Home > Mutants (Isolated) > tm924

Mutants (Isolated)

Allele Name		tm924
Allele Type		Normal
Sequence Name		C14F5.2
Gene Name		zig-3
Worm Base	Allele Name	tm924
	Gene Name	zig-3
	Sequence	C14F5.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. Dr. O. Hobert: no axonal defects in PVQ neurons. Dr. T. Kubo: normal AIM morphology. Dr. M. Peter: does not suppress par-2 (RNAi).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		1484/1485-CGGCCGATATGAACTACTTCC-1905/1906 (421 bp deletion +21 bp insertion)
Chromosome		X
Putative gene structure		join(1204..1266, 1313..1685, 1741..2060)
Map position		-0.94
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AGGCCGATAGGTAACTAAGT,IntFwd:TCGCAGCGACACTCAATGGT,ExtRev:GTGAGATCTGTTCACGGGTT,IntRev:CGACTAGATAAGTTAGGGGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705  [ PubMed ID = 38239833 ] [ RRC reference ] Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC. Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy. PLoS Genet 2019 15(12) e1008526  [ PubMed ID = 31834878 ] [ RRC reference ] Bénard C, Tjoe N, Boulin T, Recio J, Hobert O. The small, secreted immunoglobulin protein ZIG-3 maintains axon position in Caenorhabditis elegans. Genetics 2009 183(3) 917-27  [ PubMed ID = 19737747 ] [ RRC reference ] Labbé JC, Pacquelet A, Marty T, Gotta M. A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans. Genetics 2006 174(1) 285-95  [ PubMed ID = 16816419 ] [ RRC reference ]