Mutants (Isolated)

tm925

Allele Nametm925
Allele TypeNormal
Sequence NameR13H4.1
Gene Namenphp-4
Worm BaseAllele Name tm925
Gene Name nphp-4
Sequence R13H4.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M.M. Barr: Exp Cell Res. 305, 333-342 (2005). Dr. P. Sengupta: dyf defects in some neurons. Dr. B.K. Yoder: J. Cell Sciences 118, 5575-5587 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10995/10996-12104/12105 (1109 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(1198..1352, 4751..4878, 6820..6924, 6970..7603, 7783..8178, 9105..9381, 9424..9604, 9803..10675, 10737..10873, 11043..11230, 11280..11470, 11520..11637, 11990..12071, 12293..12418))
Map position3.42
Balancer
Map position of balancer
Sequence of primersExtFwd:AGATTGGCCATTATCGCCTG,IntFwd:GCTAACTCGTGTCTCCACTT,ExtRev:CCCGCTCTCCAATTCGTATA,IntRev:AATGTCGGTCAACGACTGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Ahmed M, Fischer S, Robert KL, Lange KI, Stuck MW, Best S, Johnson CA, Pazour GJ, Blacque OE, Nandadasa S.
Two functional forms of the Meckel-Gruber syndrome protein TMEM67 generated by proteolytic cleavage by ADAMTS9 mediate Wnt signaling and ciliogenesis.
bioRxiv 2024   
[ PubMed ID = 39282264 ] [ RRC reference ]

Wang J, Saul J, Nikonorova IA, Cruz CN, Power KM, Nguyen KC, Hall DH, Barr MM.
Ciliary intrinsic mechanisms regulate dynamic ciliary extracellular vesicle release from sensory neurons.
Curr Biol 2024 34(12) 2756-2763.e2 
[ PubMed ID = 38838665 ] [ RRC reference ]

Cevik S, Peng X, Beyer T, Pir MS, Yenisert F, Woerz F, Hoffmann F, Altunkaynak B, Pir B, Boldt K, Karaman A, Cakiroglu M, Oner SS, Cao Y, Ueffing M, Kaplan OI.
WDR31 displays functional redundancy with GTPase-activating proteins (GAPs) ELMOD and RP2 in regulating IFT complex and recruiting the BBSome to cilium.
Life Sci Alliance 2023 6(8)  
[ PubMed ID = 37208194 ] [ RRC reference ]

Brinzer RA, Winter AD, Page AP.
The relationship between intraflagellar transport and upstream protein trafficking pathways and macrocyclic lactone resistance in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(3)  
[ PubMed ID = 38227795 ] [ RRC reference ]

Kaplan OI.
RPI-1 (human DCDC2) displays functional redundancy with Nephronophthisis 4 in regulating cilia biogenesis in C. elegans.
Turk J Biol 2023 47(1) 74-83 
[ PubMed ID = 37529113 ] [ RRC reference ]

Wang J, Saul J, Nikonorova IA, Cruz CN, Power KM, Nguyen KC, Hall DH, Barr MM.
Ciliary intrinsic mechanisms regulate dynamic ciliary extracellular vesicle release from sensory neurons.
bioRxiv 2023   
[ PubMed ID = 37961114 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Lange KI, Best S, Tsiropoulou S, Berry I, Johnson CA, Blacque OE.
Interpreting ciliopathy-associated missense variants of uncertain significance (VUS) in Caenorhabditis elegans.
Hum Mol Genet 2022 31(10) 1574-1587 
[ PubMed ID = 34964473 ] [ RRC reference ]

De-Castro ARG, Rodrigues DRM, De-Castro MJG, Vieira N, Vieira C, Carvalho AX, Gassmann R, Abreu CMC, Dantas TJ.
WDR60-mediated dynein-2 loading into cilia powers retrograde IFT and transition zone crossing.
J Cell Biol 2022 221(1)  
[ PubMed ID = 34739033 ] [ RRC reference ]

Bentley-Ford MR, LaBonty M, Thomas HR, Haycraft CJ, Scott M, LaFayette C, Croyle MJ, Andersen RS, Parant JM, Yoder BK.
Evolutionarily conserved genetic interactions between nphp-4 and bbs-5 mutations exacerbate ciliopathy phenotypes.
Genetics 2022 220(1)  
[ PubMed ID = 34850872 ] [ RRC reference ]

Lange KI, Tsiropoulou S, Kucharska K, Blacque OE.
Interpreting the pathogenicity of Joubert syndrome missense variants in Caenorhabditis elegans.
Dis Model Mech 2021 14(1)  
[ PubMed ID = 33234550 ] [ RRC reference ]

Rossillo M, Ringstad N.
Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity.
Genes Dev 2020 34(23-24) 1666-1679 
[ PubMed ID = 33184226 ] [ RRC reference ]

van Dam TJP, Kennedy J, van der Lee R, de Vrieze E, Wunderlich KA, Rix S, Dougherty GW, Lambacher NJ, Li C, Jensen VL, Leroux MR, Hjeij R, Horn N, Texier Y, Wissinger Y, van Reeuwijk J, Wheway G, Knapp B, Scheel JF, Franco B, Mans DA, van Wijk E, Képès F, Slaats GG, Toedt G, Kremer H, Omran H, Szymanska K, Koutroumpas K, Ueffing M, Nguyen TT, Letteboer SJF, Oud MM, van Beersum SEC, Schmidts M, Beales PL, Lu Q, Giles RH, Szklarczyk R, Russell RB, Gibson TJ, Johnson CA, Blacque OE, Wolfrum U, Boldt K, Roepman R, Hernandez-Hernandez V, Huynen MA.
CiliaCarta: An integrated and validated compendium of ciliary genes.
PLoS One 2019 14(5) e0216705 
[ PubMed ID = 31095607 ] [ RRC reference ]

Masyukova SV, Landis DE, Henke SJ, Williams CL, Pieczynski JN, Roszczynialski KN, Covington JE, Malarkey EB, Yoder BK.
A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.
PLoS Genet 2016 12(2) e1005841 
[ PubMed ID = 26863025 ] [ RRC reference ]

Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]

Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Loucks CM, Bialas NJ, Dekkers MP, Walker DS, Grundy LJ, Li C, Inglis PN, Kida K, Schafer WR, Blacque OE, Jansen G, Leroux MR.
PACRG, a protein linked to ciliary motility, mediates cellular signaling.
Mol Biol Cell 2016 27(13) 2133-44 
[ PubMed ID = 27193298 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]