Mutants (Isolated)

tm925

Allele Nametm925
Sequence NameR13H4.1
CGC Namenphp-4
Worm BaseAllele Name tm925
CGC Name nphp-4
Sequence R13H4.1
Phenotypehomozygous viable. Dr. M.M. Barr: Exp Cell Res. 305, 333-342 (2005). Dr. P. Sengupta: dyf defects in some neurons. Dr. B.K. Yoder: J. Cell Sciences 118, 5575-5587 (2005).
Mutation site10995/10996-12104/12105 (1109 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(1198..1352, 4751..4878, 6820..6924, 6970..7603, 7783..8178, 9105..9381, 9424..9604, 9803..10675, 10737..10873, 11043..11230, 11280..11470, 11520..11637, 11990..12071, 12293..12418))
Map position3.42
Balancer
Map position of balancer
Sequence of primersExtFwd:AGATTGGCCATTATCGCCTG,IntFwd:GCTAACTCGTGTCTCCACTT,ExtRev:CCCGCTCTCCAATTCGTATA,IntRev:AATGTCGGTCAACGACTGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lange KI, Tsiropoulou S, Kucharska K, Blacque OE.
Interpreting the pathogenicity of Joubert syndrome missense variants in Caenorhabditis elegans.
Dis Model Mech 2021 14(1)  
[ PubMed ID = 33234550 ] [ RRC reference ]

van Dam TJP, Kennedy J, van der Lee R, de Vrieze E, Wunderlich KA, Rix S, Dougherty GW, Lambacher NJ, Li C, Jensen VL, Leroux MR, Hjeij R, Horn N, Texier Y, Wissinger Y, van Reeuwijk J, Wheway G, Knapp B, Scheel JF, Franco B, Mans DA, van Wijk E, Képès F, Slaats GG, Toedt G, Kremer H, Omran H, Szymanska K, Koutroumpas K, Ueffing M, Nguyen TT, Letteboer SJF, Oud MM, van Beersum SEC, Schmidts M, Beales PL, Lu Q, Giles RH, Szklarczyk R, Russell RB, Gibson TJ, Johnson CA, Blacque OE, Wolfrum U, Boldt K, Roepman R, Hernandez-Hernandez V, Huynen MA.
CiliaCarta: An integrated and validated compendium of ciliary genes.
PLoS One 2019 14(5) e0216705 
[ PubMed ID = 31095607 ] [ RRC reference ]

Masyukova SV, Winkelbauer ME, Williams CL, Pieczynski JN, Yoder BK.
Assessing the pathogenic potential of human Nephronophthisis disease-associated NPHP-4 missense mutations in C. elegans.
Hum Mol Genet 2011 20(15) 2942-54 
[ PubMed ID = 21546380 ] [ RRC reference ]

Liu L, Zhang M, Xia Z, Xu P, Chen L, Xu T.
Caenorhabditis elegans ciliary protein NPHP-8, the homologue of human RPGRIP1L, is required for ciliogenesis and chemosensation.
Biochem Biophys Res Commun 2011 410(3) 626-31 
[ PubMed ID = 21689635 ] [ RRC reference ]

Lambacher NJ, Bruel AL, van Dam TJ, Szymańska K, Slaats GG, Kuhns S, McManus GJ, Kennedy JE, Gaff K, Wu KM, van der Lee R, Burglen L, Doummar D, Rivière JB, Faivre L, Attié-Bitach T, Saunier S, Curd A, Peckham M, Giles RH, Johnson CA, Huynen MA, Thauvin-Robinet C, Blacque OE.
TMEM107 recruits ciliopathy proteins to subdomains of the ciliary transition zone and causes Joubert syndrome.
Nat Cell Biol 2016 18(1) 122-31 
[ PubMed ID = 26595381 ] [ RRC reference ]

Loucks CM, Bialas NJ, Dekkers MP, Walker DS, Grundy LJ, Li C, Inglis PN, Kida K, Schafer WR, Blacque OE, Jansen G, Leroux MR.
PACRG, a protein linked to ciliary motility, mediates cellular signaling.
Mol Biol Cell 2016 27(13) 2133-44 
[ PubMed ID = 27193298 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]

Masyukova SV, Landis DE, Henke SJ, Williams CL, Pieczynski JN, Roszczynialski KN, Covington JE, Malarkey EB, Yoder BK.
A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.
PLoS Genet 2016 12(2) e1005841 
[ PubMed ID = 26863025 ] [ RRC reference ]

Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]

Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Roberson EC, Dowdle WE, Ozanturk A, Garcia-Gonzalo FR, Li C, Halbritter J, Elkhartoufi N, Porath JD, Cope H, Ashley-Koch A, Gregory S, Thomas S, Sayer JA, Saunier S, Otto EA, Katsanis N, Davis EE, Attié-Bitach T, Hildebrandt F, Leroux MR, Reiter JF.
TMEM231, mutated in orofaciodigital and Meckel syndromes, organizes the ciliary transition zone.
J Cell Biol 2015 209(1) 129-42 
[ PubMed ID = 25869670 ] [ RRC reference ]

Maguire JE, Silva M, Nguyen KC, Hellen E, Kern AD, Hall DH, Barr MM.
Myristoylated CIL-7 regulates ciliary extracellular vesicle biogenesis.
Mol Biol Cell 2015 26(15) 2823-32 
[ PubMed ID = 26041936 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am J Hum Genet 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Rossillo M, Ringstad N.
Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity.
Genes Dev 2020 34(23-24) 1666-1679 
[ PubMed ID = 33184226 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]