Allele Name | tm917 |
Sequence Name | Y48E1B.13 |
CGC Name | csp-1 |
Worm Base | Allele Name |
tm917
|
CGC Name |
csp-1
|
Sequence |
Y48E1B.13
|
Phenotype | homozygous viable. Dr. R.H. Horvitz: No extra cells in anterior pharynx. Dr. S. Shaham: no defects in somatic cell death. |
Mutation site | 76885/76886-77634/77635 (749 bp deletion) |
Chromosome | II |
Putative gene structure | join(76378..76614, 77078..77206, 77454..77803, 78165..78306, 78570..78708, 79626..79879, 79924..80131, 80291..80596, 80631..80692, 80817..80918) |
Map position | 18.6 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CCCAGACTCGATTGTACATC,IntRev:GTAACAGGGGGTGTGGATAT,ExtFwd:CGCCGGACGAAAGTAAGGCT,IntFwd:TGTGGCACCGGCTTATGTCC |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Denning DP, Hatch V, Horvitz HR. Both the caspase CSP-1 and a caspase-independent pathway promote programmed cell death in parallel to the canonical pathway for apoptosis in Caenorhabditis elegans. PLoS Genet 2013 9(3) e1003341
[ PubMed ID = 23505386 ]
[ RRC reference ]
|
Chen L, McCloskey T, Joshi PM, Rothman JH. ced-4 and proto-oncogene tfg-1 antagonistically regulate cell size and apoptosis in C. elegans. Curr Biol 2008 18(14) 1025-33
[ PubMed ID = 18635357 ]
[ RRC reference ]
|
Abraham MC, Lu Y, Shaham S. A morphologically conserved nonapoptotic program promotes linker cell death in Caenorhabditis elegans. Dev Cell 2007 12(1) 73-86
[ PubMed ID = 17199042 ]
[ RRC reference ]
|
|