Mutants (Isolated)

tm939

Allele Nametm939
Sequence NameC55B7.5
CGC Nameuri-1
Worm BaseAllele Name tm939
CGC Name uri-1
Sequence C55B7.5
Phenotypelethal or sterile. Dr. M. Gotta: Development 133, 621 (2005).
Mutation site12824/12825-13470/13471 (646 bp deletion)
ChromosomeI
Putative gene structurejoin(12405..12437, 12563..12676, 12720..13565, 13623..13970)
Map position1.16
Balancer
Map position of balancer
Sequence of primersExtRev:GTTGTAGAGTTGGTTCACAG,IntRev:TTCGCCATGGAGCGAAGGAA,IntFwd:CGTGACTCATTTCCAGGGAA,ExtFwd:GTTTGCGGACTCACACTCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Parusel CT, Kritikou EA, Hengartner MO, Krek W, Gotta M.
URI-1 is required for DNA stability in C. elegans.
Development 2006 133(4) 621-9 
[ PubMed ID = 16436622 ] [ RRC reference ]

Sheaffer KL, Updike DL, Mango SE.
The Target of Rapamycin pathway antagonizes pha-4/FoxA to control development and aging.
Curr. Biol. 2008 18(18) 1355-64 
[ PubMed ID = 18804378 ] [ RRC reference ]