Mutants (Isolated)

tm969

Allele Nametm969
Sequence NameF23B12.8
CGC Namebmk-1
Worm BaseAllele Name tm969
CGC Name bmk-1
Sequence F23B12.8
Phenotypehomozygous viable
Mutation site26271/26272-26779/26780 (508 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(Z77657.1:534..595, Z77657.1:278..484, Z77657.1:105..227, 26612..27797, 26007..26566, 25699..25918, 25428..25586, 25280..25379, 24975..25234)
Map position6.38
Balancer
Map position of balancer
Sequence of primersIntRev:GTGAATTCATCGAGGAGCGA,IntFwd:AAGTGCCTGTGCGAAATCGT,ExtRev:ATTGACAACGGCGGCCGACT,ExtFwd:TAATCGTTTCGGGCGTGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Connolly AA, Osterberg V, Christensen S, Price M, Lu C, Chicas-Cruz K, Lockery S, Mains PE, Bowerman B.
Caenorhabditis elegans oocyte meiotic spindle pole assembly requires microtubule severing and the calponin homology domain protein ASPM-1.
Mol Biol Cell 2014 25(8) 1298-311 
[ PubMed ID = 24554763 ] [ RRC reference ]