TTGAGCGTGG CGTTGAAGTG ATTGATAAAG GAACCTGGTC GTCAGAGCGT ACTGATTATC CACATTACGC 
034441 CAGTCAAGTC GCACTGGCTG TTGCTGGCGG AGAGGTTGAT GGCGGGATTT TGATTTGTGG TACTGGCGTC 
034511 GGTATTTCGA TAGCGGCGAA CAAGTTTGCC GGAATTCGCG CGGTCGTCTG TAGCGAACCT TATTCCGCGC 
034581 AACTTTCGCG GCAGCATAAC GACACCAACG TGCTGGCTTT TGGTTCACGA GTGGTTGGCC TCGAACTGGC 
034651 AAAAATGATT GTGGATGCGT GGCTGGGCGC ACAGTACGAA GGCGGTCGTC ATCAACAACG CGTGGAGGCG 
034721 ATTACGGCAA TAGAGCAGCG GAGAAATTGA GATTCATCCA CTACTTGCAT GGATGAGTAA TGATTAATGT 
034791 GGATAGAGTT TCTTTTTGAG GTTGGCTAAT GAAACGCTTT CCGCTATTTC TTTTATTCAC CCTGCTCACG 
034861 CTGTCCACCG TTCCGGCCCA GGCCGATATT ATCGACGACA CCATTGGCAA TATTCAGCAG GCGATTAATG 
034931 ACGCTTATAA CCCTGACCGT GGGCGAGACT ATGAAGATTC GCGCGACGAC GGCTGGCAGC GTGAAGTGAG 
035001 CGACGATCGG CGCAGACAAT ATGACGACCG CCGCCGCCAG TTTGAAGATC GCCGCAGGCA GCTGGACGAT 
035071 CGCCAGCGCC AGCTTGATCA GGAGCGTCGG CAACTGGAGG ATGAAGAGCG GAGAATGGAA GATGAGTATG 
035141 GGCGATGAGG TTGGGTATGG AGCAGGCATC GCCCCTCACC CCAATGGGGA GAGGGAGAAA ACGAGCGCAA 
035211 TATTCAATAT CGAGCACAAT CGGTCCCCTC GCCCCTCTGG GGAGAGGGTT AGGGTGAGGG GGCCAGCGCG 
035281 CACATTCCCT CTCATCACGC CACCCCAATC TCCATCCCAT CAAACCCCAC CTCAAACCCT GACGGTAGTG 
035351 CGTTTTCCAT CAGCCACGCA TCAAACTGGT GGCTGATATG GGTCAGAATC ACCCGTGGCG AGCGGATAAC 
035421 CTGATTCAGC GCAAGCACGG TATTTAAATC ACAGTGATTA CGCGGTGCAT CCGCGCGCGG CGGGTGACTG 
035491 CAATCCATCA CCATTACCTG CGGCTGATTA TTGCGTAAAA ATTTCAGCGT TTTTTCCGGC AAGCCTGCGG 
035561 TGTCAGACAG CCACGCCACC CGGCTGTGTG CCGTTTCCAG CAGATAACCG AAGGTCAGTT TTGAGTGGTT 
035631 GAGCGGCAGG GGCGTGACCT GTAACCCCTG CAAATCAAAC ACCACAAACG GTTCCACCGT GTGGCTGAAA 
035701 TCAAGCAGGC CCGGATGTTT AAACAGATCG TCGCAGCCCT GTTCATCCGG CGGGCCGTAA ACCGGGATCG 
035771 GATCGCCAAC GCCCCAGCGC AGCGGAAACA GCCCCTGGAC GTGATCCATA TGATAATGCG TCAGCAAAAA 
035841 CTGCTGGAAC GATCCGGGCG ACCAGCGATC GGCGAGATCG TGCAGCCCGG CGTCGATCAG GGTGATTGCG 
035911 TCGTTAAACT TCACTACGCC GCTGCACGGT TGGCGGCGAT ACTGCGGCGA GCGCCGCGCT CTGGCGCAGG 
035981 CCGCACACTC GCAGCCCCAT GCCGGAACGC CCTGTGCGCC GCCGGTGCCG GTGAGCGTGA GGGTCAGGCT 
036051 CATGTTACAG CGCCTTGGTG AAGCGGAAGT GGCTCTGCTC GTAGCCTTCG CGCAGATAGA AACGGTGCGC 
036121 GTCGTGGCGC TTCACGTTGG TCGAAAGTTC GGTCATTTCG GCCCCGGCCT GGCGGGCTTC TTCTTCTGCC 
036191 CACGCCAGTA ACTTACTGCC GACGTTCAGA CCGCGCGCCT GCGGCATTAC CACCAACTCC TGAATTTCGC 
036261 CGATCCAGTT GACATGATGC AGATGAAACT GCAAATGCAG GCCGATCATG CCGACAACTT CGCCATCAAG 
036331 CAGCGCCAGA TGGTAGCGCA TGTTTGGGTC GCGCAGATTG GCGTTAAAAC CCACGCGAAA CGCGTGGTGG 
036401 TCAAACTCCG CCTGTTTTAG CTCACAAATC AGCGCGTAAA CCGCGTCGGT GTCGTACTGC GTGGCCGGGC 
036471 GAAGCTCACA AGCAGGCATG GTGTTTCTCC TTCTGATGGA TCAGCGTCAG CAGCGTGTCG ACCGACTGGC 
036541 GCAGGCTGCC GTCATTGTTG AGCGTATGGC AATCCTGTGG AGTATAGCGG GCGGCGCGCG CCAGGCGGGC 
036611 GTTAATTTCA CTGGCGTTTT CACGGCCACG GTTTTCCAGG CGCTGGCGGA GGATCTCCGG CGAAACCTGT 
036681 AAACAGACGG GCAGCAGCGC CGATTGATAG CGCGCCCGCG CCTGCGGCAG ATGGGCGCGT GAGCCGTTGA 
036751 CCAGCACGTC GAATCCGGCG TGCAGCCAGA GATCAATCTC GACGCCGACG CCATAATACA GACCGTTAGC 
036821 GTGCCAGCTT AAGGCCAACA GATTTTGCCC CGCGCGGGTA AAAAACTCCT GCTCGCTCAG GGCGATATGG 
036891 TTTTCACTTC CGGCGCTGGC ATCGCGCGTG ATGTAGCGAT GCGCCACCAG TAACTGAGTT TGTTCCCGCA 
036961 GGCGGAGTTC CGCCAGCAGG CTGTCTTTCC CGGAGCCGGA CGGCCCCATT AACCAAATCA GTTTTCCCAT 
037031 CATCAGAACA CCCTTTTACC CTGACGCCAG ACGTGGTCGA TATGAATATG ATTGTCCTTG CGATGCGCCA 
037101 GCACCAGGTC GGCGCGTTTG CCCTCGCCAA TCACCCCGCG ATCCTGGAGA TTAAGCGCCT GCGCTGGATT 
037171 TTTAGTCACC AGCTTCACCG CCTGCGGCAG CGTAAAGCGG TTGCTCTGGT CATCGGCGAC GCGAAATGCC 
037241 GCATCGAGCA GGCTGGCGGG GTAGTAGTCG GAAGAGAGGA TATCCAGCAG GCCAAGCTGC GCCAGTTCAC 
037311 TGGCCGCCAC GTTGCCGGAG TGCGAGCCGC CGCGCACAAT ATTCGGCGCG CCCATCAGCA CGTTCATGCC 
037381 ATGCTTGCGC GAGGCTTCCG CCGCTTCGAA CGTGGTGGGA AATTCGGCGA TCACGCTGCC AAGCTGGTGA 
037451 GATTCAGCAA CGTGGGCGTG GGTGGCGTCA TCGTGGCTGG CAAGCGCAAT TTTTCGCGCG CGGCACAGGG 
037521 CGGCGATGGA TTCGCGATTC GGCTGCGACC AGCGTGCGGC GAGCGCCAGT TGCTCTTCTT CGTACTGCTG 
037591 CATCTGCGCA TCAGTGAGGG AGTATTTGCC CTGATAATAT TCGCGATACT TCTCGCGGTT GGCGAACTGG 
037661 CGCTGGCCCG GCGAGTGGTC CATCAGCGAC ACCAGCGTCA CCGGCTCGCG CTGCACCAGT TTTTCAAACA 
037731 GCGGCAGCGT GGTGTGATGC GGCAGTTCGC AGCGCAGATG CAGACGGTGC TCGGCGCGGT TGACGCCGCG 
037801 TTTCTGCGTC TCTTCGATGG CGTTGATCAT CTTCTCCAGA TTCTCCAGCC GATCGCCGCC GTCGCGCACG 
037871 TCGCCAATTG CCACGGCATC CAGTACGGTG GTGATGCCGC TCGCCACCAT CAGCGCGTCG TGGCTGCTCA 
037941 TCGCCGAGTG GGCAGGCCAG TCAACTTTCG GGCGCGGGGT GAAGAATTTA TCCAGATTAT CGGTATGCAG 
038011 CTCAATCAGC CCCGGCAGCA GCCAGCCGCC TTCGCCGTCC ATCGCCTCCG GCAGGCGGCT CTGGCTTTCG 
038081 GCAAAGGCGC GGATTTCGCC GTTCTGCACC TCCAGCGAAC CGCTTACCAC CTCGTTTTCC AGCACCAGCT 
038151 TAACGTTATT GATAATCATG AAGAGGCTCC CATTGGGTGC AGGCGGTCGG CGACGTCATT ACGTACAGCT 
038221 TCGTCATGGA AGATGCCTAC GATGGCTGCG CCACGGGTTT TGGCTTCGCG AATCAGTTCC ACCACCGCGG 
038291 CGCTGTTTTT GGCGTCCAGC GAGGCGGTAG GTTCGTCAAG CAGCAGAATG GGGTAGTCGA CGATAAAGCC 
038361 GCGGGCGATG TTGACGCGCT GCTGTTCGCC ACCGGAAAAT GTCGATGGTG CCAGGTGCCA CAGGCGTTCC 
038431 GGCACGTTCA GGCGGGTGAG AAGACGCGCG GCTTTAGCGG CGCAGGCTTC ACGCGGAACG CCGGTATCGA 
038501 GCAGCGGCTG CATCACCACT TCCAGTGCTG AGATACGCGG GATGACGCGC AGAAACTGGC TCACCCAGCC 
038571 GACGGTGGTT TTGCGGATTT CCACCACTTT GCGCGCTGGC GCGGTGACCA GGTCTACCCA CTCGTCACCG 
038641 TGTTTGATCT GGATTTGACC TTCGTCGGGC AGATAGTTGG CGTACAGCGA GCGTAGCAGA GTTGATTTGC 
038711 CGCTGCCGGA ATGGCCGTGG AGCACCACGC ATTCGCCCGC GTTGACGGTG AGCGAGGCGC GATTGAGGAC 
038781 GGGCAGGCGC ACGCCGTTTT GCTGGTGCAG GATGAAGGTT TTACTGACGT TTTGTACGTT AATCATTTTT 
038851 CGCCTCGTGG TTCGGGTGTC GGATGCGACG CTGACGCGTC TTATCCGACC TACGGGGAGC GCATTTGTAG 
038921 GCCGGATAAG GCGTTTACGC CGCATCCGGC ACCGGCTCAA TTCTGCAAAA CCGATGACAC CAGCAGCTGT 
038991 GTATACGGAT GATGCGGGTC GTCGAGCACG CGGTCGGTTA ACCCACTCTC CACCACTTGC CCCTGCTTCA 
039061 TCACCAGCAA ACGGTCCGCC AGCAGGCGGG CGACGCCTAA ATCATGGGTG ACAATCACCA CCGCGAGGTT 
039131 CAGCTCCACC ACCAGGCCGC GCAGCAGGTC GAGCAGGCGG GCCTGCACCG ACACATCCAG CCCGCCGGTC 
039201 GGTTCATCCA TAAACACCAG CTTCGGATGC GTCACCAGGT TGCGGGCAAT CTGCAAACGC TGCTGCATAC 
039271 CGCCGGAAAA GGTGGTCGGC AGGTCGTCGA TCCGGTTGGC GGGAATCTCC ACCTCTTCCA GCCACTTCTG 
039341 CGCGGTGGCA CGAATATCGC CGTAATGACG TGCCCCGGTC GCCATCAGCC GCTCGCCGAT ATTGCCGCCT 
039411 GCCGACACCT GGCGGCGCAG GCCGTCGAGT GGATGCTGAT GCACCACGCC CCATTCGGTA CGCAGCAGGC 
039481 GACGGCGGTC GGCCTCGCTC ATTGCATACA GCGAACGGTT CTCGTAGTGA ATTTCCCCCT GCTGCGGCGT 
039551 CAGGCGCGCG GAGATCGACT TCAGCAGCGT GGTCTTCCCG GAGCCGGATT CCCCGACAAT GCCCAGCACT 
039621 TCCCCCGGCC ATAAATCAAA AGAGACATCG CTAAAGCCTT TGCCCGGCGC GTAAAGGTGG GTCAGGTTAT 
039691 TGACCGAAAG TAACGGTTGA TTCATTGGTT TTTTGCCTCG CTCTGTTGGC GGCAATAATC GGTATCGGAG 
039761 CAGACAAACA TGCGGTTTCC GGCGTCATCC AGCACCACTT CATCAAGATA GCTGTGGGTC GATCCGCAGA 
039831 TGGCGCATGG CTCATCCCAC TGCTGAACGG TGAACGGGTG ATCGTCGAAA TCGAGACTTT CCACGCGGGT 
039901 AAACGGCGGC ACCGCATAGA TGCGCTTCTC GCGCCCCGCG CCGAACAGTT GCAGGGCGGG CATCATGTCC 
039971 ATTTTTGGGT TATCGAATTT CGGGATCGGC GACGGGTCCA TCACGTAGCG CCCATTTACC TTCACCGGAT 
040041 AGGCGTAGGT GGTGGCGATA TGACCGAAGC GGGCGATATC TTCATACAGT TTCACCTGCA TCACGCCGTA 
040111 CTCTTCCAGC GCGTGCATGG TGCGGGTTTC CGTTTCGCGC GGCTCGATAA AGCGCAGCGG CTCGGGGATT 
040181 GGCACCTGGA AGATAATTAT CTGATCTTCG GTCAGCGGCG TTTCGGGGAT GCGGTGACGC GTCTGGATAA 
040251 CCGTCGCATC GTCCGTACGT TCCGTGGTGT TTACCCCGGT CACGCGCTTG AAGAAGTTGC GAATCGACAC 
040321 GGCGTTGGTG GTGTCATCCG CGCCCTGGTC AATCACCTTC AGCACGTCGC TTTCGCCAAT CACGCTGGCG 
