Mutants (Isolated)

tm999

Allele Nametm999
Sequence NameT06C12.10
CGC Namecgt-1
Worm BaseAllele Name tm999
CGC Name cgt-1
Sequence T06C12.10
Phenotypehomozygous viable
Mutation site20239/20240-CTTTTAGGTTGCAATGATTCTCT-22706/22707 (2467 bp deletion + 23 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(20129..20178, 20276..20438, 20735..21058, 21213..21433, 21480..21715, 21774..22005, 22058..22100))
Map position9.1
Balancer
Map position of balancer
Sequence of primersExtFwd:CCCATTCCTAAAAACACTGC,IntRev:GATATTTCGTGCAGAAGCTC,ExtRev:ACAACTTCCTTCAGTCAGAG,IntFwd:GGATGTTTCCAAACTTTCGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang H, Abraham N, Khan LA, Hall DH, Fleming JT, Göbel V.
Apicobasal domain identities of expanding tubular membranes depend on glycosphingolipid biosynthesis.
Nat Cell Biol 2011 13(10) 1189-201 
[ PubMed ID = 21926990 ] [ RRC reference ]