Mutants (Isolated)

tm935

Allele Nametm935
Sequence NameF29G9.3
CGC Nameaps-1
Worm BaseAllele Name tm935
CGC Name aps-1
Sequence F29G9.3
Phenotypelethal or sterile. Dr. G. Hermann: WT gut granules. Dr. S. L'Hernault: could not recover. Dr. O. Blacque: could not assess Dyf. Dr. G. Michaux: L1 Lvl.
Mutation site17718/17719-TCAT-18023/18024 (305 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurejoin(17476..17553, 17602..17705, 17960..18251)
Map position-0.42
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntRev:CGTCTCGGAGTTGTGATAAT,ExtRev:CCCCTGTTCGTGTTTTACAC,IntFwd:CGTAGTATTCAGGATGAGTC,ExtFwd:CAGTACCAGGACAACCGTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shafaq-Zadah M, Brocard L, Solari F, Michaux G.
AP-1 is required for the maintenance of apico-basal polarity in the C. elegans intestine.
Development 2012 139(11) 2061-70 
[ PubMed ID = 22535414 ] [ RRC reference ]

Zhang H, Kim A, Abraham N, Khan LA, Hall DH, Fleming JT, Gobel V.
Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis.
Development 2012 139(11) 2071-83 
[ PubMed ID = 22535410 ] [ RRC reference ]

Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]