040391 GTAAGCTGAA TGCCGCCGGT TCCCCAGCCG TACGGCATCG GCATCTCGCG CCCGCCAAAC GGCACCTGAT 
040461 AACCGGGGAT CGCCACCGCT TTTAAGATGG CGCGGCGGAT CATGCGTTTG GTCTGCTCGT CGAGGTAGGC 
040531 AAAGTTGTAG CCGCTCAGAT TAGCCATGGT TCTGCTCCTG TTGCAGACGT TTGAGTAGCT CCAGTTCGGC 
040601 CTGGAAATCG ACGTAGTGGG GGAGTTTGAG GTGTGAGACA AAGCCTGCGG CTTCGACGTT GTCGGCATGT 
040671 GCCAGCACGA ACTCTTCATC CTGCGCCGGG CCTGTCGCGT GCTCGCCGTA CTCCGGGGCT TGCAGAGCGC 
040741 GGTCGACCAG CGCCATCGCC ATCGCTTTGC GCTCGCTCAT GCCGAACACC AGCCCGTAGC CGCGCGTGAA 
040811 GTGCGGCGGC TCACCCGGCG GGTCGATAAA ACCGTTAACC ATTTCACACT CAGTCATCAG CAGTTCGCCG 
040881 ACGTTCACCG CAAATCCCAG CTCTTCCGGC ACAATCGACA CGTCGATATA GCCGCTGCGG ATCTCGCCTG 
040951 CGAACGGGTG ATTGCGCCCG TAACCGCGTT GGGTGGAGTA GGCCAGCGCC AGCAAATAGC CTTCGTCGCC 
041021 GCGCATCAAC TGCTGCAAAC GGGAGGAGCG TGAGCAGGGG TAAACCGGCG GCGTGCGGGT GATGTCATCC 
041091 GGCTGTGCGC CGCTATCCTC TTCAAACTTC GCCAGCCCCT GACGCGCCAG CAGGCTGAAA ACGTGCGGCG 
041161 ACGGCTGCTG TTCGCTGTCG GCGGTGGTCA GCGTCGGCGC TTCGCCGTTT GCCAGCAGGG TAAAATCGAG 
041231 CAGGCGATGG GTGTAGTCGT AGGTTGGGCC AAGCAGCTGG CCGCCGGGAA TGTCTTTATA AACGGCGGAG 
041301 ATACGGCGTT CGAGACGCAT CCCGGTGGTG TCGAGCGGCT CGCTTACCGC CAGCTTCGCC AACGTGGTGC 
041371 GGTAGGCGCG CAGCAGGAAA ATCGCTTCAA CGTTATCGCC GCTGGCCTGT TTCAGCGCCA GCGCCGCCAG 
041441 TTCGCGGTCG GCAATGCCGC CTTCGGTCAT CACGCGATCT ACCGCGAGGT TAAGCTGCTG TTCAATCTGG 
041511 GCGACGCTCA GTTCGGGCAA ATCGGTATCG CCTCGGCGTC GGCTCTCTTG CAGGGCGTGG GCGGCGTCGA 
041581 TCGCCTTCTC GCCCCCTTTC ACGGCAACGT ACATCAGCAC ACCTCCACAT GAGTGGTTCG CGGAATAGCC 
041651 AGCAGGCGCT CGCCACAGGT CAGGATCAGG TCGATGCCGA GCGGGAACGG ATGCGGGCGC TCGGTGAGTT 
041721 CGTGCAGAAT GCACTCCGGC AGCTGCGGAG CGATCATTCG TTCTTCGGCA ATACCCGCAC CAGTAAGGCG 
041791 CAACATGCGT CCGCCGCTCA GGCTGGCGAC CTGTAAAATC AGCGTCGCAC CCGCTTCCGG CGCAACGGCG 
041861 GTGCCGGTGG AAAGGGCGTT GAGCTGTTCG CTGGAAATCG CCTCATCCGT CACCGCGAAG GTCGCCTGTT 
041931 CCGGCTGGCT GACCAGCGGC GCGTTGGTAT GAAAACGCAG GCTCTGGTTG ACGATATCGT TATTTAATGG 
042001 GGTAGAAAGC CACACCGGCG TGTCGTTATC GGCCAGCGTC AGCAGCACGC TGGTGGTGGC GATATTCAGC 
042071 GGTTGCCAGC CGCGTTTGAG CTGATGCAGG GCGACAATCA CGCCCGGCTC GCTCATGGCC TTTAACAGGC 
042141 GACGAAAACT GTGCTGGGCA TCCTGCACGG GAAGCATAAA AGCGGTTTCC AGGGTCATGC GTTGTCTCCG 
042211 CGAACCATCG TAAAGAAGTC GACCCGGCTG GCGTTCACTT CGGCCTGGCG TGCGGCAATG CGTGCCATAC 
042281 GGTCAGCGTC CAGCGGGGCA ATAAGGGTTT CTGATAAGTT TTGAAAGTGG CGAGATTGCT GCATCAGCGC 
042351 GTCAATCAGC GCGCAGCGTT CGGCGTGCTG TTTATCACGC CCCTGCACCC AGCTGTAGCC GAGCGTGCCG 
042421 TCAGTCAGGC GCACGGCGGC GCGGGTCAGC GTGGCGTCGC CGGCAAAAAA ACGTTCGCCG GTGCCGCCCA 
042491 TCCGCGCCTG AATCTGTACC AGGCCAGTTT CAGCGGCGCG GATCACCTCA TAGTCGGCGG TGATGTTTAG 
042561 CGCGTTCAGG CGTGCTGCCA GTTCAGCCGG TTGGCTGTGC GCCAGCACGG ACATCCAGTG CTGGCGGGTC 
042631 GCGGTATCTG CGTGCATTCA GTGCTCCATA GTGAATTCAA TCATGTCGGC GCGCGTCAGG CTGACGGAGT 
042701 ACTCCGCCGG GCTGCTTTCA CCGTCACGGT GGTTAAGGGT GCGCACGCAC AGCAGCGGCG ACATATTCGG 
042771 GATTTCAAGA CGCTGGCACT CTTTGGCCTG GGCGCGGCGG GCGCTGATCC GCGTCTGGCT GCGGCGCAGC 
042841 GCAATTCCGG TTTGCTCGCG CAGAAAATCG TGCAGCGAGC CGCTGTCGAA GCGTTGCAGC GTCGGCCAGA 
042911 GGGTGAGGTC CGCGAAGTAG TGGTCGATTA AACAGAGCGC GACGCCGTTG ACACGACGCA GGGTGCGCAG 
042981 GTGGATGACG TTCTCCCCCT CGGTAATCCC CAGTGCGTCA GCGACGTGGC CGGACGCGGG GCGCAATACC 
043051 GAAAGCAGTT TTTCGCTGGT GGGATGGCTG CCCTGATCCA GCAGATTCTG GCTAAAACGC GCCTGGGCGT 
043121 TGAGCGGGTA ATCGAACGGG CGCATCAGCA CCAGCACGCC GACGCCCTGA CGGCGCTGTA CCCAGCCTTT 
043191 TTCCACCAGT TGGTCGATGG CGCGGCGCAG GGTGTGGCGA TTCACCTCAA AGCGCGCTGC CAGTTGCTGC 
043261 TCGGCGGGAA GATAGTCGCC GCAGCGGTAG TGTTGACGAA GCTCCTGCTC AAGTTTTGCG GCTATCTCTT 
043331 GATAGCGTGT TGGGTAGCTG GTCGGATGTG TAGACAAGTG CATAGATATC AATGCCTCGC TTATCAGATA 
043401 AAGTGCTTAC GCAACCGTTG AGAGAGGAAA TCCAGCAGGC TGACCGTGAC GATGATAAGC ACCATCAGGG 
043471 CGCAGGTTTG TTGGAACTGG AAACCGCGAA TCGCTTCCCA CAGGGTGACG CCGATCCCGC CTGCGCCGAC 
043541 CATGCCGACG ACGGTCGCCG AGCGGACGTT GGATTCGAAG CGATAGAGGG AGTAGGAGAT CAGCAGTGGC 
043611 ATCACCTGTG GCAGCACGCC GTAGAGGATC TCTTCGAGCT TGTTGGCACC GGTGGCGCGA ATGCCTTCCA 
043681 CCGGGCCGGG CTCAATCGCT TCCACCGCTT CGGAAAGCAG CTTGGAGAGC ACGCCGGTGG TGTGGATAAA 
043751 CAGCGCCAGC ACGCCAGCAC GCCAGCGAAC GGGCCGAGGC CGACGGCGAC CACGAACAGC ATGGCGAAGA 
043821 CCATTTCGTT AATGGCGCGG CAGGCGTCCA TCAGGCGGCG AACGGGCTGG TAAACCCACC ACGGCACCAG 
043891 GTTTTCGGCG CTCATCAGGC CAAAGGGGAT GGAGAGAACC ACCGCCAGCG CGGTGCCCCA GACGGCGATT 
043961 TGCAGCGTGA CGGCCATTTC GGTGAGGTAA TCCTGCCACT GGCTGAAATC GGGCGGGAAG AAGTCGGCGG 
044031 CGAACGTCGC CATGTTGCCG CCGTCTTTGA TCAGCGTAAG CGGGGCCATT TCCGCGCCCT GCCACGAGAC 
044101 GACCAACACG GCGAGTACAA CGGCCCAGCT CAGAAGCGAG AACCAGCTGC GCTTGGGTGG GGCGATGGTG 
044171 ATGGTTTGCA TGTTTGGCTC CGGTCTGTAG GCCGGATAAG GTGCTTGCAC CGCATCCGGC ATCAACGCCT 
044241 GCACATTGTC GGATGCGACG CCGGGGCGTC TTATCCGACC TACGATTTAC TGCACCGCTT TACTCACCGA 
044311 ACTCATCGCG CTTAGCGCGT TGTTCAGGCG GTCCAGGTCA TCCAGCTGCG CCTGAATCTC GGTGGTTTTT 
044381 GCCAGCTTGT CCTGCTCATT CAGTCCTTTA TTGCTTTTCA CGCCCTGCAT CTCTTTAAAC AGCGCGAGCT 
044451 GGCGAATCGG CACCAGTTGC AGGTCGCTGG AAGCGCGGAA TGGCGCCCAG CCCAGGCGTT CCAGCACCGC 
044521 TTTTTCTTCC GGCGTTTTGC CGTAGTTCAT AAAGAAGTCG TAGATCTTGT CTTTGGTGGT TTCGGAAAGA 
044591 TTCTTGCGCC AGACGATCGG ATCGCCTGGG ATCAGCGGCG ACTTCCAGAT CACCTTCAGT TCTTTCAGCT 
044661 TCTCTGGCGC GGAGGTTTTC AGCTTGTCGA GGTTTTCGGT GTTGTTGGTG GCAACATCCA CCTGCTTGTT 
044731 GGCGACGGCC AGCGCGTTGG TTTCATGCCC GGCGTTGACG GTGCGCTTGA AGTCGCTGGC GGAGATATTG 
044801 TTTTTGGCGA AGACGTAGTA GCCGGGGACG AGGAAGCCAG AGGTGGAGTT AGGATCGCCA TTGCCAAAGG 
044871 TGAGATCTTT CCGCTTCGCC AGCAGATCGT TCAGGTTGTT GATCGGACTG TCTTTGTTGA CGATCAACAC 
044941 GCTCCAGTAA CCCGGCGATC CATCCGCCGC GACCGTCTGG GCGAAGACCT GGCCATTGGC GCGATCCACC 
045011 GCTTCCATCG CCGACAGATT GCCGTACCAG GCGATATCCA CTTTATTGAA GCGCATCCCC TGGATAATGC 
045081 CCGCGTAGTC CGGGGCAAAG AAGGCGTTGA CCTTCACGCC CAGCTTCTTC TCCATATCCT GCAAGAACGG 
045151 CGTCCATTGC GGTTTCAGGT TTTGCTGTGA TTCCGTTGAA ATAATGCCGA AATTCAACGC CTTTTCCTGC 
045221 TCTTCGGCGT GCGCCGGGCT TAACAGGGTG CTGAGGCTGA ACATGCTGGT GAAGGCCAGC GAGGCAATTA 
045291 TCTTAGCGTT CATTCGTTTT CCTCAATGAT GGGGATGTCA GGCAGCTTTC GCGTTCTCTT CGACGCGGTT 
045361 AATGCTGCGG TAGAGATGGT CAAAACGTTC GTTATCAAAC TGTTGGCTGC TGCCGTCGTA GAAGACGTGC 
045431 CCCTGGCGCA GGGCGACGAT GCGTTCGCAG TAGCGCAGGG CGTAATCCAC CTGATGCAGC GTGACGACCA 
045501 CGGTGATGCC GTCGTTCTGG TTGATGTCGC GCAGGGTGTC CATCACGATG CGCGCTGATT CTGGGTCCAG 
045571 CGAGGCGATG GGTTCATCGG CCAGAATCAC TTTCGCCTGC TGCATCAGCG CACGGGCAAT CGCCACACGT 
045641 TGCTGCTGGC CGCCGGAGAG GGTGGAAACG CGCTGATGGG CAAAATGCAC CATGCCAACG CGGGTCAGCG 
045711 CCTGTAACGC GCGCTGTTTC TGCTCGCCGG TGAACCAGCT AAAACAGGTG CGCCAGAACG GCGTGCTGCC 
045781 GAGCGCGCCA ATCAGCACGT TCTCCAGTAC GCTCAGGCGG TTCACCAGGT TGAATTGTTG GAATATGTAG 
045851 CCGGTATGGG CGCGGCTTTT GCGGATATCG CGGGCCAGGC GGCCTTCGCG CTGGACTGTG CGGCCCAGCA 
045921 GCTCGATATG GCTACCGACA GATTTATCGC CGGTAATCAA ACCGCTTAAG TGACGTAAAA GGGTGGATTT 
045991 TCCGGAACCC GACGGCCCAA GCAGAGCCAC CATTTCACCG TGATGAATGT TCAGATCAAC CGCATGCAGC 
046061 GCCTGATGCT GATTGAAGGT TTTGGCGAGC TTCTCGACAC GGATAATCGT TTGCATGATG CAGCCTCCCT 
046131 AAAAAAGTGG CTCCATCGTG GCGGATTATT GTGACGATTT GGTTAATTAA AAGTGACTAA CAGATGAAGA 
046201 GTTAACGGGA ATTCGATGAC AGTGCGGGAG GGCGGGCCTC CCGGCGGGTT ATTGCGTTGG TTGTTGTTTG 
046271 ACGACATTAA TCATCCACGG TACGCCAAAT TTATCGGTGA CTTTGCCAAA GCCATGCGCC CAGAAAGTTT 
046341 CCTGCCAGGC CATTTCGATT TTTCCGTTAG CGGCAAGATT GTCAAACCAG CGTTTTCCTT CTTCGACCTG 
