Mutants (Isolated)

tm933

Allele Nametm933
Sequence NameT10G3.5
CGC Nameeea-1
Worm BaseAllele Name tm933
CGC Name eea-1
Sequence T10G3.5
Phenotypehomozygous viable. Dr. G. Hermann: WT gut granules. Dr. C. Rongo: Normal GLR-1::GFP localization. Dr. Z. Zhou: no persistent cell corpses.Dr. O. Blacque: WT dye-filling.
Mutation site26933/26934-27304/27305 (371 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(22118..22373, 22936..23228, 23544..23807, 23855..24082, 24128..24457, 25478..26365, 26694..26768, 26863..27804, 27846..28019, 28076..28120))
Map position5.35
Balancer
Map position of balancer
Sequence of primersIntFwd:GCTTCAGCATCTCTCAGCTT,ExtFwd:CTTTGTCAGTCCTTGATGCT,IntRev:CTAAACAACAGTCGACCAAG,ExtRev:ATTTAGATTGACGGCCGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol. Biol. Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]