Mutants (Isolated)

tm924

Allele Nametm924
Sequence NameC14F5.2
CGC Namezig-3
Worm BaseAllele Name tm924
CGC Name zig-3
Sequence C14F5.2
Phenotypehomozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. Dr. O. Hobert: no axonal defects in PVQ neurons. Dr. T. Kubo: normal AIM morphology. Dr. M. Peter: does not suppress par-2 (RNAi).
Mutation site1484/1485-CGGCCGATATGAACTACTTCC-1905/1906 (421 bp deletion +21 bp insertion)
ChromosomeX
Putative gene structurejoin(1204..1266, 1313..1685, 1741..2060)
Map position-0.94
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGCCGATAGGTAACTAAGT,IntFwd:TCGCAGCGACACTCAATGGT,ExtRev:GTGAGATCTGTTCACGGGTT,IntRev:CGACTAGATAAGTTAGGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bénard C, Tjoe N, Boulin T, Recio J, Hobert O.
The small, secreted immunoglobulin protein ZIG-3 maintains axon position in Caenorhabditis elegans.
Genetics 2009 183(3) 917-27 
[ PubMed ID = 19737747 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]