046411 TTGCGAATCG AGCACCAGCG TAAAGCCGGA GTAGCTGGCT TTTCCTGACG GCATGGCATC GCTCATCATG 
046481 ATGTCGCTTC CGGCAATGCG CACATTGGCG TGGGCGATGG CGGTATCGGG AAATTGCATT CCGGAAGGGC 
046551 AGTTCTCGGC GCTGTCCTGC GCTGATTTTG GCATTTCGCC GAAGCTGATT TTATAGAGCA GTTCCGCGCC 
046621 CAACGTACGT TGATAATAGG CAATCGCGTC GGAACAGTTA CCGGCAAAAG AGAGGTAGGG ACTTAACGGC 
046691 ATGATGGTGA CCTCAGTTAA GAGAAGCCAG TTAAGTGTAG TTCGAAATTT ATACAGATGA GAGGCGGCCT 
046761 GATAAGACGC GCGAGCGTCG CATCAGGCAG TCGGCACTGT TGCCGGATGC GGCGTAAACG CCTTATCCGG 
046831 CCTACGGAGG GTGCGGGAAT TTGTAGGCCT GATAAGACGC GCAAGCGTCG CATCAGGCAG TCGGCACCAT 
046901 TGCCGGATGC GGCGTAAACG CCTTATCCGG CCTACGGAGG GTGCGGGAAT TTGTAGGCCT GATAAGACGC 
046971 GCAAGCGTCG CATCAGGCAG TCGGCACCGT TGCCGGATGC GGCGTAAACG CCTTATCCGG CCTACGGATG 
047041 GTGCGGGAAT TTGTAGGCCT GATAAGACGC GCAAGCGTCG CATCAGGCAG TTGGCACTGT TGCCGGATGC 
047111 GGCGTAAACG CCTTATCCGG CCTACGGAGG GTGCGGGAAT TTGTAGGCCT GATAAGACGC GCAAGCGTCG 
047181 CATCAGGCAG TCGGCACCGT TGCCGGATGC GGCGTAAACG CCTTATCCGG CCTACGGAGG GTGCGGGAAT 
047251 TTGTAGGCCT GATAAGACGC GCAAGCGTCG CATCAGGCAT CTGGCACCGT TGCCGGATGC GGCGCGAGCG 
047321 CCTTATCCGG CTTACCGATC ACAATACAAT CAGTTCTTTT TCACAAACTC AGATTTCAGT TTCATCGGAC 
047391 CAAAACCGTC GATTTTGCAA TCGATGTTAT GGTCGCCTTC AACCAGGCGG ATGTTTTTCA CTTTGGTGCC 
047461 AATTTTCAGC ATCGAAGAGC TACCTTTCAC CTTCAGATCT TTAATGATGG TAACGCTGTC GCCGTCAGCC 
047531 AGCAGATTGC CGTTAGCATC TTTAACGATC AGCTCGTCGC TTTCCTGTGC AGGTTCTGCG TCGTTCCATT 
047601 CGTAGGCACA TTCCGGGCAG ATGTACATGC CGTTATCTTC GTAGGTGTAT TCGGAGTTGC ATTTTGGGCA 
047671 GTGTGGTAAT GACATGTGGA TTTCCTCAAA AGTCAGCAGG GCAAAAGCGC CAAAAAACGG CAGATTGCCG 
047741 AAAAAGGCCG CAATTATACA CAAAATCCCT GAGTTTGTCG GGGGTACTGC TGATTTTAGA CGACGATCGT 
047811 TTTCATTTGA AAGGAAACGC AAAAAGAAAA TAATCTTTTT GCCTCTATTT ATTATTTAAG ATAATGTTAA 
047881 TGCTCTACTT GTTCTTTTTT TAATTCACAT GATATTTTTA TCTTTCTGAC GTTTTAAACG TATCAGAAGA 
047951 CGTTATTTAT TCTGATAAAA AACAACACAC TAAATATAAA ATTATTTCTT GCAGTAATTA TAAAAGCCGA 
048021 AAACAGAACT CAAAAACAAT CTGGCTAAAT AAAATAACAA AATTTGCTTT AAGGAAGAAT TTTCTATGTA 
048091 CACACAGACC CTGTATGAGT TAAGTCAGGA GGCTGAACGC CTGTTACAGC TTTCTCGCCA ACAGTTGCAG 
048161 TTACTGGAAA AAATGCCTCT CTCTGTACCC GGAGACGACG CGCCACAACT GGCTTTACCC TGGAGTCAGC 
048231 CTAATATCGC CGAACGTCAC GCGATGCTGA ATAATGAGTT GCGTAAAATT TCCCGACTGG AAATGGTGCT 
048301 TGCAATTGTC GGTACCATGA AAGCAGGGAA ATCAACCACC ATTAATGCCA TTGTTGGTAC GGAGGTTCTG 
048371 CCTAATCGTA ATCGCCCAAT GACTGCGCTG CCGACGCTTA TTCGCCATAC GCCCGGGCAA AAGGAACCGG 
048441 TACTGCATTT TTCACATGTC GCGCCAATCG ATTGTTTAAT TCAACAATTA CAACAGCGCC TGCGTGATTG 
048511 CGATATTAAG CATCTGACCG ATGTGCTGGA AATAGATAAA GATATGCGTG CGCTTATGCA GCGGATCGAA 
048581 AATGGCGTCG CTTTCGAAAA ATATTATCTG GGTGCCCAGC CTATTTTTCA TTGTCTGAAA AGTTTGAATG 
048651 ATTTAGTGCG ACTGGCGAAG GCGCTGGACG TCGATTTTCC TTTTTCTGCT TACGCCGCCA TTGAGCATAT 
048721 TCCCGTGATT GAAGTGGAGT TTGTCCATCT AGCGGGGCTG GAGAGTTATC CCGGTCAGTT GACGTTACTG 
048791 GATACCCCCG GGCCAAATGA AGCCGGGCAA CCGCATCTGC AAAAAATGCT TAACCAGCAG CTGGCACGCG 
048861 CCTCGGCGGT ACTGGCGGTG CTGGATTATA CGCAACTGAA ATCGATCTCC GATGAAGAGG TCCGTGAGGC 
048931 GATTTTGGCG GTGGGGCAAT CGGTGCCGCT GTACGTGCTG GTCAATAAGT TCGATCAACA GGATCGTAAC 
049001 AGTGACGACG CCGACCAGGT GCGGGCACTG ATTTCCGGGA CGCTGATGAA AGGCTGTATT ACGCCACAGC 
049071 AGATATTTCC GGTGTCGTCG ATGTGGGGCT ACCTGGCGAA TCGGGCGCGC TATGAGTTAG CCAACAACGG 
049141 TAAGTTACCA CCGCCAGAGC AACAACGCTG GGTGGAAGAT TTTGCCCATG CCGCGCTTGG CAGGCGCTGG 
049211 CGTCATGCCG ATCTGGCGGA CCTCGAACAT ATTCGTCATG CTGCCGATCA GTTGTGGGAA GATTCGCTGT 
049281 TCGCCCAGCC AATTCAGGCG TTGCTTCATG CCGCTTACGC TAACGCCTCG TTGTATGCTC TGCGATCTGC 
049351 CGCGCATAAA CTGTTGAATT ACGCGCAGCA GGCGCGGGAA TACCTGGATT TTCGTGCGCA CGGGTTAAAC 
049421 GTCGCTTGTG AACAATTGCG GCAAAATATC CACCAGATCG AAGAAAGTTT GCAGCTATTG CAACTCAATC 
049491 AGGCGCAGGT GAGCGGCGAG ATTAAACATG AAATCGAGCT GGCCCTGACC TCCGCCAACC ACTTTCTGCG 
049561 TCAACAGCAA GATGCGCTGA AGGTGCAGTT AGCCGCCTTG TTTCAGGATG ATTCGGAGCC GTTAAGCGAG 
049631 ATTCGTACCC GCTGTGAGAC ACTGTTACAG ACGGCGCAGA ACACCATCAG TCGCGACTTT ACGCTGCGTT 
049701 TTGCCGAGCT TGAATCCACC CTTTGCCGGG TGTTAACCGA TGTTATTCGC CCCATTGAGC AACAAGTCAA 
049771 AATGGAATTG AGCGAGTCAG GGTTTCGTCC TGGGTTTCAT TTTCCTGTTT TTCACGGCGT AGTTCCCCAC 
049841 TTCAACACTC GCCAGCTGTT CAGTGAAGTC ATTTCGCGCC AGGAAGCAAC GGACGAGCAG AGCACGCGTT 
049911 TAGGCGTTGT GCGTGAGACT TTTTCGCGCT GGTTGAATCA GCCCGACTGG GGACGGGGAA ATGAGAAATC 
049981 ACCGACAGAA ACGGTTGATT ACAGTGTGTT GCAACGAGCA TTAAGCGCAG AAGTCGATCT CTATTGCCAA 
050051 CAAATGGCTA AAGTTCTGGC AGAGCAGGTC GATGAATCTG TTACGGCAGG CATGAATACT TTTTTCGCTG 
050121 AGTTCGCTTC ATGTTTGACG GAATTACAGA CGCGTTTACG CGAAAGTCTG GCTCTGCGTC AACAAAATGA 
050191 ATCGGTGGTC AGGCTGATGC AGCAGCAATT GCAGCAGACT GTGATGACTC ACGGCTGGAT TTACACCGAC 
050261 GCCCAGCTGT TACGCGATGA TATTCAAACA CTTTTCACGG CAGAACGATA TTGACCAAGA CGTTACTTGA 
050331 CGGCCCCGGT CGCGTGCTGG AGTCGGTTTA TCCCCGCTTT TTAGTGGATC TGGCGCAGGG TGATGATGCC 
050401 CGCCTTCCAC AAGCCCATCA GCAGCAGTTT CGTGAACGAC TGATGCAGGA ACTTCTTTCG CGTGTGCAGC 
050471 TTCAGACATG GACGAACGGC GGCATGTTAA ATGCGCCGCT TAGCCTGCGT CTGACATTGG TGGAAAAACT 
050541 GGCGTCGATG CTGGATCCCG GTCATCTGGC ACTGACGCAG ATCGCGCAGC ATCTGGCGCT GCTGCAAAAA 
050611 ATGGATCACC GCCAGCACTC TGCTTTCCCG GAGCTCCCCC AGCAAATTGC CGCCTTGTAT GAGTGGTTTT 
050681 CAGCCCGTTG TCGCTGGAAG GAAAAGGCGT TAACGCAACG AGGCCTACTG GTGCAGGCAG GTGATCAGAG 
050751 CGAGCAAATT TTTACCCGCT GGCGTGCTGG GGCGTATAAC GCCTGGTCGT TGCCTGGGCG CTGTTTTATC 
050821 GTTCTGGAGG AGTTGCGCTG GGGGGCATTT GGCGATGCCT GCCGTCTGGG AAGCCCGCAA GCGGTGGCGT 
050891 TGTTGCTGGG TGATTTGCTC GAGAAAGCGA CACAACATCT GGCAGAGAGT ATCAATGCGG CACCGACCAC 
050961 GCGTCACTAT TACCATCAGT GGTTTGCCTC TTCGACCGTT CCGACGGGCG GGGAGCATGC TGATTTTTTA 
051031 AGTTGGCTGG GAAAGTGGAC CACGGCAGAT AAACAACCCG TTTGCTGGTC AGTGACCCAA CGCTGGCAAA 
051101 CTGTCGCGCT GGGGATGCCA CGACTCTGTT CAGCGCAGCG TCTGGCGGGG GCAATGCTCG AGGAAATCTT 
051171 CTCTGTAAAT TTGGCGTAAA TAATCAGTTA CATCAATGAG TCCTAAACGA AATCCATGTG TGAAGTTGAT 
051241 CACAAATTTA AACACTGGTA GGGTAAAAAG GTCATTAACT GCCCAATTCA GGCGTCAACT GGTTTGATTG 
051311 TACATTCCTT AACCGGAGGG TGTAAGCAAA CCCGCTACGC TTGTTACAGA GATTGCATCC TGCAATTCCC 
051381 GCTCCCCTTT TGCGGCCGTC GCGCTGATTT TTCTGGCGTT TGCGGAAATG GGCCAACTCT GCGAGGAAAG 
051451 CTATGCTGAA AAGGAAAAAA GTAAAACCGA TTACCCTTCG TGATGTCACC ATTATTGATG ACGGTAAACT 
051521 GCGTAAAGCC ATTACCGCAG CATCACTGGG TAATGCAATG GAATGGTTCG ATTTTGGTGT TTATGGTTTT 
051591 GTTGCTTACG CATTAGGTAA AGTTTTTTTC CCGGGGGCTG ACCCCAGCGT GCAGATGGTT GCTGCACTTG 
051661 CCACTTTCTC CGTTCCCTTT CTGATTCGAC CGCTTGGCGG ACTCTTCTTT GGTATGTTGG GCGATAAATA 
051731 TGGTCGCCAG AAGATCCTCG CTATCACTAT TGTGATTATG TCGATCAGTA CGTTCTGTAT TGGCTTAATA 
051801 CCGTCCTACG ACACGATTGG TATTTGGGCA CCGATTCTGC TGTTGATCTG TAAGATGGCA CAAGGTTTCT 
051871 CGGTCGGCGG TGAATATACC GGGGCGTCGA TATTTGTTGC GGAATACTCC CCTGACCGTA AACGTGGCTT 
051941 TATGGGCAGC TGGCTGGACT TCGGTTCTAT TGCCGGGTTT GTGCTGGGTG CGGGCGTGGT GGTGTTAATT 
052011 TCGACCATTG TCGGCGAAGC GAACTTCCTC GATTGGGGCT GGCGTATTCC GTTCTTTATC GCTCTGCCGT 
052081 TAGGGATTAT CGGGCTTTAC CTGCGCCATG CGCTGGAAGA GACTCCGGCG TTCCAGCAGC ATGTCGATAA 
052151 ACTGGAACAG GGCGACCGTG AAGGTTTGCA GGATGGCCCG AAAGTCTCGT TTAAAGAGAT TGCCACTAAA 
052221 TACTGGCGCA GCCTGTTGAC ATGTATTGGT CTGGTAATTG CCACCAACGT GACTTACTAC ATGTTGCTGA 
052291 CCTATATGCC GAGTTATTTG TCGCATAACC TGCATTACTC CGAAGACCAC GGGGTGCTGA TTATTATCGC 
052361 CATTATGATC GGTATGCTGT TTGTCCAGCC GGTGATGGGC TTGCTGAGTG ACCGTTTTGG CCGTCGTCCG 
