Mutants (Isolated)

tm925

Allele Nametm925
Sequence NameR13H4.1
CGC Namenphp-4
Worm BaseAllele Name tm925
CGC Name nphp-4
Sequence R13H4.1
Phenotypehomozygous viable. Dr. M.M. Barr: Exp Cell Res. 305, 333-342 (2005). Dr. P. Sengupta: dyf defects in some neurons. Dr. B.K. Yoder: J. Cell Sciences 118, 5575-5587 (2005).
Mutation site10995/10996-12104/12105 (1109 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(1198..1352, 4751..4878, 6820..6924, 6970..7603, 7783..8178, 9105..9381, 9424..9604, 9803..10675, 10737..10873, 11043..11230, 11280..11470, 11520..11637, 11990..12071, 12293..12418))
Map position3.42
Balancer
Map position of balancer
Sequence of primersExtFwd:AGATTGGCCATTATCGCCTG,IntFwd:GCTAACTCGTGTCTCCACTT,ExtRev:CCCGCTCTCCAATTCGTATA,IntRev:AATGTCGGTCAACGACTGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Winkelbauer ME, Schafer JC, Haycraft CJ, Swoboda P, Yoder BK.
The C. elegans homologs of nephrocystin-1 and nephrocystin-4 are cilia transition zone proteins involved in chemosensory perception.
J. Cell. Sci. 2005 118(Pt 23) 5575-87 
[ PubMed ID = 16291722 ] [ RRC reference ]

Jauregui AR, Nguyen KC, Hall DH, Barr MM.
The Caenorhabditis elegans nephrocystins act as global modifiers of cilium structure.
J. Cell Biol. 2008 180(5) 973-88 
[ PubMed ID = 18316409 ] [ RRC reference ]

Jauregui AR, Barr MM.
Functional characterization of the C. elegans nephrocystins NPHP-1 and NPHP-4 and their role in cilia and male sensory behaviors.
Exp. Cell Res. 2005 305(2) 333-42 
[ PubMed ID = 15817158 ] [ RRC reference ]

Williams CL, Li C, Kida K, Inglis PN, Mohan S, Semenec L, Bialas NJ, Stupay RM, Chen N, Blacque OE, Yoder BK, Leroux MR.
MKS and NPHP modules cooperate to establish basal body/transition zone membrane associations and ciliary gate function during ciliogenesis.
J. Cell Biol. 2011 192(6) 1023-41 
[ PubMed ID = 21422230 ] [ RRC reference ]

Lambacher NJ, Bruel AL, van Dam TJ, Szymańska K, Slaats GG, Kuhns S, McManus GJ, Kennedy JE, Gaff K, Wu KM, van der Lee R, Burglen L, Doummar D, Rivière JB, Faivre L, Attié-Bitach T, Saunier S, Curd A, Peckham M, Giles RH, Johnson CA, Huynen MA, Thauvin-Robinet C, Blacque OE.
TMEM107 recruits ciliopathy proteins to subdomains of the ciliary transition zone and causes Joubert syndrome.
Nat. Cell Biol. 2016 18(1) 122-31 
[ PubMed ID = 26595381 ] [ RRC reference ]

Liu L, Zhang M, Xia Z, Xu P, Chen L, Xu T.
Caenorhabditis elegans ciliary protein NPHP-8, the homologue of human RPGRIP1L, is required for ciliogenesis and chemosensation.
Biochem. Biophys. Res. Commun. 2011 410(3) 626-31 
[ PubMed ID = 21689635 ] [ RRC reference ]

Masyukova SV, Winkelbauer ME, Williams CL, Pieczynski JN, Yoder BK.
Assessing the pathogenic potential of human Nephronophthisis disease-associated NPHP-4 missense mutations in C. elegans.
Hum. Mol. Genet. 2011 20(15) 2942-54 
[ PubMed ID = 21546380 ] [ RRC reference ]

Maguire JE, Silva M, Nguyen KC, Hellen E, Kern AD, Hall DH, Barr MM.
Myristoylated CIL-7 regulates ciliary extracellular vesicle biogenesis.
Mol. Biol. Cell 2015 26(15) 2823-32 
[ PubMed ID = 26041936 ] [ RRC reference ]

Williams CL, Winkelbauer ME, Schafer JC, Michaud EJ, Yoder BK.
Functional redundancy of the B9 proteins and nephrocystins in Caenorhabditis elegans ciliogenesis.
Mol. Biol. Cell 2008 19(5) 2154-68 
[ PubMed ID = 18337471 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]

Roberson EC, Dowdle WE, Ozanturk A, Garcia-Gonzalo FR, Li C, Halbritter J, Elkhartoufi N, Porath JD, Cope H, Ashley-Koch A, Gregory S, Thomas S, Sayer JA, Saunier S, Otto EA, Katsanis N, Davis EE, Attié-Bitach T, Hildebrandt F, Leroux MR, Reiter JF.
TMEM231, mutated in orofaciodigital and Meckel syndromes, organizes the ciliary transition zone.
J. Cell Biol. 2015 209(1) 129-42 
[ PubMed ID = 25869670 ] [ RRC reference ]

Williams CL, Masyukova SV, Yoder BK.
Normal ciliogenesis requires synergy between the cystic kidney disease genes MKS-3 and NPHP-4.
J. Am. Soc. Nephrol. 2010 21(5) 782-93 
[ PubMed ID = 20150540 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet. 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet. 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am. J. Hum. Genet. 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Bialas NJ, Inglis PN, Li C, Robinson JF, Parker JD, Healey MP, Davis EE, Inglis CD, Toivonen T, Cottell DC, Blacque OE, Quarmby LM, Katsanis N, Leroux MR.
Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein and two novel MKS1-related (MKSR) proteins.
J. Cell. Sci. 2009 122(Pt 5) 611-24 
[ PubMed ID = 19208769 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J. Cell Biol. 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J. Cell. Sci. 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J. Cell. Sci. 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]