Mutants (Isolated)

tm951

Allele Nametm951
Sequence NameC49G7.11
CGC Namedjr-1.2
Worm BaseAllele Name tm951
CGC Name djr-1.2
Sequence C49G7.11
Phenotypehomozygous viable. Dr. A.R. Skop: normal growth and locomotion.
Mutation site27461/27462-28190/28191 (729 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(26442..26599, 26701..26971, 27229..27360))
Map position-6.77
Balancer
Map position of balancer
Sequence of primersIntRev:CCAGTCAACTTGTTCAAGGA,ExtRev:AGGATCCTCGTGACGATCCA,ExtFwd:CACAGTGGCTTCAAAAGACT,IntFwd:CCCTCCAGTGTTTCGACGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]