052431 TTTGTGCTAC TTGGTAGTGT TGCCCTGTTT GTGTTGGCGA TCCCGGCGTT TATTCTGATT AACAGTAACG 
052501 TCATCGGCCT GATTTTTGCC GGGTTACTGA TGCTGGCGGT GATCCTTAAC TGCTTTACGG GCGTTATGGC 
052571 TTCTACCTTG CCAGCGATGT TCCCGACGCA TATCCGTTAC AGCGCGCTGG CGGCGGCATT TAATATTTCG 
052641 GTGCTGGTTG CCGGTCTGAC GCCAACGCTG GCGGCCTGGC TGGTCGAAAG CTCGCAGAAT CTGATGATGC 
052711 CTGCCTATTA CCTGATGGTA GTGGCGGTGG TTGGTTTAAT CACCGGCGTA ACCATGAAAG AGACGGCAAA 
052781 TCGTCCGTTG AAAGGTGCGA CACCGGCGGC GTCAGATATA CAGGAAGCGA AGGAAATTCT CGTCGAGCAT 
052851 TACGATAATA TCGAGCAGAA AATCGATGAT ATTGACCACG AGATTGCCGA TTTGCAGGCG AAACGTACCC 
052921 GCCTGGTGCA GCAACATCCG CGAATTGATG AATAAGCTGA AACGGATGGC CTGATGTGAC GCTGTCTTAT 
052991 CAGGCCAATT GAACTCTTAA GGTTCACTTA ATCTCTGACG CGCATACTCT CCTCCAGGTT AACGGAGGAG 
053061 AGTGCAATGA AAAACCGTGT TTATGAAAGT TTAACTACCG TGTTCAGCGT GCTGGTGGTC AGCAGCTTTC 
053131 TTTATATCTG GTTTGCCACG TACTGATCTT TCTTCAGCCG TACCCAGGCC CGCGTGCCGG AAGTCTCTTG 
053201 CCGGTTTTGC AGGAAAAACT GCCCGTGATG CAACTGTGTA ATGCGGCTGA CAATACTTAA CCCCAGACCA 
053271 ATCCCGCCAT AACGGCTGTC CATACGTACA AACGCTTTAC TCAACTCCCC GCATTTACTC TCATCAATAC 
053341 CTGGTCCTTC ATCTTCAACT GCCATGACCG CTCCGTCATC TTCTTGCAGC TTAATCATAA TGTTGCTGCC 
053411 TTGCGGGCTG TAACGATGGG CGTTTTCTAC CAGGTTTCGC AATAACATCC GCAGCAGGGT TGCATCACCC 
053481 TGAACGGTGA TGTCGGCGGC GCTCTCTGGC AATAGCAGGG TTTGCTGTCG CTGGTCGAGC ATGGTACTGA 
053551 GTTCGTCATA CGAGGGGAGA ATGACATCTT CCAGCAGTTT TACATGTTGA TAATTACCGG AAGAAAATGA 
053621 CTGTCCGGCA CGCGCCAGTT GCAGCAGCTG GGAGACGCTC TCCATCATCT GATCAAGCCG TGCCACTAAC 
053691 GGTGCTACAT CAATGTGATG CGTTTTCGCC AGCAGTTCCA GATGCAAACG CACCCCCGCC AGTGGCGTTC 
053761 GCAGTTCGTG CGCGACGTCA GCGGTAAACA ACCTTTCGTT ATCCAGCGTG CTGGTCAGGC GACTGACCAG 
053831 ATCGTTTAAC GCCGAAACCA CCGCTTCGAT TTCGAGGGTG GCGCTGTGAA TGGCAATGGG CGTTAAGTTG 
053901 TCGGCGGTGC GCGCTTCCAG CTCTTTTTGC AGCTCCGCCA GCGGGCGGGT GATGCGGCGT ACCGCCTGAT 
053971 AGCAGATAAA TAGCGTCAGG CTGACCATAA AGACGCCGGG GACAATCAGG CTGGCGACCG CCTCGCGGAT 
054041 CTCACGCATG ATGTGGCGAT CGTTGTTGCG ATTGTCGCGT AGCGCCTGCT CAAACAGCTG AATCTGCTCG 
054111 GTACTTTCAT GCCATAGCCA GAAGACGCTG ATCAGCTCAA ACACCAACAA AATGGCCCCG ATGGTCAATA 
054181 TCAGCCGTTG GCGCAGCGAT ATTGGTCGGC GCAGAAAATG CATCAGATTC AATTAGTTTT CCTCATTCGC 
054251 GACCAGCATA TAGCCAAAGC CGCGCACGGT GCGGATACGG GCTTTGCCCA CTTTGTCGCG CAGATTGTGG 
054321 ATATGCACTT CCAGGGTGTT GGTCGAGGGT TCATTGTCCC AGTTATAGAT GTCGTTGTAG AGAATTTCCC 
054391 GATGCACCGG ACTGCCTGCT TTGAGCATTA ACCGTGACAG CAGAGCATAT TCTTTGGGCG TCAGAATCAA 
054461 CTCTTCACCG CCCATCCATA CCTGACGGCG ACCCATGTTC AGCGTCAGAT TGCCAACAAT CAGCTCACTT 
054531 TCGCCCTGAT TATTATGGCG TCGTAGCAGG GCGCGGATAC GGGCATGTAA CTCTTCCAGC GCAAAAGGCT 
054601 TCACCAGATA GTCGTCGGCA CCGACATCCA GCCCGGCGAT TTTGTCGGTC AGCGTATCGC GAGCGGTGAG 
054671 GATCAGTACC GGCAGGGTAT ATTTTTTCTG CCGGATACGG GCGAGAAAAT GCAGTCCATC TTCGTCGGGT 
054741 AACCCTAAAT CCAGTACCAC CAGGCTGTAA TGACCTGCCT CAAGGCTTTG TTCCGCCATC CGCGCGGTTG 
054811 TCACGCTATC GCACGCGTAG CCTTCGGTTT GCGCCGCCAG AATCAGTCCC TGCAATAACA GCGTATCGTC 
054881 TTCAACAATC AGAATTTTCA TTCACTCACT CTCCTGCAAG TTTGCAGAAT ATCATCCGCA GCCTGGTAAT 
054951 ACTTCGTCTC AACGCCAGTT AATCCCAATA GCGTGGAGAA TAAATTGTCT TGTGAATAGT GTTGCGTTTG 
055021 CGCCTGTTTT TGCAGGCAGT TCTGGTCAAC CTGATACCGT TTTTGATAAT CCTCCGACAG CCACAGCAGC 
055091 ATCGGCACCT GTTTTTGGCT ATCCGGGGCG ATGGCATAAG GCAGACCGTG CAGATAGATG CCATTTTCAC 
055161 CTAACGATTC ACCGTGGTCA GAAAGATAAA CCAGGCTGGT GGTAAATTTA TCCTGATGTT CTTTCAGCAG 
055231 ATTAATCGCT TTATCAACAA TATAGTCGAC GTAAACCAGC GTGTTGTCGT AAGTGTTCAC CAGTTGCTCT 
055301 TTGGTACAGG TCTGGATCTC ATTGGTGTCG CAGGTTGGGG TAAATTTCCT GAACTGAGGC GGATAGCGGT 
055371 TGTAATAGGT CGGACCGTGG CTGCCGATGG TGTGTAAGAC AATCACGCCA TCACCTTGCA GGTTATTGAT 
055441 GTACTCTTCA AGCCCGTGGA ACAGCACTTC GTCATAGCAT TCGCCGTTGA TGCACTGATC AGGTAGATTC 
055511 AGCGCGGTGA CGTTCTGGTG AGGCACGCGG TCGCAGGCAC CTTTACAGCC GCCATCGTTG TCATTCCACA 
055581 GCACGTTGAT GCCCGCTCGC TGAATGATAT CCAGCACGCC TTCCTGGTGC TGTGCCAGCT CTTCTTTGTA 
055651 GTGCTCACGC GGCATATCCG AGAACATGCA CGGTACTGAA ACTGCCGTTG CCGTGCCGCA AGATGCGGTA 
055721 TTAGGGAAAT AGACCACGTT ATCTTTCGCC AGCCGCGGGT TAGTTTCACG CGGGTAGCCG TTGAGGGAGA 
055791 AGTTCTCCGC CCGCGAGGTT TCGCCGACAA TCAGGATGGT CAAATTTTTA CGTTTTTCGT TCTGCATTAA 
055861 CGGGTTGCGG TGCGCGTCTT CACCAATTCG CACCAGCGGC AGATTTGCCA GTCGCTGATG GGAGTACCAT 
055931 GACCAGCTGG CAACAATGCT GTTAGAGGGG CTTAAGGATT TCACCAGCTC TTTGTTATTG CGGAACAACG 
056001 AGGCGTAGTC TTTATAAAAC AGTGCGGCGA CCAGCAAAAT CAGTAGTACA GAAACCAGAA TATTGGCTCC 
056071 ACGGAAAAGA ACACTGCGCA GACGCGAGGT GGCAGGTTTG ATTTTTATCC AGCAGGCAAT CAGCGCAGCA 
056141 AGCACGCCGC TGAATCCCAG CGTTAATAAC ATTTGCGGTG TCATCAGCGC ATAACTTTCT GCCGGAGTGG 
056211 TATCAATAAT ATTGGCAATC ATCGAGCGGT CGATGACGAT GCCGTAAGTC ATTATGAAAT ATTGTGCAGC 
056281 CGCGCCAACC AGAATAAACA GGCAGGCCAG TGGTCGATTA AGCCATAAGA AAGAGCTTAG TGTCAGGACA 
056351 ATATTAATCA CGCTGAAAGC GACGACCGGC ATCGACAAGA AAACCAGTAC GTTATGCAGC GAATCCAGCG 
056421 GCAGCGCCTG CAACACCTGT TTAAAAAAGG CAATATTCAG GCAGATAGAG ATATAAAAAG CGGCCAACAA 
056491 TAGCCAGGCG AGTAAATTCA AAGAGGGTCT TTTTAGTAGG CGCTTCAACA TCACGGTGTT TCCATCGAAC 
056561 AAAGTGCGCA TATGCTCGCA AAGCAAAATT AAGCCAACCT TAAGTTCTTA AGGTTGGCTT TTATGTTTGC 
056631 TGGATTAAGG GGAATTAATC TTTGCTTATT GGTGCATCTA AGGGATACGG GTTTTTATGT AGCCGGTTGT 
056701 AATTCAGCGC ATACATGGCG GTGATGACCA TCAGGGTGAC AAATGACCAC ATAACCTCTT TCGCTCCGGA 
056771 CCCCACCACG GCCCAGATGC AGTAGAGGAA GGCAATGGTA GTAACTGCCA GATATGCCGG GCGTGCTTTA 
056841 CCAAAGTGAC CGTGTCCGAG CAGCAGTAAC GCCGCACAGG TGTAAAGATA TGGCACCAGT GTAAAGATGA 
056911 CCGAGACGGA AGAAACCAGA CCGAACTCTT TGGTCGCGTT TGGTGAAATG CTGCTGAGCT GGAAGATGGT 
056981 CATCAAAATA CCGACGATAA TCAGCCCCGC CACTGGCGTA CCCGCTTTAT TTACACGGGC AAAAATCGGT 
057051 GGGAACAGTC CGTCATCGGC AGCGGCTTTC GCCGTTTGAC CCGCCAGCAA CGTCCAGCCG CCCAGTGAAC 
057121 CTAAGCAACC CGCAGCTGCG CAGAAGGAAA CAATGGCCCC GGCGGTGTCA CCCAACGCCA TCCGTGCGGC 
057191 ATCACCGAAT GGCGAAGCAG AAACGCGCAG TGCGGCATTA GGGATCATCC CCATAATCGC GGTGGTAGAA 
057261 AGTACATAGC AAACGGCGGC AATCAATACC CCACCAATGG TGGCGATAGG GACATTGCGT TTCGGGTTTT 
057331 TCACCACACC TGCGGCAACG GAGGCACTTT CCACACCGAT GAACGACCAC AGCGTAACGT TAAGGGTACT 
057401 TTGAATTGCA CCGAAGGTGC CCAGGCCGCT GACGTTCCAT GCCGCCATAT AGGTTTCACC ACGGAACCAG 
057471 AACCAGCCAA ATACGGCAAT CCCGACGATG GGGATCAGCG CCAGCACGGT GGCAACTGCC TGCACACGGG 
057541 TGATCATTTT CGGACCGACA ATGTTCAGCA GGACGAAGAT CCACAGCACC ACGACGCAGG TGATGGTTAA 
057611 TACCAATGGA TCTTTCAGAA TCGGGAAGAA GTAACTTAAA TATCCTACGC CAATGACCAC CATGGCGATA 
057681 TTGCCGATCC AGCAGGCCAG CCAGTAGAGG ACGTTGGTTT GATAACCGAG AAACGGGCCA AAGCAGCGGC 
057751 GGGCGTAAGC GTAAGAACCA CCAGGACTTG GGTCGAGGAA CGACATTTTG GCGTATACCA TCGAGAGCCC 
057821 CAGTGCACCG ATAATCGTCA CCAACCATCC ATAAATGGCA ATCCCGCCAG TAGAGGCCAG GTTTGCAGGT 
057891 AACAGAAAAA CACCTGACCC CATAATATTC CCCGACACCA TCAGGGTGAC GGGGATTAAG CCCACTTTGT 
057961 GAGCATCAGC ATCCGAAGAC ATAATTAAAC TCCTGCGAAG GCGAGCTTCG TGACAATAAA TTACGTCATA 
058031 TCATACGCCT GCATTCGATA GTTGAATTAT TATCGACCGG GTTATCGCTG ATGCCGTTAT TAATATAGCT 
058101 CTTCGTTAAG GTTAAAAATC AGGCGACAGT GCGTTCTCTG TGCTGACTAA CATAATGCAG CGGCGTCATA 
058171 CCGTAGAAGT CTTTAAAGAC AGAAATAAAG TACGACGTAC TGTTGTAGCC GCAGGACTGT GATACCTGAG 
058241 AGATATTTTT ACCGTCCATC ATTAATTCAT TTACGGCATA ACGCATGCGG CAGGTGGTGA TTATTTGGCT 
058311 ATAACTGGTG TTTTCGCTTT TCAACTTTTT CTTTAACAGA CTTGGGCTAA GACATAAACA ACTGGCTACC 
058381 ATACTAAGAT TCCAGTCTTT GTGAATATCG CTTTCAATAA TTTGATAAAC GCTGTCACTT ACACAATTAC 
