| Allele Name | tm936 |
| Allele Type | Normal |
| Sequence Name | K10D2.3 |
| Gene Name | cid-1 |
| Worm Base | Allele Name |
tm936
|
| Gene Name |
cid-1
|
| Sequence |
K10D2.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. R. Plasterk: Genes Dev. 19, 782-(2005). |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8405/8406-AATTGTGAT-8840/8841 (435 bp deletion + 9 bp insertion) |
| Chromosome | III |
| Putative gene structure | join(6864..6945, 7243..7700, 7821..7983, 8034..8341, 8504..9496, 9546..10079, 10162..11018, 11531..11639, 11689..12100, 12432..12642, 12688..12808, 12896..12925) |
| Map position | -2.04 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCTTGGTTGCCGCTGTACAA,IntFwd:GCAAGTGCAATGGACTATTC,ExtRev:TCGTGATGGGTTCCGGCTTG,IntRev:GTTCCGGCTTGATTTCCTAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115
[ PubMed ID = 32887607 ]
[ RRC reference ]
|
Shakes DC, Allen AK, Albert KM, Golden A.
emb-1 encodes the APC16 subunit of the Caenorhabditis elegans anaphase-promoting complex.
Genetics 2011 189(2) 549-60
[ PubMed ID = 21775471 ]
[ RRC reference ]
|
van Wolfswinkel JC, Claycomb JM, Batista PJ, Mello CC, Berezikov E, Ketting RF.
CDE-1 affects chromosome segregation through uridylation of CSR-1-bound siRNAs.
Cell 2009 139(1) 135-48
[ PubMed ID = 19804759 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.