Mutants (Isolated)

tm917

Allele Nametm917
Sequence NameY48E1B.13
CGC Namecsp-1
Worm BaseAllele Name tm917
CGC Name csp-1
Sequence Y48E1B.13
Phenotypehomozygous viable. Dr. R.H. Horvitz: No extra cells in anterior pharynx. Dr. S. Shaham: no defects in somatic cell death.
Mutation site76885/76886-77634/77635 (749 bp deletion)
ChromosomeII
Putative gene structurejoin(76378..76614, 77078..77206, 77454..77803, 78165..78306, 78570..78708, 79626..79879, 79924..80131, 80291..80596, 80631..80692, 80817..80918)
Map position18.6
Balancer
Map position of balancer
Sequence of primersExtRev:CCCAGACTCGATTGTACATC,IntRev:GTAACAGGGGGTGTGGATAT,ExtFwd:CGCCGGACGAAAGTAAGGCT,IntFwd:TGTGGCACCGGCTTATGTCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chen L, McCloskey T, Joshi PM, Rothman JH.
ced-4 and proto-oncogene tfg-1 antagonistically regulate cell size and apoptosis in C. elegans.
Curr. Biol. 2008 18(14) 1025-33 
[ PubMed ID = 18635357 ] [ RRC reference ]

Abraham MC, Lu Y, Shaham S.
A morphologically conserved nonapoptotic program promotes linker cell death in Caenorhabditis elegans.
Dev. Cell 2007 12(1) 73-86 
[ PubMed ID = 17199042 ] [ RRC reference ]

Denning DP, Hatch V, Horvitz HR.
Both the caspase CSP-1 and a caspase-independent pathway promote programmed cell death in parallel to the canonical pathway for apoptosis in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003341 
[ PubMed ID = 23505386 ] [ RRC reference ]