058451 GTAACATATA CATCATTAAT GAAACGAATT TTTTACTGTC GAGAAAACGG GATAGCACCG TGAATAATAA 
058521 TGCGCGTGTT CGTTCCTTTT CTGACTCAGT TTCTGCGGGC ATCATGCTGT GTTGCGCGGC AACGCGAAAG 
058591 ACGTCTGGCG TCAGGCATGG CAGGGTGAGT ATGGGCGTAG CGCTACGTTG CCATACTGGT ATTTGCGAGA 
058661 GATCTTTATT CAGAAACCGG AGGTAATCTT TGATGATGTC GTGACTAATA TGAGCAACCA AAGTGTTGTT 
058731 AAGAGAGGAG ACGTCGATAA TATTATTTTC ACAATTTAAT AACGCCATAT GGTTAGCTTT AAGGCTAATA 
058801 GGTTCTTTCC CATTCACCCT TATCCAGACA TCTTTTTCAG TCAATAAAAC AATACAAGGT TGGTCGCTGC 
058871 AAATCCTCAT ACATGTACTC CTGAGTGCGA ATAAAAGACC AGTTCTCGCT AAAGCAAAGC GATACCGGGA 
058941 AATGGTTATA TAATTGTATG ATGAATATAA ACATGCATAA AAATAACGAG TTTTACTAAT AGTACAAATT 
059011 TTTATAGTAA TTTCTCATGT ACATATTTTT TTACAGGATA AATAACAGGC AAAAAAAAGC GCGGGGTGGG 
059081 GCCGCGCAAA AAGTATGACA TTTTTGTTTG CAGCAATTTT TATGAAAACG TTGCCATACT CAAAAGGCCT 
059151 AAGGCCAGGC GGCGTAATGT TATTTAAACA ATTACGCCTT CAGCGGAATA GTGGTTACGC TTTCACGCAC 
059221 ATAACGTGGT AAATACCGTC AATAATTTCA GTCCCTTCAG TTTCGTGTTC AAATCCAGGG AAATGGTGGT 
059291 CCCAGGATTG CAGCGAGCGT AAATAACTTA CTTGCGGACT GTTTTTATCG CCGAAGTTTT CACCAGACAG 
059361 CAGCATCGGG ATTCCTGGCG GATACGGGAT AACTGAGTTT GCCGCGATGC GTCCTGGCAG ATTTTCAATG 
059431 GATACCAGTT CGACATTGTT GTCGACAATC GCGTTGTACG CTTCACGCGG GGTGACTTCC GCCACCGGCA 
059501 GGCCGGAATA GGCTTCGTTC AACCGTGCGC CAGGGTTGTT TTCTTTCAGC CAGGCAAACA TGGTGTCACC 
059571 CAGATCGTGA ATCCCCATGT TCGCGTAAGT GTCAGGATAT TGTTCAACAA GTTCCGGCAT CACCTGCGCC 
059641 AGCGGTGTGT TGGCGTCATA GTGGCGTTTG AAGGAGCAAA GGGTGTTAAC CAGAGTTCCC CATTTCCCAC 
059711 GGGTTACGCC CATAGAGAAC AGGAACATAA TTTGGAAGTC AGTGGTGCGG GTAGGTACAA TGCCGTGGCG 
059781 ACCAAGCCAG GCAGTGACCA GCGCCGCCGG AACACCGGTT TCTTCCAGTT CACCATCTTC ACCCATTCCC 
059851 GGAGCAAGGA TGCTGACTTT AATCGGGTCG AGCATACTCC AGTTATCCGG AATATCTTTG AAGCCGTGCC 
059921 AGCTTTCGCC CGGATGCATT ACCCAGCAGT CCTGAACGGT GGTCAGCAGT TTGGTTGGTG CGTCAGCAAA 
059991 GTCATAGGTT TTGCCGGTTT GTGGGTCGGT GACGACTTCT TTGTTCCACG GTTTGAAGAA CCAGCTACCG 
060061 TCAGCGGTGA ACTCTTTATA TAGCCGCGCC ATCGCCTGAC GGAAATCAAC CGCTTCGTCA ATCACTTCCT 
060131 GTGTCAGTGA CAGGCCGCTG TTGCCGTCCA TCATCGACAC CGCCACGTCG TTGGATGCGC AGATGGCATA 
060201 CAGCGGGGAG GTGGTGGCAT GCATCATGTA GGCCTGGTTG AAGCGGGAGA AGTTAATCGC CCCACGACCT 
060271 TCACGTACAT GAATATAAGA AGCCTGTGAC AGCGCATTCA GCAGTTTGTG GGTGGAGTGG GTGGCGAAAA 
060341 CGGTAGGACC GTTGTGATCG CCAGGTTCGC CGCGCATGGC ATAGTGATCG GCATAGATCG GGTTGAAACG 
060411 TGCATAGCCG TACCAGGCTT CGTCAAAGTG CAGACGATCG GAGGTTTTTT CCAGCAGATC CTGCGCTTCT 
060481 TTAGCGTTAT AACACACGCC GTCATAGGTG CAGTTGGTCA CCACGCAGTA AGACGGTTTT TGCCCGGCTT 
060551 TGTCTTTGGT CAGCGGGCTT TCACTGATTT TCTTCTGCAA GGTTTCAGGT TGCATTTCCT GCGGATAGAT 
060621 TGGCCCGATA ATGCCGTAGC GGTTGCGGCT TGGCACCATA TAGACCGGTT TCGCGCCTGT CAGCATCAAA 
060691 CCTTGTTCGA TGGATTTATG GCAGTTACGG TCAACGACCA CGACATCGTT ATCGGTCATG CAAGCCTGCA 
060761 TGATGGTGCG GTTAGAGCCG GAAGTACCGA CGACTACCGA CCAGGAGCGA TCGGCACCAA ATACGCGTGC 
060831 GGCATATTTT TCGCTTTCGC CAAATGCGCC AGTATGGTCA AGCAAAGAAC CGAGGGAAGT TCGTTCGATG 
060901 CCCATGTCGG TGCGGAACAG ATTTTCACCA TAGTAGTCAT GGTAGAAACG TCCGGCGGGT GTTTTGGTAA 
060971 AACCAACGCC GCCCTGGTGG CCTGGCGCTG CCCAGGAATA TTCATGGATG TCACTATATT TCATCAGCGC 
061041 GCTGAACAGT GGCGGCAACA GCTGCTGGCG GTAGCGGGTC ATCGCGGCAA CGGCGCGTCC GGCGATAAAG 
061111 TCGGCGGTAT CTTCCAGAAT CCAGGCGAAT TCATCGACAA GCTCCAGCAG GTCGCGATCC ATTGCGGCGA 
061181 GGGCTTTTTC CCGATCGCCC AACAGGAAGA CCGGCACGTT TTGTTGGCGC TCATGAAGCT TACCGATCAA 
061251 TTGTCTGACG TTTTGATGTT CGTCCGGATG TTCCATTTGA TAGCTGAACA TCAGGCAGTC AATGGCTTCG 
061321 TTTGAAGAGA GAATGGCAAA ACCATCATCA AAGGAGGTGG ATTTAATCAC GGTAACATTT TGCTGGCTTA 
061391 AAGCATCTGC CAGACGCTCA ACGGCGTTAC CGACCCAGGT GTCTTGATGG AGAAACTCGC TTTCAACAAT 
061461 TAATACTTTC ATCATTGCTT ACCCGGTTAT GAAGGAATCT TCGTTGCGGG CAAGTATCTT CCGGCCTTTT 
061531 CGGGCTGTAA AGCGCGTGAA AAACAAACAT TTTTGAAATA TTTAGTTTTA TAAACAATAC GTTATGTGAT 
061601 TATTTTAAAT TATTTTCACT GCTTATTATC GACGGCTAAA CTATTTTTTT GGCTGATACT GATATCGTCT 
061671 TTAGCCGGGA AACGTCTGGC GGCGCTGTTG GCTAAGTTTG CGGTATTGTT GCGGCGACAT GCCGACATAT 
061741 TTGCCGAACG TGCTGTAAAA ACGACTACTT GAACGAAAGC CTGCCGTCAG GGCAATATCG AGAATACTTT 
061811 TATCGGTATC GCTCAGTAAC GCGCGAACGT GGTTGATGCG CATCGCGGTA ATGTACTGTT TCATCGTCAA 
061881 TTGCATGACC CGCTGGAATA TCCCCATTGC ATAGTTGGCG TTAAGTTTGA CGTGCTCAGC CACATCGTTG 
061951 ATGGTCAGCG CCTGATCATA GTTTTCGGCA ATAAAGCCCA GCATCTGGCT AACATAAAAT TGCGCATGGC 
062021 GCGAGACGCT GTTTTTGTGT GTGCGCGAGG TTTTATTGAC CAGAATCGGT TCCCAGCCAG AGAGGCTAAA 
062091 TCGCTTGAGC ATCAGGCCAA TTTCATCAAT GGCGAGCTGG CGAATTTGCT CGTTCGGACT GTTTAATTCC 
062161 TGCTGCCAGC GGCGCACTTC AAACGGGCTA AGTTGCTGTG TGGCCAGTGA TTTGATCACC ATGCCGTGAG 
062231 TGACGTGGTT AATCAGGTCT TTATCCAGCG GCCAGGAGAG AAACAGATGC ATCGGCAGAT TAAAAATCGC 
062301 CATGCTCTGA CAGGTTCCGG TATCTGTTAG TTGGTGCGGT GTACAGGCCC AGAACAGCGT GATATGACCC 
062371 TGATTGATAT TCACTTTTTC ATTGTTGATC AGGTATTCCA CATCGCCATC GAAAGGCACA TTCACTTCGA 
062441 CCTGACCATG CCAGTGGCTG GTGGGCATGA TATGCGGTGC GCGAAACTCA ATCTCCATCC GCTGGTATTC 
062511 CGAATACAGC GACAGCGGGC TGCGGGTCTG TTTTTCGTCG CTGCTGCACA TAAACGTATC TGTATTCATG 
062581 GATGGCTCTC TTTCCTGGAA TATCAGAATT ATGGCAGGAG TGAGGGAGGA TGACTGCGAG TGGGAGCACG 
062651 GTTTTCACCC TCTTCCCAGA GGGGCGAGGG GACTCTCCGA GTATCATGAG GCCGAAAACT CTGCTTTTCA 
062721 GGTAATTTAT TCCCATAAAC TCAGATTTAC TGCTGCTTCA CGCAGGATCT GAGTTTATGG GAATGCTCAA 
062791 CCTGGAAGCC GGAGGTTTTC TGCAGATTCG CCTGCCATGA TGAAGTTATT CAAGCAAGCC AGGAGATCTG 
062861 CATGATGTCT GCACCCAAAA TTACATTTAT CGGCGCTGGT TCGACGATTT TCGTTAAAAA TATTCTTGGT 
062931 GATGTGTTCC ATCGCGAGGC GCTGAAAACG GCGCATATTG CCCTGATGGA CATTGACCCC ACCCGCCTGG 
063001 AAGAGTCGCA TATTGTGGTG CGTAAGCTGA TGGATTCAGC AGGGGCCAGC GGCAAAATCA CCTGCCACAC 
063071 CCAACAGAAA GAAGCCTTAG AGGATGCCGA TTTTGTCGTG GTGGCATTTC AGATTGGCGG TTATGAACCT 
063141 TGCACGGTGA CTGATTTCGA GGTCTGTAAG CGGCATGGTC TGGAACAAAC CATTGCCGAT ACGTTGGGGC 
063211 CGGGCGGTAT TATGCGCGCG CTACGTACCA TTCCGCATCT GTGGCAAATT TGCGAGGACA TGACGGAAGT 
063281 CTGCCCCGAT GCCACCATGC TCAACTATGT TAACCCAATG GCGATGAATA CCTGGGCGAT GTATGCCCGC 
063351 TATCCGCATA TCAAACAGGT CGGGCTGTGC CATTCGGTGC AGGGAACGGC GGAAGAGTTG GCGCGTGACC 
063421 TCAATATCGA CCCAGCTACG CTGCGTTACC GTTGCGCAGG TATCAACCAT ATGGCGTTTT ACCTGGAGCT 
063491 GGAGCGCAAA ACCGCCGACG GCAGTTATGT GAATCTCTAC CCGGAACTGC TGGCGGCTTA TGAAGCAGGG 
063561 CAGGCACCGA AGCCGAATAT TCATGGCAAT ACTCGCTGCC AGAATATTGT GCGCTACGAA ATGTTCAAAA 
063631 AGCTGGGCTA TTTCGTCACG GAATCGTCAG AACATTTTGC TGAGTACACA CCGTGGTTTA TTAAGCCAGG 
063701 TCGTGAGGAT TTGATTGAGC GTTATAAAGT ACCGCTGGAT GAGTACCCGA AACGCTGCGT CGAGCAGCTG 
063771 GCGAACTGGC ATAAAGAGCT GGAGGAGTAT AAAAAAGCCT CCCGGATTGA TATTAAACCG TCACGGGAAT 
063841 ATGCCAGCAC AATCATGAAC GCTATCTGGA CTGGCGAGCC GAGTGTGATT TACGGCAACG TCCGTAACGA 
063911 TGGTTTGATT GATAACCTGC CACAAGGATG TTGCGTGGAA GTAGCCTGTC TGGTTGATGC TAATGGCATT 
063981 CAGCCGACCA AAGTCGGTAC GCTACCTTCG CATCTGGCCG CCCTGATGCA AACCAACATC AACGTACAGA 
064051 CGCTGCTGAC CGAAGCTATT CTTACGGAAA ATCGCGACCG TGTTTACCAC GCCGCGATGA TGGACCCGCA 
064121 TACTGCCGCC GTGCTGGGCA TTGACGAAAT ATATGCTCTT GTTGACGACC TGATTGCCGC CCACGGCGAC 
064191 TGGCTGCCAG GCTGGTTGCA CCGTTAAAAC GCGACTAAAC GCTACTGCGC CGGGGGATTT ATTCCGGCGC 
064261 ACACCTCTGA CGATACCAAT AACAGAAGGC GGGCGTTGGT AACAGCGACC CGATACCCTA TGAGCATTTC 
064331 AATGACTACA AAACTCAGTT ATGGATTTGG AGCGTTCGGG AAGGATTTTG CGATCGGCAT TGTGTATATG 
064401 TACCTCATGT ATTACTACAC CGATGTCGTC GGGCTGTCTG TGGGTTTGGT CGGTACTTTG TTTCTGGTGG 
