Mutants (Isolated)

tm947

Allele Nametm947
Sequence NameC27A2.3
CGC Nameify-1
Worm BaseAllele Name tm947
CGC Name ify-1
Sequence C27A2.3
Phenotypelethal or sterile. Dr. K. Subramaniam: Emb.
Mutation site2371/2372-3019/3020 (648 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(1531..1974, 2085..2308, 2359..2425))
Map position-2.58
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:GAGGGAGTTTCTCTTGAGGT,ExtRev:AGCGACCACACGGAGCCAAT,ExtFwd:ATCACAGGGGAAGGTTGGCT,IntFwd:CTTCGGCGAGGAGGTCGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang R, Kaul Z, Ambardekar C, Yamamoto TG, Kavdia K, Kodali K, High AA, Kitagawa R.
HECT-E3 ligase ETC-1 regulates securin and cyclin B1 cytoplasmic abundance to promote timely anaphase during meiosis in C. elegans.
Development 2013 140(10) 2149-59 
[ PubMed ID = 23578927 ] [ RRC reference ]

Stein KK, Golden A.
The C. elegans eggshell.
WormBook 2018 2018 1-36 
[ PubMed ID = 26715360 ] [ RRC reference ]