Mutants (Isolated)

tm968

Allele Nametm968
Sequence NameC54G10.3
CGC Namepmp-3
Worm BaseAllele Name tm968
CGC Name pmp-3
Sequence C54G10.3
Phenotypehomozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA.
Mutation site11702/11703-12126/12127 (424 bp deletion)
ChromosomeV
Putative gene structurejoin(7006..7263, 7314..7453, 7843..8359, 10749..10840, 11318..11634, 11962..12521, 12573..12671)
Map position6.57
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTTCGTCCCTATTGTTGGA,ExtRev:CAATGTCGTGAAGGGACCAT,IntFwd:GACTGGGATCCTAAATGACA,IntRev:CCATTCTCCACTGCGACCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]