064471 CGAGGATCTG GGATGCTATT AACGATCCGA TTATGGGATG GATTGTAAAT GCTACGCGAT CGCGATGGGG 
064541 TAAGTTCAAA CCCTGGATCC TGATCGGTAC GTTGGCAAAC TCTGTAATCT TATTTCTCCT CTTTAGTGCG 
064611 CATCTGTTTG AAGGTACTAC TCAGATTGTC TTTGTTTGCG TGACCTACAT CCTCTGGGGC ATGACTTACA 
064681 CCATTATGGA TATTCCCTTC TGGTCGCTGG TTCCAACCAT CACGCTCGAT AAACGTGAGC GCGAACAACT 
064751 GGTTCCTTAT CCGCGTTTTT TTGCCAGTCT GGCAGGCTTT GTTACGGCAG GTGTGACGCT ACCATTTGTT 
064821 AATTATGTCG GCGGTGGCGA TCGGGGATTT GGCTTTCAGA TGTTCACTCT GGTACTGATC GCCTTTTTTA 
064891 TTGTTTCAAC CATCATCACT CTGCGCAATG TGCATGAAGT CTTTTCGTCA GACAATCAAC CGTCTGCTGA 
064961 AGGAAGCCAT CTGACACTTA AAGCCATCGT TGCGCTAATT TATAAAAACG ATCAGCTTTC ATGCCTCTTG 
065031 GGTATGGCTC TTGCTTATAA TGTAGCCAGC AACATTATTA CCGGCTTTGC TATCTATTAT TTCTCATATG 
065101 TTATCGGTGA TGCGGATTTG TTCCCCTATT ATCTGTCGTA TGCGGGAGCT GCTAACCTGG TGACGTTAGT 
065171 ATTCTTCCCA CGCTTAGTTA AATCATTATC CCGACGCATT TTATGGGCCG GAGCATCTAT TCTTCCGGTG 
065241 TTAAGCTGTG GTGTTCTCCT GTTAATGGCA TTAATGAGCT ATCACAACGT CGTCCTCATT GTGATTGCGG 
065311 GTATTTTGCT GAATGTGGGA ACGGCGCTTT TCTGGGTATT ACAGGTCATC ATGGTGGCAG ATATCGTTGA 
065381 TTACGGTGAA TATAAACTGC ACGTACGCTG TGAAAGTATC GCTTACTCCG TGCAGACTAT GGTGGTGAAG 
065451 GGCGGTTCAG CCTTTGCGGC TTTTTTCATT GCGGTTGTGT TAGGGATGAT TGGCTATGTA CCGAATGTTG 
065521 AACAGTCTAC GCAAGCCCTA TTAGGTATGC AGTTTATTAT GATTGCTCTA CCAACTCTGT TTTTCATGGT 
065591 AACGCTGATT CTCTACTTCC GTTTCTATCG CCTCAATGGT GACACGCTGC GCAGGATCCA GATCCATCTG 
065661 CTGGATAAAT ATCGCAAAGT ACCGCCCGAG CCTGTTCATG CTGATATTCC GGTCGGTGCA GTGAGTGATG 
065731 TGAAAGCCTG ACGTGGACAA TAGCTAACGA AAATGGCCTG ATGCGATATG TTTATCAGGC CACGTCTTAA 
065801 TGTAATGCTT TGGATTTGCA AATTTTGTAG ACCGGATAAG GAATTCACGC CGCATCCGGC ATCAACAAAG 
065871 CGCAAGTTGT TATCCGGTTA TCAAGCCAAA GCGCCGTAGC TGGCGGCAAT GAAAGCGAGC GAGGAATATC 
065941 ACCGTCGTTA ATGCGCCAAG CAGCGCGCAG AACATATCGG ATTGCGTGTC CCACTGGTCG CCCTGGGTGC 
066011 CGAGAAAATC ATCCGCTCCC TGACCCATTG CCAGCGCTGC CCACCACTCG ATTAATTCAT ACATCGCGCT 
066081 TATCGCCAGC GCCACGCAGC AGACCAGGAA CGCCACCATT TTACGTCCGC GCACGTACAT CCCGCGAACG 
066151 AGAATTTCTC GTGCCACCAG TGCAGGCACC AGCCCCTGGA AAAAGTGCCC CAGCTTGTCA TACGGATTAC 
066221 GACTCAACCC CAGCCATTCC TGCACCTCAA AACCAACGGG GACTTTCGCG TAGGTGTATT GTCCGCCGAC 
066291 CATCAGGATG ATGGCGTGAA GGAAAATGAG CGTATAGAGC AGCGGCGTTA ACGGATAACG TCTGGCGGTG 
066361 GCAAGCAGTA GCTGCACGAC AATAATCACC GGTGTCACTT CCATCAGCCA GGTGAGTTTG TCATGGGCCG 
066431 AAATGCCGGT ATAAATCAGG ATTAACGTTA GCGTCAGTGC GCTGGTGTTA AGAATTAACG GCTTGAGTGT 
066501 GCGGGTCATG GTGAGTTCGC AAATCAGGGA AAATACTGAC TATTCACCAG CAAGCGTGAA ATTACAATCG 
066571 CAAAAGAGGT GGCCAGGGGG ATCACCTGGC AGCATGCTGC CAGGCGCTGG GCCGAAGAGG TTACTTAGTG 
066641 CAGTTCGCGC ACTGTTTGTT GACGATTTGC TGGAAGAAGT CGTTACCTTT GTCATCGACC AGGATAAACG 
066711 CCGGGAAATC TTCTACTTCG ATTTTCCAGA TAGCTTCCAT ACCCAGCTCC GGATAAGCGA CGCACTCCAG 
066781 ATGCTTGATG CTCTGCTGCG CCAGTACCGC CGCCGGACCG CCGATGCTAC CGAGGTAGAA GCCGCCGTGT 
066851 TTATGACACG CGTCGGTAAC CTGCTGACTG CGGTTACCTT TCGCCAGCAT GATCATGCTG CCGCCGTGGG 
066921 ATTGCAGCAG ATCCACGTAG GAGTCCATAC GGCCTGCGGT GGTTGGGCCA AGTGAACCTG ATGGATAACC 
066991 GGCAGGGGTT TTCGCCGGAC CCGCGTAGTA GATCGGGTGA TCTTTGATGT ACTGCGGAAG TTCTTTACCG 
067061 GCGTCAATCA GCTCTTTCAG CTTGGCGTGT GCAATATCTC GGCCCACGAT AATGGTGCCG GTGAGCGACA 
067131 AACGAGTGGA TACCGGGTAT TGCGAAAGCT GGGCGAGGAT CTCTTTCATC GGGCGGTTAA GGTCAACTTT 
067201 CACCGCTTCG CCTTCACCGG CCTGGCGCAG TTCTTGTGGA ATGTACTGGC CTGGGTTGTG TTCCAGTTTT 
067271 TCGATCCAGA TACCTTCGCG GTTGATTTTC GCTTTAATGT TACGGTCAGC GGAGCAGGAG ACGCCCATGC 
067341 CGACCGGGCA GGATGCGCCG TGACGTGGCA GACGGATAAC GCGAATGTCG TGCGCGAAGT ATTTACCGCC 
067411 AAACTGCGCG CCAAGACCGA GTTTCTGGGC CTCTTCCAGC AGTTCCTGTT CCAGCTGGAC ATCGCGGAAC 
067481 GCCTGACCAT GTTCGTTCCC TTCCGTCGGC AGTTCATCGT AATAGTGAGC GCTTGCTAAC TTGACGGTTT 
067551 TCAGGTTGGT TTCCGCAGAC GTACCGCCAA TCACAAACGC GATATGGTAC GGCGGGCAGG CTGCAGTACC 
067621 GAGGGTACGC ATTTTCTCGA CGAGGAAGTT TTTCAGTTTG CCGGGAGTCA GCAGGGCTTT GGTTTCCTGG 
067691 TAGAGATACG TTTTGTTGGC AGAGCCGCCG CCTTTCGCAA CGCAAAGGAA TTTGTACTCA TCGCCATCTA 
067761 CCGCGTACAG GTCGATTTGC GCAGGCAGGT TAGTGCCGGT GTTGACCTCT TTGTACATGT CCAGCGCCGC 
067831 ATTCTGTGAA TAGCGCAGGT TATCTTCGAT ATAGGTGTTA TAGACGCCTT TCGACAGCGT TTCTTCATCA 
067901 CCGCCGCCGG TCCACACGCG CTGGCCTTTT TTACCGACGA TGATCGCGGT GCCGGTATCC TGGCAGGTCG 
067971 GCAGCACGCC TTTGGCGGCG ATTTCGGAGT TTCTTAAGAA TTGCAGCGCC ACGTACTTGT CGTTTTCGCT 
068041 GGCTTCTGGA TCGTGAAGAA TAGCCGCAAC CTGTTTCTGG TGTGCCGGGC GGAGCATAAA AGAAGCGTCG 
068111 TGAAAGGCTT GCTGCGCCAG CAGGGTCAGG GCTTCTGGTT CCACTTTCAG GATGGTTTCG CCGTCGAAGT 
068181 CGGCAACGCT AACGTAATCG GAAGTGAGTA GATAGTATTC GGTATTGTCT TTCCCCATCG GGAAAGGTGC 
068251 CTGGTAGATA AAGGGTTTGT TTGACATAGC TTCCAGCCTG TAACTCTGTA TTTGTTATTC GAAAATGGCG 
068321 TGCCGCGTAG TCACGGGCGG CACGCAAAGT GCATTTATAA GAACCCGTAC ATCGCGGCGA AGATCCAGCC 
068391 GAAGACGCAC GATACGCTCA CACCAATCAA CCCCGGCAGA ATAAAGCTGT GGTTGATGAC GAAGCGACCG 
068461 ATGTGGGTGG TGCCGGAACG GTCAAACTGA ATCGCTGCCA GATCGCTCGG ATAAGTCGGC AGGATGTAAT 
068531 AACCGTAGCA AGCCGGTGCT GAAGCCACGA TGTATGCCGG ATCAACGCCG ATCGCCAGCG CGACCGGAAC 
068601 AATCGCCGCC AGCGCCGCAG CCTGAGAGTT TACAAACTTG GAAACCAGCA GCAGAACAAT GGCATAGGCC 
068671 CACGGATACT CTTTCACCAT TTCACCCAGT ACGCCCTGAA TTTCAGACAT ATGCGCACCG AACATGGTTT 
068741 CTGCCATCCA TGCGATACCG TACACCGCCA CGATGGCGAT CATACCGGAA CGGAAGACTT CGTTTTTTGA 
068811 GATAGACGCG GGATTGGTTT TGGTCAGGAT AATAATCAGC GCCCCGGTCA GCAGCATAAA CATCTGAATA 
068881 ACCAGTACCA TCGACAGCGG TTTGCCGCCG AAGGATGGAC GCAGGTCCGA ATCAGCACCA AGAAGGGCGA 
068951 CTACAGCGAT TGCCCCGAGG AAAATCCACA TTGCCAGCCA GTTGCTTTTC GGCAGTTTTT TATCCAGCAG 
069021 CGTCGCGGTA TCACCGTAAA CATACTCACG GTTTTCCGGT ACGGAGATGA ATTTCTGGAA CTCTTCGTCT 
069091 TTATCCAGAT CTTTACCGCG GAACCAGCTG AAGATACCGA TCGCCAGGAT ACCGATTAAC GTCGATGGAA 
069161 TGGTGATTGC CAGCAGATCG AGGAACTCAA GATGGCGACC ATCAAAGGTG ACATTACCCA GCATCGCAAC 
069231 CAGAGACACG ACCGCAACCG ACACCGGACT GGCGATAATC CCCATCTGTG CACCGATAGA ACTTGCCGCC 
069301 ATCGGACGTT CCGGACGGAT GTTGTTCTTA ATGGCGACGT CGTAGATGAT CGGCAGAATG GTGTAAACCA 
069371 CATGACCCGT ACCGCAAAGA ATGGTCAGTG TACAGGTCAC AAACGGCGCG ACAATTGAGA CATATTTCGG 
069441 GTTGCGGCGC AGCAGCTTCT CGGCAATTTG CAGCATGACA TCAAGACCGC CCGAAGCTTG CAAGGTCGCC 
069511 GATGCCGCCA CCACCGCAAT GATAACCAGC ATGACATCAA CTGGTGGTTT ACCTGGCTGA AGGTGGAAGA 
069581 CGAAGACCAG AATGACCAGA CCGATACCGC CTAATAAACC CAGCGCGATA CCACCCTTTC TGGCACCATA 
069651 AAACAGACAT ATCAGTATTA TGATAAGTTG GATAGTAAAT AACATGTGTG AACCCTCGCG ATAATCCTAT 
069721 TTAAATTTTT GCTGAATAGA TCACAGTCAC GTTCTGTTTT GTATGAACTG TTTTCAGAGC CTGACTAAAT 
069791 ATCCGTTTGG TCGTTACCGG CTTTAGCAAA TACCTCACAG TGAATATTGG CTGATTAAAG CAGCGGCAAA 
069861 TTTATGCACT GTGATAAGCG GCTTTTTCAG AGAGAAAGAC TCTCTGGCGA TGGGTTTATA GTTTGTACTG 
069931 CGCAGATGTT AATGTTTTGT TTGCTGTTAT CTTATTGATA TTTATCGGTC TATTTTTTGT TCTCAGGGCA 
070001 GATGTCATTA GGTTTATAGA TTAATCTGAT CTACCCATTT GTGGGTAAAA ATACACATAA TGCGGGTGAC 
070071 ATAATAGTTA ATTAACTTTT GTTAGCGTTT TGAAATTAAA AACACCGTTC ACCTGAAGAG ATATTAATTT 
070141 TTAGCGATGA TGGAGGGATA ATTATATTTG ATCTGGCACA AGTTTTACTG ATGAAGGATG TAACTTGTGC 
070211 CAGGGGTATT TTGCATTACG GTAATAATTA TTACTTACAG ATAACCAGCG ATCCGTTATT GGCAATATTG 
070281 TTTCAGTAGT GAGTAGTGTT CTGCCTGAAT ACGGTAACGG TAAACTGGAC GCCCCGTGAC GCCATAATGG 
070351 ATACTGGTGA ACAAGATGTG GCAGTTGACC AGCCAGATGA GGTATTTACG GCAGGAAACA CGCGAAATGT 
