Mutants (Isolated)

tm996

Allele Nametm996
Sequence NameC54D1.1
CGC Namepgp-10
Worm BaseAllele Name tm996
CGC Name pgp-10
Sequence C54D1.1
Phenotypehomozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA.
Mutation site33381/33382-TTN-33934/33935 (553 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurejoin(30298..30466, 31026..31141, 31188..31289, 31336..31467, 31540..31673, 32410..32491, 32543..32629, 32672..32780, 32833..32937, 32988..33175, 33224..33364, 33415..33503, 33553..33847, 34139..34255, 34303..34512, 34571..34726, 34775..34876, 34939..35004, 35048..35307, 35353..35493, 35540..35680, 35732..35891, 35938..36027, 36287..36493, 36543..36647, 36689..36899, 37012..37148)
Map position-1.82
Balancer
Map position of balancer
Sequence of primersIntRev:GGACGCTAAGTTAGCAGCTT,ExtRev:ATGTTTGCAAGCACCACGGA,ExtFwd:CCCTTGTTAGCCAGGAGCCA,IntFwd:GCCAGTACTCTTTGATGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]