070421 TAACCTCGTT GGCTAGCTCG TCGGTTGAAA ATTCATAGTC CTGATGCGCG TCAATCCACT GGCACAGTGT 
070491 GCGTAACGTC TGCGGCGTTA AGCCTTTTGG CAAGCGACGA GGATCCTGTT CGTTGGAGCT GCTGCCGTGG 
070561 ATTAGCTGAT CAAGCTCGGC CTGGTCATAA TACTGATGTT TTTCCAGCGC CATTTTCTTT TGCCGCCAGC 
070631 CGGTGAGCGC CTCTTCAAAG CGGGAAGCCT GGAAGGGTTT GATCAGGTAA TCCACGACAC CGTAATGCAG 
070701 CGAATCTTTA ATGGTTGCCG CATCGGCTGC GGAGGAGATG ACAATCACAT CACTTTTGCA ACGCGCGTTA 
070771 TGCAGGACAG GCAGTAAATC GAGCCCGTTC TCTTTTTGCA TATAGATATC GAGCAATATC AGGTCGATAG 
070841 GCGTATCGCT ATTGAAGATA ATCTCTTTGG CTTTCTCCAG CGTCGAGGCT GTTCCACAGC ATTGAAAGCC 
070911 TGGGATTTGT GCTACGTATC GGCGATTCAG CTCCGCGACC ATTGCGTCGT CATCGATAAT TAATACATTG 
070981 ATCATCTGTT CGACCTCTCC CCGTCCCAGG GTATCTGGAC AAAAAATTGT GTGAAAATCC CGGGTTCCGA 
071051 TTCCACGGCG ATGCTGCCGC CGAGATTTTC TACCTGTTGT TTGACAAGTG CTAAACCGAC GCCTCGCTCG 
071121 CTTCCTTTTG TCGAGACACC TTTGTCAAAA ATGTGATCGA TTTTATCGGG TGCGATCCCC GGTCCATCAT 
071191 CATTAACTTC ACAGTGCAGC CAGCCGTGAC GGTAGTGCAA TGTTACGCTA ATTTCGCCTC CGGGTTCCGG 
071261 CCCTAATGCC TCCAGCGCGT TTTCTATCAG ATTTCCCAAC GTGGTAATCA GCGTCGCGAC CTGGTCCTCA 
071331 CTGCCGCTGT CTGGCAGCTG GCTTTCACTG TTTAAAATCA GCGTATGGCC TAAATCGGTC GCGCGGTTAA 
071401 TCTTGCTGAT TAAAAAACCA GCGATAACCG GAGATTTGAT CTTACCCAGC AGAGAGCCAA TCTCTTCCTG 
071471 ATAGTTATTG GCTGTTTTGA GAATGTAATC TTCCAACTGC TTATAACTCT TCAGATGCAA TAATCCGAGA 
071541 ATCACATGCA ATTTATTCAT AAATTCGTGG GATCGTTCAC GAAGTGCGTC AGCATAGTTG ACCAGACCGT 
071611 CGAGTCGCTG CATCAGTTTA CGTACTTCAG TTTTGTCCCT GAAGGTTGAA ATGGCACCGA TGATAACGCC 
071681 ATTACTGCGC ACCGGAACGG TGTTGATCAG TAATAGCCGG TCTTTAATCG TAATCTCTTC GTCGCGGCGC 
071751 GGGGTACCGT CGCGTAACAC TTCCGAGACA TCTACCACCT GTGACCATGA GTGGCTTAGC GTCGACAGTT 
071821 TCTCATCGTC CTGCGACTTA CGGTAATTCA GCAATTCTTG TGCGGCATCG TTGATCAGCG TGACCTCGCC 
071891 GCGATCGTCC ACGGCAACGA CGCCTTCTTT GATAGACTGC AACATGGCCT GGCGTTGCTC AAACAGCGTG 
071961 GAGATTTCGT AGGGTTCCAG GCCGAAAAGG ATTTTTTTCA GTACCTTAAC CAGAATGCAG GTGCCAATCA 
072031 GTCCGACCAG CATGCCAAAT AATACCGACC AGATAATGCT CCAGCGACTG TCATTGATCT GTTGGGTCAC 
072101 ACGGCTTAAC TCAAGGCCGA TCGCCACCAC GCCAATTTGT TTATGATTTT CATCGTAGAT GGGGGTAAAT 
072171 ACGCGTAAAG CCTGCGCCAG AAAACCGCGA TTGATAGCGA CATTTTCTTC GCCATTCAGC GCTTTAAGGA 
072241 TGTCATCACC TTTAAATGGC TGACCAATAC GCTGGGCTTC AGGATGCGAG TAGCGAAGAC TTTGCATATC 
072311 GGTAACGACA ATAAACAGCA GATCGTTGCG TTTGCGTACG GCTTCCGCGA TGGCCTGGAT GCCACTCTCC 
072381 TGCGGTTTTT TCTGCAAGCC CTGACGGATT TCCGGCGAGT CGGCGAGGGT ACGCGCCACT GCCAGTGCCT 
072451 TGTTGGCTAG CCCATCTCGC GTCATATCAC TGATTTGCGA GAAGTAAATC AGATGCACCA CCAATAGCAC 
072521 CGAGAACAGT ACCGCACTGA CCATTAAGAT CACTGTGGTA CTCAATTTCA TCGGACGTTT GCGTAACATG 
072591 CGGTAGGGCA ATGAATGTCT CATCAGCTTC CTTGTGTGAC AAATTTCTTA AGCATTATCT CTGATGAGGC 
072661 GGGTAATTCA AAGGGAGTAA GAATGATTGG CTATATAGGG GAAGAGACTC TGGCAACGGA AACTGCCAGT 
072731 GCTGTATGAA GATTCCGGGG CTATGCTTAT AGCGATAATC ATACTGATGA GAGAGGGAAG GTCATGGATC 
072801 AGGCGCTACT GGACGGGGGT TATCGCTGTT ATACCGGCGA AAAGATCGAT GTCTATTTCA ACACTGCGAT 
072871 ATGTCAGCAT TCTGGCAATT GCGTACGTGG CAACGGCAAG TTATTTAATC TCAAACGAAA GCCGTGGATC 
072941 ATGCCGGATG AAGTCGACGT CGCCACTGTG GTTAAAGTGA TTGATACGTG CCCGAGCGGC GCGCTGAAAT 
073011 ACCGTCATAA ATAAGCGAGG GTAAAATGGA AATACGCGAA GGCCACAATA AATTTTACAT TAATGACAAA 
073081 CAAGGCAAGC AAATCGCTGA AATTGTCTTT GTGCCGACCG GAGAGAATTT AGCGATTATC GAACATACCG 
073151 ATGTCGATGA AAGCCTGAAA GGGCAAGGGA TTGGTAAACA GCTGGTTGCG AAAGTCGTGG AAAAAATGCG 
073221 TCGGGAAAAA CGAAAAATTA TCCCATTATG CCCATTTGCG AAACATGAAT TTGATAAAAC GCGGGAGTAT 
073291 GATGATATTC GCAGTTGATG GGAGAGTACA GAGTCACGAT ATTTTTCATT CTCTCCGCGA TGTGATGCAG 
073361 GAGAGCATCT GAAGGGTAGG GGGATGCACA AAGAATGGGC AGAGAGCGCG TTTTTTTGTC CCAAGTCATC 
073431 CCCTTTACTG AGCAAAAAAA AGAATATCTC CTATATGAGA ATCATCAATC GGGGTTAATA AGTTTTGCGT 
073501 CCCCAGAGCG TTTAATATTG ATAGGAGTCA TATTATGGAA GGTAAAAACA AGTTCAATAC TTATGTTGTT 
073571 TCTTTTGATT ATCCATCATC TTATTCCTCA GTGTTCTTAA GATTAAGATC ATTGATGTAT GATATGAATT 
073641 TCTCCTCTAT CGTGGCTGAT GAATATGGGA TACCACGACA ATTGAATGAA AACTCCTTCG CAATAACGAC 
073711 ATCGTTAGCC GCAAGTGAAA TCGAAGATTT AATCAGGCTC AAATGCTTAG ACTTACCGGA TATTGATTTT 
073781 GACCTCAACA TTATGACAGT TGATGACTAT TTCCGTCAGT TTTACAAGTA GCCAGGAAGG ATAAGAAGAA 
073851 CATAAAAAAT GGCACTATTC TCTAAAATAT TAATTTTTTA TGTGATTGGT GTGAACATAT CCTTTGTCAT 
073921 TATCTGGTTT ATCTCACATG AGAAAACACA TATTCGTTTA CTTAGTGCAT TCCTGGTCGG AATAACCTGG 
073991 CCAATGAGTC TGCCTGTGGC ATTACTTTTT TCTCTCTTTT AGGAGCTGTA GTTGAGTGGA CCCGCTGGTT 
074061 ATCGTGAAAC GAAGCGTCTC TCCTCAAAAC TGGATTTGCG GAACGATGAA CGAAGCAGTC GCCTGACTGC 
074131 TTCGTTCATT AAAGTGAAAT TTATTTCTGT GGGCGCATCG CCGGGAAGAG AATAACGTCG CGAATAGTAT 
074201 GGCTGTTAGT AAACAGCATA ATCATTCGGT CGATACCAAT ACCCAGACCA GCGGTTGGCG GCAGACCATA 
074271 TTCCAGCGCA GTCACGTAAT CTTCGTCATA GAACATGGCT TCGTCGTCAC CTGCAGCTTT AGCATTAACC 
074341 TGTTCCTGGA AACGTTCAGC CTGATCTTCT GCGTCGTTTA ATTCGCTAAA ACCATTACCG ATTTCACGAC 
074411 CACCGATGAA GAATTCAAAA CGGTCGGTGA TTTCCGGGTT AACATCATTA CGGCGTGCCA GCGGGGACAC 
074481 TTCTGCCGGA TATTCCGTAA TAAAGGTTGG CTGAATCAGA TGTGCTTCTG CCACTTCATC AAAGATCTCT 
074551 GTGACAATAC GTCCCAACCC CCAGCTTTTC TCTACCGTAA TACCGATAGA TTCAGCTAAT GCTTTAGCAG 
074621 CATCAAAATT ATCCAGGTCG GCCATATCGG TTTCTGGACG ATATTTTTTG ATTGCTTCGC GCATGGTGAG 
074691 TTTTTCAAAC GGTTTGCCGA AATCAAACAC ATGCTCGCCA TAAGTGACTT TAGTGGTACC CAGAACCTCT 
074761 TGTGCCAGGG TGCGGAACAG TGACTCTGTC AGTTCAATCA AATCGTGGTA ATCCGCATAC GCCATGTAGA 
074831 GTTCCATCAT TGTGAACTCA GGATTATGGC GAACAGAAAT ACCTTCATTA CGGAAGTTAC GGTTGATTTC 
074901 GAATACCCGT TCAAAACCGC CTACAACCAG ACGTTTCAGA TACAGCTCCG GCGCGATACG CAGATACATA 
074971 TCTAAATCCA GAGCATTATG ATGGGTAATA AACGGGCGAG CAGATGCCCC ACCTGGAATT ACCTGCATCA 
075041 TCGGGGTTTC TACTTCCATA AAGCCGCGCG CGACCATGAA TTGACGGATA GCGGCCAGAA TTTTTGAACG 
075111 GACAACAAAC GTTTGACGGG ATTTATCGTT AGCGATGAGG TCCAGATAAC GTTGACGATA ACGGACTTCC 
075181 TGATCCTGCA GACCATGGAA TTTATCTGGT AAAGGACGTA GTGCTTTAGT CAGCAGGCGC AGCTCAGTAC 
075251 AGTGAATGGA AAGCTCACCC GTTTGCGTCT TAAACAGCGT ACCGCGGGCA CCGATAATGT CACCCAGATC 
075321 CCATTTTTTA AACTGATCGT TATAAACACC TTCTGGCAGG CTATCTCTTG CAACGTACAG TTGAATACGG 
075391 CCACCGACAT CCTGCAACGT TACAAAGGAG GCTTTCCCCA TGATACGACG GGTCATCATT CGGCCAGCAA 
075461 CCGAGACTTC AATGTTTAAG GATTCCAGTT CCTGGTTATC CTTCGCATCA AACTCTTCGT GCAACTGGTC 
075531 AGAGGTATGG TCGCGGCGAA AATCATTGGG AAACGCCACA CCTTGCTGAC GTAGTGCCGC CAGTTTTTCG 
075601 CGGCGATTTC TCAGTTCATC GTTAAAATCA ATAGCCTCAT TGGCTCCCCG TGTTTCTTGT TCAGACATTT 
075671 TGGTTCCTCT AAATCCAGCT TTCAATTTAG CGTAGATAAA GAGACAGATC GGTACACTGT ATTATCTGCC 
075741 TCGACTATTA GTAACTCAGT TTATCTTATC GAAACTAACG CTTACCTCAA GTTGATATCA CTAATAAATA 
075811 ACCATCAAAA TGGTTTAAAT GACTTATTAA TCTCGATTTG TTAGTGTTAT AAACTGAAAG TTAATTTATT 
075881 CATAACCAAT TGTTTTTACG ACAGTTAATC GTTGCTCTCC TGTATCATAT TCGTCGGCGT GCTAAACAGA 
075951 AAACGGGTAG CAAAGGCCAA TACGACGATG ATCGCGACAC AAGCCAACGT CCACTCTCCC ATCTGAGAAA 
076021 AGAATCGCTG GTAAGCTGCA ATTGCCATAC CGCTAATTTG CGACTCTGTC GTCTGCTGTG CCACGACGCC 
076091 TGCCAGCCAG TTGGCGACCG CGCCTGTTGC CAGCATATAA ATCCCGGTTA ATACGCCAGA CATTTTCAGA 
076161 CGCGTGATTT GCGCAATCGC CACCGGGTCA ATAAAGAGTT CGGCAAAGCC CATTAGCGCC AGCCCGGATA 
076231 TCATCACGCC CATTGACGCT TGACCGTCAG CCGCTGCATG TCGGGCATCA AATGCCAACA ACATAAAGCC 
076301 ACAAGCCATC AGCAGTAAGC CAAAGGCAAA CTTCAGCCAG ACGCGCAATG TTGAGTTGCC GCGGCTTTCT 
076371 GGCGACGCCA GCCAGGCCAG TACAACCCCA GCGAGCATCA CCGCAATTGC ATTCACCGAC TGGAATAGTG 
076441 CTGTAGGTAC TTCAATATTG AATGCCTGAC GATTCACAAA GCGATCGATA AACAAGCTGA TGGTACTGCC 
076511 GCCCTGTTGT GCCAGTACCC AGAACAATGT CCCGACAAAC ATCAACAATA CAATTTGCCA AAGAGCACGG 
076581 CGATGTTCGG GGAATTTGAT CATCATGCGG GCAATGATTT GTGCGGCAAT GAGGCAAACG ATCGCCAGCA 
076651 AATATCCGGA CCAGTCGTTC TCCAGCAGCA GAGTAAAAAA TACTGGGGCT AAACAGAGCA TCACCACTAA 
076721 CCAGCTCCAT ACTGGTAAGG CAAATTTGAC ACTAGTGAGC GCTTTTTTAT CCATACTACG TGTGGACTGG 
076791 AAATGACGAT GACCGCTTAA GAAAATCAAC AAACCGATAA ACATGCCGCC ACCCGCAAGG GCAAAGCCAA 
076861 CATGCCATCC ATACCACTGA GCAGCCAGGC CGCAGGCGAT TGGGGCTGCG ATAGAACCGA TATTGCCCGC 
076931 AGCATACAGC AGCGAAAAAC CGCCATCACG TCGATGATCG TTCTCGTCGT AGAGCTCGCC AAGCAAACAG 
077001 CTGATGTTTG ATTTGAATAA ACCGTAGCCA CAAATAATGA TTGCCAGCGC CAGATACAGG CTAAAGGTTG 
077071 AATTTGTATC AATACCCAGC ACCACATGGC CAAGGGTCAT TAACAGCGCG CCGGCAATCA CTGCAGTGCG 
077141 GTTGCCGAGC AGGCGGTCGG CAAGCCAGCC GCCGAGAATA GGGGTAACGT AAACCAGAGA AGCATATGCG 
077211 CTGAACAGGC TGATGGCATG GTTATCATCA AAACCAAGCT GATGGGTGAG ATAGAGAATG AGTAAGGCAC 
077281 GCATGCCGTA AAAACTGAAG TACTCCCAGA TTTGGATCGC CACGATATAG TATATCGCGC GCGGCTGTGA 
077351 GGGTGTTTTC ATGTGTTCTC CTTATGAGCA AAAAAGGGAA GTGGCAAGCC ACTTCCCTTG TACGAGCTAA 
077421 TTATTTTTTG CTTTCTTCTT TCAATACCTT AACGGTATAG CGGCCATCAG CCTGACGGTA TGCACCGTGA 
077491 ATATCGGTTT CAAAGCCCGG ATAGTGAGCG CCGATTTCAC ACAGCATCTG CAGGAACTCC AGAACCGGAC 
077561 GGCTTTCTTC GGTGATCATT TCACCCGGCA TTACCAGAGG AACTCCCGGC GGGTACGGAA GGATCATATT 
077631 GGCGTTAATA CGACCTACCA TTTCGTCGAG GTAAACTTCT TCGGTCATAC CGTGCAGCTC TTTCTGGAAT 
077701 GCAGCATACG GAGTCATTAC CATCGTCGGC AGCACTTCAA ATGCGCGATA CATCAGATCC GGCAGATTGT 
077771 GGTGAACAAT CAGTTTGTGG ATATTCTGAG CCAGTTCCTG AATACGCATG TTTTCATAGA ATTCAGGATC 
077841 TTCACGATAC AGAGACGGCA GCATGTTTTT CACACGCAGG TTCAGGTCGA ACGCACGTTT AAAGTCAGTC 
077911 AGAGCACGCA GCAGGCTCAG TGCTTTGGTC TTATCGATAC CGATGCTGAA CAGGAACAGC AGGTTATACG 
077981 GACCGGTTTT CTCAACAACG ATGCCATGTT CGTCGAGGTA TTTCGCCACG ATGCTGGCCG GAATACCAAA 
078051 GTCGCTCATG GTGCCGTCTT TTTCCATCCC CGGAGTCAGC AGGGTGACTT TGATCGGGTC AAGATACATG 
078121 TGCTCGTTAT CGATGTTTTT GAAGCCGTGC CAGGTGCTGT CAGAACGCAG CGGCCAGCAT TCAGTCGTAT 
078191 CGATATGATC CGGCTGCCAT ACATCAAAGA ACCAGCCATC AGATTCCGTT CTCAGACGTT TGATCTCTTT 
078261 ACGGAATTTG ATCGCACGTT CAATAGAACC GTTGATCAGA CGCTTACCTG CATTGCCTTT CATCATCGCC 
078331 GCAGCGGTTT CAGTGGACGC CACGATACCG TAGTGCGGAG AAGTGGTGGT GTGCATCATG TAGGCTTCGT 
078401 TAAAGGTTTC TTCGTTTACG TCACCTTTAA CGTGGATCAT GGAAGCCTGA GAGAACGCCG CCAGCAGTTT 
078471 GTGAGTGGAC TGGGTTTCGT AAATCACTTT CCCTTCTACA CGGCCACCGC TCATACCGCA TTTACCTTCG 
078541 TAAATCGGTG AGAAGTTGGT GTAAGGCACC CACGCGGAGT CAAAGTGGAT GGATTTCACA TCCAGTGTTT 
078611 TCTTGATGAA GTCGGTGTTG TACAGCAGAC CATCATAGGT AGAGTTGGTA ATTACAGCAT GTACCGGCCA 
078681 GGTTGCGTTT GGTGTTTCTT TCACGCGCTT AGCAATGGTA GCGTGCTGGA ATTCACTCTG TGGGATACCA 
078751 CCAAGAATAC CGTAAGCGTT ACGGGTCGGG CGGAAATAGA TTGGCGTAAC ATCGCTCATC ATCATCAGGT 
078821 GGGTCAGCGA TTTGTGGCAG TTACGGTCAA TCAGAATGGT GCTGCCTGCT GGAGCAGAGT ACATACCAAC 
078891 AATTTTGTTC GCAGTGGAAG TACCGTTGGT CACCATGTAG CTGCGGTCTG CGTTAAAGAC GCGAGCGATA 
078961 TACTGTTCTG CTTCTTTGTG TGGACCACTG TGATCCAGCA GAGAACCCAG TTCAGATACT GAAATGGAAA 
079031 TATCAGATTT CATGGTATTC GGACCAAAGA AATCATAGAA CAGGCTACCT ACCGGGCTTT TCTGGAATGC 
079101 AGTACCGCCC ATGTGACCAG GAGTACAGAA AGTATATTTA CCTTCACGAA CATATTTAAA CAGTGCTTTA 
079171 GTCAGCGGAG GCAGAATAGT GTTGATATAT TCGTCAGTGG TCTGCTTGAT CTTATTAGCA ATATCTTCAG 
079241 CAGCACCCAG CGCATATTCA AAGAAGCTAA TCTGTAAACG CAGGTCATTC AGGCTTACAT CGAGAGTGGA 
079311 ATACGTATTA GCGAACGCGT ACAACGGCAG GTTCTCGTTC ATTTTGCTAA TTTCTTCGCA CAGCTCGAGA 
079381 TTATATTTAT CCCAGTCAAA AATAACGCCG CACAGACGCG CATTGTTTTC GATCAGTTTT AATAAGTCGT 
079451 CACGGTCGTT CGGGTAAACA ATCTGGAAGT TCAGACGTTC AAGCGCGCGA TGAAGTTCAC GGATGGGTTC 
079521 TTCTTTAAAA TAAACCCCCA TGTGATTCAA TATTGCAATA ACGTTCATAG TCATATCTCC AGGTAAAAAA 
079591 GGCCCCTCCC AACACATGGG ACAAAATGAA AGGAGGAGCC TCGGAAAATA CTTTTAATTA ATGTGCGTTA 
079661 GACGCGGTGT GGTTATCCAT TGAGTGGCTC TGGCGCTCGT GCATTTTGCG AGCGTAGAAC ATCAGGATAA 
079731 TCAGGCTGAC GATGAAGGTA CCTGCCAGCT CGAAGGAGCT TGCGCCCATC AGCGCGATGA AGCAGAACAC 
079801 GCAACCCAGT ACAGAGCAGA TCAGGCTGAC AAAGTTGCGG ATGTTAACGC CTTCAAAACG AATCAGGTCA 
079871 ACGCAAGAGT AGAAATACGG CAGCATAGTC AGCAGTACTG CGATACCGGT CAGTTCACCG AACAGGTCAG 
079941 ATGCTTTACC ACCGGCAGAG TTCATCAGAG TGATAAGGAT CATCAGGGCA GTCATTTTCA CTGCAGCCAG 
080011 CAGCAGACCT TTTTTCGGAA TACCGTTGCT GTCGACTTCA CCATAAACTT TCGGGAAGTT ACCGTCGTTA 
080081 GCGGCACGTA CACCTGCCTG GCCTACCAAC ATCATCCAGG AGCCCAGAGA AGTCAGGCAC GCAAAGGCGG 
080151 TGAATGCAGA AACCAGCGGC GCAGCCCAGT TACCGAGGAT AGTTGAAGCA CTGATTGCAA ACGGAGCACC 
080221 GGAAGCCGCC ATTACAGAAG ACGGATACAT ACCGGAAAGC ACCTGAGTCG CAGCGATGTA AACAATACCT 
080291 GCTAAACCAG TACCCAGCAT GGTTGCCAGC GGAACGGTAC GTTTCGGGTT TTTAACCATA CCAGTACTTA 
080361 CAGCTGCGGA TTCAACACCC ACGAAGGCCC ACAGGCAGAG CAGAATACTT TTAATGATCG CATGACCATC 
080431 AGTGGTATCC GCAGTATTCC AGTTAGCTGC ATAAGTTGCC GCATCAAACC AATGCCAGCC AACAATAGCA 
080501 GTCATCACCA CAGGAATAAG AACCAGCACC AGACCAATAG TGGTTAAACG GCTTACCCAA GTACCGCCGA 
080571 GCATATTTAC AAAGGTAAAT ACCCAGACGA TAGCAATACA GGCGATACCC GCCGGAACAG GATCATTTAA 
080641 TACTGGGAAG AAGGTGGAAA GATAAGATAC AGCGGTAATA CCAATCGCCA GGTTACCAAT CCAGTTAGCA 
080711 TGGTAATAAA GAACACCTGT CTGAAAACCA AATGCAGGGG AAATTTCTCC GGCATAAGCA ATTGGGCCAC 
080781 CTTGTTGCGG GTTTTTTGTT GCCAGTCGGG CATATACATA CGCCAGCGAC ATTGCACCAA TAATAGAGAT 
080851 AATCCAACCC CAGATAGCAA TACCACCGAT ACTTGCTAGG TTCGCAGGTA ATAATGCAAT ACCGCTCCCC 
080921 ATCATATTAC CGGCAACAAC ACCGGTACAG GCAAATAGCC CGATCTTCTT GGCAGAACTC ATGCTCTTCT 
080991 CCTAATTTCA TTTTTGAATT TGGAGTCCGG GTCATGATGT ATAACTATTT CCTGACCAGA CCAAACTGGC 
081061 GATAAGATTA CTCACGAAAA AAGGATTAAT CCTAAAGATT AGGTGAAATA ACACAAAAGT TTCTGTAAGT 
081131 GAGAACTTGA GGTTTTTTAT TAACACATCA GGATCGCAAG TTGATATCAT GAAAAGATAA ACATTTAATG 
081201 TTTACAATGG ATTGCGTGAC ATTCTCTGGT TAAATTTATG TAATAAAAAT TATGCGGCAA ATAAATTGCC 
081271 GCAACATATT ATACCAACAG GAACATACAA AAACTCAACA ACAAATATTT CCGAGCATAA ATCAACCCGG 
081341 AGTTACTTAT TCTGAAGCAA GAAATTTGTC GAGATAAGGT ACAACATAAG GAACAGAAGT CTGGAATATA 
081411 CCATTTTCAA TCCAGTAAAG GGTGTTTGCC CCTGGGCGTA AATTAAAGGC GGTGAGATAT GCATCAGCTG 
081481 CTTCCCGGTT CATCCCCTTC ATTTCATAAA CCTTGCCAAG CAACACATAA TTTAGCCAGG ACATTTCAAG 
081551 ATCAATGCCA GTATTTATCG CCTGGTAAGA CTCATCTGTT TTACCTTTTA CCAGAGCACT GACCGCTTTT 
081621 ATTTGATATA TAATGGACAG GTTGTTCAAT TCCGGCAGTG TAACAATGTT ATCTATTTCT GTGTTCAGTG 
081691 CTGCTAATTG TTTTTCATCT AAAGGATGTT GAGAATGGCG CACGATATCA ACTAATGCTT TTTCTGCTCT 
081761 CGCGTAGGTA AATTCTGGGG ATGATTGAAC AATCTCACCT AATAATTCAC TGGCACGGTT CAATGATTTA 
081831 TCATCGCCAT GCAGTAAATA ATCATGTGCC TGATAAAAAT TAGTTAATAA CGCACCACGA TGCGGCAAAA 
081901 TTTTCTGGAG CGTCTCCTGC ATTCGTTGTG GCCACGGTTG GTTTAACGCT TTTGATAAAC TCTCCAGTAA 
081971 ATCATTTTGA ATCGCCAGCT GATTACCGTT AGTGATGACA TAACGTTTAT CCAGCATGGT TGAACCATCT 
082041 GCATTGTCTA CCAATTTTAT CGACATAAAG CATTGTTGAG CACGGTATTG GCGCTGATTA ACAAACGCAA 
082111 TAGATAATGT TTTACCGGAA CTGCTCGGTT CATCAATGTT GTAGTTGATT TTGTCATGCA CCATAAAGGT 
082181 GGAGAAGGTG TTAAGTGATG TCGCCACCAA ATCACCCACG CCTATCGCGT AAGAGAGCTG ATACGGGGAA 
082251 CTCCAGCTGT TACAACTTTT ATTTACCATA TTAATGTCAA TATCGCGTGG ATTGAGCAAA ATACGCGATT 
082321 TGCTCATAGG AAGACGTGTA TCAAGACTTG AAAACGCTAC CAGTGCTACA CAGATACCTA ACGACAACAG 
082391 GAAAAAAAAC CATACCCAAA AGGTAGTGAA TCGTTTGCTT TTAACTGGGG ATTGTTCAGG TGGCGTTGCG 
082461 GTGTTTTGAA TGT